Reduced gluconeogenesis and lactate clearance in Huntington's disease

Neurobiology of Disease 40 (2010) 656–662

Contents lists available at ScienceDirect

Neurobiology of Disease j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / y n b d i

Reduced gluconeogenesis and lactate clearance in Huntington's disease Knud Josefsen a,⁎, Signe M.B. Nielsen a,b, André Campos a, Thomas Seifert d, Lis Hasholt b, Jørgen E. Nielsen b,c, Anne Nørremølle b, Niels H. Skotte b, Niels H. Secher d, Bjørn Quistorff e a

The Bartholin Institute, Rigshospitalet, Copenhagen, Denmark Section of Neurogenetics, Department of Cellular and Molecular Medicine, University of Copenhagen, Copenhagen, Denmark Neurogenetics Clinic, Memory Disorders Research Group, Rigshospitalet, Copenhagen, Denmark d Copenhagen Muscle Research Centre, Department of Anaesthesia, Rigshospitalet and University of Copenhagen, Copenhagen, Denmark e Nuclear Magnetic Resonance Centre, Department of Biomedical Sciences, University of Copenhagen, Copenhagen, Denmark b c

a r t i c l e

i n f o

Article history: Received 16 April 2010 Revised 23 July 2010 Accepted 11 August 2010 Available online 19 August 2010 Keywords: Glucose Exercise Liver perfusion Gluconeogenesis Brain metabolism

a b s t r a c t We studied systemic and brain glucose and lactate metabolism in Huntington's disease (HD) patients in response to ergometer cycling. Following termination of exercise, blood glucose increased abruptly in control subjects, but no peak was seen in any of the HD patients (2.0 ± 0.5 vs. 0.0 ± 0.2 mM, P b 2 × 10−6). No difference was seen in brain metabolism parameters. Reduced hepatic glucose output in the HD mouse model R6/2 following a lactate challenge, combined with reduced phosphoenolpyruvate carboxykinase and increased pyruvate kinase activity in the mouse liver suggest a reduced capacity for gluconeogenesis in HD, possibly contributing to the clinical symptoms of HD. We propose that blood glucose concentration in the recovery from exercise can be applied as a liver function test in HD patients. © 2010 Elsevier Inc. All rights reserved.

Introduction HD is a dominantly inherited, neurodegenerative disease caused by a CAG repeat expansion mutation in the huntingtin gene. This creates an elongated polyglutamine stretch in the expressed protein, that causes cellular dysfunction and, in some instances, cell death (The Huntington's Disease Collaborative Research Group, 1993). Although the symptomatology of HD is primarily neurological, most tissues express mutant huntingtin (Li et al., 1993; Van Raamsdonk et al., 2007), which is also the case in the murine HD model R6/2 (Sathasivam et al., 1999). In HD patients, an elevated lactate concentration has been found in the frontal cortex of 17 patients and 4 asymptomatic carriers (Harms et al., 1997) and in the basal ganglia from 18 HD patients or carriers (Jenkins et al., 1993). Also, the lactate/creatine and lactate/N-acetyl aspartate ratios were increased in parieto-occipital and cerebellar regions in 23 patients (Martin et al., 2007). Increased lactate concentration was also seen in several brain areas of R6/2 mice (Tsang et al., 2006) and in a transgenic primate model for HD (Dautry et al., 1999). In contrast, no lactate increase was found in the brain of 15 HD patients (Hoang et al., 1998) or in serum from 11 HD patients (Nicoli et al., 1993).

In order to determine, whether this increase in brain lactate was related to a change in brain lactate metabolism and/or peripheral lactate handling, we investigated systemic and cerebral glucose and lactate metabolism in HD patients. This was achieved by performing an ergometer exercise test during which repeated blood sampling was performed. During intense exercise, accumulation of lactate takes place when the rate of production by glycolysis exceeds the capacity for removal. More specifically, this happens as the delivery of glycolysis substrate from breakdown of glycogen in the working muscles will occur at a higher rate than pyruvate dehydrogenase and mitochondrial oxidation can cope with (Putman et al., 1995; Newsholme and Leech, 1983), and blood lactate may reach 30 mM (Nielsen, 1999). If not consumed by the muscle itself (Secher et al., 1977), this lactate is released to the blood to be transformed to glucose, primarily by liver but with contribution from kidney (Lauritsen et al., 2002) or oxidized in other organs like the brain (Ide et al., 2000) and the heart (Gertz et al., 1988). Lactate accumulation may also occur when the cytosolic redox state (NADH/NAD) is increased for reasons other than glycolytic flux. Thus, net lactate accumulation may be initiated by tissue hypoxia and reduced mitochondrial respiration. Methods

⁎ Corresponding author. Bartholin Instituttet, Rigshospitalet, Copenhagen Biocenter, Ole Maaløes Vej 5, 2200 Copenhagen N, Denmark. E-mail address: [email protected] (K. Josefsen). Available online on ScienceDirect (www.sciencedirect.com). 0969-9961/$ – see front matter © 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.nbd.2010.08.009

Patient studies HD patients (51.7 ± 10 years, 9 males, 2 females) participated in the study after providing informed written consent. The patients’ BMI

K. Josefsen et al. / Neurobiology of Disease 40 (2010) 656–662

was 24.4 ± 6.1 kg/m2, and their average CAG repeat units 42.6 ± 3.5. Standardized evaluations included total functional capacity score (TFC; from 0: no functional capacity to 13: normal capacity), the unified Huntington disease rating scale (UHDRS) with a motor score ranging from 0 (no signs of HD) to 124 and the global clinical impression scale (GCI; from 0: normal to 6: among the most extremely ill patients). At the time of the experiment their UHDRS rating was 27.9 ± 17.8, their TFC was 10.1 ± 2.5, and their GCI was 2.4 ± 0.7. A group of age-matched, healthy volunteers (4 males, 4 females, 54.0 ± 7 years, BMI 21.8 ± 1), served as controls. To allow evaluation of the influence of age on lactate metabolism, results were also compared to a group of young, fit adults (7 males, 2 females, 25 ± 2 years, BMI 24.3 ± 2). The study was approved by the Copenhagen Ethical Committee (No. H-01-012/03F) and carried out according to the Code of Ethics of the World Medical Association (Declaration of Helsinki) for experiments involving humans. Under local anesthesia (2% lidocaine) and using ultrasound guided Seldinger technique, a catheter (1.6 mm, Arrow International, PA) was placed in the right internal jugular vein and advanced to the superior bulb of the vein, close to the ear (Ferrier et al., 1993). An additional catheter was placed in the brachial artery of the left arm. Exercise was performed as cycling in a semi-supine position on a Krogh ergometer with gradually increasing work intensity until exhaustion. Blood samples (~ 2 mL) were obtained simultaneously from the jugular vein and the artery every 2 min before, during and after cycling, and less frequently during the ~60 min of the recovery (Ide et al., 2000). Samples were drawn into pre-heparinized syringes (Radiometer, Copenhagen, Denmark) which were mixed by gentle inversion and subsequently kept in ice water until analysis for O2, glucose and lactate (ABL 725, Radiometer). Brain metabolism was calculated according to the Fick principle as the a-v difference of individual metabolites multiplied by cerebral blood flow (Quistorff et al., 2008), assuming a resting cerebral blood flow of 0.7 l/min and a 25% increase during exercise (Jorgensen et al., 1992). Animal studies R6/2 mice, transgenic for exon 1 of the human HD gene encompassing approximately 144 CAG repeat units (Mangiarini et al., 1996), originated from the Jackson Laboratory (Bar Harbor, Maine) and were maintained by backcrossing males to CBA/J x B6 females (Taconic, Denmark). The mice were kept under specific pathogen free (SPF) conditions at a 12 h light/12 h darkness cycle in standard polystyrene cages with free access to standard chow. Tail tip DNA was used for genotyping (Norremolle et al., 1993). The CAG repeat length was around 130 throughout the experiment. Ten-weekold animals of both sexes were used. Littermates without the HD transgene were used as controls. Experiments were performed in accordance with the Danish Animal Experiments Inspectorate's guidelines (permit no. 2007/561-1345), the Danish Working Environment Authority (permit no. 20070033239/4) and the EC Directive 86/609/EEC for animal experiments. Mice, fasted for 18 h, were injected intraperitoneally (i.p.) with 4 μL/g body weight of NaCl (1 mg/mL) or L-lactate (2 mg/mL, Sigma). Blood samples of 10 μL were drawn from a tail vein into EDTA-coated capillaries at regular intervals for 2 h, transferred to Eppendorf tubes containing 100 μL 0.5 M perchloric acid and spun at 10,000g for 2 min, and the supernatant was frozen for later analysis. The fractional clearance of lactate was calculated as the area under the curve AUC0–1 h /AUC0–2 h. Mouse livers were perfused in situ (Quistorff et al., 1985). In brief, anesthesia was induced by subcutaneous injection of 3.75 μL Hypnorm (Janssen, Oxford, England) and 3.75 μL Midazolam (Roche, Denmark) per gram body weight. The perfusate (Krebs Henseleit solution 1 L: MgSO4 0.141 g, KHPO4 0.16 g, KCl 0.35 g, NaCl 6.9 g, CaCl2 0.373 g, NaHCO3 2.1 g, pH 7.4) was delivered at 6 mL/min at 37 °C via

657

a micro-oxygenator manufactured from hollow fibers harvested from a commercial oxygenator (SAFE MINI, Maquet Cardiovascular) and fitted into a standard laboratory flask containing humidified oxygen (100%). The void volume of the device was 100 μL and of the entire perfusion system 8 mL, including a 3-mL reservoir. Before entering the liver, the perfusion solution passed through a bubble trap. Perfusate effluent samples (50 μL) were drawn every 5 min for 30 min. The samples were stored at −20 °C for later analysis. Enzyme assays Tissue samples for enzyme activity assays were removed quickly after cervical dislocation and snap frozen in liquid nitrogen. The samples were later thawed on ice and homogenized (Polytron, Kinematica GmBH) at medium speed for 2 × 10 s in 10 (w/v) volumes of ice-cold glycyl-glycine buffer (25 mM glycyl-glycine, 150 mM KCl, 5 mM MgSO4, 5 mM EDTA, pH 7.5 with 1 mM DTT, 0.02% BSA, and 0.1% Triton X-100). Samples were spun for 2 min at 20,000g, aliquoted and stored at −80 °C until analysis. Protein content of homogenates was determined using the Micro BCA Protein Assay Reagent Kit (Pierce). All assays were performed in 96-well plates using a Fluoroskan Ascent Plate Reader with a 355/460 nm filter pair (Thermo Fisher Scientific) and reagents from Sigma, except ATP, NAD+, NADP+, NADH, glucose-6-phosphate dehydrogenase, malate dehydrogenase and L-lactate dehydrogenase (Roche Applied Science). Pyruvate kinase (PK) activity was determined according to (Hess and Wieker, 1974) and glucose-6-phosphate dehydrogenase activity (Passononneau and Lowry, 1993) was measured using a modified assay buffer (0.2 M TEA pH 7.8 with 3.5 mM MgCl2, 0.2 mM NADP+, 1.75 mM glucose-6-phosphate, 0.02% BSA). For phosphoenolpyruvate carboxykinase (PEPCK) activity (Petrescu et al., 1979), (50 mM Tris–HCl, 1 mM MnSO4, 1 mM PEP, 50 mM NaHCO3, 2 U MDH/mL, 0.25 mM NADH, 0.15 mM dGDP) was used. Glycogen phosphorylase activity (Passonneau and Lowry, 1993) was measured without 5′-AMP. Blood and perfusate glucose and lactate were measured using assay buffer (0.2 M Tris, 2 mM MgCl2, 0.33 M NADP+, 3 mM ATP, 0.9 U/ml glucose-6-phosphate dehydrogenase, pH 7.5 and 0.5 M glycine, 2.5% hydrazine solution (80%), pH 9 with 3 mM NAD+ and 33 U/mL L-lactate dehydrogenase), modified from Kunst et al., 1974 and Passonneau and Lowry, 1993, respectively. Glycogen was determined as glucose following alkaline degradation (Good et al., 1933). Real time PCR RNA was isolated from liver tissue samples using Trizol (Invitrogen), and absolute mRNA quantification was performed as described by Josefsen et al., 2010 except that cDNA was synthesized using the High Capacity RNA-to-cDNA Master Mix (Applied Biosystems) iScript cDNA synthesis kit (BioRAD). The following primers were used: mitochondrial PEPCK TTGGAGAGAATGCTCGTGTG and CCCTAGCCTGTTCTCTGTGC, cytosolic PEPCK GTCAACACCGACCTCCCTTA and CCCTAGCCTGTTCTCTGTGC, PK AGTCGGAGGTGGAAATTGTG and GTTCCACTTCGGTCACCAGT, peroxisome proliferator-activated receptor-γ coactivator (PGC)-1α GTCAACAGCAAAAGCCAC and TCTGGGGTCAGAGGAAGA. In all instances, the results were normalized relative to cyclophilin, which was quantified using the primers TTACAGGACATTGCGAGCAG and GTGGTCTTTGGGAAGGTGAA. Western blotting Tissue was homogenized as described above, denatured in the presence of 0.1 M DTT and electrophoresed in a 4–12% NuPAGE gel (Invitrogen). Transfer to nitrocellulose (Schleicher & Schüel) was performed for 1 h at 125 V and following blocking for 1 h at room temperature, the blot was incubated at 4 °C over night with anti-PGC-

658

K. Josefsen et al. / Neurobiology of Disease 40 (2010) 656–662

1α antibody (1:2000, Abcam). The secondary antibody was HRPlabeled goat-anti-rabbit (1:1000, DAKO) and the signals were visualized with Supersignal Femto (Pierce) and a Chemidoc XRS imager (BioRad). Statistics Values are presented as means ± SD. Student's t-test was used for comparison of AUC, peak blood values and for group comparison of enzyme activities and P b 0.05 was considered statistically significant. Error bars on graphs represent the ±95% confidence interval. The manuscript was prepared according to the International Committee of Medical Journal Editors: “Uniform requirements for manuscripts submitted to biomedical journals,” April 2010. Results

This is also reflected by the AUC (1.10 ± 1.6 vs. −5.6 ± 6, P = 0.001). Following cessation of exercise, the glucose concentration increased abruptly in the control subjects while no increase was seen in HD patients (2.0 ± 0.5 vs. 0.0 ± 0.2 mM, P b 2 × 10−6). During the recovery period, glucose gradually normalized in the control group, while it remained constant in the HD patients. Blood lactate concentration is shown in Fig. 1B. No differences were seen in maximal concentration or elimination of lactate (−0.17 ± 0.1 vs. −0.22 ± 0.1, P = 0.48). There was considerable inter-individual variation in the HD group compared with the control subjects, but no correlation between the lactate clearance rate and any of the disease severity parameters could be established. We also compared these results with a control group consisting of young, fit adults. Relative to this group, lactate elimination in HD patients was reduced (0.14 ± 0.02 vs. 0.37 ± 0.02 mM/min, P b 10−4). Comparing the two control groups, the younger group reached higher levels of lactate than the older control group (14.3 ± 2.7 vs. 10.7 ± 2.4 mM, P = 0.011), but there was no difference in the lactate elimination rate (P = 0.13).

Peripheral glucose and lactate metabolism in humans The time course of the blood glucose concentration in HD patients and in the age-matched control group during exercise and into the recovery period is shown in Fig. 1A. At rest, blood glucose levels were similar in the two groups of subjects, but during exercise, the concentration increased in the patients while it decreased in the control subjects (0.020 ± 0.07 vs. - 0.12 ± 0.12 mM / min, P = 0.004).

Fig. 1. Arterial lactate and glucose concentration in HD patients and control subjects during rest, exercise and recovery. (A) The rate of increase in the blood glucose concentration during exercise is similar in HD patients ( ) and age-matched controls (●), but during recovery the glucose peak seen in control subjects is virtually absent in HD patients. (B) No differences were found in resting arterial blood lactate concentration or in lactate disappearance in HD patients ( ) compared to age-matched controls (●), but HD patients metabolized lactate significantly slower than the young control subjects (■).

Gluconeogenesis by lactate challenge in the R6/2 mouse model Since the result in the patients could be caused by several defects, we turned our attention to the R6/2 mouse. We first investigated gluconeogenesis by intraperitoneal lactate injection. Impaired lactate and glucose metabolism was also demonstrated in the mouse model (Fig. 2). The rise in blood glucose concentration in the R6/2 animals following lactate administration was only 9% of that seen in WT animals

Fig. 2. Glucose production and lactate disappearance in fasted R6/2 mice. Tail blood glucose (A) and lactate (B) concentration following i.p. injection of lactate in R6/2 ( ) and WT (●) mice. Lactate levels reached higher blood concentrations, and the subsequent increase in blood glucose was reduced in R6/2 mice compared to WT animals. Control injections with NaCl are shown in broken lines. (N = 19 WT + 20 R6/2).

K. Josefsen et al. / Neurobiology of Disease 40 (2010) 656–662

659

corresponding to the formation of one glucose molecule from two lactate molecules, suggesting that the increase in glucose is due to gluconeogenesis from lactate. This as expected, as the mice were fasted prior to the experiment and thus not capable of contributing glucose by glycogenolysis. As the liver is probably responsible for a major part of the lactate metabolism, we investigated in perfused liver whether impaired gluconeogenesis could explain the reduced blood lactate clearance and glucose release. These studies (Fig. 3A, B) showed that the amount of glucose formed increased three-fold in WT mice (AUC: 63 ± 33 vs. 195 ± 120 mM; P = 0.01) when lactate was added to the perfusion medium, whereas no such increase was seen using livers from R6/2 mice, suggesting reduced gluconeogenesis in the R6/2 mouse livers. The net glucose production in WT animals is 34.5 μmoles per 30 min, which is comparable with the maximal uptake of lactate (2.34 μmol/g·min−1) found in rat liver (Sumida et al., 2006). Enzyme activities and expression levels To substantiate these findings, we measured the activity of PEPCK, a key regulatory enzyme in liver gluconeogenesis (Pilkis and Granner, 1992), PK, glucose-6-phosphate dehydrogenase (the entry enzyme to the pentose phosphate pathway) and glycogen phosphorylase (catalyzes the first step in glucose release from liver glycogen) as shown in Table 1. PEPCK activity was reduced by ~20% in liver tissue from R6/2 mice. The reduction was specific for liver, as it was not seen in the other major gluconeogenic organ, the kidney, from R6/2 animals. PK activity was increased by 58% in R6/2 mice vs. controls. The mRNA level of the cytosolic (but not of the mitochondrial) isoform of PEPCK was reduced in the liver, consistent with the functional findings for the enzyme, since the cytoplasmic form of PEPCK accounts for 90% of the activity in mice (Hanson, 2009) and thus suggests that the reduction in enzyme activity seen in R6/2 mice is caused by reduced transcription. The increased PK activity could not be explained by this mechanism, however, since there was no difference in PK mRNA levels between the groups. Further, glucose6-phosphate dehydrogenase activity was normal in R6/2 mice, suggesting a normal pentose phosphate pathway flow. PGC-1α is a stimulator of thermogenesis, which participates in both carbohydrate- and lipid metabolism, and its activity is reduced in HD patients (Chaturvedi et al., 2009; Phan et al., 2009) and in a HD mouse model (Weydt et al., 2006). We did not find differences in

Fig. 3. In situ liver perfusion in non-fasted R6/2 mice. Glucose concentration in perfusate without (A) and with (B) lactate in perfusion buffer in R6/2 ( ) and WT mice (●). The glucose release is significantly higher (P=0.01) in WT than in R6/2 mice. (A: N = 9 WT+ 3 R6/2, B: N = 6 WT+ 6 R6/2).

(area under curve (AUC): 35.6 ± 272 vs. 386.0 ± 188; n = 20 + 20, P b 0.001). Also, the weight-adjusted dosages of lactate resulted in peak blood lactate concentrations which were 60% higher in R6/2 animals than in WT controls (20.7± 5.0 vs. 12.8 ± 2.8 mM; P b 10−6). Further, the fraction (AUC) of lactate cleared during the first hour was greater in WT than in R6/2 animals (67% vs. 53%, P b 0.001). During the first hour, the rate of increase in blood glucose (0.06 mM/min) matched the decrease in blood lactate concentration (0.13 mM/min) in WT mice,

Table 1 Liver, brain, muscle and kidney enzyme activities and mRNA levels of key carbohydrate metabolism enzymes. Tissue was obtained from anesthetized animals and quick frozen until quantification of enzyme activities, mRNA and glycogen. Western blotting was used for quantification of PGC-1α protein. R6/2 Enzyme activities (U/mg protein) PEPCK, liver × 103 PEPCK, kidney × 103 Pyruvate kinase, liver Pyruvate kinase, muscle Pyruvate kinase, brain Glucose-6-phosphate dehydrogenase Glycogen phosphorylase activity

7.44 ± 1.2 5.26 ± 1.6 41 ± 19 3.66 ± 0.7 2.70 ± 0.7 14 ± 8 76 ± 20

WT 8.88 ± 0.5 5.57 ± 1.3 26 ± 18 3.56 ± 0.9 2.61 ± 0.5 11 ± 13 73 ± 164

N

P

% change

8+8 10 + 11 15 + 20 12 + 10 13 + 11 15 + 19 8+8

0.007 0.65 0.02 0.78 0.72 0.4 0.7

19% ↓ – 58% ↑ – – – –

b 0.001 0.6 0.2

37% ↓ – –

mRNA levels (a.u.) Cytosolic PEPCK, liver Mitochondrial PEPCK, liver Pyruvate kinase mRNA, liver

0.059 ± 0.02 2.31 ± 1.9 × 10−4 3.57 ± 1.6 × 10− 3

0.096 ± 0.03 1.93 ± 0.6 × 10− 4 2.68 ± 1.2 × 10−3

17 + 21 10 + 10 10 + 9

Liver glycogen content (mg/g liver tissue) Fed mice Fasted mice

44.97 ± 1.2 1.72 ± 1.3

47.72 ± 0.7 4.44 ± 2.4

10 + 10 10 + 11

0.12 0.0045

– 61% ↓

14 + 14 12 + 11

0.70 0.79

– –

Transcription factors (a.u.) PGC-1α, protein PGC-1α, mRNA a.u., arbitrary units.

1.04 ± 0.2 2.00 ± 1.2 × 10−3

1 ± 0.3 2.16 ± 1.80 × 10−3

660

K. Josefsen et al. / Neurobiology of Disease 40 (2010) 656–662

Table 2 Brain uptake of oxygen and glucose in HD patients and healthy volunteers. Uptake was calculated based on arterio-venous difference, assuming similar cerebral blood flow in all subjects (Quistorff et al., 2008). The uptake was estimated during a 15–20 min exercise interval and during the subsequent 30–60 min of recovery. N = 8 and 9 for control subjects and HD patients, respectively. P-values comparing control subjects and HD patients are given.

Exercise

Recovery

Controls HD patients P Controls HD patients P

Glucose (mmol/min)

O2 (mmol/min)

0.555 ± 0.13 0.579 ± 0.24 0.78 0.402 ± 0.12 0.421 ± 0.12 0.72

2.08 ± 0.81 2.59 ± 0.41 0.12 2.71 ± 0.94 2.62 ± 0.73 0.41

PGC-1α mRNA or protein expression between R6/2 and control mice in liver tissue.

Glycogen metabolism We did not find any indication that glycogenolysis could be responsible for the lower blood glucose levels in R6/2 mice: glycogen phosphorylase activity was not altered and glucose release from the liver was similar in non-fasted R6/2 and control mice perfused without lactate. Thus, liver glycogen content was only reduced in R6/2 mice during fasting (Table 1).

Cerebral metabolism Since studies have reported lactate accumulation in the brain of HD patients, we finally investigated cerebral oxygen and glucose consumption and found that it did not differ in the HD group compared with the control group of young individuals (Table 2). For lactate, the evaluation is more difficult, because lactate uptake depends on lactate concentration (Quistorff et al., 2008) which is changing dramatically during the experiment, as shown in Fig. 1. However, since net lactate uptake may be evaluated against the arterial lactate concentration, the kinetics of the lactate uptake may be obtained as shown in Fig. 4. The lactate uptake was linearly dependent on arterial lactate within the concentration range experienced in the experiments, i.e. 1.5–12 mM for the control group subjects and 1.5– 10 mM for HD patients. Thus, the apparent Km value for lactate uptake in the brain in vivo was N 10 mM. The data also show that the kinetics of net lactate uptake of the control group and the HD patients is similar with a slope of about 0.11 mmol·min−1/mM.

Fig. 4. Lactate consumption by the brain as a function of the arterial lactate concentration in HD patients and in controls. The arterio-venous lactate difference was used to calculate the uptake by the brain using the Fick principle (see methods). This was then correlated to the actual arterial lactate concentration. No difference between HD patients ( ) and control individuals (●) is seen (regression lines: Ycontrol = 0.1189X − 0.1166, R = 0.9849 and YHD = 0.106X − 0.0766, R = 0.712).

Discussion The key finding of the present paper is that HD patients and R6/2 mice display an impaired capacity for hepatic glucose formation. In the patients, the spike in blood glucose concentration normally seen immediately after discontinuation of intense exercise is absent, and in the mouse model hepatic glucose output is reduced in response to a lactate load. The abrupt increase in blood glucose in healthy individuals immediately after exercise is attributed to a stimulated liver glucose output induced by the enhanced catecholamine level associated with high intensity exercise (Hespel et al., 1986). When exercise suddenly stops, catecholamine output continues for a short while producing the hyperglycemic episode shown in Fig. 1A (Dalsgaard, 2006). This phenomenon did not occur in the HD patients, suggesting a reduced rate of hepatic glucose release, but as the patients were not starved prior to exercise, both glycogenolysis and gluconeogenesis could be impaired. Since liver is the most significant organ for glucose release in the mammalian organism, we investigated these functions in mouse R6/2 liver. The data support reduced liver gluconeogenesis as the main reason for the lack of glucose response, since we found reduced activity of the flux-generating enzyme of hepatic gluconeogenesis, PEPCK, increased activity of the liver PK, which is consistent with increased PK protein level in R6/2 brain (Zabel et al., 2009) and normal glycogen phosphorylase activity (Table 1). However, since the participants in the human study were not starving during the experiment, impaired glycogenolysis cannot be ruled out either. Patients therefore need to be examined in the fasting state. Abnormal liver function has been described in HD patients as reduced urea cycle activity (Chiang et al., 2007) and unspecific morphological changes (Chiu et al., 1975; Bolt and Lewis, 1973). It is reasonable to attribute the reduced PEPCK activity to reduced PEPCK mRNA. This could be a direct consequence of the expression of mutant huntingtin, since huntingtin regulates and interact with several transcription factors including SP1, CREB, CBP and AP-1 (Thomas, 2006) that bind to elements in the PEPCK promoter (Yang et al., 2009). Although we did not find changes in the expression of PGC-1α, this could also be involved, since we did not investigate posttranslational modifications. PGC-1α is a key regulator of gluconeogenesis (Yoon et al., 2001) by regulating PEPCK expression (Rhee et al., 2003), it is down-regulated in muscle (Chaturvedi et al., 2009) and adipose tissue (Phan et al., 2009) from HD patients and its signaling of cold environments to the uncoupling protein 1 (UCP-1) is inefficient in HD mice (Weydt et al., 2006). During intense exercise, muscle is by far the major lactateproducing organ, and lactate values exceeding 30 mM is seen during competitive rowing (Nielsen et al., 2002). Exercise is therefore efficient for raising lactate in order to study its subsequent clearance from blood. We found a N2-fold lower lactate clearance in affected versus control animals in the mouse model, but not among HD patients (Fig. 1B). Further, we did not see increased resting plasma lactate values in symptomatic HD patients as previously reported (Duran et al., 2010) or reduced lactate clearance in the older control group compared with the younger, although that has been described (Deschenes et al., 2006; Deschenes et al., 2009). This, however, does not imply that that hepatic lactate clearance in HD patients is normal. Although lactate is first, and probably foremost cleared by the liver (Ross et al., 1967), also skeletal muscle (Secher et al., 1977), brain (Dalsgaard, 2006; Quistorff et al., 2008), heart (Gertz et al., 1988), and kidney (Lauritsen et al., 2002) contribute. Thus, following exercise, the patients are likely to have increased peripheral lactate uptake. The specific contribution of the liver in lactate removal must therefore be investigated separately. Increased cortisol levels and decreased insulin levels have been demonstrated in blood and urine from HD patients as well as in the R6/2 mouse model (Bjorkqvist et al., 2006; Leblhuber et al., 1995;

K. Josefsen et al. / Neurobiology of Disease 40 (2010) 656–662

Saleh et al., 2009; Aziz et al., 2009; Andreassen et al., 2002; Hurlbert et al., 1999). Both high cortisol and low insulin levels stimulate gluconeogenesis, but apparently not enough to normalize gluconeogenesis in patients or in animals. Further, the lack of the glucose response after exercise, as seen in the human study, constitutes a robust indication of a pathological liver response, likely to be independent of an insulin signal. We also estimated the net uptake of glucose, oxygen and lactate over the brain of the human subjects. The uptake was calculated according to the Fick principle as the arterio-venous concentration difference multiplied by the cerebral blood flow, as explained in methods. The uptake of oxygen and glucose was almost constant during the experiment (rest, exercise and recovery) and the HD patients did not differ from the control group (Table 2). Lactate uptake by the brain is controlled by monocarboxylate carriers, of which 4 different proteins have been described, with Km values varying from ~ 0.7 to ~ 4 mM (Simpson et al., 2007). In the present experiments the arterial lactate concentration varied from ~ 1 mM at rest to N10 mM by the end of exercise. It was therefore possible to analyze the kinetics of brain net lactate uptake as shown in Fig. 4. Within the concentration range of lactate to which the brain was exposed, we observed a linear relation between uptake and arterial concentration with similar uptake rates in HD patients and control subjects (Fig. 4). This indicates an apparent Km of lactate uptake in vivo considerably higher than 10 mM, which seems to be somewhat at variance with the notion of low-Km monocarboxylate carriers as the major contributors to lactate uptake (Bergersen, 2007). In any case, the kinetics of lactate uptake in the HD patients does not differ from the control group and we therefore conclude that the lactate metabolism of the HD brain is maintained, including the ability to accelerate anaerobic metabolism during activation (van Hall et al., 2009). Conclusion HD patients had reduced systemic glucose response after exercise. In the R6/2 mouse model, in which we made similar observations, we conclude that HD involves impaired liver gluconeogenesis, but in humans reduced glycogenolysis may also play a role. We did not find any effects of HD on brain glucose and lactate metabolism. A quantitative evaluation of actual liver gluconeogenesis in HD patients is warranted. It should also be clarified whether liver function and disease severity are correlated and whether treatments aimed at improving liver function in HD patients could ameliorate their symptoms and improve quality of life. Due to interactions between liver and brain in illnesses like liver cirrhosis (Eroglu and Byrne, 2009), it is of interest to direct attention to the liver function in HD patients as their disease progresses. The exercise test suggested in this study might prove useful in that regard. Acknowledgments We wish to thank Ib Terkelsen for technical laboratory help with the human studies and blood analyses, Sverre Haveland from Maquet Nordic for donating the oxygenator and for helpful discussions regarding the design of the micro-oxygenator and Wim Snoeks, Cardiac Care, The Netherlands, for advice regarding the perfusion system. References Andreassen, O.A., Dedeoglu, A., Stanojevic, V., et al., 2002. Huntington's disease of the endocrine pancreas: insulin deficiency and diabetes mellitus due to impaired insulin gene expression. Neurobiol. Dis. 11, 410–424. Aziz, N.A., Pijl, H., Frolich, M., van der Graaf, A.W., Roelfsema, F., Roos, R.A., 2009. Increased hypothalamic-pituitary-adrenal axis activity in Huntington's disease. J. Clin. Endocrinol. Metab. 94, 1223–1228.

661

Bergersen, L.H., 2007. Is lactate food for neurons? Comparison of monocarboxylate transporter subtypes in brain and muscle. Neuroscience 145, 11–19. Bjorkqvist, M., Petersen, A., Bacos, K., et al., 2006. Progressive alterations in the hypothalamic-pituitary-adrenal axis in the R6/2 transgenic mouse model of Huntington's disease. Hum. Mol. Genet. 15, 1713–1721. Bolt, J.M., Lewis, G.P., 1973. Huntington's chorea. A study of liver function and histology. Q. J. Med. 42, 151–174. Chaturvedi, R.K., Adhihetty, P., Shukla, S., et al., 2009. Impaired PGC-1alpha function in muscle in Huntington's disease. Hum. Mol. Genet. 18, 3048–3065. Chiang, M.C., Chen, H.M., Lee, Y.H., et al., 2007. Dysregulation of C/EBPalpha by mutant Huntingtin causes the urea cycle deficiency in Huntington's disease. Hum. Mol. Genet. 16, 483–498. Chiu, E., Mackay, I.R., Bhathal, P.B., 1975. Hepatic morphology in Huntington's chorea. J. Neurol. Neurosurg. Psychiatry 38, 1000–1002. Dalsgaard, M.K., 2006. Fuelling cerebral activity in exercising man. J. Cereb. Blood Flow Metab. 26, 731–750. Dautry, C., Conde, F., Brouillet, E., et al., 1999. Serial 1H-NMR spectroscopy study of metabolic impairment in primates chronically treated with the succinate dehydrogenase inhibitor 3-nitropropionic acid. Neurobiol. Dis. 6, 259–268. Deschenes, M.R., Carter, J.A., Matney, E.N., Potter, M.B., Wilson, M.H., 2006. Aged men experience disturbances in recovery following submaximal exercise. J. Gerontol. A Biol. Sci. Med. Sci. 61, 63–71. Deschenes, M.R., Connell, A.M., Jackson, E.M., Taylor, J.L., Glass, E.K., 2009. A comparison of physiological variables in aged and young women during and following submaximal exercise. Am. J. Hum. Biol. 21, 836–843. Duran, R., Barrero, F.J., Morales, B., Luna, J.D., Ramirez, M., Vives, F., 2010. Oxidative stress and plasma aminopeptidase activity in Huntington's disease. J. Neural Transm. 117, 325–332. Eroglu, Y., Byrne, W.J., 2009. Hepatic encephalopathy. Emerg. Med. Clin. North Am. 27, 401–414. Ferrier, C., Jennings, G.L., Eisenhofer, G., et al., 1993. Evidence for increased noradrenaline release from subcortical brain regions in essential hypertension. J. Hypertens. 11, 1217–1227. Gertz, E.W., Wisneski, J.A., Stanley, W.C., Neese, R.A., 1988. Myocardial substrate utilization during exercise in humans. Dual carbon-labeled carbohydrate isotope experiments. J. Clin. Invest. 82, 2017–2025. Good, C.A., Kramer, H., Somogyi, M., 1933. The determination of glycogen. J. Biol. Chem. 100, 485–491. Hanson, R.W., 2009. Thematic minireview series: a perspective on the biology of phosphoenolpyruvate carboxykinase 55 years after its discovery. J. Biol. Chem. 284, 27021–27023. Harms, L., Meierkord, H., Timm, G., Pfeiffer, L., Ludolph, A.C., 1997. Decreased N-acetylaspartate/choline ratio and increased lactate in the frontal lobe of patients with Huntington's disease: a proton magnetic resonance spectroscopy study. J. Neurol. Neurosurg. Psychiatry 62, 27–30. Hespel, P., Lijnen, P., Vanhees, L., et al., 1986. Differentiation of exercise-induced metabolic responses during selective beta 1- and beta 2-antagonism. Med. Sci. Sports Exerc. 18, 186–191. Hess, B., Wieker, H.J., 1974. In: Bergmeyer, H. (Ed.), Merhods in Enzymatic Analysis. Verlag Chemie, Weinheim, pp. 804–811. Hoang, T.Q., Bluml, S., Dubowitz, D.J., et al., 1998. Quantitative proton-decoupled 31P MRS and 1H MRS in the evaluation of Huntington's and Parkinson's diseases. Neurology 50, 1033–1040. Hurlbert, M.S., Zhou, W., Wasmeier, C., Kaddis, F.G., Hutton, J.C., Freed, C.R., 1999. Mice transgenic for an expanded CAG repeat in the Huntington's disease gene develop diabetes. Diabetes 48, 649–651. Ide, K., Schmalbruch, I.K., Quistorff, B., Horn, A., Secher, N.H., 2000. Lactate, glucose and O2 uptake in human brain during recovery from maximal exercise. J. Physiol. 522, 159–164. Jenkins, B.G., Koroshetz, W.J., Beal, M.F., Rosen, B.R., 1993. Evidence for impairment of energy metabolism in vivo in Huntington's disease using localized 1H NMR spectroscopy. Neurology 43, 2689–2695. Jorgensen, L.G., Perko, M., Hanel, B., Schroeder, T.V., Secher, N.H., 1992. Middle cerebral artery flow velocity and blood flow during exercise and muscle ischemia in humans. J. Appl. Physiol. 72, 1123–1132. Josefsen, K., Lee, Y.C., Thams, P., Efendic, S., Nielsen, J.H., 2010. AKAP 18 alpha and gamma have opposing effects on insulin release in INS-1E cells. FEBS Lett. 584, 81–85. Kunst, A., Draeger, B., Ziegenhorn, J., 1974. In: Bergmayer, H.U. (Ed.), Methods of Enzymatic Analysis. Verlag Chemie, Weinheim, pp. 163–172. Lauritsen, T.L., Grunnet, N., Rasmussen, A., Secher, N.H., Quistorff, B., 2002. The effect of hepatectomy on glucose homeostasis in pig and in man. J. Hepatol. 36, 99–104. Leblhuber, F., Peichl, M., Neubauer, C., et al., 1995. Serum dehydroepiandrosterone and cortisol measurements in Huntington's chorea. J. Neurol. Sci. 132, 76–79. Li, S.H., Schilling, G., Young III, W.S., et al., 1993. Huntington's disease gene (IT15) is widely expressed in human and rat tissues. Neuron 11, 985–993. Mangiarini, L., Sathasivam, K., Seller, M., et al., 1996. Exon 1 of the HD gene with an expanded CAG repeat is sufficient to cause a progressive neurological phenotype in transgenic mice. Cell 87, 493–506. Martin, W.R., Wieler, M., Hanstock, C.C., 2007. Is brain lactate increased in Huntington's disease? J. Neurol. Sci. 263, 70–74. Newsholme, E.A., Leech, A., 1983. Biochemistry for the medical Sciences. Weiley, New York, pp. 209–229. Nicoli, F., Vion-Dury, J., Maloteaux, J.M., et al., 1993. CSF and serum metabolic profile of patients with Huntington's chorea: a study by high resolution proton NMR spectroscopy and HPLC. Neurosci. Lett. 154, 47–51.

662

K. Josefsen et al. / Neurobiology of Disease 40 (2010) 656–662

Nielsen, H.B., 1999. pH after competitive rowing: the lower physiological range? Acta Physiol. Scand. 165, 113–114. Nielsen, H.B., Bredmose, P.P., Strömstad, M., Volianitis, S., Quistorff, B., Secher, N.H., 2002. Bicarbonate attenuates arterial desaturation during maximal exercise in humans. J. Appl. Physiol. 93, 724–731. Norremolle, A., Riess, O., Epplen, J.T., Fenger, K., Hasholt, L., Sorensen, S.A., 1993. Trinucleotide repeat elongation in the Huntingtin gene in Huntington disease patients from 71 Danish families. Hum. Mol. Genet. 2, 1475–1476. Passonneau, J.V., Lowry, O.H., 1993. Enzymatic analysis: a practical guide. Humana Press, New Jersey. Petrescu, I., Bojan, O., Saied, M., Barzu, O., Schmidt, F., Kuhnle, H.F., 1979. Determination of phosphoenolpyruvate carboxykinase activity with deoxyguanosine 5′-diphosphate as nucleotide substrate. Anal. Biochem. 96, 279–281. Phan, J., Hickey, M.A., Zhang, P., Chesselet, M.F., Reue, K., 2009. Adipose tissue dysfunction tracks disease progression in two Huntington's disease mouse models. Hum. Mol. Genet. 18, 1006–1016. Pilkis, S.J., Granner, D.K., 1992. Molecular physiology of the regulation of hepatic gluconeogenesis and glycolysis. Annu. Rev. Physiol. 54, 885–909. Putman, C.T., Jones, N.L., Lands, L.C., Bragg, T.M., Hollidge-Horvat, M.G., Heigenhauser, G.J., 1995. Skeletal muscle pyruvate dehydrogenase activity during maximal exercise in humans. Am. J. Physiol. 269, E458–E468. Quistorff, B., Grunnet, N., Cornell, N.W., 1985. Digitonin perfusion of rat liver. A new approach in the study of intra-acinar and intracellular compartmentation in the liver. Biochem. J. 226, 289–297. Quistorff, B., Secher, N.H., Van Lieshout, J.J., 2008. Lactate fuels the human brain during exercise. FASEB J. 22, 3443–3449. Rhee, J., Inoue, Y., Yoon, J.C., et al., 2003. Regulation of hepatic fasting response by PPARgamma coactivator-1alpha (PGC-1): requirement for hepatocyte nuclear factor 4alpha in gluconeogenesis. Proc. Natl. Acad. Sci. U. S. A. 100, 4012–4017. Ross, B.D., Hems, R., Freedland, R.A., Krebs, H.A., 1967. Carbohydrate metabolism of the perfused rat liver. Biochem. J. 105, 869–875. Saleh, N., Moutereau, S., Durr, A., et al., 2009. Neuroendocrine disturbances in Huntington's disease. PLoS One 4, e4962.

Sathasivam, K., Hobbs, C., Turmaine, M., et al., 1999. Formation of polyglutamine inclusions in non-CNS tissue. Hum. Mol. Genet. 8, 813–822. Secher, N.H., Clausen, J.P., Klausen, K., Noer, I., Trap-Jensen, J., 1977. Central and regional circulatory effects of adding arm exercise to leg exercise. Acta Physiol. Scand. 100, 288–297. Simpson, I.A., Carruthers, A., Vannucci, S.J., 2007. Supply and demand in cerebral energy metabolism: the role of nutrient transporters. J. Cereb. Blood Flow Metab. 27, 1766–1791. Sumida, K.D., Urdiales, J.H., Donovan, C.M., 2006. Impact of flow rate on lactate uptake and gluconeogenesis in glucagon-stimulated perfused livers. Am. J. Physiol. Endocrinol. Metab. 290, E185–E191. The Huntington's Disease Collaborative Research Group, 1993. A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington's disease chromosomes. Cell 72, 971–983. Thomas, E.A., 2006. Striatal specificity of gene expression dysregulation in Huntington's disease. J. Neurosci. Res. 84, 1151–1164. Tsang, T.M., Woodman, B., McLoughlin, G.A., et al., 2006. Metabolic characterization of the R6/2 transgenic mouse model of Huntington's disease by high-resolution MAS 1H NMR spectroscopy. J. Proteome Res. 5, 483–492. van Hall, G., Stromstad, M., Rasmussen, P., et al., 2009. Blood lactate is an important energy source for the human brain. J. Cereb. Blood Flow Metab. 29, 1121–1129. Van Raamsdonk, J.M., Murphy, Z., Selva, D.M., et al., 2007. Testicular degeneration in Huntington disease. Neurobiol. Dis. 26, 512–520. Weydt, P., Pineda, V.V., Torrence, A.E., et al., 2006. Thermoregulatory and metabolic defects in Huntington's disease transgenic mice implicate PGC-1alpha in Huntington's disease neurodegeneration. Cell Metab. 4, 349–362. Yang, J., Reshef, L., Cassuto, H., Aleman, G., Hanson, R.W., 2009. Aspects of the control of phosphoenolpyruvate carboxykinase gene transcription. J. Biol. Chem. 284, 27031–27035. Yoon, J.C., Puigserver, P., Chen, G., et al., 2001. Control of hepatic gluconeogenesis through the transcriptional coactivator PGC-1. Nature 413, 131–138. Zabel, C., Mao, L., Woodman, B., et al., 2009. A large number of protein expression changes occur early in life and precede phenotype onset in a mouse model for huntington disease. Mol. Cell. Proteomics 8, 720–734.