Recovery of Vibrio harveyi from scale drop and muscle necrosis disease in farmed barramundi, Lates calcarifer in Vietnam

Aquaculture 473 (2017) 89–96

Contents lists available at ScienceDirect

Aquaculture journal homepage: www.elsevier.com/locate/aquaculture

Recovery of Vibrio harveyi from scale drop and muscle necrosis disease in farmed barramundi, Lates calcarifer in Vietnam H T Dong a,⁎, S Taengphu b, P Sangsuriya c,d, W Charoensapsri b,d, K Phiwsaiya b,d, T Sornwatana e, P Khunrae a, T Rattanarojpong a, S Senapin b,d,⁎ a

Department Microbiology, Faculty of Science, King Mongkut's University of Technology Thonburi (KMUTT), Bangkok 10140, Thailand Center of Excellence for Shrimp Molecular Biology and Biotechnology (Centex Shrimp), Faculty of Science, Mahidol University, 272 Rama VI Road, Bangkok 10400, Thailand Aquatic Molecular Genetics and Biotechnology Laboratory, National Science and Technology Development Agency, Pathumthani 12120, Thailand d National Center for Genetic Engineering and Biotechnology (BIOTEC), National Science and Technology Development Agency, Pathumthani 12120, Thailand e Department of Biochemistry, Faculty of Science, Mahidol University, 272 Rama VI Road, Bangkok 10400, Thailand b c

a r t i c l e

i n f o

Article history: Received 6 November 2016 Received in revised form 1 February 2017 Accepted 2 February 2017 Available online 5 February 2017 Keywords: Barramundi Scale drop Muscle necrosis Vibrio harveyi Unculturable bacteria

a b s t r a c t Symptoms of scale drop and muscle necrosis have been considered as an emerging problem in farmed barramundi (Lates calcarifer) in Vietnam since 2013. Naturally diseased fish exhibited remarkable external clinical signs of scale loss, muscle degradation and eventually died. The objective of this study was to determine the infectious causative agent of the clinically diseased fish collected from barramundi caged culture in central Vietnam in 2015. Histological examination from naturally sick fish revealed signs of severe necrotic muscles with infiltration of massive immune-related cells, severe hemorrhage and blood congestion in the brain, collapsed kidney tubules and epithelial cells sloughing into the lumen. Five different bacterial species were recovered from diseased fish and putatively identified as Vibrio harveyi, Vibrio tubiashii, Tenacibaculum litopenaei, Tenacibaculum sp. and Cytophaga sp. based on homology of 16S rDNA sequences and biochemical characteristics. Experimental infection revealed that only V. harveyi killed the fish with similar clinical signs and histological changes compared to naturally diseased fish. Additionally, several unculturable bacteria including T. maritimum were also uncovered from DNA extracted from necrotic muscles by species-specific PCR and 16S rDNA clone library sequencing, but their roles in disease manifestation need further investigation. © 2017 Elsevier B.V. All rights reserved.

1. Introduction Barramundi (Lates calcarifer), also known as Asian sea bass, is one of the most important marine aquaculture finfish in Australia and Asian countries including Indonesia, Singapore, Thailand and Vietnam (FAO, 2006–2016). Significant economic damage has been reported in farmed barramundi due to infectious pathogens such as betanodavirus (Azad et al., 2005; Ransangan and Manin, 2010), Iridovirus (Moody and Owens, 1994), Streptococcus iniae (Bromage et al., 1999; Kayansamruaj et al., 2015), Vibrio alginolyticus (Sharma et al., 2012), Vibrio harveyi (Ransangan and Mustafa, 2009; Ransangan et al., 2012) and Photobacterium damselae subsp. damselae (Kanchanopas-Barnette et al., 2009). Gibson-Kueh et al. (2012) described an emerging disease in Asian barramundi exhibiting loss of scales and referred to as “scale

⁎ Corresponding authors. E-mail addresses: [email protected] (H.T. Dong), [email protected] (S. Senapin).

http://dx.doi.org/10.1016/j.aquaculture.2017.02.005 0044-8486/© 2017 Elsevier B.V. All rights reserved.

drop syndrome, SDS”. Later study indicated that a novel Megalocytivirus is the causative agent of scale drop disease (SDD) (de Groof et al., 2015). The authors, however, inferred that the disease previously occurred in barramundi in Malaysia and Singapore was believed to be caused by Tenacibaculum maritimum (de Groof et al., 2015; Gibson-Kueh et al., 2012). In Vietnam, outbreaks in commercial barramundi farms exhibiting similar clinical signs have periodically occurred since 2013 but the causative agents are unknown. Disease outbreaks appeared to occur in all fish sizes after stocking in open-net cages but were more frequently found in smaller fish (b 200 g) with cumulative mortality up to 40%. Diseased fish exhibited remarkable external clinical signs of losing scales and severe muscle necrosis. Fin rot was also observed in the diseased fish. According to a farm manager, current therapeutic application using antibiotics could control the disease outbreak, suggesting possible involvement of bacterial agent(s). In this study, we reported several bacterial species associated with diseased fish and identified a pathogenic V. harveyi as a causative bacterium of “Scale Drop and Muscle Necrosis disease (SDMND)” in farmed barramundi in Vietnam.

90

H.T. Dong et al. / Aquaculture 473 (2017) 89–96

2. Materials and methods 2.1. Diseased fish Twelve diseased juvenile and sub-adult barramundi (body length 11–45 cm), which exhibited severe scale drop and necrotic muscle symptoms (Fig. 1), were collected from three different cages (3–5 specimen each) in an intensively cultured barramundi farm in Vietnam during disease outbreak in April 2015. Moribund fish lost their appetite and appeared on water surface prior to death. The fish were then subjected to tissue collection and bacterial isolation and species identification. Fish tissues (muscle, kidney, liver and brain) were preserved in absolute alcohol for PCR assays and in 10% buffer formalin for histological analysis. 2.2. Rapid microscopic examination, bacterial isolation and phenotypic test The fish body surface was disinfected with 70% alcohol and aseptically necropsied. Muscle collected from necrotic lesions of individual fish was smeared on glass slides, air-dried and stained by the Gram staining method prior to examination under light microscope. In parallel, bacterial isolation was performed from necrotic muscle lesions and internal organs including liver, kidney, spleen and brain. Three different media including Anacker & Ordal's Agar (AOA) prepared using filtration-steriled marine water, thiosulfate citrate bile salts sucrose agar (TCBS), and marine agar (MA) were used for bacterial isolation in this study. Incubated plates at 30 °C were examined daily for 5 days and representative colonies were subcultured for further analysis. Bacterial morphology of pure isolates was examined under light microscope

followed by conventional Gram staining. Five selected bacterial isolates, which later used for challenge assay (Supplemental Table 1), were subjected for phenotypic tests using API 20E kit (BioMérieux) according to manufacture’ instructions. Biochemical characteristics of these isolates were compared with reference/type strains described in a practical identification manual by Buller (2014). 2.3. DNA preparation from fish tissue and pure bacterial isolates Genomic DNA of the bacterial isolates, which were recovered from diseased barramundi, was prepared by the boiling extraction method as previously described (Dong et al., 2015a). In brief, single colonies of each pure isolate were suspended in a small amount of ultrapure water (300 μL), boiled for 5 min and rapidly cooled down on cold-ice for 5 min. After centrifugation, supernatant containing DNA was collected and kept at −20 °C until used. DNA from fish muscle or internal organs (liver, kidney, spleen) was extracted separately using a standard phenol-chloroform extraction method. DNA concentration and quality were measured by spectrophotometric analysis at 260 and 280 nm. 2.4. 16S rDNA sequence analysis of culturable bacteria Two sets of universal primers were used for amplification of 16S rDNA of 15 culturable bacterial isolates in this study. Primers 20F/ R1438 (Darwish and Ismaiel, 2005) usually used for Flavobacteriaceae family were employed for 4 long rod-shaped, Gram negative bacterial isolates (SDMN-T1 to SDMN-T4) whereas primers Uni-bact-F/R (Weisburg et al., 1991) were used for the 11 remaining isolates. PCR

Fig. 1. Severe scale drop and muscle necrosis (SDMN) observed in naturally diseased fish (A–C). Juveniles barramundi exposed to V. harveyi SDMN-Y6 by intramuscular injection exhibited similar clinical signs (D–G) with naturally diseased fish. Experimental fish in early infection exhibited scale stand-up and slight muscle necrosis (D, E) and the lesion progressed to massive scale losing (F) and severe necrotic muscle (G).

H.T. Dong et al. / Aquaculture 473 (2017) 89–96

amplicons yielded from each isolate were purified using a Favogen Gel/ PCR Purification Kit (Taiwan) and cloned into pPrime cloning vector (5PRIME). Recombinant clones were subjected to DNA sequencing using vector primers i.e. T7 promoter and SP6 promoter primers. DNA homology search of the obtained sequences with published sequences in the GenBank database was performed using BLAST search (NCBI). Following multiple alignments of 16S rDNA sequences (~ 1.45 kb) with their closed taxa by Clustal W method, a neighbor-joining phylogenetic tree was constructed using MEGA version 6 with bootstraps of 1000 replicates. 2.5. 16S rDNA sequence analysis of unculturable bacteria

91

sterile 0.85% NaCl. Cells were adjusted to OD600 of 0.8 (~ 108 CFU mL− 1). The bacterial strains Cytophaga sp. SDMN-T3, Tenacibaculum sp. SDMN-T2, and T. litopenaei SDMN-T4 were recovered on MA plates and incubated at 30 °C for 36 h. Bacterial cells were directly scraped from the MA plates and resuspended with sterile 0.85% NaCl prior to being adjusted to an OD600 of 0.8 (~108 CFU mL−1). Fish from each treatment group were intramuscularly injected with 0.1 mL of prepared bacterial suspension (Table 3). The bacterial densities were retrospectively known by conventional plate count and are presented in Table 3. Fish in the control group were treated in the same manner with sterile 0.85% NaCl. Mortality of experimental fish was monitored for 15 days. Freshly dead and moribund fish from treatment groups were subjected for bacterial isolation and histological analysis.

To enhance possibility of identification of bacteria present in the necrotic fish muscle, DNA of diseased fish from the same cage were pooled into 3 sets, designating as UNM1-UNM3, and subjected to amplification of 16S rDNA using the universal primers 20F/R1438 (Darwish and Ismaiel, 2005) specific for Flavobacteriaceae family. Amplified products obtained from each pooled samples were purified and cloned as described above. Recombinant clones were double-digested with AflIII and HindIII restriction enzymes to investigate digested band patterns using agarose gel electrophoresis. Representative clones were then selected for DNA sequence and phylogenetic analysis as mentioned above.

Representative tissue samples of the liver, kidney, spleen, brain and muscle from non-challenged fish and naturally and experimentally moribund fish were fixed with 10% buffer formalin for 24 h. Specimens were then transferred to 70% ethanol prior to paraffin embedding and sectioning, followed by staining with hematoxylin and eosin (H&E). The stained sections were observed under the Olympus BX51 digital light microscope (Japan).

2.6. Detection of Tenacibaculum maritimum by species-specific PCR assay

3. Results

DNA extracted from necrotic muscles of individual fish (n = 12) were also used as a template for T. maritimum-specific PCR diagnosis. Sequences of specific primer pair MAR1–MAR2 targeting 16S rDNA of T. maritimum (Toyama et al., 1996) are listed in Table 1. PCR mixtures consisted of 12.5 μL of Master Mix (Go-Taq®Green, Promega), 0.4 μM of each primer, 100 ng DNA temples and nuclease-free water in a final volume of 25 μL. Conditions for PCR amplification was performed according to a published paper Toyama et al. (1996). Expected amplicons (1.1 kb) from 2 representative fish samples were randomly chosen for cloning and sequencing to verify the sequences and confirm accuracy of PCR amplification.

3.1. Vibrio harveyi is dominant among culturable bacteria from diseased fish

2.7. Experimental challenge Apparently normal barramundi fingerlings (21 ± 4 g body weight) used for the experimental challenge were purchased from a commercial hatchery in Thailand. Fish were acclimatized in aerated seawater (30 ppt) at ~ 27 °C and fed with commercial feed twice daily for 2 weeks. Prior to the challenge test, fish were distributed into eight treatment and one control groups with 8–10 fish each (Table 3). Representatives of the five identified bacterial species obtained from the diseased fish were randomly selected and used in the experimental challenge. This included V. harveyi, V. tubiashii, Cytophaga sp., Tenacibaculum sp., and T. litopenaei. For bacterial preparation, a single colony of V. harveyi SDMN-Y6 and V. tubiashii SDMN-G4 was individually cultured in 5 mL of tryptic soy broth (TSB) medium supplemented with 1.5% NaCl, incubated at 30 °C with agitation for 3–4 h. After centrifugation, the bacterial cell pellet was collected and washed once with

2.8. Histological analysis

A total of 15 bacterial isolates were chosen from three different plates streaked with several fish tissues in this study (Supplemental Table 1). Yellow colonies grown on TCBS plates appeared to be dominant among all of the recovered bacteria. Subsequently, 7 representative yellow colonies, designated SDMN-Y1 to SDMN-Y7, were selected. Additionally, 4 isolates that formed green colonies on TCBS plates (namely SDMN-G1 to SDMN-G4) were also included for further study. Four putative Tenacibaculum isolates (SDMN-T1 to SDMN-T4) in which 2 isolates each obtained from AOA and MA plates were also chosen for bacterial identification. SDMN-T1 to SDMN-T4 were long rod-shaped, Gram negative yellow-pigmented bacteria on AOA and MA plates. Bacterial species identification was performed by amplifying and sequencing of their 1.5 kb fragment of 16S rDNA. Sequence analysis revealed that the amplified products obtained from SDMN-Y1 to SDMNY7 showed the highest similarity (99.3–100%) to the reference strain of Vibrio harveyi ATCC 33843 (GenBank accession no. CP009467) and were putatively identified as V. harveyi. Four isolates SDMN-G1 to SDMN-G4 were putatively identified as Vibrio tubiashii based on 99.0% identity to Vibrio tubiashii ATCC 19109 (GenBank accession no. CP009354). Isolate SDMN-T4 was identified as Tenacibaculum litopenaei based on 99.8% similarity to the type strain T. litopenaei B-I (GenBank accession no. NR043967) while two isolates SDMN-T1 and SDMN-T2 exhibited the highest similarity with only 96.6 and 96.9% identity, respectively to T. litopenaei B-I and thus were putatively identified as Tenacibaculum sp. Isolate SDMN-T3 was putatively identified as

Table 1 Primers used in this study. Organism

Gene

Primer names/sequences (5′to 3′)

Product size (bp)

References

Common bacteria

16S rRNA

1500

Weisburg et al. (1991)

Flavobacteriaceae

16S rRNA

1450

Darwish and Ismaiel (2005)

T. maritimum

16S rRNA

1078

Toyama et al. (1996)

V. harveyi

toxR

Uni-Bact-F/AGAGTTTGATCMTGGCTCAG Uni-Bact-R/ACGGHTACCTTGTTACGACTT 20F/AGAGTTTGATC(AC)TGGCTCAG R1438/GCCCTAGTTACCAGTTTTAC MAR1/AATGGCATCGTTTTAAA MAR2/CGCTCTCTGTTGCCAGA toxRF1/GAAGCAGCACTCACCGAT toxRR1/GGTGAAGACTCATCAGCA

382

Pang et al. (2006)

92

H.T. Dong et al. / Aquaculture 473 (2017) 89–96

Cytophaga sp. based on 99.9% nucleotide homology with the isolates Cytophaga sp. I-601 (GenBank accession no. AB073568.2). Phylogenetic tree based on 16S rDNA of all bacterial isolates in this study together with the type/reference strains and their closest taxa retrieved from the GenBank database confirmed species identification of all 15 bacterial isolates (Fig. 2). All 16S rDNA sequences of 15 culturable isolates have been deposited in the GenBank database (accession nos. KY003115KY003129). In addition, phenotypic characteristics of representatives of five bacterial species were presented in Table 2. In consistent with 16S-rDNA identification, the isolate SDMN-Y6 had biochemical profile resembling to V. harveyi ATCC 35084T while several phenotypic variations were found between the isolate SDMN-G4 and V. tubiashii LMG 10936T. Phenotypic characteristics of the three remaining isolates exhibited high similarity to bacteria in the genera Tenacibaculum and Cytophaga. 3.2. Presence of novel unculturable bacteria in the muscle of diseased fish Rapid Gram staining prepared from the muscle of naturally diseased fish revealed the presence of both short and long rod-shaped, Gram negative bacteria. In order to increase the likelihood of observing the bacterial population in the necrotic fish muscle, analysis of 16S rDNA clone library were performed. In addition, Tenacibaculum maritimumspecific PCR for a suspected pathogen of scale drop disease as previously reported (Gibson-Kueh et al., 2012), was also conducted. The result of specific PCR targeting 16S rDNA of T. maritimum in Fig. 3 showed that 8 out of 12 samples from 2 barramundi cages were T. maritimum positive. Amplified products of 1.1 kb from fish samples representative of each cage were randomly selected for cloning and sequencing.

Table 2 Phenotypic characteristics of representatives of five bacterial species used for challenge assay in this study. Characteristics

Bacterial isolates SDMN-Y6 SDMN-G4 SDMN-T2 SDMN-T3 SDMN-T4

Gram Bacterial morphology ONPG Arginine dihydrolase Lysine decarboxylase Ornithine decarboxylase Citrate utilization H2S production Urease TDA Indole production Voges-proskauer Gelatin Acid production

Negative Short, rod + − + +

Negative Short, rod − + − −

Negative Long, rod − − − −

Negative Long, rod + − − −

Negative Long, rod − − − −

+ +w − − + − +

+ − − − − − −

− − − − − − +

− − − − − + −

− − − − − − +

D-Glucose

+

+

−

+w

−

D-Mannitol

+

−

−

−

−

Inositol D-Sorbitol

+ +

− −

− −

− −

− −

L-Rhamnose

−

−

−

−

−

D-Sucrose

+

−

−

+w

−

D-Melibiose

−

−

−

+w

−

Amygdalin L-Arabinose

+ −

− −

− +w

− +w

− −

NO2 production

+

−

−

−

−

+, positive; +w, weak positive; −, negative.

Fig. 2. Neighbor-joining phylogenetic tree constructed based on 16S rDNA of 15 isolates (bold text) of culturable bacteria isolated from naturally diseased barramundi and their closely related species obtained from GenBank. Bootstrap values were 1000 replicates and percentage bootstrap values are shown at each branch point.

H.T. Dong et al. / Aquaculture 473 (2017) 89–96

93

Fig. 3. PCR detection of Tenacibaculum maritimum from DNA extracted from 12 individual diseased barramundi from 3 different cages in Vietnam. Expected product size of 1.1 kb is indicated and amplicons sent for sequence analysis are indicated by #. *, marks non-specific amplicons; M1, GeneRuler 100 bp Plus DNA Ladder (Thermo Scientific); N, no template control.

Sequence analysis revealed that there were 5 nucleotide differences between the two clones (namely clones M1 and M2 in Fig. 4). BLAST search results indicated 99.4–99.8% nucleotide homology with the sequences of T. maritimum IFO 15946 and NUF1128 (accession nos. AB078057 and AB979246) and both clones were well clustered into T. maritimum clade (Fig. 4). The obtained sequences were deposited to GenBank (accession nos. KY003147-KY003148). Additionally, construction of 16S rDNA clone library was conducted with pooled DNA, namely UNM1-UNM3 representing fish samples from three different cages. Amplified 1.5 kb products of 16S rDNA were successfully obtained from each pool (Fig. 5A). After cloning, recombinant clones containing inserted genes were subjected to restriction enzyme digestion to investigate the population of 16S rDNA sequences. Subsequently, 16 out of 26 clones (Fig. 5B) were subjected for DNA sequencing. BLAST results and phylogenetic analysis revealed that three clones

from pooled sample UNM1 (2, 7 and 9) and four from pooled samples UNM2 (4, 5, 18 and 23) form close but separate clades in which the latter set of clones was a sister group to the clade of Aureispira maritima 59SA (NR041537) and Saprospira sp. SS91-40 (AB058900) with ~ 97% sequence identity among sister groups (Fig. 4). In addition, four clones of sample UNM3 (1, 3, 23 and 30) were clustered together and all matched (96.7–99.5% identity) to uncultured bacteria of unknown species (GenBank accession nos. EF123557 and FJ202784). The findings suggested novel bacterial species found in the naturally diseased fish and the presence of a unique bacterial population in each cage (Fig. 4). Interestingly, the presence of T. maritimum was confirmed by the clone sequence numbers 3, 10, 13 and 14 obtained from 3 pooled samples (UNM1-UNM3) that showed the highest identity (≥ 99%) to T. maritimum sequences in the GenBank database (Fig. 4). Clone 4 from pooled sample UMN1 exhibited 99.5% identity to T. litopenaei B-I

Fig. 4. Phylogenetic analysis based on 16S rDNA of unculturable bacteria obtained from necrotic muscle of diseased barramundi and their closely related species retrieved from the GenBank database. Bold texts represent 16 sequences from clone library and 2 amplified amplicons obtained by T. maritimum specific PCR. Bootstrap values were 1000 replicates and percentage bootstrap values are shown at each branch point.

94

H.T. Dong et al. / Aquaculture 473 (2017) 89–96

Fig. 5. PCR amplification using universal primers 20F/R1438 yielded a ~1.5 kb amplicon from three pooled DNA samples representing fish from 3 cages (A). After cloning, recombinant plasmids were double-digested with AflIII and HindIII restriction enzymes and 16 representative digested clones out of 26 are shown (B). M1, GeneRuler 100 bp Plus DNA Ladder (Thermo Scientific); M2, 2-logg ladder (New England Biolabs).

(NR043967) and Flexibacter echinicida F2 (AY006466) (Fig. 4). All nucleotide sequences of unculturable bacteria have been deposited in GenBank under accession numbers KY003131- KY003146. 3.3. Vibrio harveyi caused scale drop and muscle necrosis in laboratory challenge Among 5 bacterial species subjected to in vivo challenge tests, only V. harveyi was able to kill fish. Three different doses of V. harveyi SDMN-Y6 were used in this study. Fish received a high dose (2.53 × 107 CFUs fish−1) died 100% within 24 h with unclear clinical signs, while a lower dose (2.53 × 105 and 1.0 × 105 CFUs fish−1) caused 80 and 50% cumulative mortality, respectively (Table 3) with clear disease progression. Experimental fish exhibited “stand-up” scales near to the injection side in early infection (Fig. 1D). The small lesion spread and scales started to fall, known as so-called “scale drop” (Fig. 1E, F). Severe muscle necrosis and massive mortality were observed from day 3 post infection (Fig. 1G). Representative bacterial isolates (n = 14) recovered from muscle and internal organs of experimentally diseased fish were confirmed as V. harveyi based on species specific PCR as previously described by Pang et al. (2006) (data not shown). No dead fish were observed in other bacterial administrated groups, despite the high challenge doses used (Table 3). All fish in the control group survived until the end of the experiment at day 15. 3.4. A novel histological change of naturally and experimentally diseased fish Muscle and internal organs of both naturally and experimentally diseased fish were observed histologically by H&E staining. The results shown in Fig. 6 indicated that clinically sick fish collected from an affected farm and the fish infected with V. harveyi SDMN-Y6, exhibited similar histological changes. Severe necrotic muscle with infiltration of massive immune-related cells was observed (Fig. 6A, B). The novel histological changes were notably seen in the kidney with collapsed tubules and epithelial cells sloughing into the lumen (Fig. 6C, D). The liver of infected

fish showed blood congestion and hemorrhage (picture not shown). Hemorrhage and blood congestion were observed in the brain of fish from both natural and experimental infection but were more pronounced in the naturally diseased fish (Fig. 6E, F). No abnormal histological change was observed in the control fish. Note that hypertrophied cells, the typical histological change of megalocytivirus infection, were not observed in the internal organs of naturally diseased fish. 4. Discussion This study described scale drop and muscle necrosis disease (SDMND) in farmed barramundi in Vietnam and proved to be caused by a pathogenic V. harveyi strain that was isolated from the outbreak case. The disease was different from “scale drop syndrome” (SDS) (Gibson-Kueh et al., 2012), later known as scale drop disease (SDD) caused by a novel Megalocytivirus (de Groof et al., 2015) by having external muscle necrotic lesions accompanied with scale loss. Additionally, histological manifestation of two mentioned diseases can be differentiated by the presence of hypertrophied infected cells and basophilic cytoplasmic inclusion bodies in the spleen, kidney, liver and heart in SDD fish (de Groof et al., 2015; Gibson-Kueh et al., 2012) while changes found in SDMND barramundi were necrotic muscle with infiltration of massive immune-related cells, hemorrhage and blood congestion in the brain, collapsed kidney tubules and epithelial cells sloughing as evidenced in the present study. Vibrio harveyi (synonyms Vibrio carchariae or Vibrio trachuri) is a common bacterial pathogen affecting various marine aquaculture species both vertebrates and invertebrates (Austin and Zhang, 2006; Noga, 2010). Previous studies also reported infection of V. harveyi in farmed barramundi in the Philippines and Malaysia (Ransangan and Mustafa, 2009; Tendencia, 2002) and virulence of V. harveyi in barramundi appeared to be strain-dependent (Ransangan et al., 2012). To our best knowledge, external symptoms of “scale-drop” and unique histological change in the kidney of diseased fish (collapsed kidney tubules and epithelial cells sloughing) have never been described in fish

Table 3 Detail of experimental challenge assays by intramuscular injection. Treatment group

Number of fish

Bacteria administered

Challenge dose (CFU fish−1)

% cumulative mortality at day 15 post challenge

1 2 3 4 5 6 7 8 9

10 10 8 10 10 10 10 10 10

V. harveyi SDMN-Y6

2.53 × 107 2.53 × 105 1.0 × 105 ~107 ~105 1.26 × 107 2.08 × 107 6.10 × 108 –

100 80 50 0 0

CFUs, colony forming units.

V. tubiashii SDMN-G4 Tenacibaculum litopenaei SDMN-T4 Tenacibaculum sp. SDMN-T2 Cytophaga sp. SDMN-T3 0.85% NaCl (control)

0 0 0

H.T. Dong et al. / Aquaculture 473 (2017) 89–96

95

Fig. 6. Similar histological changes of naturally diseased fish and experimentally sick fish after artificial infection with V. harveyi by intramuscular injection. The muscle exhibited severe necrosis with infiltration of massive immune-related cells (A, B). The kidney tubules collapsed (c) and sloughing (s) of epithelial cells into the lumen were observed (C, D). The brain showed severe blood congestion (E, F), square boxes indicated hemorrhagic brain observed by naked eyes.

infected with Vibrio or other bacterial pathogens. Interestingly, this histopathology is similar to those reported in hepatopancreas of white shrimp (Penaeus vannamei) with emerging acute hepatopancreatic necrosis disease (AHPND) that was caused by a unique strain of V. parahaemolyticus. This strain becomes highly virulent by acquiring a virulent plasmid that expresses binary Pir-like toxins responsible for the collapse and pathognomonic massive sloughing of hepatopancreatic tubule epithelial cells (Joshi et al., 2014; Lee et al., 2015; Sirikharin et al., 2015). Further investigation is needed to examine whether the identified V. harveyi in this study harbors such a unique plasmid or contains any virulent genes that produce deadly toxins required for SDMND pathogenesis in barramundi. The majority of fish disease studies have focused on only single infection while the presence of other pathogens that might also be associated with disease outbreaks were probably overlooked. Recent studies addressed occurrence of dual or multiple bacterial infections in farmed tilapia and striped catfish (Assis et al., 2016; Dong et al., 2015a, 2015b). Similarly, barramundi has also been farmed in open-net floating cages which are also likely to be exposed to multiple pathogens rather than a single one. The findings in this study have further indicated concurrent infections of various culturable and unculturable bacteria associated with SDMND in barramundi. However, only V. harveyi could induce

disease in in vivo experiments while four remaining culturable bacteria species (V. tubiashii, T. litopenaei, Tenacibaculum sp. and Cytophaga sp.) failed to induce disease in experimental infection despite the high challenge doses used. This suggests that the non-pathogenic bacteria were likely to serve as opportunistic pathogens which may co-interact with V. harveyi or others to increase severity of the disease. Further study is required to clarify whether artificial co-infections of sub-lethal doses of V. harveyi with the non-pathogenic bacteria will cause a synergistic effect for disease manifestation. Additionally, the presence of other bacteria from necrotic muscle tissues was revealed by amplification and analysis of 16S rDNA sequences but their pathogenicity remains undetermined due to the limitation of ‘unculturability’. Both species-specific PCR and sequencing of the 16S rDNA clone library indicated the presence of T. maritimum in the muscle of naturally diseased fish from all 3 cages. With individual fish tested for T. maritimum-specific PCR, no positive specimen was found from cage 3. However, when pooled DNA sample was amplified using bacterial universal primers followed by cloning and sequencing, the presence of T. maritimum (clone 13) was revealed. This could suggests that the amplification efficiency of the universal primers was better that that of T. maritimum-specific primers in the assayed conditions. The bacterium T. maritimum has been previously reported to cause fin rot and muscle

96

H.T. Dong et al. / Aquaculture 473 (2017) 89–96

necrosis in various marine fish and results in similar histological changes in the muscle compared to barramundi infected with V. harveyi in this study (Avendano-Herrera et al., 2006; Failde et al., 2013). However, no report indicated that T. maritimum alone caused the same histopathology in the internal organs described in our current work. This might suggest that T. maritimum co-infection may contribute to the severity of external symptoms of clinically sick fish. It is not known if other bacteria found in this study contributed to the disease manifestation in fish. T. litopenaei was previously isolated from the water of a shrimp pond while V. tubiashii was reported as a pathogen of mollusks but no evidence showed their virulence to fish (Elston et al., 2008; Sheu et al., 2007). Other batches of unculturable bacteria could not be identified into species levels but their closest taxa have not been reported to be associated with fish diseases. For example, Aureispira spp. and Saprospira sp. were found in marine environment (Furusawa et al., 2003; Hosoya et al., 2007) and the set of uncultured bacteria that were phylogenetically close to the clones from sample UMN3 were associated with black band disease and white plague disease in corals (Sekar et al., 2008; Sunagawa et al., 2009). Note that some library clones exhibited different digested band patterns but belonged into the same species. This is probably might be due to the intragenomic variation of 16S rDNA genes in the bacterial genomes. In conclusion, this study reported an emergence of SDMND in farmed barramundi in Vietnam which exhibited unique histopathological changes in the kidney of the diseased fish. Coinfections of numerous culturable and unculturable bacteria were uncovered and in vivo infection assay of a pathogenic strain of V. harveyi mimicked major clinical signs and histological changes of naturally diseased fish. Other culturable bacteria alone did not cause disease in barramundi but may serve as opportunistic pathogens. The role of unculturable bacteria in disease manifestation needs further attempts on bacterial isolation and bioassay. Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.aquaculture.2017.02.005. Acknowledgements This work was supported by a research grant from Mahidol University. The authors would like to thank Panadda Meenium for technical assistance. HT Dong has been supported by a Postdoctoral research grant from King Mongkut's University of Technology Thonburi, Thailand. References Assis, G.B., Tavares, G.C., Pereira, F.L., Figueiredo, H.C., Leal, C.A., 2016. Natural coinfection by Streptococcus agalactiae and Francisella noatunensis subsp. orientalis in farmed Nile tilapia (Oreochromis niloticus L.). J. Fish Dis. http://dx.doi.org/10.1111/jfd.12493. Austin, B., Zhang, X.H., 2006. Vibrio harveyi: a significant pathogen of marine vertebrates and invertebrates. Lett. Appl. Microbiol. 43, 119–124. Avendano-Herrera, R., Toranzo, A.E., Magarinos, B., 2006. Tenacibaculosis infection in marine fish caused by Tenacibaculum maritimum: a review. Dis. Aquat. Org. 71, 255–266. Azad, I.S., Shekhar, M.S., Thirunavukkarasu, A.R., Poornima, M., Kailasam, M., Rajan, J.J., Ali, S.A., Abraham, M., Ravichandran, P., 2005. Nodavirus infection causes mortalities in hatchery produced larvae of Lates calcarifer: first report from India. Dis. Aquat. Org. 63, 113–118. Bromage, E.S., Thomas, A., Owens, L., 1999. Streptococcus iniae, a bacterial infection in barramundi Lates calcarifer. Dis. Aquat. Org. 36, 177–181. Buller, B.B., 2014. Bacteria and fungi from fish and other aquatic animals. A Practical Identification Manual, second ed. CABI Publishing. Darwish, A.M., Ismaiel, A.A., 2005. Genetic diversity of Flavobacterium columnare examined by restriction fragment length polymorphism RNA gene and the and sequencing of the 16S ribosomal 16S-23S rDNA spacer. Mol. Cell. Probes 19, 267–274. de Groof, A., Guelen, L., Deijs, M., van der Wal, Y., Miyata, M., Ng, K.S., van Grinsven, L., Simmelink, B., Biermann, Y., Grisez, L., van Lent, J., de Ronde, A., Chang, S.F., Schrier, C., van der Hoek, L., 2015. A novel virus causes scale drop disease in Lates calcarifer. PLoS Pathog. 11, e1005074. Dong, H.T., Nguyen, V.V., Phiwsaiya, K., Gangnonngiw, W., Withyachumnarnkul, B., Rodkhum, C., Senapin, S., 2015a. Concurrent infections of Flavobacterium columnare

and Edwardsiella ictaluri in striped catfish, Pangasianodon hypophthalmus in Thailand. Aquaculture 448, 142–150. Dong, H.T., Nguyen, V.V., Le, H.D., Sangsuriya, P., Jitrakorn, S., Saksmerprome, V., Senapin, S., Rodkhum, C., 2015b. Naturally concurrent infections of bacterial and viral pathogens in disease outbreaks in cultured Nile tilapia (Oreochromis niloticus) farms. Aquaculture 448, 427–435. Elston, R.A., Hasegawa, H., Humphrey, K.L., Polyak, I.K., Hase, C.C., 2008. Re-emergence of Vibrio tubiashii in bivalve shellfish aquaculture: severity, environmental drivers, geographic extent and management. Dis. Aquat. Org. 82, 119–134. Failde, L.D., Losada, A.P., Bermudez, R., Santos, Y., Quiroga, M.I., 2013. Tenacibaculum maritimum infection: pathology and immunohistochemistry in experimentally challenged turbot (Psetta maxima L.). Microb. Pathog. 65, 82–88. FAO, 2006–2016. In: Rimmer, M.A. (Ed.), Cultured Aquatic Species Information Programme, Lates calcarifer. FAO Fisheries and Aquaculture Department ([online]. Rome. Updated 3 June 2006. [Cited 16 August 2016]). http://www.fao.org/fishery/ culturedspecies/Lates_calcarifer/en. Furusawa, G., Yoshikawa, T., Yasuda, A., Sakata, T., 2003. Algicidal activity and gliding motility of Saprospira sp. SS98-5. Can. J. Microbiol. 49, 92–100. Gibson-Kueh, S., Chee, D., Chen, J., Wang, Y.H., Tay, S., Leong, L.N., Ng, M.L., Jones, J.B., Nicholls, P.K., Ferguson, H.W., 2012. The pathology of 'scale drop syndrome' in Asian seabass, Lates calcarifer Bloch, a first description. J. Fish Dis. 35, 19–27. Hosoya, S., Arunpairojana, V., Suwannachart, C., Kanjana-Opas, A., Yokota, A., 2007. Aureispira maritima sp. nov., isolated from marine barnacle debris. Int. J. Syst. Evol. Microbiol. 57, 1948–1951. Joshi, J., Srisala, J., Truong, V.H., Chen, I.T., Nuangsaeng, B., Suthienkul, O., Lo, C.F., Flegel, T.W., Sritunyalucksana, K., Thitamadee, S., 2014. Variation in Vibrio parahaemolyticus isolates from a single Thai shrimp farm experiencing an outbreak of acute hepatopancreatic necrosis disease (AHPND). Aquaculture 428, 297–302. Kanchanopas-Barnette, P., Labella, A., Alonso, C.M., Manchado, M., Castro, D., Borrego, J.J., 2009. The first isolation of Photobacterium damselae subsp. damselae from Asian seabass Lates calcarifer. Fish Pathol. 44, 47–50. Kayansamruaj, P., Dong, H.T., Nguyen, V.V., Le, H.D., Pirarat, N., Rodkhum, C., 2015. Susceptibility of freshwater rearing Asian seabass (Lates calcarifer) to pathogenic Streptococcus iniae. Aquac. Res. http://dx.doi.org/10.1111/are.12917. Lee, C.T., Chen, I.T., Yang, Y.T., Ko, T.P., Huang, Y.T., Huang, J.Y., Huang, M.F., Lin, S.J., Chen, C.Y., Lin, S.S., Lightner, D.V., Wang, H.C., Wang, A.H.J., Wang, H.C., Hor, L.I., Lo, C.F., 2015. The opportunistic marine pathogen Vibrio parahaemolyticus becomes virulent by acquiring a plasmid that expresses a deadly toxin. Proc. Natl. Acad. Sci. U. S. A. 112, 10798–10803. Moody, N.J.G., Owens, L., 1994. Experimental demonstration of the pathogenicity of a frog virus, bohle Iridovirus, for a fish species, barramundi Lates calcarifer. Dis. Aquat. Org. 18, 95–102. Noga, E.J., 2010. Fish Disease: Diagnosis and Treatment. second ed. Wiley-Blackwell. Pang, L., Zhang, X.H., Zhong, Y., Chen, J., Li, Y., Austin, B., 2006. Identification of Vibrio harveyi using PCR amplification of the toxR gene. Lett. Appl. Microbiol. 43, 249–255. Ransangan, J., Manin, B.O., 2010. Mass mortality of hatchery-produced larvae of Asian seabass, Lates calcarifer (Bloch), associated with viral nervous necrosis in Sabah, Malaysia. Vet. Microbiol. 145, 153–157. Ransangan, J., Mustafa, S., 2009. Identification of Vibrio harveyi isolated from diseased Asian seabass Lates calcarifer by use of 16S ribosomal DNA sequencing. J. Aquat. Anim. Health 21, 150–155. Ransangan, J., Lal, M.T., Al-Harbi, H.A., 2012. Characterization and experimental infection of Vibrio harveyi isolated from diseased Asian seabass (Lates calcarifer). Malays. J. Microbiol. 8, 104–115. Sekar, R., Kaczmarsky, L.T., Richardson, L.L., 2008. Microbial community composition of black band disease on the coral host Siderastrea siderea from three regions of the wider Caribbean. Mar. Ecol. Prog. Ser. 362, 85–98. Sharma, S.R.K., Rathore, G., Verma, D.K., Sadhu, N., Philipose, K.K., 2012. Vibrio alginolyticus infection in Asian seabass (Lates calcarifer, Bloch) reared in open sea floating cages in India. Aquac. Res. 44, 86–92. Sheu, S.Y., Lin, K.Y., Chou, J.H., Chang, P.S., Arun, A.B., Young, C.C., Chen, W.M., 2007. Tenacibaculum litopenaei sp. nov., isolated from a shrimp mariculture pond. Int. J. Syst. Evol. Microbiol. 57, 1148–1153. Sirikharin, R., Taengchaiyaphum, S., Sanguanrut, P., Chi, T.D., Mavichak, R., Proespraiwong, P., Nuangsaeng, B., Thitamadee, S., Flegel, T.W., Sritunyalucksana, K., 2015. Characterization and PCR detection of binary, Pir-like toxins from Vibrio parahaemolyticus isolates that cause acute hepatopancreatic necrosis disease (AHPND) in shrimp. PLoS One 10. Sunagawa, S., DeSantis, T.Z., Piceno, Y.M., Brodie, E.L., DeSalvo, M.K., Voolstra, C.R., Weil, E., Andersen, G.L., Medina, M., 2009. Bacterial diversity and white plague disease-associated community changes in the Caribbean coral Montastraea faveolata. ISME J. 3, 512–521. Tendencia, E.A., 2002. Vibrio harveyi isolated from cage-cultured seabass Lates calcarifer Bloch in the Philippines. Aquac. Res. 33, 455–458. Toyama, T., Kita-Tsukamoto, K., Wakabayashi, H., 1996. Identification of Flexibacter maritimus, Flavobacterium branchiophilum and Cytophaga columnaris by PCR targeted 16S ribosomal DNA. Fish Pathol. 31, 25–31. Weisburg, W.G., Barns, S.M., Pelletier, D.A., Lane, D.J., 1991. 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 173, 697–703.