Recombination in SV40-infected cells: Nucleotide sequences at viral-viral recombinant joints in naturally arising variants

VIROLOGY

109, 344-352 (1981)

Recombination in SV40-Infected Cells: Nucleotide Sequences at Viral-Viral Recombinant Joints in Naturally Arising Variants MARY Department

of Cell

and

Tumor

Biology,

WOODWORTH-GUTAI’ Roswell

Accepted

Park

September

Memorial

Institute,

Buffalo,

New

York

14263

19, 1980

Nucleotide sequence analysis of recombinant joints in variants of SV40 is one important means of gaining insight into the mechanisms of recombination in eucaryotic cells. Earlier studies (M. W. Gutai and D. Nathans, 1978, J. Mol. Biol. 126,275-288) of the viral-host recombinant joints in a cloned, host-substituted evolutionary variant of SV40 and the present studies of viral-viral recombinant joints in naturally arising variants of SV40 suggest that the same factors play a role in recombination between viral and host DNA molecules as between circular viral DNA molecules. Recombination is not limited to a single specific nucleotide sequence, does not require extensive homology, and may in some instances involve regions of patchy homology between recombining molecules as well as regions rich in A .T base pairs. In the case of viral-viral recombination, the comparison of parental viral recombining sequences reveals that an extraneous base of unknown source is sometimes inserted at the recombinant joint and one viral-viral joint has formed at a tetranucleotide occurring at the point of recombination in both recombining parents. The recombination events that generate additional viral origins of DNA replication do not appear to depend on regions of A .T richness or patchy homology in the recombining molecules. INTRODUCTION

The mechanism(s) for recombination in eucaryotic cells is not known. It is clear from a number of restriction endonuclease mapping studies of evolutionary variants, adenoSV40 hybrid viruses and integrated SV40 genomes in transformed cells that recombination occurs at many different map positions on the SV40 genome (reviewed by Nathans and Gutai, 1978). More recently, the actual nucleotide sequences have been identified for a number of recombination sites in naturally arising SV40 variants (Gutai and Nathans, 1978; Wakamiya et al., 1979; McCutchan et al., 1979). Although the release of infectious viral DNA from SV40transformed cells following fusion to permissive cells probably occurs by homologous recombination (Botchan et al., 1980), recombination in naturally arising SV40 variants does not require extensive homology. Nucleotide sequence analysis of six viral-host recombinant joints in a substi’ To whom reprint requests should be addressed. 0042~6822/81/040344-09$02.00/O Copyright 0 1981 by Academic Press, Inc. All rights of reproduction in any form reserved

344

tuted evolutionary variant of SV40, ev-1104, demonstrated that there is no specific recognition site which reoccurs in the cellular DNA segments or in the viral DNA sequences involved in recombination (Gutai and Nathans, 1978). In every instance, different nucleotide sequences have recombined to form unique host-viral recombinant joints. Apparently recombination in eucaryotes does not favor the recognition of a single nucleotide sequence, in contrast to the 15 nucleotide core sequence recognized in the A procaryotic int and xis systems (Landy and Ross, 1977). The study of viralhost recombinant joints by Gutai and Nathans (1978) also indicated that while recombination can occur in eucaryotic cells in the absence of extensive homology there are at least two factors which may play a role in the formation of recombinant molecules, namely, short stretches of patchy homology between recombining molecules and A .Trich regions adjacent to the site of recombination. McCutchan et al. (1979) have also found regions rich in A +T base pairs at

RECOMBINANT

JOINTS

IN

NATURALLY

SV40-cellular recombinant joints in other host-substituted variants of SV40. Since the recombining parental cellular sequences are generally unknown, it is of interest to extend the studies of recombination in SV40infected cells by analyzing viral-viral recombinant joint sequences where both recombining parental sequences can be identified and analyzed. Serial passage of SV40 at high multiplicity of infection in permissive monkey kidney cells results in extensive recombination between and within SV40 DNA molecules (reviewed by Brockman, 1977). Deletions as well as duplications of portions of the viral genome are common. The variants that evolve have at least one duplication of the region of the genome containing the origin of DNA replication (Danna and Nathans, 1972; Fareed et al., 1972). Apparently additional origins of DNA replication confer a selective replicative advantage on the variant as compared to the wild type virus (Lee and Nathans, 1979). Upon continued high multiplicity serial passage, variants evolve which contain segments of cellular DNA. However, by utilizing evolutionary variants of SV40 cloned from early serial passage stocks, before host substitution predominates, it is possible to analyze the viral-viral recombinant joint sequences at the site of deletions and duplications in naturally arising variants. In this paper, I present the nucleotide sequences at six viralviral recombinant joints present in three evolutionary variants of SV40, ev-1114, ev-1117, ev-1119, cloned by Brockman, Gutai, and Nathans (1975) after three serial undiluted passages. The data extend and support the earlier work on substituted variants by providing additional evidence that recombination is not limited to a single specific nucleotide sequence, does not require extensive homology, and may in some instances involve regions of patchy homology between recombining molecules as well as regions rich in A .T base pairs. MATERIALS

AND

METHODS

Cells and virus. The small plaque strain (776) of simian virus 40 (SV40) was grown on the BSC-1 line of African green monkey kidney cells in 2% fetal calf serum and Eagle’s minimum essential medium (MEM-

ARISING

SV40

VARIANTS

345

2). Evolutionary variants, ev-1114, ev-1117, and ev-1119, were previously cloned from the third undiluted serial passage (Brockman et al., 1975). Preparation

of radiolabeled

viral DNA.

Nearly confluent BSC-1 cells were infected with wild type virus at a multiplicity of approximately 1, or with a 15 dilution in MEM-2 of plaque-purified stocks of ev-1114, ev-1117, or ev-1119. The DNA was labeled at 24 hr after infection with 10 &i [“HIthymidine and/or 20 PCi 32P (New England Nuclear) per lo-cm dish and harvested at 55-66 hr after infection when 90% of the cells exhibited cytopathic changes. The viral DNA was extracted according to the Hirt procedure (1967), treated with RNase (10 pg/ml), phenol extracted, and precipitated with cold ethanol. Wild type viral DNA was purified by equilibrium centrifugation on a CsCl/ethidium bromide gradient followed by sucrose density gradient centrifugation. Variant DNA was separa.ted from helper virus DNA by electrophoresis at 100 V for 26 hr on 1.4% agarose slab gels (28 cm x 35.5 cm x 3 mm). After visualization by autoradiography, the variant DNA was cut from the gel, dissolved in saturated potassium iodide solution, and purified on a hydroxyapatite column. DNA restriction fragments. All restriction endonucleases were obtained from New England Nuclear Biolabs except forEcoRI1 which was purchased from Miles Laboratories and HindIIldIII which was prepared in our laboratory according to Smith and Wilcox (1970) as modified by Smith (1974) and Lai and Nathans (1974). Digestions were carried out at DNA concentrations of 45 pg (or less)/ml for 1-2 hr at 37” using 1-4 units of enzyme per 60 ~1 reaction volume. The enzyme digest products were extracted with phenol and electrophoresed on polyacrylamide slab gels (40 x 18 cm) composed of 8% acrylamide in the lower half and 4% acrylamide in the upper half. After electrophoresis at 150 V for 15- 18 hr in 40 mJ4 Tris-HCl (pH 7.8)-20 n&! sodium acetate2 n&f sodium EDTA buffer, the DNA was recovered from the gel fragments by elution in 0.5 M ammonium acetate-O.01 M magnesium acetate-0.1% (w/v) sodium dodecyl sulfate-O. 1 n-J! EDTA buffer.

346

MARY

WOODWORTH-GUTAI

Labeling of 5’-termini. 5’-Terminal phosphate groups were removed from DNA restriction fragments by incubation with 50 pglml bacterial alkaline phosphatase (Worthington) in 0.05 J4 NaCl-0.05 M Tris-HCl, pH 7.4, at 37°C for 30 min. The reaction was stopped by adding EDTA to a final concentration of 0.05 M, left at room temperature for 30 min, then phenol extracted twice and dialyzed in 1 mM EDTA10 ti Tris-HCl (pH 7.4). The dephosphorylated DNA fragments were end-labeled using 100 @Zi[y-“2P]ATP (1000-3000 Ci/ mmol, New England Nuclear) and 4 units of polynucleotide kinase (P-L Biochemicals) per 100 ~1 reaction volume containing 0.05 M Tris-HCl (pH 9.5)-0.01 M MgCl,-0.005 M dithiothreitol-5% (v/v) glycerol-O. 1 mJ4 spermidine. After a 30-min incubation at 3’7”, the end-labeled DNAs were dialyzed for 18 hr in 1 M NaCl-5 mJ4 EDTA-10 mM Tris-HCl (pH 7.4) and then for 4 hr in 10 mM Tris-HCl (pH 7.4). Each DNA fragment was then digested with another restriction endonuclease to remove one 5’labeled end, purified by polyacrylamide gel electrophoresis, and eluted in 0.5 M ammonium acetate-O.01 M magnesium acetate-0.1% (w/v) sodium dodecyl sulfate-O.1 mJ4 EDTA. Alternatively, the fragment was denatured in 0.3 N NaOH and the individual strands were isolated by polyacrylamide gel electrophoresis according to the method described by Maxam and Gilbert (1977). DNA sequencing methodology. The appropriate DNA restriction fragments, with one labeled 5’-terminus were sequenced by the dimethyl sulfate/hydrazinolysis procedure of Maxam and Gilbert (1977). The chemical degradation products were fractionated on 20% polyacrylamide-8 M urea slab gels (40 cm x 18 cm x 1.5 mm) as described by Maxam and Gilbert (1977) or on thinner 10% polyacrylamide-8 M urea slab gels (40 cm x 18 cm x 0.4 mm) as described by Sanger and Coulson (1978). RESULTS

Physical Maps of ev-1114, ev-1117, and ev-1119

The Endo R .HindIIIIII of three SV40 variants,

restriction maps ev-1114, ev-1117,

FIG. 1. HindIIidIII restriction maps of variant genomes compared to SV40. Nucleotide residue numbers at theHin sites correspond to Reddyet al. (1978). Each recombinant joint (J) is located in terms of residue numbers.

and ev-1119 cloned from third serial passage stocks by Brockman et al. (1975), are depicted in Fig. 1. A physical map of wild type SV40 is shown for comparison. As previously reported (Brockman et al., 1975), most of the late region of the SV40 genome (transcribed clockwise from HinC through HinG) is deleted in ew-1114 generating a recombinant joint between Hin fragments C and G (m fusion fragment) while a large portion of the early region of the genome (transcribed counterclockwise from Hin A through Hin B) is deleted in ev-1117 and ev-1119 with recombination occurring between Hin fragments A and B (a fusion fragment) as shown in Fig. 1. Furthermore, a portion of the genome containing the Hin A. C junction is duplicated in each variant giving rise to three additional recombinantbints: CA in ev-1114, AC in ev-1117, and AD in ew-1119 (Fig. 1). Each of the six recombinant joints are derived from viral DNA. There is no known cell-derived DNA in these variants. Restriction Joint

Mapping

of Each Recombinant

The portion of each variant containing a recombinant joint was extensively digested with restriction endonucleases and the results are presented in Fig. 2. The restriction

RECOMBINANT

JOINTS

IN

NATURALLY

ARISING

SV40

VARIANTS

347

FIG. 2. Restriction endonuclease maps of six recombinant joint-containing DNA segments from SV40 variants, ev-1114, 1117, and 1119. The location of each restriction enzyme site is depicted by a vertical line and the nucleotide residue (numbering corresponds to Reddy et al., 1978). The position of the recombinant joint is designated by a vertical arrow and the two recombining nucleotide residues. The extent and polarity of the sequence determined for each joint-containing segment is indicated by horizontal arrows.

enzyme sites which are depicted are those found to be present after restriction enzyme digestion and fractionation of digest products by polyacrylamide gel electrophoresis. Nucleotide residues are numbered according to the wild type SV49 sequence reported by Reddy et al. (1978). Sowce

sf‘ Fragments

Jar Nucleotide

Se-

The appropriate double-stranded restriction fragments were isolated and treated with bacterial alkaline phosphatase prior to end-labeling with [y-“*P]ATP in the presence of polynucleotide kinase. One of the 5’labeled termini was then removed by additional restriction enzyme cleavage, or alter-

natively strands were separated, prior to nucleotide sequence analysis. An endlabeled ALuI-ALuI DNA restriction fragment was cleaved with Hoe111 for determination of the ev-1114-m sequence; a HaeIII-Hind11 fra=ent was cut with B~wIHI for the ev-1114~CG sequence; an ALuI-ALuI fragment was digested with Hoe111 for the ev-1117-E sequence; aHindII-TaqI fray ment was cut with Hinf for the ev-1117-AB sequence; a Hinf-Hinf fragment was cut with H&d11 to sequence ezl-1119-m; and a TaqI-Tag1 fragment was cleaved with Hoe111 for the ev-1119-a sequence. The portion of each fragment which was sequenced is illustrated in Fig. 2. The regions adjacent to the joint which were also se-

348

MARY WOODWORTH-GUTAI

A

T

A

G

C

T

G

G

T

T

A

_/

A

T

A

G A

T

A

T

A

G

G \

A

T

C

G

G

A

G

A

A C

T T T

G A

\

C

T \

C

T A

C i

A

G A

A

A A

T A

T T G-

A

\

T A A

FIG. 3. Autoradiogram of oligonucleotide products of Maxam-Gilbert sequencing procedure electrophoresed on a slab gel (3 mm x 40 cm x 18 em) composed of 20% polyacrylamide-8 M urea. The sequence is that of the AC joint of ev-111’7 beginning at nucleotide residue 4555 in HinA, proceeding through the joint sequence at residues 4521/0146 and into HinC sequences. The sequence was obtained from an end-labeled AluI-AluI fragment cleaved with HaeIII.

RECOMBINANT

JOINTS

IN

NATURALLY

ARISING

SV40

quenced are included in the figure. Each sequence was then compared to published sequences of the same strain of SV40 DNA (Fiers et al., 19’78; Reddy et al., 1978). Location

of Recombinant

Nucleotide Joints

Sequences

of

Recombinant

of Recombining

Parental

Sequences

Since earlier studies of viral-host recombinant joints (Gutai and Nathans, 1978;

1

A + T CONTENT”

(a) Recombinant

An autoradiogram of a representative nucleotide sequence determination is shown in Fig. 3, and the nucleotide sequences at each recombinant joint are compiled in Fig. 4. Included for comparison are the two recombining parental viral sequences adjacent to each recombinant joint. Short patches of homology between the parental sequences have been underlined. There is a single common nucleotide occurring at the recombination site of the parental DNAs of two recombinant joints (a G in the case of ev-1114 CA, and an A in ev-1119 AD). The recombining parental DNAs of the ev-1119 AB joint share a four nucleotide sequence (TTTG) at the site of recombination. Because of the common homology the precise location of these joints cannot be assigned. For two of the six recombinant joints (ev-1117 AB and ev-1119 m), there are short stretches of up to seven nucleotides in the parental DNAs which could have base paired to form an initial intermediate recombinant. As can be seen in Fig. 4, an extra nucleotide (G) is present between the junction of parental HinA and HinC at the AC joint in ev-1117, and an extra T at the AB joint of ev-1119. Base Composition

TABLE

Joints

The nucleotide positions for each of the recombinant joints are shown in Fig. 2. In all five recombinant joints containing HinA sequences a different region in HinA (nucleotide positions 4225,4521,4395,4976, and 4639) was involved in the recombination event as is true for the three junctions involving HinC (nucleotide positions 0153, 0376, and 0146) as well as the two junctions involving recombination with HinB (positions 2600 and 3011). In every instance, the site of recombination is different.

349

VARIANTS

Hid.% HinCG Hina HinAB HinAD HinB

joint joint joint joint joint joint

u Total A both sides recombinant the point recombining wild type Black, 1964).

in in in in in in

(b) Parental recombining segments (%)

(%)

ev-1114 u-1114 ev-1117 ev-1117 ev-1119 ev-1119

52 54 64 68 66 66

HinCiHinA HinClHinG .HinA!HinC .HinAlHinB .Hin Al Hin D .HinAIHinB

44168 .54150 78144 -56172 66152 60168

+ T content of thlz 25 nucleotides on of the recombinant joint in (a), the sequence, and the 50 nucleotides spanning of recombination in (b), the parental segments. The total A + T content of the SV40 genome is 59% (Crawford and

McCutchan et al., 1979) suggested that sequences rich in A .T base pairs are often involved in the recombination event, we analyzed the total A + T content of the parental DNAs spanning the viral-viral recombinant joints (25 nucleotides on each side) as shown in Table 1. The number of A .T base pairs ranges in value from 44%’ for each of the HinC recombining segments of the CA joint in ezl-1114 and the AC joint in ev-1117 to 72% A*T for the HinB recombining segment of the Ai? joint in ew-1117 and 78% A .T for the HinA recombining segment of the AC joint in ev-ll17. Notably, the lowest A + T content is seen in the HinC segments. DISCUSSION

Earlier studies by Gutai and Nathans (1978) indicated that recombination between viral and cellular DNA in SV40-infected cells was not limited to a single specific nucleotide sequence signal, and did not require extensive sequence homology between recombining DNAs. The data suggested, however, that recombination might be influenced by short stretches of homologous parental sequences and by A .T-rich flanking sequences. Those studies have now been extended to the analysis of recombination

350

MARY

e_v-1114

fi

WOODWORTH-GUTAI

5LATACTTCTGCCTGCTGGGGAGCCTGGCAGTG

L

SV40-Hin

c

-ATACTTCTGCCTGCTGGGGAGCCTG@GACTTTCCAtACCCTAACTGACA

SV40-Hin

A

-TATTTTTCCATAATTTTCTTGTAT@CAGTGCAGCTTTmTTTGTGGT

e_v-1114

b -GAGCTTTTGCTGCAATTTTGTGAAGAGCAGTGGAAGGGAC~CCCAGATA

k

SV40-H&I

C

-GAGCTTTTGCTGCAATTTTGTGAAGGGGAAGATACTGTTGACGGGAAACG --

SV40-&

G

-CTGTTTACCACCACTTCTGGAACACAGCAGTGGAAGGGAC~CCCAGATA --

~~-1117

4 -ATTTTTAAGTGTATAATGTGrrAAAAGCCCAGCAGGCAGAAGTATGCAAAGC

K

SV40-Hin-

A

-ATTTTTAAGTGTATAATGTGTTAAACTAAACTACTGATTCTAATTGTTTGTGTATT

SV40-Hin-

C

-TTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGC

pv-1117

4 -CAGAAGAAATGCCATCTAGTGATGACAATTGTTGTTG

a

SV40-Hin

A

-CAGAAGAAATGCCATCTAGTmATGAGGCTACTGCTGACTCTCAACAT --

SV40-Hin-

B

-CT&&&CTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTAr

e_v-1119

SV40-HinSV40-

e_v-1119

c -CTCTGATGAGAAAGGCATATTTAAAAGCAGCAATTTCAGCTACTGAAAAT

a A -Hin

-CTCTGATGAGAAAGGCATATTTAAA@AATeGGAGTTTCATCCTGAT D

Ax

-CTTCAATTGCAGCAGCGGCCTCTCC@GCAGCAATTTCAGCTACJQIAAAT t -TTGCTTTAGAATGTGGTTTTGCTTCTTATGTTAATTTGGTACAG

SV40-Hin-

A

-CTTCGATTGCTTTAGAATGTGGTTTGGACaGATCTTTGTGAAGGAACCT

SV40-Hin-

B

-GAATAATTCAAAGTGGCATTGCTTTGCTTCTTATGTTATGGTACAGA

FIG. 4. Comparison of nucleotide sequences at viral-viral recombinant joints. The position of the joint is indicated by an arrow. The recombining parental sequences (50 nucleotides each) are written below the joint sequence. Sequences common to both parental DNAs are underlined. Boxes enclose those nucleotides occurring at the joint which are common to both parental DNAs and make the precise location of the joint uncertain.

between viral segments of naturally arising variants in SV40-infected cells. With the added advantage of having the nucleotide sequences of both recombining parental DNAs, the recombinant and parental sequences could be compared directly. Three variants, ~-1114, ev-1117, and ev-1119, cloned from the third serial undiluted passage (Brockman et al., 1975), have both deletions and duplications of portions of the viral genome. No cellular DNA segments have been detected in the genomes of these variants. The six viral-viral recombinant joints in the three variants were extensively mapped by restriction endonuclease cleavage, and appropriate fragments of each recombinant joint were sequenced using the

Maxam and Gilbert (1977) direct DNA sequencing technique. The 25 nucleotides of parental DNA extending in both directions from the recombinant joint have been evaluated in detail. Clearly the nucleotide sequence at the site of recombination is different in each case, as was true for viral-host recombinants. For each of the six recombinant joints, the two recombining parental DNAs were examined for regions of shared homology. For two of the six recombinant joints (AB of ev-1117 and AB ofev-1119), I found that the parental DNAs have short homologous patches of up to seven continuous nucleotides which occur in the proper order and could have base paired to hold the initial intermediate re-

RECOMBINANT

JOINTS IN NATURALLY

combinant together until some form of repair finalized the new recombinant joint sequence. In the case of ev-1119 AB, the homologous patches include a tetranucleotide (TTTG) common to both recombining parental DNAs which occurs at the junction of the two DNAs. While the amount of patchLhomology is rather extensive in the two AB recombinant joints, there is little or no homology in the other four recombinant joints. Zain and Roberts (1978) found no homology at an adeno-SV40 recombinant joint, however, there is patchy homology in recombinant joint sequences in the 14B cell line of SV40-transformed cells (Botchan et al., 1980) and in one of the seven linked P-globin genes in the mouse (Jahn et al., 1980). It should also be noted that with the possible exception of the ev-1117 AC joint, in which a G has substituted for a C residue, there is no evidence for any mismatch correction in or around recombinant joints. Therefore it remains unclear what role, if any, short homologous sequences play in influencing the location of recombination events. As has been previously noted (Landy and Ross, 1977; Gutai and Nathans, 1978; McCutchan et al., 1979), A .T-rich regions and particularly uninterrupted A .T pairs may enhance the recombining potential of the region. The three viral-viral recombinant joints which do not contain HinC sequences have an A + T content greater than the total genomic wild type SV40 DNA value and this A .T richness may have been a factor in recombination. However, in the case of the three recombinant joints containing HinC sequences, it is particularly striking that these recombinant joints are low in A + T content and also do not have regions of patchy homology. Perhaps the mechanism involved in duplication of the origin of DNA replication (located in the HinC fragment) differs from the mechanism responsible for deletion or recombination genera!ly. ACKNOWLEDGMENTS I am grateful to Daniel Nathans for many helpful discussions and reading of the manuscript. This research was supported by grants from the United States National Cancer Institute, DHEW, CA 14801, CP

ARISING

SV40 VARIANTS

71062, and a Research Career Development (CA 00449).

351

Award

REFERENCES BOTCHAN, M., STRINGER, J., MITCHISON, T., and SAMBROOK, J. (1980). Integration and excision of SV40 DNA from the chromosome of a transformed cell. Cell 20, 143-152. BROCKMAN, W. W. (1977). Evolutionary variants of simian virus 40. In “Progress in Medical Virology’ (J. L. Melnick, ed.), Vol. 23, pp. 69-95. Karger, Basel. BROCKMAN, W. W., GUTAI, M. W., and NATHANS, D. (1975). Evolutionary variants of simian virus 40: Characterization of cloned complementing variants. Virology

66, 36-52.

CRAWFORD, L. V., and BLACK, P. H. (1964). The nucleic acid of simian virus40. Virology 24,388-392. DANNA, K. J., and NATHANS, D. (1972). Bidirectional replication of simian virus 40 DNA. Proc. Nut. Acad. Sci. USA 69, 3097-3100. FAREED, G. C., GARON, C. F., and SALZMAN, N. P. (1972). Origin and direction of SV40 DNA replication. J. Virol. 10, 484491. FIERS, W., CONTRERAS,R., HAEC:EMAN, G., ROGIERS, R., VAN DE VOORDE, A., VA~[ HERREWEGHE, J., VAN HEUVERSWYN, H., VOLCKAERT, G., and YSEBAERT, M. (1978). Complete nucleotide sequences of SV40 DNA. Nature (London) :273, 113-120. GUTAI, M. W., and NATHANS, D. (1978). Evolutionary variants of simian virus 40: Cellular DNA sequences and sequences at recombinant joints of substituted variants. J. Mol. Biol. 126, 275-288. HIRT, B. (1967). Selective extraction of polyoma DNA from infected mouse cell cultures. J. Mol. Biol. 26, 365-369.

JAHN, C. L., HUTCHISON, C. A., III, PHILLIPS, S. J., WEAVER, S., HAIGWOOD, N. L., VOLIVA, C. F., and EDGELL, M. H. (1980). DNA sequence organization of the Pglobin complex in the I3ALB/c mouse. Cell 21, 159-168. LAI, C.-J., and NATHANS, D. (1974). Deletion mutants of simian virus 40 generated by enzymatic excision of DNA segments from the viral genome. J. Mol. Biol. 89, 179-193. LANDY, A., and ROSS, W. (1977). Viralintegration and excision: Structure of the lambda att sites. Science 197, 1147-1160. LEE, T. N. H., and NATHANS, D. (1979). Evolutionary variants of simian virus 40: Replication and encapsidation of variant DNA. Virology 92, 291-298. MAXAM, A. M., and GILBERT, W. (1.977). A new method for sequencing DNA. Proc. Nat. Acad. Sci. USA 74, 560-564.

MCCUTCHAN, T., SINGER, M., and ROSENBERG, M. (1979). Structure of simian virus 40 recombinants that contain both host and viral DNA sequences. II.

352

MARY

WOODWORTH-GUTAI

The structure of variant 1103 and its comparison to variant CVPUiP2 (Eco RI res). J. Biol. Chem. x4,3592-3597. NATHANS, D., and GUTAI, MI W. (1977). “Mosbach Colloquium,” Vol. 28, pp. 49-58. Springer-Verlag, Berlin/New York. REDDY, V. B., THIMMAPPAYA, B., DHAR, R.. SUBRAMANIAN, K. N., ZAIN. B. S., PAN, .I., GHOSH, P. K., CELMA, M. L., and WEISSMAN, S. M. (1978). The genome of SV40. Science 200, 494-502. SANGER, F., and COULSON, Ai R. (1978). The use of thin acrylamide gels for DNA sequencing. FE&S’ Lett. 87, 107-110. SMITH, H. 0. (1974). Restriction endonuclease from H. infEuenzae Rd. In “Methods in Molecular Biology Series,” Vol. 7, pp. 71-85. Dekker, New York. SMITH, H. O., and WILCOX, K. W. (1970). A restriction

enzyme from Hemophilus injtuenzae. I. Purification and general properties. b. Mol. Biol. 51, 379-391. THIMMAPPAYA, B., and SHENK, T. (1979). Nucleotide sequence analysis of viable deletion mutants lacking segments of the simian virus 40 genome coding for small t antigen. J. Viral. 30, 668-673. VOLCKAERT, G., FEUNTEUN. J., CRAWFORD, L. V.. BERG, P., and FIERS, W. (1979). Nucleotide sequence deletions within coding regions for small t antigen of simian virus 40. J. Viral. 30, 674-682. WAKAMIYA, T., MCCUTCHAN, T., ROSENBERG, M., and SINGER, M. (1979). Structure of simian virus 40 recombinants that contain both host and viral DNA sequences. I. The structure of variant CVPRIlIP2 (Eco RI res). J. Biol. Chem. 254, 3584-3591. ZAIN, B. S., and ROBERTS, R. (1978). Characterization and sequence analysis of a recombination site in the hybrid virus Ad2+ND,. J. Mol. Biol. 120, 13-32.