- Email: [email protected]
Redox Control of Cell Cycle-Coupled Topoisomerase IIα Gene Expression
448
[381
NUCLEIC ACIDS AND GENES
Acknowledgments We acknowledge Dr. Scott Provost (Stratagene) for teaching K.F. the)~LIZ assay and providing ~,LIZ transgenic B6 mice for backcrossing. We are grateful to Drs. Martijn Doll6 and Jan Vijg (Cancer Therapy and Research Center, University of Texas Health Science Center at San Antonio) for training L.R. in the pUR288 assay and providing the pUR288 transgenic B6 mice for backcrossing. We are equally grateful to Dr. Michael Boerrigter (Leven) for sharing his expertise on the pUR288 assay and many fruitful scientific discussions. We are indebted to Drs. Sharon Jackson and Steven Holland (NIAID, NIH) for the kind gift of p47 ph°x knockout mice. We thank our long-term collaborators, Drs. Georg-Wilhelm Bornkamm (Institute for Tumor Genetics and Clinical Molecular Biology, GSF, Munich) and Michael Potter (Laboratory of Genetics, National Cancer Institute, NIH) for supporting these studies.
[38] Redox Control of Cell Cycle-Coupled Topoisomerase IIa Gene Expression B y PRABHAT C. GOSWAMI, RYUJI HIGASHIKUBO, and DOUGLAS R. SPITZ
Introduction M a m m a l i a n t o p o i s o m e r a s e IIc~ (Topo II) is a multifunctional protein i n v o l v e d in m a n y cellular processes including replication, repair, transcription, r e c o m b i n a tion, c h r o m o s o m e condensation and segregation, and the G2 cell cycle checkpoint pathway. 1-3 Topo II gene expression during the cell cycle is regulated mainly via posttranscriptional m e c h a n i s m s o f changes in m R N A stability. 4 Topo II m R N A and protein levels increase in late S phase, peak in Gz/M, and rapidly decrease after cell division. 4 Several cancer therapeutic agents including ionizing radiation are k n o w n to generate reactive o x y g e n species and affect Topo II g e n e expression. 5-8 B e c a u s e a g r o w i n g body of literature suggests the importance of o x y g e n radicals as possible physiological regulators of cell proliferation and expression of Topo II is proliferation dependent, d e v e l o p m e n t o f methods to assay redox regulation o f Topo II gene expression m a y provide a mechanistic understanding of how the ! J. C. Wang, Annu. Rev. Biochem. 65, 635 (1996). 2 W. C. Earnshaw and M. M. S. Heck, J. Cell Biol. 100, 1716 (1985). 3 C. S. Downes, D. J. Clarke, A. M. Mullinger, J. F. Gimenez-Abian, A. M. Creighton, and R. T. Johnson, Nature (London) 372, 467 (1994). 4 p. C. Goswami, J. L. Roti Roti, and C. R. Hunt, Mol. Cell. Biol. 16, 1500 (1996). 5 p. C. Goswami, M. Hill, R. Higashikubo, W. D. Wright, and J. L. Roti Roti, Radiat. Res. 132, 162 (1992). 6 S. M. DeToledo, E. I. Azzam, M. K. Gasmann, and R. E. J. Mitchel, Int. J. Radiar Biol. 67, 135 (1995). 7 T. A. Jarvinen, J. Kononen, M. Pelto-Huikko, and J. Isola, Am. J. Pathol. 148, 2073 (1996). 8 D. J. Grdina, J. S. Murley, and J. C. Roberts, Cell. Prolif 31, 217 (1998).
METHODSINENZYMOLOGY,VOL353
Copyright2002,ElsevierScience(USA). Allrightsreserved. 0076-6879/02$35.00
[38]
REDOX AND Topo II GENEEXPRESSION
449
intracellular redox state influences Topo II gene expression both under normal growth conditions and in response to stress. 9-12 The purpose of this chapter is to provide a useful description of methods for studying cell cycle-coupled Topo II gene expression and the possible regulatory role of the intracellular redox state in these processes. Cell S y n c h r o n i z a t i o n a n d T o p o i s o m e r a s e IIa mRNA S t a b i l i t y A s s a y HeLa cells {human cervical cancer cell line) are grown in monolayer cultures at 37 ° and 5% CO2 in Ham's F10 medium supplemented with 10% {v/v) calf serum (GIBCO, Grand Island, NY), penicillin (100 U/ml), and streptomycin (100 #g/ml). Monolayer cells are grown to 60-70% confluence and synchronous cell populations representing the mitotic phase are obtained by selective detachment of mitotic cells according to previously published procedures (Goswami et al. 4 and Terasima and Tolmachl3). To minimize perturbation in cell growth, all procedures are performed in a 37 ° warm room. Approximately 1.5% of mitotic cells are obtained by the shake-off method from an exponentially growing cell culture. Viability, as measured by a colony-forming assay, is more than 95% and the mitotic index is more than 97% as determined by microscopic examination. 4 Synchronized cells (3-5 x 105) are plated in 10 ml of prewarmed and CO2-equilibrated medium in a 100-mm tissue culture dish. Progression through the cell cycle is monitored by fluorescence-activated cell sorting (FACS) analysis. Monolayer cells are pulse labeled with 10/zM bromodeoxyuridine (BrdU) for 30 min, trypsinized, and fixed in 1 ml of ice-cold 70% (v/v) ethanol. Indirect immunostaining of BrdU-labeled cells and subsequent FACS analysis are performed according to a previously published procedure.~4 Briefly, ethanol-fixed cells are washed with phosphate-buffered saline (PB S) and treated with pepsin (0.4 mg/ml in 0.1 N HC1) for 30 min at room temperature. Nuclei are isolated by centrifuging the samples at 530g for 5 rain in a Beckman (Fullerton, CA) centrifuge set at 4 °. The pellet is washed once with PBS and incubated with anti-BrdU antibody (5 #1 of the antibody in a 50-#1 sample volume) for 1 hr at room temperature. Antibodies, both primary and secondary, are purchased from BD Immunocytometry Systems (San Jose, CA). At the end of the incubation, samples are diluted with 1 ml of PBS and centrifuged at 1600 rpm for 5 min at 4 °. Nuclei are then incubated with fluorescein isothiocyanate (FITC)-conjugated goat 9 T. Finkel, Curr. Opin. Cell Biol. 10, 248 (1998). 10 R. H. Burdon, Free Radic. Biol. Med. 18, 775 (1995). 11 p. C. Goswami, J. Sheren, L. D. Albee, A. Parsian, J. E. Sim, L. A. Ridnour, R. Higashikubo, D. Gius, C. R. Hunt, and D. R. Spitz, J. Biol. Chem. 275, 38384 (2000). 12 G. Pani, R. Colavitti, B. Bedogni, R. Anzevino, S. Borrello, and T. Galeotti, J. Biol. Chem. 275, 38891 (2000). 13 T. Terasima and L. J. Tolmach, Exp. Cell Res. 30, 344 (1963). 14 p. C. Goswami, W. He, R. Higashikubo, and J. L. Roti Roti, Exp. Cell Res. 214, 198 (1994).
450
NUCLEIC ACIDS AND GENES
[38]
anti-mouse IgG for 1 hr and digested with RNase A (0.1 mg/ml) for 30 min at room temperature. The nuclei are counterstained with propidium iodide (PI, 20/zg/ml) for 1 hr and stained cells are analyzed on a FACS 440 (BD Immunocytometry Systems) flow cytometer. The FACS 440 flow cytometer is equipped with a coherent 190-5 UV laser operating at 300 mW and at 488-nm excitation wavelengths. Red fluorescence from PI is detected through a 640-nm long-pass filter, and green fluorescence from FITC is detected through a 525-nm band-pass filter. Data from a minimum of 10,000 nuclei are acquired in list mode and processed by Cytomation software. More than 90% of the cells are in G1 phase 1 hr after replating (Fig. 1A) and approximately 30% of the cells enter S phase at 12 hr (Fig. 1B). Four hours later, approximately 70% of the cells enter the G2/M phase (Fig. 1C) and by 20 hr 25% of the cells enter the G1 phase of the next generation (Fig. 1D). These results demonstrate a synchronous progression of cells during the time period of the experiment and show that the mitotic shake-off method is a suitable technique for obtaining high degree of cell synchrony. Cells in duplicate dishes are treated with actinomycin D (10 /zg/ml) 1 hr (G1 phase) and 14 hr (S phase) after replating. Cells are cultured in the presence of actinomycin D for an additional 4 hr and scraped into 1 ml of TRI-reagent (MRC, Cincinnati, OH). Total cellular RNA is then isolated and analyzed by Northern blotting (Fig. 1E) according to standard procedures. Radiolabeled Topo II human cDNA probe is prepared by random prime labeling and radioactive bands are visualized by exposing the blot to a Phosphorlmager screen (Molecular Dynamics STORM 840 Phosphorlmager; Amersham Pharmacia Biotech, Piscataway, NJ). The results presented in Fig. 1E show that Topo II mRNA levels are low in G1 phase and increase more than 16-fold in late S phase (compare lanes 1 and 3). Inhibition of new transcription in G1 phase rapidly turns over Topo II mRNA levels (compare lanes 1 and 2 in Fig. 1E). These results are in sharp contrast to those seen in late S phase (14 hr postmitosis). In late S phase, there is essentially no turnover of Topo II mRNA in the absence of new transcription (compare lanes 3 and 4 in Fig. 1E). These results demonstrate that mRNA stability plays a significant role in regulating Topo II mRNA levels during the cell cycle. These results also show the applicability of the mitotic shake-off cell synchronization method in studying cell cycle-coupled gene expression. R e p o r t e r T r a n s f e c t i o n A s s a y to D e t e r m i n e P o s s i b l e Role of T o p o i s o m e r a s e IIa 3 ' - U n t r a n s l a t e d R e g i o n in mRNA Levels d u r i n g Cell Cycle The plasmid pNASSfl (Clontech, Palo Alto, CA) is used to generate reporter constructs. The pNASSfl vector lacks eukaryotic promoter and enhancer sequences and carries the Escherichia coli fl-galactosidase gene as the reporter. A 1.6-kb fragment containing 650 nucleotides (nt) of the human Topo II promoter, exon 1 (2 l nt),
®
[38]
o
"
o
<
,', %~,.
0
REDOX AND Topo II GENEEXPRESSION
i*
! i i
011_-I-FIPJB5o-I
==
Z==-
~==~
451
H~
==
452
NUCLEIC ACIDS AND GENES
[38]
the following intron (860 nt), and exon 2 (150 nt) is amplified by polymerase chain reaction (PCR) from human genomic DNA (Clontech), using primer pairs 5' _562GGGGCGGGGTTGAGGCAGATGCCAGAATCT_5323' and 5' +150AGGT GTCTGGGCGGAGCAAAATATGTTCC+121 3'. 15 The samples are denatured initially at 94 ° for 2 min and amplification is performed with a DNA thermal cycler (GeneAmp PCR system 9600; PerkinElmer, Norwalk, CT) at 94 ° for 30 sec, annealing at 60 ° for 30 sec, and extension at 72 ° for 30 sec for 25 cycles. The final cycle is followed by a 10-rain extension step at 72 °. The PCR-amplified fragment is cloned into TA-cloning vector (Invitrogen, Carlsbad, CA) and inserted clones are selected on the basis of blue/white color. The Topo 1I promoter-containing insert in the TA plasmid DNA is excised with SpeI and XhoI restriction enzymes and directionally cloned into SmaI- and XhoI-digested pNASSfl plasmid DNA. The resulting reporter construct (HflgalSV40), when expressed, transcribes a Topo II promoter-driven/%galactosidase reporter mRNA with the simian virus 40 (SV40) 3' untranslated region (UTR) at its 3' end (approximately 3 kb in size). In the second reporter construct (HflgalTopo), the SV40 3' UTR in HflgalSV40 plasmid DNA is removed by SalI and BamHI restriction enzyme digestion and replaced with the human Topo II 3' UTR. The Topo II 3' UTR is excised byXhoI andBamHI restriction enzyme digestion of plasmid DNA containing the entire human Topo II cDNA.16 The resulting reporter HflgalTopo construct, when expressed, represents an approximately 4-kb fl-galactosidase reporter mRNA with the Topo II 3' UTR at its Y end. 11 Orientation and sequence of all inserts are verified by dideoxy sequencing of both strands of DNA in each plasmid construct. Mouse NIH 3T3 fibroblast cells are stably transfected with plasmid DNAs pSVneo (Clontech), H/SgalTopo, or HflgalSV40, using LipofectAMINE according to the manufacturer-supplied protocol (GIBCO-BRL, Grand Island, NY). Geneticin-resistant colonies are pooled or individually cloned, and cultured in G418-containing medium. Asynchronously growing cells are synchronized by incubating monolayer cultures for 30 hr in medium containing 0.2% (v/v) serum and stimulated to reenter the cell cycle in medium containing 10% (v/v) serum. Cells are harvested at various times for analysis of cell cycle position and reporter mRNA levels. For analysis of cell cycle position, cells are harvested by trypsinization and fixed in 70% (v/v) ethanol. The cell pellet is digested with RNase A (1 mg/ml) and stained with PI (10/zg/ml) for FACS analysis. Figure 2A shows representative histograms of cell cycle positions after reentry into the cell cycle. The majority of the cells are in GI phase (approximately 85%) at the time of serum stimulation (0 hr) and 6 hr after the stimulation. At 20 hr after serum stimulation 58% of the cells enter S phase and approximately 20-30% of the cells enter G2/M phase 24 hr 15 D. Hochhauser, C. A. Stanway, A. L. Harris, and I. D. Hickson, J. Biol. Chem. 267, 18961 (1992). 16 M. Tsai-Pflugfelder, L. E Liu, A. A. Liu, K. M. Tewey, J. Whang-Peng, T. Knutsen, K. Huebner, C. M. Croce, and J. C. Wang, Proc. Natl. Acad. Sci. U.S.A. 85, 7177 (1988).
a~
c~
0
,1-
C~
0 C~I
C~
0
0
2~
.~aqmnu IlaO
G.
0
to U
z r~
~
~
c~
~?~
.'=.~.=
~
o .~= o,~
o
-,-
='~
~.~
~
~
z<
~
"~"
~.~
m
.~
454
NUCLEICACIDS AND GENES
[381
after serum stimulation. These results are comparable to results obtained with untransfected control cells (data not shown) and demonstrate that transfection of the reporter construct does not perturb cell cycle progression. When the total cellular RNA from the H/3galTopo-transfected cell populations is analyzed by Northern blotting, an mRNA band of approximately 4 kb, representing the H/~galTopo reporter construct, is detected with a radiolabeled /3-galactosidase probe (Fig. 2B). H/3galTopo reporter mRNA levels are low in GI phase (0-6 hr) and increase 12- to 16-fold by late S to G2 phases (20-24 hr). Results with the H/~galSV40 reporter construct (20-24 hr), which contains the Topo II promoter but not the 3' UTR, indicate a small increase in cell cycleregulated /%galactosidase reporter mRNA levels. This can be attributed to the 2-fold increase in Topo II transcription that has been reported previously to occur during late S phase by us and other investigators. 4'15'17 Because the two reporter constructs differ only in the Y UTR sequence, the above-described results show a regulatory role for the Topo II 3' UTR in cell cycle-coupled expression of Topo II. These results demonstrate the feasibility of the reporter assay, which could be used to determine the possible role of 3' UTRs in the regulation of cell cycle-coupled mRNA levels. I n Vitro R N A - P r o t e i n B i n d i n g A s s a y
The 177-nucleofide (nt) cDNA sequence representing the putative proteinbinding site (nt 4772--4948; Goswami et al. 11) in the Topo II 3' UTR is amplifed by PCR from plasmid DNA containing the entire Topo II 3' UTR (pTopUTR), using primer pairs 5' TAGTGACCATCTATGGG 3' and 5' CTGCTCTAGTTTTAGCT TAGTGG 3'. 11 PCR-amplified Topo I1 3' UTR cDNA (177 nt) is cloned into transcription vector pGEM-T plasmid DNA (Promega, Madison, WI). fl-Galactosidase transcript is used as nonspecific competitor in the RNA-protein binding assays. fl-Galactosidase-coding sequence within the HpaI and ClaI restriction sites in pCMV plasmid (Clontech) is cloned into pBS II SK(+) and runoff transcript is generated by using T7 RNA polymerase. Riboprobes representing the sense strand of RNA from each plasmid are transcribed in vitro according to the protocol from Promega. Labeled riboprobes are transcribed by inclusion of [c~-32p]UTP (800 Ci/mmol; NEN Life Science Products, Boston, MA) in the transcription reaction. Reaction mixtures are treated with 1 U of DNase I and riboprobes are purified with the Promega Wizard PCR Prep DNA cleanup system. Bound transcripts are eluted with RNase-free water and stored at - 2 0 ° in the presence of RNasin (1 U/#I; Promega). Radiolabeled riboprobe (1 × 105 cpm) is incubated with 15-20/zg of protein extract in buffer containing 12 mM HEPES (pH 7.9), 15 mM KC1, 5 mM MgC12, 2 mM dithiotreitol (DTT), 1 #g of tRNA, heparin (1 #g/#l), RNasin (1 U/ttl), and 17j. Falck,E Dagger, B. Jensen, and M. Sehested,J. Biol. Chem. 274, 18753(1999).
[38]
REDOX AND
Topo II GENE EXPRESSION
455
10% (v/v) glycerol in a total volume of 20/zl for 20 min at 25 °. Total cellular protein extracts are prepared by repeated freeze-thawing in buffer containing 10 mM HEPES, 1.5 mM MgC12, 1 mM EDTA, 0.2 mM EGTA, 10 mM KC1, 1 mM DTT, 1 mM phenylmethylsulfonyl fluoride (PMSF), and 10% (v/v) glycerol. For competition experiments, the protein extract is first incubated for 10 min at 25 ° with unlabeled competitor RNA (specific or nonspecific) before the addition of the radiolabeled transcript. Control reactions without competitors are sham treated under identical conditions. RNA-protein binding reactions are treated with 5 U of RNase T1 for 15 min at 25 + and separated by electrophoresis on a 4.5% (w/v) native polyacrylamide gel in 45 mM Tris, 45 mM boric acid, and 1.2 mM EDTA buffer, pH 7.4. Radioactive bands are visualized by exposing the dried gels to a Phosphorlmager screen. Results presented in Fig. 3 show that the mobility of the 177-nt Topo II 3' UTR transcript is retarded in the presence of protein extract compared with the control reaction without protein extract (compare lanes 1 and 2 in Fig. 3). The retardation
1
2
3
4
5
IIII
Extract Comp.
+
+
+
+
+
+
NS
4,
Complex
,~
Free
FIG. 3. In vitro RNA-protein binding assay. RNA-protein gel shift assay of [32p]UTP-labeled 177-nucleotide Topo II 3~UTR riboprobe. Radiolabeled riboprobe (1 × 105 cpm) was incubated with (lane 2) or without (lane 1) 15 #g of protein extract prepared from asynchronously growing HeLa cells. For competition experiments, the protein extract was first incubated for 10 min at 25 ° with unlabeled specific [177-nucleotide Topo II 3' UTR, lane 3 (0.1 ng) and lane 4 (10 ng)], or nonspecific (10 ng of fl-galactosidase, lane 5), competitor RNA before the addition of the radiolabeled transcript. Comp., Unlabeled competitor transcript; NS, nonspecific/3-galactosidasetranscript. Arrows represent mobility of the free and protein-bound riboprobes.
456
NUCLEIC ACIDS AND GENES
[38]
in mobility is due to an RNA-protein interaction, because proteinase K treatment of cellular extracts before the binding assay abolishes the retardation (data not shown). The specificity of the RNA-protein complex is determined by performing competition experiments in the presence of unlabeled 177-nt Topo II 31 UTRspecific competitor or nonspecific competitor RNA (/3-galactosidase). Whereas addition of 0.1 ng (Fig. 3, lane 3) of unlabeled specific competitor has a minimal effect on protein binding, 10 ng (Fig. 3, lane 4) of the unlabeled transcript competes completely with the radiolabeled 177-nt Topo II 3' UTR RNA for protein binding. In contrast, 10 ng of the unlabeled nonspecific competitor RNA (fl-galactosidase) does not compete with the radiolabeled transcript for protein binding (Fig. 3, lane 5). In control reactions without the protein extract (Fig. 3, lane 1), the radioactive bands above and below the complex could be due to RNase T 1-resistant secondary structures of the transcript. These results show that protein binding to the 177-nt Topo II Y UTR transcript is specific and demonstrate the applicability of the in vitro RNA-protein binding assay. R e d o x S e n s i t i v i t y of in Vitro R N A - P r o t e i n B i n d i n g A s s a y The redox sensitivity of protein binding to the 177-nt Topo II 3' UTR is assayed by slight modifications of the method described above. Protein extract is prepared from asynchronously growing HeLa cells, using extraction buffer that lacks the reducing agent DTT. Similarly, DTT is omitted from the binding reaction buffer. Subsequently, binding reactions are performed in the presence of 2 mM DTT. The reaction mixture containing the protein extract is incubated with DTT for 10 rain at 25 ° before the addition of the 177-nt riboprobe. The binding reaction is continued for 20 min after the addition of radiolabeled transcript and is analyzed by RNA gel shift assay as described above. Binding of cellular proteins to the Topo II 3I UTR increases 3- to 4-fold in protein extracts pretreated with the reducing agent DTT {compare lane 2 with lane 1 in Pig. 4). The assay is then repeated in extracts supplemented with 2 mM DTT and increasing concentrations of a thiol-oxidizing agent (diamide). A dose-dependent inhibition of protein binding is observed in extracts pretreated with the sulfhydryl-oxidizing agent diamide (0.1, 0.5, 1, 5, and 10 mM; Pig. 4, lanes 5-9). Whereas 0.1 mM diamide does not cause any significant change in protein binding (Pig. 4, lane 5), 0.5 and 1 mM diamide cause 30 and 50% decreases in protein binding (Pig. 4, lanes 6 and 7). Increasing the diamide concentration to 5 mM (Fig. 4, lane 8) and 10 mM (Pig. 4, lane 9) further inhibits RNA-protein complex formation. Taken together, these results indicate that reduced thiol residues in Topo II 3' UTR-binding proteins participate in the RNAprotein complex formation and that oxidation of these thiol residues to the disulfide form abolishes binding. These results show that the RNA-protein binding assay described here can be applied in vitro to determine the redox sensitivity of proteins binding to the 31 UTRs of cell cycle genes.
[38]
REDOXANDTopo II GENEEXPRESSION 1
2
3
4
5
6
7
8
457 9
Complex
4,
Extract D'l-I"
+
+ +
+
Diamide (mM)
+
+
+
+
+
+
+
+
+
+
+
+
.1
.5
1
5
10
Free
FIG. 4. Redox sensitivity of RNA-protein binding assay. RNA-protein gel shift assay of the 177nucleotide Topo II Y UTR riboprobe and HeLa cellular protein extracts pretreated with thiol-reducing or -oxidizing agents. (A) Protein extracts from asynchronously growing HeLa cells were prepared with extraction buffer without any DTT. RNA-protein binding reactions were carried out with protein extracts that were pretreated with (lane 2) or without (lane 1) 2 m M DTT. Lanes 4-9, protein extracts from asynchronously growing HeLa cells were prepared with regular extraction buffer containing 2 m M D T r and RNA-protein binding reactions were carried out in the presence of increasing concentrations of diamide (0.1,0.5, 1, 5, and 10 mM). Lane 3 represents a control reaction without any protein extract.
In Vivo M a n i p u l a t i o n of Redox State a n d in Vitro
RNA-Protein Binding A s s a y Asynchronously growing HeLa cells are treated with 20 mM N-acetyl-Lcysteine (NAC) and assayed for NAC uptake, reduced and oxidized glutathione content, RNA-protein binding, and Topo II mRNA levels. The pH of the NAC is adjusted to pH 7.0 with sodium bicarbonate. Intracellular reduced and oxidized glutathione as well as NAC levels are assayed according to previously published protocols.18,19 Cell pellets are homogenized in 50 mM potassium phosphate buffer (pH 7.8) containing 1.34 mM diethylenetriaminepentaacetic acid. Total glutathione content is determined in sulfosalicylic acid [5% (w/v) SSA] extracts by the method 18 R. V. Blackburn, D. R. Spitz, X. Liu, S. S. Galoforo, J. E. Sim, L. A. Ridnour, J. C. Chen, B. H. Davis, P. M. Corry, and Y. J. Lee, Free Radic. Biol. Med. 26, 419 (1999). 19 L. A. Ridnour, R. A. Winters, N. Ercal, and D. R. Spitz, Methods Enzymol. 299, 258 (1999).
458
NUCLEIC ACIDS AND GENES
A
[381
B 2
3
TopoII Complex 28S Free
'~
NAC
Extract
+
NAC
0
6
Hr
4-
6
Hr
C
16 []
NAC (nmol/mg protein)
•
GSH/GSSG Ratio
12
8 4 0 0 hr
6 hr
FIG. 5. Manipulation of intracellular redox state. Asynchronously growing HeLa cells were treated with 20 mM NAC (pH 7.0) and subjected to the RNA-protein gel mobility shift assay (A); Topo II mRNA levels were determined (B), as was NAC uptake (by HPLC) and glutathione content (by spectrophotometric recycling assay) (C). Changes in intracellular redox state were measured as the ratio ofGSH (nmol/mg) to GSSG (2 × nmol/mg). Ethidium bromide-stained 28S ribosomal RNA levels were included for comparison of the Northern blot results. o f A n d e r s o n . 2° R e d u c e d ( G S H ) a n d o x i d i z e d ( G S S G ) g l u t a t h i o n e are d i s t i n g u i s h e d b y a d d i t i o n o f 2 / z l o f a 1 : 1 m i x t u r e o f 2 - v i n y l p y r i d i n e a n d e t h a n o l p e r 30 #1 o f s a m p l e f o l l o w e d b y i n c u b a t i o n at r o o m t e m p e r a t u r e for 1.5 h r b e f o r e a d d i t i o n o f SSA. N A C levels in cells are m e a s u r e d after d e r i v a t i z a t i o n w i t h N - ( 1 - p y r e n y l ) 20 M. E. Anderson, in "Handbook of Methods for Oxygen Radical Research" (R. A. Greenwald, ed.), p. 317. CRC Press, Boca Raton, FL, 1985.
[38]
REDOX AND
Topo II GENE EXPRESSION
459
maleimide, using a 15-cm C18 Reliasil column (Column Engineering, Ontario, CA) coupled with high-performance liquid chromatography with fluorescence detection. 19 All biochemical determinations are normalized to the protein content of whole cell homogenates, using the method of Lowry et al. 2~ Results presented in Fig. 5C show that treatment of cells with NAC alters the intracellular redox state to a more reducing environment. Thus, NAC levels are approximately 5.6 nmol/mg protein after 6 hr of treatment. Consistent with these results, the ratio of GSH to GSSG increases approximately 1.5- to 2.0-fold during this time frame. Total cellular protein extracts are prepared in the absence of DTT and in vitro RNA-protein binding assays are performed according to the method described above. These results show that protein binding to the Topo II 3' UTR increases 3- to 4-fold in NAC-treated cells compared with untreated controls (compare lanes 2 and 3 in Fig. 5A). These results provide in vivo evidence that a shift to a more reducing environment enhances protein binding to the 177-nt Topo II 3' UTR. Topo II mRNA levels are analyzed after a 6-hr treatment with NAC. An increase in intracellular reducing state induced by NAC treatment decreases Topo II mRNA levels by more than 90% (compare lanes 1 and 2 in Fig. 5B). Interestingly, the NAC-induced decrease in Topo II mRNA levels correlates with enhanced protein binding to the Topo II 3' UTR (Fig. 5A). These results indicate that protein binding to the Topo II 3' UTR is favored in a reducing environment, which appears to facilitate mRNA degradation. These results show the feasibility of manipulating the intracellular redox state and its subsequent effect on Topo II gene expression. Conclusion A growing body of literature suggests the importance of the intracellular redox state as the possible physiological regulator of cell proliferation. Although the molecular mechanisms are currently not fully understood, it is possible that at least some of the mechanisms could be at the level of cell cycle-coupled gene expression. The assays described here provide methods to study alterations in gene expression during the cell cycle and possible effects of alterations in the intracellular redox state on cell cycle-coupled variations in gene expression. Although the assays were optimized for the study of Topo II expression, similar approaches can be used to study the redox regulation of other cell cycle-coupled genes. Acknowledgments This work was supported by NIH Grants R29 CA-69593 (P.C.G.) and RO1 HL-51469 (D.R.S.).
21 O. H. Lowry, N. J. Rosenbrough, A. L. Fan, and R. J. Randall, J. Biol. Chem. 193, 265 (1951).
[381
NUCLEIC ACIDS AND GENES
Acknowledgments We acknowledge Dr. Scott Provost (Stratagene) for teaching K.F. the)~LIZ assay and providing ~,LIZ transgenic B6 mice for backcrossing. We are grateful to Drs. Martijn Doll6 and Jan Vijg (Cancer Therapy and Research Center, University of Texas Health Science Center at San Antonio) for training L.R. in the pUR288 assay and providing the pUR288 transgenic B6 mice for backcrossing. We are equally grateful to Dr. Michael Boerrigter (Leven) for sharing his expertise on the pUR288 assay and many fruitful scientific discussions. We are indebted to Drs. Sharon Jackson and Steven Holland (NIAID, NIH) for the kind gift of p47 ph°x knockout mice. We thank our long-term collaborators, Drs. Georg-Wilhelm Bornkamm (Institute for Tumor Genetics and Clinical Molecular Biology, GSF, Munich) and Michael Potter (Laboratory of Genetics, National Cancer Institute, NIH) for supporting these studies.
[38] Redox Control of Cell Cycle-Coupled Topoisomerase IIa Gene Expression B y PRABHAT C. GOSWAMI, RYUJI HIGASHIKUBO, and DOUGLAS R. SPITZ
Introduction M a m m a l i a n t o p o i s o m e r a s e IIc~ (Topo II) is a multifunctional protein i n v o l v e d in m a n y cellular processes including replication, repair, transcription, r e c o m b i n a tion, c h r o m o s o m e condensation and segregation, and the G2 cell cycle checkpoint pathway. 1-3 Topo II gene expression during the cell cycle is regulated mainly via posttranscriptional m e c h a n i s m s o f changes in m R N A stability. 4 Topo II m R N A and protein levels increase in late S phase, peak in Gz/M, and rapidly decrease after cell division. 4 Several cancer therapeutic agents including ionizing radiation are k n o w n to generate reactive o x y g e n species and affect Topo II g e n e expression. 5-8 B e c a u s e a g r o w i n g body of literature suggests the importance of o x y g e n radicals as possible physiological regulators of cell proliferation and expression of Topo II is proliferation dependent, d e v e l o p m e n t o f methods to assay redox regulation o f Topo II gene expression m a y provide a mechanistic understanding of how the ! J. C. Wang, Annu. Rev. Biochem. 65, 635 (1996). 2 W. C. Earnshaw and M. M. S. Heck, J. Cell Biol. 100, 1716 (1985). 3 C. S. Downes, D. J. Clarke, A. M. Mullinger, J. F. Gimenez-Abian, A. M. Creighton, and R. T. Johnson, Nature (London) 372, 467 (1994). 4 p. C. Goswami, J. L. Roti Roti, and C. R. Hunt, Mol. Cell. Biol. 16, 1500 (1996). 5 p. C. Goswami, M. Hill, R. Higashikubo, W. D. Wright, and J. L. Roti Roti, Radiat. Res. 132, 162 (1992). 6 S. M. DeToledo, E. I. Azzam, M. K. Gasmann, and R. E. J. Mitchel, Int. J. Radiar Biol. 67, 135 (1995). 7 T. A. Jarvinen, J. Kononen, M. Pelto-Huikko, and J. Isola, Am. J. Pathol. 148, 2073 (1996). 8 D. J. Grdina, J. S. Murley, and J. C. Roberts, Cell. Prolif 31, 217 (1998).
METHODSINENZYMOLOGY,VOL353
Copyright2002,ElsevierScience(USA). Allrightsreserved. 0076-6879/02$35.00
[38]
REDOX AND Topo II GENEEXPRESSION
449
intracellular redox state influences Topo II gene expression both under normal growth conditions and in response to stress. 9-12 The purpose of this chapter is to provide a useful description of methods for studying cell cycle-coupled Topo II gene expression and the possible regulatory role of the intracellular redox state in these processes. Cell S y n c h r o n i z a t i o n a n d T o p o i s o m e r a s e IIa mRNA S t a b i l i t y A s s a y HeLa cells {human cervical cancer cell line) are grown in monolayer cultures at 37 ° and 5% CO2 in Ham's F10 medium supplemented with 10% {v/v) calf serum (GIBCO, Grand Island, NY), penicillin (100 U/ml), and streptomycin (100 #g/ml). Monolayer cells are grown to 60-70% confluence and synchronous cell populations representing the mitotic phase are obtained by selective detachment of mitotic cells according to previously published procedures (Goswami et al. 4 and Terasima and Tolmachl3). To minimize perturbation in cell growth, all procedures are performed in a 37 ° warm room. Approximately 1.5% of mitotic cells are obtained by the shake-off method from an exponentially growing cell culture. Viability, as measured by a colony-forming assay, is more than 95% and the mitotic index is more than 97% as determined by microscopic examination. 4 Synchronized cells (3-5 x 105) are plated in 10 ml of prewarmed and CO2-equilibrated medium in a 100-mm tissue culture dish. Progression through the cell cycle is monitored by fluorescence-activated cell sorting (FACS) analysis. Monolayer cells are pulse labeled with 10/zM bromodeoxyuridine (BrdU) for 30 min, trypsinized, and fixed in 1 ml of ice-cold 70% (v/v) ethanol. Indirect immunostaining of BrdU-labeled cells and subsequent FACS analysis are performed according to a previously published procedure.~4 Briefly, ethanol-fixed cells are washed with phosphate-buffered saline (PB S) and treated with pepsin (0.4 mg/ml in 0.1 N HC1) for 30 min at room temperature. Nuclei are isolated by centrifuging the samples at 530g for 5 rain in a Beckman (Fullerton, CA) centrifuge set at 4 °. The pellet is washed once with PBS and incubated with anti-BrdU antibody (5 #1 of the antibody in a 50-#1 sample volume) for 1 hr at room temperature. Antibodies, both primary and secondary, are purchased from BD Immunocytometry Systems (San Jose, CA). At the end of the incubation, samples are diluted with 1 ml of PBS and centrifuged at 1600 rpm for 5 min at 4 °. Nuclei are then incubated with fluorescein isothiocyanate (FITC)-conjugated goat 9 T. Finkel, Curr. Opin. Cell Biol. 10, 248 (1998). 10 R. H. Burdon, Free Radic. Biol. Med. 18, 775 (1995). 11 p. C. Goswami, J. Sheren, L. D. Albee, A. Parsian, J. E. Sim, L. A. Ridnour, R. Higashikubo, D. Gius, C. R. Hunt, and D. R. Spitz, J. Biol. Chem. 275, 38384 (2000). 12 G. Pani, R. Colavitti, B. Bedogni, R. Anzevino, S. Borrello, and T. Galeotti, J. Biol. Chem. 275, 38891 (2000). 13 T. Terasima and L. J. Tolmach, Exp. Cell Res. 30, 344 (1963). 14 p. C. Goswami, W. He, R. Higashikubo, and J. L. Roti Roti, Exp. Cell Res. 214, 198 (1994).
450
NUCLEIC ACIDS AND GENES
[38]
anti-mouse IgG for 1 hr and digested with RNase A (0.1 mg/ml) for 30 min at room temperature. The nuclei are counterstained with propidium iodide (PI, 20/zg/ml) for 1 hr and stained cells are analyzed on a FACS 440 (BD Immunocytometry Systems) flow cytometer. The FACS 440 flow cytometer is equipped with a coherent 190-5 UV laser operating at 300 mW and at 488-nm excitation wavelengths. Red fluorescence from PI is detected through a 640-nm long-pass filter, and green fluorescence from FITC is detected through a 525-nm band-pass filter. Data from a minimum of 10,000 nuclei are acquired in list mode and processed by Cytomation software. More than 90% of the cells are in G1 phase 1 hr after replating (Fig. 1A) and approximately 30% of the cells enter S phase at 12 hr (Fig. 1B). Four hours later, approximately 70% of the cells enter the G2/M phase (Fig. 1C) and by 20 hr 25% of the cells enter the G1 phase of the next generation (Fig. 1D). These results demonstrate a synchronous progression of cells during the time period of the experiment and show that the mitotic shake-off method is a suitable technique for obtaining high degree of cell synchrony. Cells in duplicate dishes are treated with actinomycin D (10 /zg/ml) 1 hr (G1 phase) and 14 hr (S phase) after replating. Cells are cultured in the presence of actinomycin D for an additional 4 hr and scraped into 1 ml of TRI-reagent (MRC, Cincinnati, OH). Total cellular RNA is then isolated and analyzed by Northern blotting (Fig. 1E) according to standard procedures. Radiolabeled Topo II human cDNA probe is prepared by random prime labeling and radioactive bands are visualized by exposing the blot to a Phosphorlmager screen (Molecular Dynamics STORM 840 Phosphorlmager; Amersham Pharmacia Biotech, Piscataway, NJ). The results presented in Fig. 1E show that Topo II mRNA levels are low in G1 phase and increase more than 16-fold in late S phase (compare lanes 1 and 3). Inhibition of new transcription in G1 phase rapidly turns over Topo II mRNA levels (compare lanes 1 and 2 in Fig. 1E). These results are in sharp contrast to those seen in late S phase (14 hr postmitosis). In late S phase, there is essentially no turnover of Topo II mRNA in the absence of new transcription (compare lanes 3 and 4 in Fig. 1E). These results demonstrate that mRNA stability plays a significant role in regulating Topo II mRNA levels during the cell cycle. These results also show the applicability of the mitotic shake-off cell synchronization method in studying cell cycle-coupled gene expression. R e p o r t e r T r a n s f e c t i o n A s s a y to D e t e r m i n e P o s s i b l e Role of T o p o i s o m e r a s e IIa 3 ' - U n t r a n s l a t e d R e g i o n in mRNA Levels d u r i n g Cell Cycle The plasmid pNASSfl (Clontech, Palo Alto, CA) is used to generate reporter constructs. The pNASSfl vector lacks eukaryotic promoter and enhancer sequences and carries the Escherichia coli fl-galactosidase gene as the reporter. A 1.6-kb fragment containing 650 nucleotides (nt) of the human Topo II promoter, exon 1 (2 l nt),
®
[38]
o
"
o
<
,', %~,.
0
REDOX AND Topo II GENEEXPRESSION
i*
! i i
011_-I-FIPJB5o-I
==
Z==-
~==~
451
H~
==
452
NUCLEIC ACIDS AND GENES
[38]
the following intron (860 nt), and exon 2 (150 nt) is amplified by polymerase chain reaction (PCR) from human genomic DNA (Clontech), using primer pairs 5' _562GGGGCGGGGTTGAGGCAGATGCCAGAATCT_5323' and 5' +150AGGT GTCTGGGCGGAGCAAAATATGTTCC+121 3'. 15 The samples are denatured initially at 94 ° for 2 min and amplification is performed with a DNA thermal cycler (GeneAmp PCR system 9600; PerkinElmer, Norwalk, CT) at 94 ° for 30 sec, annealing at 60 ° for 30 sec, and extension at 72 ° for 30 sec for 25 cycles. The final cycle is followed by a 10-rain extension step at 72 °. The PCR-amplified fragment is cloned into TA-cloning vector (Invitrogen, Carlsbad, CA) and inserted clones are selected on the basis of blue/white color. The Topo 1I promoter-containing insert in the TA plasmid DNA is excised with SpeI and XhoI restriction enzymes and directionally cloned into SmaI- and XhoI-digested pNASSfl plasmid DNA. The resulting reporter construct (HflgalSV40), when expressed, transcribes a Topo II promoter-driven/%galactosidase reporter mRNA with the simian virus 40 (SV40) 3' untranslated region (UTR) at its 3' end (approximately 3 kb in size). In the second reporter construct (HflgalTopo), the SV40 3' UTR in HflgalSV40 plasmid DNA is removed by SalI and BamHI restriction enzyme digestion and replaced with the human Topo II 3' UTR. The Topo II 3' UTR is excised byXhoI andBamHI restriction enzyme digestion of plasmid DNA containing the entire human Topo II cDNA.16 The resulting reporter HflgalTopo construct, when expressed, represents an approximately 4-kb fl-galactosidase reporter mRNA with the Topo II 3' UTR at its Y end. 11 Orientation and sequence of all inserts are verified by dideoxy sequencing of both strands of DNA in each plasmid construct. Mouse NIH 3T3 fibroblast cells are stably transfected with plasmid DNAs pSVneo (Clontech), H/SgalTopo, or HflgalSV40, using LipofectAMINE according to the manufacturer-supplied protocol (GIBCO-BRL, Grand Island, NY). Geneticin-resistant colonies are pooled or individually cloned, and cultured in G418-containing medium. Asynchronously growing cells are synchronized by incubating monolayer cultures for 30 hr in medium containing 0.2% (v/v) serum and stimulated to reenter the cell cycle in medium containing 10% (v/v) serum. Cells are harvested at various times for analysis of cell cycle position and reporter mRNA levels. For analysis of cell cycle position, cells are harvested by trypsinization and fixed in 70% (v/v) ethanol. The cell pellet is digested with RNase A (1 mg/ml) and stained with PI (10/zg/ml) for FACS analysis. Figure 2A shows representative histograms of cell cycle positions after reentry into the cell cycle. The majority of the cells are in GI phase (approximately 85%) at the time of serum stimulation (0 hr) and 6 hr after the stimulation. At 20 hr after serum stimulation 58% of the cells enter S phase and approximately 20-30% of the cells enter G2/M phase 24 hr 15 D. Hochhauser, C. A. Stanway, A. L. Harris, and I. D. Hickson, J. Biol. Chem. 267, 18961 (1992). 16 M. Tsai-Pflugfelder, L. E Liu, A. A. Liu, K. M. Tewey, J. Whang-Peng, T. Knutsen, K. Huebner, C. M. Croce, and J. C. Wang, Proc. Natl. Acad. Sci. U.S.A. 85, 7177 (1988).
a~
c~
0
,1-
C~
0 C~I
C~
0
0
2~
.~aqmnu IlaO
G.
0
to U
z r~
~
~
c~
~?~
.'=.~.=
~
o .~= o,~
o
-,-
='~
~.~
~
~
z<
~
"~"
~.~
m
.~
454
NUCLEICACIDS AND GENES
[381
after serum stimulation. These results are comparable to results obtained with untransfected control cells (data not shown) and demonstrate that transfection of the reporter construct does not perturb cell cycle progression. When the total cellular RNA from the H/3galTopo-transfected cell populations is analyzed by Northern blotting, an mRNA band of approximately 4 kb, representing the H/~galTopo reporter construct, is detected with a radiolabeled /3-galactosidase probe (Fig. 2B). H/3galTopo reporter mRNA levels are low in GI phase (0-6 hr) and increase 12- to 16-fold by late S to G2 phases (20-24 hr). Results with the H/~galSV40 reporter construct (20-24 hr), which contains the Topo II promoter but not the 3' UTR, indicate a small increase in cell cycleregulated /%galactosidase reporter mRNA levels. This can be attributed to the 2-fold increase in Topo II transcription that has been reported previously to occur during late S phase by us and other investigators. 4'15'17 Because the two reporter constructs differ only in the Y UTR sequence, the above-described results show a regulatory role for the Topo II 3' UTR in cell cycle-coupled expression of Topo II. These results demonstrate the feasibility of the reporter assay, which could be used to determine the possible role of 3' UTRs in the regulation of cell cycle-coupled mRNA levels. I n Vitro R N A - P r o t e i n B i n d i n g A s s a y
The 177-nucleofide (nt) cDNA sequence representing the putative proteinbinding site (nt 4772--4948; Goswami et al. 11) in the Topo II 3' UTR is amplifed by PCR from plasmid DNA containing the entire Topo II 3' UTR (pTopUTR), using primer pairs 5' TAGTGACCATCTATGGG 3' and 5' CTGCTCTAGTTTTAGCT TAGTGG 3'. 11 PCR-amplified Topo I1 3' UTR cDNA (177 nt) is cloned into transcription vector pGEM-T plasmid DNA (Promega, Madison, WI). fl-Galactosidase transcript is used as nonspecific competitor in the RNA-protein binding assays. fl-Galactosidase-coding sequence within the HpaI and ClaI restriction sites in pCMV plasmid (Clontech) is cloned into pBS II SK(+) and runoff transcript is generated by using T7 RNA polymerase. Riboprobes representing the sense strand of RNA from each plasmid are transcribed in vitro according to the protocol from Promega. Labeled riboprobes are transcribed by inclusion of [c~-32p]UTP (800 Ci/mmol; NEN Life Science Products, Boston, MA) in the transcription reaction. Reaction mixtures are treated with 1 U of DNase I and riboprobes are purified with the Promega Wizard PCR Prep DNA cleanup system. Bound transcripts are eluted with RNase-free water and stored at - 2 0 ° in the presence of RNasin (1 U/#I; Promega). Radiolabeled riboprobe (1 × 105 cpm) is incubated with 15-20/zg of protein extract in buffer containing 12 mM HEPES (pH 7.9), 15 mM KC1, 5 mM MgC12, 2 mM dithiotreitol (DTT), 1 #g of tRNA, heparin (1 #g/#l), RNasin (1 U/ttl), and 17j. Falck,E Dagger, B. Jensen, and M. Sehested,J. Biol. Chem. 274, 18753(1999).
[38]
REDOX AND
Topo II GENE EXPRESSION
455
10% (v/v) glycerol in a total volume of 20/zl for 20 min at 25 °. Total cellular protein extracts are prepared by repeated freeze-thawing in buffer containing 10 mM HEPES, 1.5 mM MgC12, 1 mM EDTA, 0.2 mM EGTA, 10 mM KC1, 1 mM DTT, 1 mM phenylmethylsulfonyl fluoride (PMSF), and 10% (v/v) glycerol. For competition experiments, the protein extract is first incubated for 10 min at 25 ° with unlabeled competitor RNA (specific or nonspecific) before the addition of the radiolabeled transcript. Control reactions without competitors are sham treated under identical conditions. RNA-protein binding reactions are treated with 5 U of RNase T1 for 15 min at 25 + and separated by electrophoresis on a 4.5% (w/v) native polyacrylamide gel in 45 mM Tris, 45 mM boric acid, and 1.2 mM EDTA buffer, pH 7.4. Radioactive bands are visualized by exposing the dried gels to a Phosphorlmager screen. Results presented in Fig. 3 show that the mobility of the 177-nt Topo II 3' UTR transcript is retarded in the presence of protein extract compared with the control reaction without protein extract (compare lanes 1 and 2 in Fig. 3). The retardation
1
2
3
4
5
IIII
Extract Comp.
+
+
+
+
+
+
NS
4,
Complex
,~
Free
FIG. 3. In vitro RNA-protein binding assay. RNA-protein gel shift assay of [32p]UTP-labeled 177-nucleotide Topo II 3~UTR riboprobe. Radiolabeled riboprobe (1 × 105 cpm) was incubated with (lane 2) or without (lane 1) 15 #g of protein extract prepared from asynchronously growing HeLa cells. For competition experiments, the protein extract was first incubated for 10 min at 25 ° with unlabeled specific [177-nucleotide Topo II 3' UTR, lane 3 (0.1 ng) and lane 4 (10 ng)], or nonspecific (10 ng of fl-galactosidase, lane 5), competitor RNA before the addition of the radiolabeled transcript. Comp., Unlabeled competitor transcript; NS, nonspecific/3-galactosidasetranscript. Arrows represent mobility of the free and protein-bound riboprobes.
456
NUCLEIC ACIDS AND GENES
[38]
in mobility is due to an RNA-protein interaction, because proteinase K treatment of cellular extracts before the binding assay abolishes the retardation (data not shown). The specificity of the RNA-protein complex is determined by performing competition experiments in the presence of unlabeled 177-nt Topo II 31 UTRspecific competitor or nonspecific competitor RNA (/3-galactosidase). Whereas addition of 0.1 ng (Fig. 3, lane 3) of unlabeled specific competitor has a minimal effect on protein binding, 10 ng (Fig. 3, lane 4) of the unlabeled transcript competes completely with the radiolabeled 177-nt Topo II 3' UTR RNA for protein binding. In contrast, 10 ng of the unlabeled nonspecific competitor RNA (fl-galactosidase) does not compete with the radiolabeled transcript for protein binding (Fig. 3, lane 5). In control reactions without the protein extract (Fig. 3, lane 1), the radioactive bands above and below the complex could be due to RNase T 1-resistant secondary structures of the transcript. These results show that protein binding to the 177-nt Topo II Y UTR transcript is specific and demonstrate the applicability of the in vitro RNA-protein binding assay. R e d o x S e n s i t i v i t y of in Vitro R N A - P r o t e i n B i n d i n g A s s a y The redox sensitivity of protein binding to the 177-nt Topo II 3' UTR is assayed by slight modifications of the method described above. Protein extract is prepared from asynchronously growing HeLa cells, using extraction buffer that lacks the reducing agent DTT. Similarly, DTT is omitted from the binding reaction buffer. Subsequently, binding reactions are performed in the presence of 2 mM DTT. The reaction mixture containing the protein extract is incubated with DTT for 10 rain at 25 ° before the addition of the 177-nt riboprobe. The binding reaction is continued for 20 min after the addition of radiolabeled transcript and is analyzed by RNA gel shift assay as described above. Binding of cellular proteins to the Topo II 3I UTR increases 3- to 4-fold in protein extracts pretreated with the reducing agent DTT {compare lane 2 with lane 1 in Pig. 4). The assay is then repeated in extracts supplemented with 2 mM DTT and increasing concentrations of a thiol-oxidizing agent (diamide). A dose-dependent inhibition of protein binding is observed in extracts pretreated with the sulfhydryl-oxidizing agent diamide (0.1, 0.5, 1, 5, and 10 mM; Pig. 4, lanes 5-9). Whereas 0.1 mM diamide does not cause any significant change in protein binding (Pig. 4, lane 5), 0.5 and 1 mM diamide cause 30 and 50% decreases in protein binding (Pig. 4, lanes 6 and 7). Increasing the diamide concentration to 5 mM (Fig. 4, lane 8) and 10 mM (Pig. 4, lane 9) further inhibits RNA-protein complex formation. Taken together, these results indicate that reduced thiol residues in Topo II 3' UTR-binding proteins participate in the RNAprotein complex formation and that oxidation of these thiol residues to the disulfide form abolishes binding. These results show that the RNA-protein binding assay described here can be applied in vitro to determine the redox sensitivity of proteins binding to the 31 UTRs of cell cycle genes.
[38]
REDOXANDTopo II GENEEXPRESSION 1
2
3
4
5
6
7
8
457 9
Complex
4,
Extract D'l-I"
+
+ +
+
Diamide (mM)
+
+
+
+
+
+
+
+
+
+
+
+
.1
.5
1
5
10
Free
FIG. 4. Redox sensitivity of RNA-protein binding assay. RNA-protein gel shift assay of the 177nucleotide Topo II Y UTR riboprobe and HeLa cellular protein extracts pretreated with thiol-reducing or -oxidizing agents. (A) Protein extracts from asynchronously growing HeLa cells were prepared with extraction buffer without any DTT. RNA-protein binding reactions were carried out with protein extracts that were pretreated with (lane 2) or without (lane 1) 2 m M DTT. Lanes 4-9, protein extracts from asynchronously growing HeLa cells were prepared with regular extraction buffer containing 2 m M D T r and RNA-protein binding reactions were carried out in the presence of increasing concentrations of diamide (0.1,0.5, 1, 5, and 10 mM). Lane 3 represents a control reaction without any protein extract.
In Vivo M a n i p u l a t i o n of Redox State a n d in Vitro
RNA-Protein Binding A s s a y Asynchronously growing HeLa cells are treated with 20 mM N-acetyl-Lcysteine (NAC) and assayed for NAC uptake, reduced and oxidized glutathione content, RNA-protein binding, and Topo II mRNA levels. The pH of the NAC is adjusted to pH 7.0 with sodium bicarbonate. Intracellular reduced and oxidized glutathione as well as NAC levels are assayed according to previously published protocols.18,19 Cell pellets are homogenized in 50 mM potassium phosphate buffer (pH 7.8) containing 1.34 mM diethylenetriaminepentaacetic acid. Total glutathione content is determined in sulfosalicylic acid [5% (w/v) SSA] extracts by the method 18 R. V. Blackburn, D. R. Spitz, X. Liu, S. S. Galoforo, J. E. Sim, L. A. Ridnour, J. C. Chen, B. H. Davis, P. M. Corry, and Y. J. Lee, Free Radic. Biol. Med. 26, 419 (1999). 19 L. A. Ridnour, R. A. Winters, N. Ercal, and D. R. Spitz, Methods Enzymol. 299, 258 (1999).
458
NUCLEIC ACIDS AND GENES
A
[381
B 2
3
TopoII Complex 28S Free
'~
NAC
Extract
+
NAC
0
6
Hr
4-
6
Hr
C
16 []
NAC (nmol/mg protein)
•
GSH/GSSG Ratio
12
8 4 0 0 hr
6 hr
FIG. 5. Manipulation of intracellular redox state. Asynchronously growing HeLa cells were treated with 20 mM NAC (pH 7.0) and subjected to the RNA-protein gel mobility shift assay (A); Topo II mRNA levels were determined (B), as was NAC uptake (by HPLC) and glutathione content (by spectrophotometric recycling assay) (C). Changes in intracellular redox state were measured as the ratio ofGSH (nmol/mg) to GSSG (2 × nmol/mg). Ethidium bromide-stained 28S ribosomal RNA levels were included for comparison of the Northern blot results. o f A n d e r s o n . 2° R e d u c e d ( G S H ) a n d o x i d i z e d ( G S S G ) g l u t a t h i o n e are d i s t i n g u i s h e d b y a d d i t i o n o f 2 / z l o f a 1 : 1 m i x t u r e o f 2 - v i n y l p y r i d i n e a n d e t h a n o l p e r 30 #1 o f s a m p l e f o l l o w e d b y i n c u b a t i o n at r o o m t e m p e r a t u r e for 1.5 h r b e f o r e a d d i t i o n o f SSA. N A C levels in cells are m e a s u r e d after d e r i v a t i z a t i o n w i t h N - ( 1 - p y r e n y l ) 20 M. E. Anderson, in "Handbook of Methods for Oxygen Radical Research" (R. A. Greenwald, ed.), p. 317. CRC Press, Boca Raton, FL, 1985.
[38]
REDOX AND
Topo II GENE EXPRESSION
459
maleimide, using a 15-cm C18 Reliasil column (Column Engineering, Ontario, CA) coupled with high-performance liquid chromatography with fluorescence detection. 19 All biochemical determinations are normalized to the protein content of whole cell homogenates, using the method of Lowry et al. 2~ Results presented in Fig. 5C show that treatment of cells with NAC alters the intracellular redox state to a more reducing environment. Thus, NAC levels are approximately 5.6 nmol/mg protein after 6 hr of treatment. Consistent with these results, the ratio of GSH to GSSG increases approximately 1.5- to 2.0-fold during this time frame. Total cellular protein extracts are prepared in the absence of DTT and in vitro RNA-protein binding assays are performed according to the method described above. These results show that protein binding to the Topo II 3' UTR increases 3- to 4-fold in NAC-treated cells compared with untreated controls (compare lanes 2 and 3 in Fig. 5A). These results provide in vivo evidence that a shift to a more reducing environment enhances protein binding to the 177-nt Topo II 3' UTR. Topo II mRNA levels are analyzed after a 6-hr treatment with NAC. An increase in intracellular reducing state induced by NAC treatment decreases Topo II mRNA levels by more than 90% (compare lanes 1 and 2 in Fig. 5B). Interestingly, the NAC-induced decrease in Topo II mRNA levels correlates with enhanced protein binding to the Topo II 3' UTR (Fig. 5A). These results indicate that protein binding to the Topo II 3' UTR is favored in a reducing environment, which appears to facilitate mRNA degradation. These results show the feasibility of manipulating the intracellular redox state and its subsequent effect on Topo II gene expression. Conclusion A growing body of literature suggests the importance of the intracellular redox state as the possible physiological regulator of cell proliferation. Although the molecular mechanisms are currently not fully understood, it is possible that at least some of the mechanisms could be at the level of cell cycle-coupled gene expression. The assays described here provide methods to study alterations in gene expression during the cell cycle and possible effects of alterations in the intracellular redox state on cell cycle-coupled variations in gene expression. Although the assays were optimized for the study of Topo II expression, similar approaches can be used to study the redox regulation of other cell cycle-coupled genes. Acknowledgments This work was supported by NIH Grants R29 CA-69593 (P.C.G.) and RO1 HL-51469 (D.R.S.).
21 O. H. Lowry, N. J. Rosenbrough, A. L. Fan, and R. J. Randall, J. Biol. Chem. 193, 265 (1951).