Reconstitution of B cell function in murine models of immunodeficiency

Available online at www.sciencedirect.com R

Clinical Immunology 107 (2003) 90 –97

www.elsevier.com/locate/yclim

Reconstitution of B cell function in murine models of immunodeficiency Andrea S. Porpiglia,a Jurg Rohrer,a,1 and Mary Ellen Conleya,b,* b

a Department of Immunology, St. Jude Children’s Research Hospital, Memphis, TN 38105, USA Department of Pediatrics, University of Tennessee College of Medicine, Memphis, TN 38105, USA

Received 26 November 2002; accepted with revision 31 January 2003

Abstract Murine models of immunodeficiency were used to evaluate strategies that might allow B cell engraftment in patients with X-linked agammaglobulinemia. Mice with defects in Btk or ␮ heavy chain were given 2.5 ⫻ 106 bone marrow cells from wild-type congenic donors. In the absence of any preparative regimen or immunosuppression, Btk-deficient mice on the CBA background developed normal concentrations of serum IgM and IgG3 by 12 weeks posttransplant. By contrast, ␮ heavy chain-deficient mice on the C57BL/6 background required some immunosuppression to achieve engraftment. Treatment of these mice with anti-T-cell antibodies 2 and 4 days prior to transplant resulted in normal concentrations of serum immunoglobulins by 6 weeks posttransplant. These pretreated mice had only 10% of the normal number of splenic B cells and they had no evidence of donor T cell engraftment. These results suggest that myelotoxic drugs may not be needed to achieve B cell engraftment in B-cell-deficient subjects. © 2003 Elsevier Science (USA). All rights reserved. Keywords: B-lymphocytes; Hematopoietic stem cell transplantation; Graft enhancement, Immunological; Agammaglobulinemia; Transplantation conditioning; Disease models, animal; Chimera

Introduction In the last 10 years, most of the genes responsible for the classic primary immunodeficiencies have been identified [1,2]. This has greatly improved genetic counseling for affected families and it has provided a strong basis for improved therapy. Once the abnormal gene has been identified, one can better understand how the defective gene product causes disease and one can evaluate treatments for the disease in animal models. The abnormal gene in X-linked agammaglobulinemia (XLA) was identified by two groups in 1993 [3,4]. Within a few months, it was recognized that a well-characterized murine model of immunodeficiency, the xid mouse, had a

* Corresponding author. University of Tennessee College of Medicine, St. Jude Children’s Research Hospital, 332 North Lauderdale, Memphis, TN 38105. Fax: ⫹1-901-495-3977. E-mail address: [email protected] (M.E. Conley). 1 Current address: Pharmingen, San Diego CA.

mutation in the same gene, Btk [5,6]. Btk is a cytoplasmic tyrosine kinase that is activated by cross-linking of a variety of cell surface markers, including the B cell and pre-B cell antigen receptor [7]. The manifestations of mutations in this gene are more severe in the human than in the mouse. Patients with XLA have less than 1% of the normal number of B cells, they have marked reductions in all isotypes of immunoglobulins, and they generally fail to make antibodies to all antigens [8 –10]. By contrast, xid mice have 50% of the normal number of B cells, they have low serum IgM and IgG3 but normal IgG1 and IgG2, and they are unable to make antibodies to some thymus-independent antigens, such as NP-Ficoll [11,12]. However, xid mice can make antibodies to thymic-dependent antigens. Studies done in human and murine heterozygous carriers of Btk mutations have shown that B cell precursors with a normal Btk gene have a strong selective advantage in proliferation, differentiation, and/or survival compared to precursors with mutant Btk [13–16]. It should be possible to use this selective advantage to help correct Btk deficiency.

1521-6616/03/$ – see front matter © 2003 Elsevier Science (USA). All rights reserved. doi:10.1016/S1521-6616(03)00044-5

A.S. Porpiglia et al. / Clinical Immunology 107 (2003) 90 –97

To test this hypothesis, we treated lethally and sublethally irradiated xid mice and then gave them xid bone marrow cells that had been supplemented with variable numbers of bone marrow cells from congenic mice with normal Btk [17]. The results of these studies showed that as few as 2.5 ⫻ 104 unmanipulated congenic CBA/J bone marrow cells could predictably provide normal concentrations of serum IgM and IgG3 and a normal response to NP-Ficoll in xid mice that had received 900 rad (lethal irradiation) or 450 rad. In xid mice that received lower doses of irradiation or no irradiation, it took longer to see any improvement in the concentrations of serum IgM and IgG3, but all of the transplanted mice demonstrated some increase in serum immunoglobulins. In the sublethally irradiated mice, normal immune function could be seen in mice when only 10% of the splenic B cells were derived from the normal donor [17]. To extend these experiments, we have transplanted unirradiated xid mice with increasing numbers of bone marrow cells from normal congenic mice. We also examined immune correction in mice with a more severe defect in B cell development, ␮MT mice. In these mice, the membrane exons of ␮ heavy chain have been replaced with the neomycin gene. As a result, the mice have profound hypogammaglobulinemia and absent B cells [18]. We expected that mice with a more severe defect in B cell development might demonstrate more rapid correction of the immune system or correction with fewer donor cells. Our results show a more complicated picture; xid mice were more easily corrected than ␮MT mice. This could be attributed, at least in part, to the fact that the two immune defects are on different genetic backgrounds; the xid defect is on the CBA background, whereas the ␮MT defect is on the C57BL/6 background.

Materials and methods Mice The CBA/N (xid), CBA/J (wild-type control for xid), ␮MT, and C57BL/6 (wild-type control for ␮MT) mice were initially obtained from Jackson Laboratories (Bar Harbor ME) and then bred and maintained in the Animal Research Center at St. Jude Children’s Research Hospital. The treated and untreated ␮MT mice were maintained on sulfamethoxazole/trimethoprim. Only male mice were used as bone marrow recipients. The donor and recipient mice were 5–7 weeks of age at the time of the transplants. Cell preparation and transplantation Irradiation of recipient mice, preparation of donor bone marrow, and intravenous infusion of bone marrow cells were performed as previously described [17]. Anti-T-cell antibodies were given ip in a volume of 0.5 ml and included a 1:10 dilution of ascites from the anti-CD8 clone 2.43 and

91

a 1:5 dilution of ascites from the anti-CD4 clone GK1.5. Both clones were obtained from ATCC (Rockville MD). At the end of some experiments, the spleens and bone marrow were harvested and prepared for immunofluorescence staining as previously described [17]. The splenic cells were stained with phycoerythrin-conjugated (PE) B220 and fluorescein isothiocyanate-conjugated (FITC) anti-IgM or FITC B220 and PE anti-CD3. Bone marrow cells were stained with PE B220 and FITC anti-IgM or with FITC B220 and PE-conjugated anti-CD43. In some experiments splenic cells were sorted into B220⫹ cells and CD3⫹ cells and bone marrow cells were sorted into B220⫹ and B220⫺ cells using a Becton–Dickinson FACStar-plus cell sorter (Palo Alto, CA). Quantitative serum immunoglobulins and antibody response Mice were bled via the retro-orbital plexus and serum samples were stored in aliquots at ⫺80°C. Serum IgM, IgG, and IgG3 were measured by ELISA as previously described, with minor modifications [17]. Microtiter plates were coated overnight with 10 ␮g/ml of polyclonal anti-IgM (Zymed), IgG, or IgG3 (Southern Biotechnology). The plates were then blocked with bovine serum albumin and five threefold dilutions of serum samples were added. The plates were developed with polyclonal alkaline phosphatase-conjugated anti-IgM, IgG, or IgG3 (Southern Biotechnology) and substrate. Samples of purified IgM, IgG, and IgG3 were analyzed in parallel and used to create a standard curve. As an additional internal control, an aliquot of the same pooled serum sample was included in each ELISA. SOFTmax Pro (Molecular Devices Corp.) software was used to calculate the serum immunoglobulin concentrations. Mice were immunized with 100 ␮g of NP-Ficoll (Biosearch Technologies, Novato, CA) in phosphate-buffered saline injected intraperitoneally. Plasma samples were obtained 10 days postimmunization and NP-specific antibody was measured as previously described [17]. Semiquantitative PCR Purified DNA from sorted cells was amplified by PCR using a sense primer from intron 4 of the murine ␮ constant region gene (CAGGTCCATACATTGCATCTG) and an antisense from the neomycin resistance gene (CAAGCAGGCATCGCCATGGGT) to identify DNA from ␮MT mice or an antisense primer from exon 5 of the ␮ heavy constant region gene (the first membrane exon) (GTGAATGCTGAGGAGGAA) to identify DNA from the wild-type mice. A sample of DNA containing equal amounts of DNA from ␮MT mice and wild-type mice was used as a control. The PCR was done in the presence of [32P]cytosine using the following conditions: 95°C for 5 min and then 28 cycles of 95°C for 45 s, 60°C for 30 s, and 72°C for 30 s, with a final extension of 5 min at 72°C. PCR products were separated

92

A.S. Porpiglia et al. / Clinical Immunology 107 (2003) 90 –97

Fig. 1. Correction of the antibody deficiency in Btk-deficient xid mice. Unirradiated xid mice were given 2.5 ⫻ 106 bone marrow cells (filled squares), 2.5 ⫻ 105 bone marrow cells (filled triangles), or 2.5 ⫻ 104 bone marrow cells (filled circles) from congenic CBA/J mice and serum IgM (left) and IgG3 (right) were measured at 6-week intervals. The gray area represents the range of normal in six untreated CBA/J mice. The controls included xid mice pretreated with 450 rad and given 4.75 ⫻ 105 bone marrow cells from xid donors plus 2.5 ⫻ 104 bone marrow cells from normal CBA/J donors (open circles) and untreated xid mice (open squares).

on a 6% polyacrylamide gel and analyzed by Phosphoimager and Imagequant software.

Results Our previous studies showed improved but not normal immune function in unirradiated xid mice that received 2.5 ⫻ 104 bone marrow cells from congenic CBA/J mice. To determine if larger numbers of bone marrow cells could completely correct the B cell defect in xid mice, groups of four to six unirradiated xid mice were given 2.5 ⫻ 104, 2.5 ⫻ 105, or 2.5 ⫻ 106 unmanipulated bone marrow cells from age-matched CBA/J mice. The controls included xid mice treated with 450 rad and 475,000 xid bone marrow cells plus 2.5 ⫻ 104 cells from the normal congenic mice, untreated xid mice, and CBA/J mice. Serum IgM and IgG3 were examined at 6-week intervals and at 18 weeks posttrans-

plant, all of the mice were immunized with the T-cellindependent antigen NP-Ficoll. As shown in Fig. 1, by 12 weeks posttransplant, mice that received 2.5 ⫻ 106 cells had normal concentrations of serum IgM and IgG3 which persisted until the end of the experiment at 40 weeks posttransplant. Mice that received 2.5 ⫻ 105 or 2.5 ⫻ 104 cells had improved but not normal immunoglobulins. Five of six control CBA/J mice, three of four mice that were given 450 rad and 2.5 ⫻ 104 donor cells, and two of five of the unirradiated mice that received 2.5 ⫻ 106 cells had at least a twofold increase in titer to NP (Fig. 2). None of the unirradiated mice that received fewer than 2.5 ⫻ 106 cells made antibody to NP. This experiment was repeated in a second group of mice and identical results were obtained. Because the block in B cell differentiation in ␮MT mice is more severe than that seen in xid mice and more similar to that seen in patients with XLA, we hypothesized that the defect in these mice might be corrected more rapidly or with fewer donor cells. As in the experiments described above, groups of four to six unirradiated ␮MT mice were given 2.5 ⫻ 104, 2.5 ⫻ 105, or 2.5 ⫻ 106 unmanipulated bone marrow cells from age-matched congenic C57BL/6 mice and serum IgM, IgG, and IgG3 were evaluated at 6 week intervals. None of the treated mice developed any measurable serum IgM (⬍ 10 ng/ml) or IgG (⬍ 30 ng/ml) in the 24 weeks after transplant. These results were confirmed in a second group of unirradiated ␮MT mice given 2.5 ⫻ 106 bone marrow cells from the C57BL/6 donors. Two possible explanations for the differences between the xid and ␮MT mice were considered. The two murine immune deficiencies occur on different genetic backgrounds. It may be that genetic differences between CBA/J mice and C57BL/6 mice affect immune correction. Alternatively, the C57BL/6 mice might not be as closely related to the ␮MT mice as CBA/J mice are to the xid mice, allowing immune rejection of donor cells in the ␮MT mice. These possibilities were evaluated by crossing xid female mice with C57BL/6 males and treat-

Fig. 2. Transplanted xid mice, wild-type (WT), and untreated (xid) controls were immunized with NP-Ficoll and 10 days later the serum IgM anti-NP titer was measured by ELISA. The preimmunization titer is shown in the gray bars and the postimmunization titer is shown in the filled bars for each individual mouse. The xid mice in Group 1 were pretreated with 450 rad and given 475,000 xid bone marrow cells plus 2.5 ⫻ 104 cells from the normal CBA/J congenic donor. The unirradiated xid mice in the remaining groups were given 2.5 ⫻ 106 cells (Group 2), 2.5 ⫻ 105 cells (Group 3), or 2.5 ⫻ 104 cells (Group 4) from the normal congenic donor.

A.S. Porpiglia et al. / Clinical Immunology 107 (2003) 90 –97

Fig. 3. Correction of the antibody deficiency in ␮ heavy chain-deficient (␮MT) mice. After receiving anti-T-cell antibodies at days ⫺4 and ⫺2, unirradiated ␮MT mice were given 2.5 ⫻ 106 bone marrow cells (filled circles) or 0.5 ⫻ 106 bone marrow cells (filled triangles) from congenic C57BL/6 mice and serum IgM was measured at 6-week intervals. The gray area represents the range of normal in 14 untreated C57BL/6 mice. The controls included ␮MT mice pretreated with 450 rad and given 2.5 ⫻ 106 bone marrow cells from C57BL/6 donors (open circles) and 19 untreated ␮MT mice (open squares).

ing the Btk-deficient males from the F1 generation with bone marrow from their completely matched sisters. Three unirradiated Btk-deficient males from the F1 generation showed no increases in serum IgM or IgG3 after being given 2.5 ⫻ 106 bone marrow cells from their Btk heterozygous sisters. These results suggest that there are genetic factors specific to the C57BL/6 strain of mice that make this strain more resistant to engraftment of donor stem cells or B lineage cells. We took advantage of the resistance of the ␮MT mice to B cell engraftment and used it as a model to examine strategies that might influence engraftment of MHCmatched cells in the absence of lethal irradiation. Low-dose irradiation (450 rad) was compared to a preparative regimen consisting of a mixture of monoclonal antibodies to CD4 and CD8 given 2 and 4 days prior to transplant. To examine the effect of these preparative regimens on T cells, two ␮MT mice pretreated with 450 rad and two mice given anti-T cell antibodies were sacrificed on the day of transplant and the number of splenic T cells was compared to that seen in untreated ␮MT mice. Both treatments resulted in an approximately 85% decrease in the number of T cells harvested. Mice pretreated with 450 rad or anti-T-cell antibodies and untreated ␮MT mice were given 2.5 ⫻ 106 or 0.5 ⫻ 106 bone marrow cells from C57BL/6 mice. Controls included untreated C57BL/6 and ␮MT mice. Each experiment was performed at least twice. As in previous experiments, the ␮MT mice that received 2.5 ⫻ 106 bone marrow cells, but were not pretreated, showed no serum IgM or IgG at any time after transplant. All of the mice that were pretreated with 450 rad or antiT-cell antibodies, and were given 2.5 ⫻ 106 bone marrow

93

cells, had measurable amounts of IgM and IgG by 6 weeks after transplant. In the transplanted mice, the concentrations of serum IgM and IgG were more variable than that seen in the untreated C57BL/6 controls but the mean concentration of IgM in the mice that received 450 rad was higher than that seen in the untreated controls at 6, 12, and 18 weeks posttransplant (Fig. 3). By contrast, the mean serum IgM concentration in the mice treated with anti-T-cell antibodies was very similar to that in the untreated controls. One of the 15 mice treated with 450 rad had a normal concentration of serum IgM 6 weeks posttransplant but the concentration of IgM declined and was undetectable by 24 weeks posttransplant. Three of the 17 mice pretreated with anti-T-cell antibodies and given 2.5 ⫻ 106 bone marrow cells had serum concentrations of IgM that fell below the range of normal at two or more time points. Of the 8 ␮MT mice pretreated with anti-T-cell antibodies and given 0.5 ⫻ 106 bone marrow cells, all had low but measurable concentrations of serum IgM 6 weeks posttransplant, but 5 of the 8 mice had undetectable IgM by 24 weeks posttransplant. The ␮MT mice that were pretreated with 450 rad or anti-T-cell antibodies and received 2.5 ⫻ 106 bone marrow cells all had normal or near normal concentrations of serum IgG throughout the experimental period. Those given 450 rad did not show the early elevation in serum IgG that was seen for IgM in the same mice. Mice pretreated with antiT-cell antibodies and given 0.5 ⫻ 106 bone marrow cells had low but measurable IgG 6 and 12 weeks after transplant. At 18 weeks posttransplant three of the eight mice that received the lower dose of bone marrow cells had normal serum IgG (Fig. 4); this group included all three of the mice that had low but measurable amounts of serum IgM at this time point. Three additional mice that received the lower dose of bone marrow cells had concentrations of IgG between 113 and 483 ␮g/ml. The two remaining mice in that experimental group had low concentrations of IgG throughout the experiment. In the mouse, IgG3 constitutes a minor fraction of total serum IgG but it is the major antibody isotype directed

Fig. 4. Concentration of total serum IgG and IgG3 18 weeks posttransplant. The ␮MT mice in Group 1 were pretreated with 450 rad and given 2.5 ⫻ 106 bone marrow cells. The unirradiated ␮MT mice in Groups 2 and 3 were pretreated with anti-T-cell antibodies and given 2.5 ⫻ 106 bone marrow cells (Group 2) or 0.5 ⫻ 106 bone marrow cells (Group 3). Controls included 19 untreated ␮MT mice and wild-type C57BL/6 mice (WT).

94

A.S. Porpiglia et al. / Clinical Immunology 107 (2003) 90 –97

Table 1 Splenic B cells in transplanted ␮MT mice

␮MT mice given 450 rad and 2.5 ⫻ 106 BM cells (7)b ␮MT mice given anti-T-cell antibodies and 2.5 ⫻ 106 BM cells (6) Untreated ␮MT mice (4) Untreated C57/B mice (5) a b

Total cells harvested ⫻ 106 a

Percentage of B220⫹

Absolute number of B cells ⫻ 106 a

39 ⫾ 10 21 ⫾ 14

67 ⫾ 12 31 ⫾ 14

26 ⫾ 10 6⫾8

10 ⫾ 9 70 ⫾ 23

2⫾2 77 ⫾ 7

⬍0.2 54 ⫾ 17

Mean ⫾ 1 SD. Number of mice analyzed.

against carbohydrate antigens; therefore, we evaluated the serum concentrations of IgG3 in the transplanted mice. Surprisingly, in the mice given 2.5 ⫻ 106 bone marrow cells, the mice that were pretreated with 450 rad were less likely to develop a serum IgG3 of greater than 20 ␮g/ml (2 of 14 mice) than mice pretreated with anti-T-cell antibodies (14 of 17 mice) (Fig. 4). Of the 8 mice pretreated with anti-T-cell antibodies and given 0.5 ⫻ 106 bone marrow cells, 2 mice had a serum IgG3 of between 20 and 30 ␮g/ml; the remaining mice had less than 20 ␮g/ml of IgG3. At 18 weeks posttransplant, the mice were immunized with NP-Ficoll and the IgM response to NP was measured 10 days later. Eight of 9 control C57BL/6 mice demonstrated an antibody response to NP. Of the mice given 2.5 ⫻ 106 bone marrow cells, 11/14 mice pretreated with 450 rad and 11/17 mice pretreated with anti-T-cell antibodies responded to immunization. None of the mice pretreated with anti-T-cell antibodies and given 0.5 ⫻ 106 bone marrow cells made antibodies to NP. In the group of mice pretreated with anti-T-cell antibodies and given 2.5 ⫻ 106 bone marrow cells, 2 of the 3 mice with low or absent serum IgG3 failed to make an antibody response to NP. A subset of the mice were sacrificed at 48 ⫾ 4 weeks posttransplant and the percentage, absolute number, and phenotype of the B220⫹ cells were examined. As shown in Table 1, the untreated C57BL/6 wild-type mice and the ␮MT mice that had received 450 rad plus 2.5 ⫻ 106 bone marrow cells had relatively similar percentages of B220⫹ cells in the spleen, but the total number of cells harvested and the absolute numbers of B220⫹ cells in the irradiated, transplanted ␮MT mice were approximately half of that seen in the wild-type mice. The ␮MT mice that were not irradiated but were treated with anti-T-cell antibodies prior to transplant had highly variable percentages and absolute numbers of B220⫹ cells that did not correlate with serum immunoglobulin concentrations. As in the irradiated mice, the percentage of B220⫹ cells in the mice treated with anti-T-cell antibodies was closer to normal than the absolute numbers of B220⫹ cells. In the majority of the treated mice, the intensity of surface IgM, a marker of B cell maturity, was similar to that seen in the controls. In the group of mice that received anti-T-cell antibodies as a preparative regimen, two mice had less than 1 ⫻ 106 B220⫹ splenic B cells at the time of harvest. In both of these mice, almost all of the

B cells were intensely stained for IgM (Fig. 5), suggesting that they were very immature B cells. The number and phenotype of the B220⫹ cells in the bone marrow was examined by immunofluorescence. Cells were stained with B220 and CD43 to identify B220dim CD43⫹ pro-B cells, B220dim CD43⫺ pre-B cells, and B220bright CD43⫺ mature B cells (Fig. 6). The ␮MT mice treated with 450 rad prior to transplant had only slightly decreased percentages of B220⫹ cells (35.6 ⫾ 6%) compared to the wild-type control (47.6 ⫾ 4%). By contrast, the ␮MT mice treated with anti-T-cell antibodies prior to transplant had markedly decreased percentages of B220⫹ cells, 6.3 ⫾ 1.1% in the mice given 2.5 ⫻ 106 bone marrow cells. Untreated age-matched ␮MT mice had 3.3% B220⫹ cells. As expected, all of the B220⫹ cells in the untreated ␮MT mice were pro-B cells. By contrast, the B220⫹ cells in the transplanted mice given 450 rad showed a similar ratio of pro-B cells to pre-B cells and mature B cells to that seen in the wild-type mice. The transplanted mice that were treated with anti-T-cell antibodies showed a pattern that was similar to that seen in immunodeficient mice that do not have a

Fig. 5. The immunofluorescence analysis of splenic lymphocytes from a wild-type C57BL/6 mouse (top left panel) and ␮MT mice given 2.5 ⫻ 106 bone marrow cells from C57BL/6 donors (the remaining panels) is shown. The mouse in the top right panel was pretreated with 450 rad; the mice in the bottom panels were pretreated with anti-T-cell antibodies. The percentage of B220⫹sIgM⫹ cells in each sample is indicated in the top righthand corner of each panel. The mean fluorescence intensity of the positive cells is shown in the bottom righthand portion of the same quadrant.

A.S. Porpiglia et al. / Clinical Immunology 107 (2003) 90 –97

95

less than 10% of the DNA in CD3⫹ cells was derived from the wild-type donor. Because ␮MT mice produce normal or elevated numbers of pro-B cells, variable amounts of host DNA were expected in the B220⫹ populations from the bone marrow of the transplanted mice. In the mice that received 450 rad, 70 – 90% of the DNA in the B220⫹ cells was derived from the donor mice, whereas in the mice pretreated with anti-T-cell antibodies, only 10 –30% of the DNA from the B lineage cells was derived from the donor. In these antibody-treated mice, donor DNA was below the level of detection or less than 5% of total DNA in the B220⫺ cells in the bone marrow. In the mice given 450 rad, the ratio of donor to host DNA in the B220⫺ bone marrow cells was the same as that seen in the CD3⫹ splenic T cells. These results indicate that donor B cells can be maintained in the periphery in the absence of significant amounts of donor T cell chimerism.

Discussion

Fig. 6. The immunofluorescence analysis of bone marrow cells from a ␮MT mouse (top right panel), a wild-type C57BL/6 mouse (middle left panel), a ␮MT mouse pretreated with 450 rad and given 2.5 ⫻ 106 bone marrow cells (middle right panel), a ␮MT mouse pretreated with anti-Tcell antibodies and given 2.5 ⫻ 106 bone marrow (bottom left panel), and a ␭5-deficient mouse is shown. The top left panel is used to show the gates specific for pro-B cells (R2 ⫽ CD43dim, B220dim), pre-B cells (R3 ⫽ CD43⫺, B220dim), and mature B cells (R4 ⫽ CD43⫺, B220bright). The figures in the top righthand portion of each panel indicate the percentage of cells within the lymphoid gate that fall into each stage of differentiation.

complete block in B cell differentiation. Fig. 6 shows that both ␭5-deficient mice and the transplanted ␮MT mice pretreated with anti-T-cell antibodies have normal percentages of pro-B cells and a small number of mature, B220bright CD43⫺ cells but almost no pre-B cells. The marked decrease in numbers of pre-B cells and mature B cells was seen even in the anti-T-cell antibody-treated mice that had a normal phenotype of splenic B cells. The proportion of splenic and bone marrow cells that were derived from the wild-type donor in the transplanted mice was determined by semiquantitative PCR. Splenic cells were sorted into B220⫹ and CD3⫹ cells and bone marrow cells were sorted into B220⫹ and B220⫺ cells. As expected, greater than 90% of the DNA from splenic B220⫹ cells in all of the transplanted mice was derived from the wild-type donor mice. However, the proportion of DNA in the splenic CD3⫹ cells that was derived from the wild-type donor was more variable. Two mice that were pretreated with 450 rad were analyzed; in one, approximately equal amounts of DNA from CD3⫹ cells were derived from the donor and host; in the other mouse, 80% of the DNA was from the donor. In three mice given anti-T-cell antibodies,

In recent years there has been increasing interest in non-myeloablative preparation for hematopoietic stem cell transplants [19 –21]. The preparative regimens currently being used do include low-dose irradiation and/or antimetabolites. It is possible that less toxic approaches could be used and this could significantly shift the risk/benefit ratio for transplants in patients with genetic disorders of hematopoietic cells. However, several questions arise that must be answered before appropriate preparative regimens can be designed. Do you need to make “space” in the bone marrow to provide a favorable environment for the donor cells? Can you achieve lineage-specific engraftment, for example, B cell engraftment, in the absence of significant T cell engraftment? In the studies reported here, we have shown in two murine models of B cell deficiency that a marked improvement in B cell function can be seen in animals that have received no irradiation and no drugs toxic to bone marrow. Btk-deficient mice that were not given any preparative regimen or antirejection therapy showed long-lasting correction of the B cell defect after infusion of 2.5 ⫻ 106 bone marrow cells from wild-type congenic donors. Mice with defects in ␮ heavy chain (␮MT mice) could be corrected with 2.5 ⫻ 106 bone marrow cells if they had been pretreated with anti-T-cell antibodies. Although the majority of ␮MT mice given 2.5 ⫻ 106 bone marrow cells after pretreatment with anti-T-cell antibodies had normal concentrations of serum immunoglobulins, these mice had less than 10% of the normal number of splenic B cells. The donor B cells persisted in the transplanted mice in the absence of significant T cell engraftment. It is possible that the B cells in these animals were derived from long-lasting mature B cells in the bone marrow inoculum; however, the fact that the splenic B cells in some of these mice had an immature phenotype suggests that a small number of stem cells or early B cell precursors

96

A.S. Porpiglia et al. / Clinical Immunology 107 (2003) 90 –97

engrafted in the mice and provided a long-term source of B cells. The marked paucity but not absence of pre-B cells and mature B cells in the bone marrow of these animals supports this hypothesis. As mice weigh approximately 30 g, the dose of 2.5 ⫻ 106 bone marrow cells used in these experiments is relatively comparable to the typical 108/kg unmanipulated bone marrow cells given to patients undergoing bone marrow transplant from an HLA-matched sibling. We chose to use antiT-cell antibodies as our preparative regimen based on the hypothesis that failure to engraft in the ␮MT mice was not due to the lack of an appropriate “space” in the bone marrow but instead due to rejection of donor cells by host T cells. Studies done in both humans and mice have shown that T cells play a major roll in graft resistance and anti-Tcell antibodies can enhance engraftment of foreign cells [22–24]. There was no obvious toxicity in the mice treated with anti-T-cell antibodies. Although the mice were not housed in a germ-free facility, the mice treated with antiT-cell antibodies did not have more infections than the control ␮MT mice. We had expected that it would be easier to correct the ␮MT defect than the Btk defect because the ␮MT defect results in an earlier and more severe block in B cell differentiation [18]. The partial graft resistance in the ␮MT mice could be explained by several factors. It is possible that the more severe block in B cell development in ␮MT mice allows the production of B-cell-specific T cells in the transplanted mice. Baumgarth et al. have shown that CD4⫹ cells from ␮MT mice can block the development of adoptively transferred B cells [25]. The fact that the ␮MT defect and the Btk defect occur on different genetic backgrounds could also contribute to the relative graft resistance in the ␮MT mice. The Btk-deficient mice are on the CBA background and the ␮MT mice are on the C57BL/6 background. When Btk-deficient mice were crossed with C57BL/6 mice, the resulting F1 Btk-deficient males could not be corrected by 2.5 ⫻ 106 bone marrow cells from their matched sisters. Muller-Sieburg and Riblet have shown that C57BL/6 mice have reduced numbers of stem cells compared to some other strains [26]; however, the fact that Btk-deficient mice on the CBA background showed improved concentrations of serum IgM after receiving 1 log fewer, 2.5 ⫻ 105, congenic bone marrow cells suggests that additional factors contribute to the graft resistance in the ␮MT mice on the C57BL/6 background. The experiments were designed to allow us to determine the most subtle indicators of improved immune function in mice that were not completely reconstituted, for example, the ␮MT mice that received a reduced number of bone marrow cells. In all of the transplanted ␮MT mice, total serum IgG was more likely to fall into the normal range than serum IgM, which in turn was more easily corrected than serum IgG3. As in the xid mice, production of normal antibody to NP-Ficoll in the transplanted ␮MT mice was a relatively stringent test of immune reconstitution. Past stud-

ies that have evaluated Btk-deficient mice crossed with mice bearing a Btk transgene [27] and Btk-deficient mice treated with a retroviral vector-mediated Btk gene therapy [28] have also shown poor antibody response to NP or TNPFicoll. Care must be taken when trying to extrapolate these results to transplantation of patients with XLA. Our results show that even two different strains of mice can vary significantly in their response to transplantation. However, the results do shed light on the question of whether myelotoxic drugs are needed to make “space” in the marrow of the immunodeficient subject. Our findings demonstrate that B cell engraftment can occur in the absence of treatment that could make this kind of “space.” The results further suggest that it may be possible to improve immune function in patients with XLA with minimally toxic transplant regimens.

Acknowledgments These studies were supported in part by Grant AI25129 from the National Institute of Health, National Cancer Institute Grant P30 CA21765, the Assisi Foundation, American Lebanese Syrian Associated Charities, and by funds from the Federal Express Chair of Excellence. We thank Judy Rush for secretarial assistance and Elizabeth Boylin for technical assistance.

References [1] M.E. Conley, Genetics of primary immunodeficiency diseases, Rev. Immunogenet. 2 (2000) 231–242. [2] A. Fischer, Primary immunodeficiency diseases: an experimental model for molecular medicine, Lancet 357 (2001) 1863–1869. [3] S. Tsukada, D.C. Saffran, D.J. Rawlings, O. Parolini, R.C. Allen, I. Klisak, R.S. Sparkes, H. Kubagawa, T. Mohandas, S. Quan, J.W. Belmont, M.D. Cooper, M.E. Conley, O.N. Witte, Deficient expression of a B cell cytoplasmic tyrosine kinase in human X-linked agammaglobulinemia, Cell 72 (1993) 279 –290. [4] D. Vetrie, I. Vorechovsky, P. Sideras, J. Holland, A. Davies, F. Flinter, L. Hammarstrom, C. Kinnon, R. Levinsky, M. Bobrow, C.I.E. Smith, D.R. Bentley, The gene involved in X-linked agammaglobulinemia is a member of the src family of protein-tyrosine kinases, Nature 361 (1993) 226 –233. [5] J.D. Thomas, P. Sideras, C.I.E. Smith, I. Vorechovsky, V. Chapman, W.E. Paul, Colocalization of X-linked agammaglobulinemia and Xlinked immunodeficiency genes, Science 261 (1993) 355–361. [6] D.J. Rawlings, D.C. Saffran, S. Tsukada, D.A. Largaespada, J.C. Grimaldi, L. Cohen, R.N. Mohr, J.F. Bazan, M. Howard, N.G. Copeland, N.A. Jenkins, O.N. Witte, Mutation of unique region of Bruton’s tyrosine kinase in immunodeficient XID mice, Science 261 (1993) 358 –361. [7] D.J. Rawlings, Bruton’s tyrosine kinase controls a sustained calcium signal essential for B lineage development and function, Clin. Immunol. 91 (1999) 243–253. [8] M.E. Conley, B cells in patients with X-linked agammaglobulinemia, J. Immunol. 134 (1985) 3070 –3074. [9] H.M. Lederman, J.A. Winkelstein, X-linked agammaglobulinemia: an analysis of 96 patients, Medicine 64 (1985) 145–156.

A.S. Porpiglia et al. / Clinical Immunology 107 (2003) 90 –97 [10] M.E. Conley, J. Rohrer, Y. Minegishi, X-linked agammaglobulinemia, Clin. Rev. Allergy Immunol. 19 (2000) 183–204. [11] R.M. Perlmutter, M. Nahm, K.E. Stein, J. Slack, I. Zitron, W.E. Paul, J.M. Davie, Immunoglobulin subclass-specific immunodeficiency in mice with an X- linked B-lymphocyte defect, J. Exp. Med. 149 (1979) 993–998. [12] L.S. Wicker, I. Scher, X-linked immune deficiency (xid) of CBA/N mice, Curr. Top. Microbiol. Immunol. 124 (1986) 87–101. [13] M.E. Conley, P. Brown, A.R. Pickard, R.H. Buckley, D.S. Miller, W.H. Raskind, J.W. Singer, P.J. Fialkow, Expression of the gene defect in X-linked agammaglobulinemia, N. Engl. J. Med. 315 (1986) 564 –567. [14] E.R. Fearon, J.A. Winkelstein, C.I. Civin, D.M. Pardoll, B. Vogelstein, Carrier detection in X-linked agammaglobulinemia by analysis of X-chromosome inactivation, N. Eng. J. Med. 316 (1987) 427– 431. [15] M.H. Nahm, J.W. Paslay, J.M. Davie, Unbalanced X chromosome mosaicism in B cells of mice with X-linked immunodeficiency, J. Exp. Med. 158 (1983) 920 –931. [16] L.M. Forrester, J.D. Ansell, H.S. Micklem, Development of B lymphocytes in mice heterozygous for the X-linked immunodeficiency (xid) mutation: Xid inhibits development of all splenic and lymph node B cells at a stage subsequent to their initial formation in bone marrow, J. Exp. Med. 165 (1987) 949 –958. [17] J. Rohrer, M.E. Conley, Correction of X-linked immunodeficient mice by competitive reconstitution with limiting numbers of normal bone marrow cells, Blood 94 (1999) 3358 –3365. [18] D. Kitamura, J. Roes, R. Kuhn, K. Rajewsky, A B cell-deficient mouse by targeted disruption of the membrane exon of the immunoglobulin mu chain gene, Nature 350 (1991) 423– 426. [19] R.F. Storb, R. Champlin, S.R. Riddell, M. Murata, S. Bryant, E.H. Warren, Non-myeloablative transplants for malignant disease, Hematology (Am Soc. Hematol. Educ. Program) 91 (2001) 375–391. [20] N.J. Chao, C.X. Liu, B. Rooney, B.J. Chen, G.D. Long, J.J. Vredenburgh, A. Morris, C. Gasparetto, D.A. Rizzieri, Nonmyeloablative

[21]

[22]

[23]

[24]

[25]

[26]

[27]

[28]

97

regimen preserves “niches”allowing for peripheral expansion of donor T-cells, Biol. Blood Marrow Transplant. 8 (2002) 249 –256. H.B. Gaspar, P. Amrolia, A. Hassan, D. Webb, A. Jones, N. Sturt, G. Vergani, A. Pagliuca, G. Mufti, N. Hadzic, G. Davies, P. Veys, Non-myeloablative stem cell transplantation for congenital immunodeficiencies, Recent Results Cancer Res. 159 (2002) 134 –142. H. Xu, B.G. Exner, D.E. Cramer, M.K. Tanner, Y.M. Mueller, S.T. Ildstad, CD8(⫹), alphabeta-TCR(⫹), and gammadelta-TCR(⫹) cells in the recipient hematopoietic environment mediate resistance to engraftment of allogeneic donor bone marrow, J. Immunol. 168 (2002) 1636 –1643. P.G. Schlegel, M. Eyrich, P. Bader, R. Handgretinger, P. Lang, D. Niethammer, T. Klingebiel, OKT-3-based reconditioning regimen for early graft failure in HLA-non-identical stem cell transplants, Br. J. Haematol. 111 (2000) 668 – 673. S. D’Costa, J.L. Hurwitz, Antibody and pre- plus post-transplant prednisone treatments support T cell-depleted stem cell engraftment without drug-induced morbidity, Bone Marrow Transplant. 29 (2002) 553–556. N. Baumgarth, G.C. Jager, O.C. Herman, L.A. Herzenberg, CD4⫹ T cells derived from B cell-deficient mice inhibit the establishment of peripheral B cell pools, Proc. Natl. Acad. Sci. USA 97 (2000) 4766 – 4771. C.E. Muller-Sieburg, R. Riblet, Genetic control of the frequency of hematopoietic stem cells in mice: mapping of a candidate locus to chromosome 1, J. Exp. Med. 183 (1996) 1141–1150. A.B. Satterthwaite, H. Cheroutre, W.N. Khan, P. Sideras, O.N. Witte, Btk dosage determines sensitivity to B cell antigen receptor crosslinking, Proc. Natl. Acad. Sci. USA 94 (1997) 13152–13157. M.E. Conley, J. Rohrer, L. Rapalus, E.C. Boylin, Y. Minegishi, Defects in early B-cell development: comparing the consequences of abnormalities in pre-BCR signaling in the human and the mouse, Immunol. Rev. 178 (2000) 75–90.