- Email: [email protected]
K alkaline phosphatase gene expression in renal cell carcinoma: Plausible role in tumorigenesis
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54
BIOCHI4462_proof ■ 9 June 2014 ■ 1/9
Biochimie xxx (2014) 1e9
Contents lists available at ScienceDirect
Biochimie journal homepage: www.elsevier.com/locate/biochi
Research paper
Reduced L/B/K alkaline phosphatase gene expression in renal cell carcinoma: Plausible role in tumorigenesis Q3
Ujjawal Sharma a, Deeksha Pal a, Shrawan Kumar Singh b, Nandita Kakkar c, Rajendra Prasad a, * a b c
Department of Biochemistry, PGIMER, Chandigarh, India Department of Urology, PGIMER, Chandigarh, India Department of Histopathology, PGIMER, Chandigarh, India
a r t i c l e i n f o
a b s t r a c t
Article history: Received 15 April 2014 Accepted 28 May 2014 Available online xxx
Renal cell carcinoma (RCC) is the most common kidney cancer in adults. Although several genes have been found to be involved in carcinogenesis of RCC, more great efforts are needed to identify new genes which are responsible for the process. Clear cell RCC, originated from proximal tubule cells, is the most common pathological type of RCC. Alkaline phosphatase (ALP) is a marker enzyme of brush border membrane of proximal tubular cells. Our previous studies showed a significant decreased activity of Liver/Bone/Kidney (L/B/K) alkaline phosphatase in RCC. In the present study, we explored the molecular basis of the decreased activity of ALP in RCC. Immunohistochemistry, immunofluorescence and flow cytometry analysis showed decreased ALP protein in RCC. Additionally, real time PCR documented significantly reduced ALP gene expression (P ¼ 0.009). Moreover, RCC cell lines (ACHN and A498) transfected with full length L/B/K cDNA showed decreased migratory property as well as viability of these cells as compared with controls (P ¼ 0.000). Further, L/B/K ALP cDNA transfected cells (ACHN and A498) showed significant increased apoptosis as compared to control (P ¼ 0.000). These findings suggest the new role of ALP in cell viability and apoptosis and involvement in RCC tumorigenesis. However, further studies are needed to explore the exact molecular mechanism. © 2014 Published by Elsevier Masson SAS.
Keywords: Alkaline phosphatase Renal cell carcinoma Transfection Apoptosis Cell lines
1. Introduction Renal cell carcinoma (RCC) is the most common type of kidney cancer which scores about 90e95% of neoplasm originating from proximal tubular epithelium of kidney [1]. It is the 10th leading cause of death, approximately 11,600 people die every year from this disease worldwide [2]. Strikingly, RCC is one of the most chemo and radio-resistant tumor [3]. Surgical excision is only curative treatment for localized RCC tumor using radical nephrectomy [4]. The plasma membrane of cancer cells behaved differently from that of normal cells [5]. Brush border membrane (BBM) of renal epithelial cells is a mosaic of structural and functional proteins intercalated in lipid bilayer [6]. It is reported that the BBM enzymes activity and lipid composition are altered in RCC [7,8] which may partially determine the biological behavior of tumors.
* Corresponding author. Tel.: þ91 172 2755178; fax: þ91 172 2744401, þ91 172 2745078. E-mail address: [email protected] (R. Prasad).
Alkaline phosphatases (orthophosphoric monoester phosphohydrolase, E.C. 3.1.3.1, alkaline optimum) are a group of phosphatidyl inositol-anchored membrane glycoproteins with wide substrate specificity [9,10]. Four major ALP isoenzymes have been characterized on the basis of physicochemical properties. The heat labile isoenzyme represents the Liver/Bone/Kidney (L/B/K) or tissue non specific form which is present in the most cell type [11]. Ectopic expression of ALP has been associated with a variety of cancers for instances, placental ALP and germ cell ALP are overexpressed in cells derived from breast cancer and choriocarcinoma respectively [12,13]. Increased expression of intestinal ALP has also been reported in hepato-cellular carcinoma [14]. However, the aberrant expression of ALP gene in cancer cell has led to connotation whether ALP isoenzyme may involved in tumorigenesis. In pertaining to RCC, we have previously demonstrated a drastically reduced activity of ALP [8,15]. In view of these facts, the present study was planned to investigate the L/B/K ALP gene expression in RCC. Further, we investigated the involvement of ALP gene expression in tumorigenesis by transfecting L/B/K ALP cDNA in renal cell carcinoma cell lines.
http://dx.doi.org/10.1016/j.biochi.2014.05.011 0300-9084/© 2014 Published by Elsevier Masson SAS.
Please cite this article in press as: U. Sharma, et al., Reduced L/B/K alkaline phosphatase gene expression in renal cell carcinoma: Plausible role in tumorigenesis, Biochimie (2014), http://dx.doi.org/10.1016/j.biochi.2014.05.011
55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
BIOCHI4462_proof ■ 9 June 2014 ■ 2/9
2
U. Sharma et al. / Biochimie xxx (2014) 1e9
2. Materials and methods 2.1. Patients The present study was approved by institute ethics committee and informed consent was obtained from patients. Tumorous tissues of RCC and corresponding adjacent normal kidney tissues were dissected out following nephrectomy. All tissue samples were snap frozen in liquid nitrogen and stored at 80 C till further use.
(Santa Cruz, USA). Unlabeled renal cells were used as control. Immunostaining acquisition and analysis were performed on 10,000 events gated on viable cells using a FACScan flow cytometer with CellQuest software (BD Biosciences, USA). Results were expressed as mean fluorescence intensity. 2.6. Total RNA isolation and real time-PCR
Goat polyclonal IgG antibody directed against the human L/B/K ALP (Santa Cruz, USA) was used to detect L/B/K ALP according to the method as previously described [16]. Briefly, 4 mm tissue sections were cut, dewaxed, and incubated in absolute methanol solution with 0.3 mL of hydrogen peroxide for 30 min. Antigen retrieval was carried out by boiling the slides in 10 mM citrate buffer, pH 6.0 for 15 min. Slides were then treated with blocking serum for 10 min after which they were incubated with 1:200 diluted primary antibody (anti L/B/K ALP) at 37 C for 60 min followed by 1:50 diluted HRP anti-goat IgG (Bangalore Geni, India). Chromogen detection was performed with diaminobenzidine (DAKO Corp., Carpinteria, CA) solution (0.5 mL of stock diaminobenzidine in 4.5 mL of Tris buffer with 20 mL of hydrogen peroxide). Slides were counterstained with hematoxylin and photographed. A modified visual semi quantification method was used. The semi quantification of immunointensity was scored on a scale of: 0, negative; 1, weak, 2, moderate; 3, strong; 4, very strong.
Total RNA was isolated from 100 mg tissue samples using PureLink™ RNA mini Kit (Invitrogen, CA, USA), according to the manufacturer's protocol. The RNA samples were then stored at 80 C until use. DNase treatment was given to all RNA samples prior to cDNA synthesis. Reverse transcription reaction was carried out in 20 mL volume, containing 1 mg of total RNA using Super scriptIII first strand synthesis system (Invitrogen, CA, USA). Oligonucleotide primers were L/B/K ALP, CGTGGATCCGTGTGTGTGATCAAAGGC and CGGAATTCATGGCAGGTGTAAGAGAAAGG; b-actin, CGTGACATTAA GGAGAAG CTG and CTAGAAGCATTTGCGGTGGAC. Real-time analysis was performed on 7300 RT-PCR system (Roche Indianapolis, IN) using the SYBR Green PCR Master Mix (TaKaRa, Madison, WI) using following conditions: initial denaturation for 5 min at 94 C followed by denaturation for 30 s at 94 C, annealing for 30 s at 55 C, elongation for 30 s at 72 C, totally 35 cycles, and ending with a final 5 min elongation at 72 C. Each assay included a no-template control and cDNA template (in triplicate). The expression levels of L/B/K ALP were calculated by relative quantification using b-actin transcript levels for normalization. The fold change in mRNA expression was calculated by comparative DDCt method [18].
2.3. Immunofluorescence
2.7. Cell lines
The immunofluorescence analysis of ALP in RCC and normal kidney sections was carried out as described earlier [16]. In brief, frozen sections of tissue were fixed by keeping at 80 C for one day. The 4 mm tissue sections were incubated with 1:100 diluted primary antibody (anti L/B/K ALP) (Santa Cruz, USA) at 37 C for 45 min in a humified chamber. After washing with PBS (pH 7.0), the slides were incubated with FITC labeled anti-goat IgG (1:50 dilution) at 37 C for 45 min. The slides were again washed with PBS (pH 7.0). The sections were mounted in 10% glycerin, viewed under fluorescence microscope (LEICA MPS52) and photographed. The semi quantification of immunointensity was scored on a scale of: 0, negative; 1, weak, 2, moderate; 3, strong; 4, very strong.
Renal cell carcinoma cell lines (ACHN and A498) were obtained from the National Centre for Cell Sciences (Pune, India), cultured in Dulbecco's modified Eagle's medium (Sigma, USA) supplemented with penicillin (100 U/mL), streptomycin (100 mg/mL) (Life Technologies, Paisley, Scotland), and 10% heat-inactivated fetal calf serum (FCS; Biological Industries, Kibbutz Beth Haemek, Israel). Cells were maintained at 37 C in a humidified 5% CO2 atmosphere.
2.2. Immunohistochemistry
2.8. Plasmid The ALP full length cDNA cloned in expression vector pcDNA 3.1 was purchased from Sino Biological Corp., China.
2.4. Renal cell isolation 2.9. Transient transfection Renal cells were isolated from both tumor and normal parenchyma as described by Hanari et al. [17]. The renal tissue from RCC as well as adjacent normal kidney were finely minced separately and suspended in 30 mL of the Hank's balanced salt solution (HBS) containing collagenase and hyaluronidase at a concentration of 1 mg/mL. The suspension was incubated for 30e40 min at 37 C and centrifuged at 130 g for 1 min. The pellet was suspended in 10e15 mL of HBS and re-centrifuged. Pellet was re-suspended in an incubation medium (140 mM KCl, 10 mM HEPES-Tris buffer (pH 7.4), 10 mM Mannose, 0.5 mM b-hydroxybutyrate, 2.5 mM Glutamine). Microscopic examination revealed that the preparation consisted of single cells with clusters of from 2 to 6 cells. 85% of the isolated cells were found viable on trypan blue staining.
ACHN and A498 cells (untransfected, cells alone) were grown until 60% confluence. Cells were washed with serum free medium and then transiently transfected with 2e3 mg of vector pcDNA 3.1 containing full-length ALP cDNA (ALP cDNA transfected) or vector alone (empty vector transfected) using LipofectAMINE reagent (Invitrogen) according to the manufacturer's protocol. Following transfection, cells were subjected to ALP expression/activity analysis at the time indicated in Results or in the figure legends by real time PCR and ALP activity assay according to the protocol described below. Untransfected and transfected cells were used for further experiments. 2.10. ALP activity
2.5. Flow cytometric analysis Cells isolated from normal and tumor renal tissue as described above were incubated with FITC labeled anti L/B/K ALP antibodies
Cellular ALP activity was analyzed in cells transfected with vector alone or with vector containing ALP cDNA and untransfected cells. Approximately 106 cells were homogenized in
Please cite this article in press as: U. Sharma, et al., Reduced L/B/K alkaline phosphatase gene expression in renal cell carcinoma: Plausible role in tumorigenesis, Biochimie (2014), http://dx.doi.org/10.1016/j.biochi.2014.05.011
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
BIOCHI4462_proof ■ 9 June 2014 ■ 3/9
U. Sharma et al. / Biochimie xxx (2014) 1e9
3
2.12. In vitro migration scratch assay
Table 1 Clinical and pathological characteristics of the patients. Patients (n) Gender, n (%) Male Female
50 38 (76) 12 (24)
Age (years), mean ± S.D.
53 ± 13.8
BMI, mean ± S.D.
23.67 ± 0.164
After 24 h of transfection, a pipette tip was used to make a scratch in the cell monolayer. The cells were then rinsed with PBS and replaced with fresh medium. Images of the scratches were acquired using a digital camera system coupled to a microscope after incubating the cells for 0 h, 24 h and 48 h of scratch generation. 2.13. Cell proliferation assessment by the MTT assay
Commonest presenting complaints Hematuria Flank pain Both Incidental radiological examination
30 (60) 22 (44) 18 (36) 5 (10)
Histologic subtype, n (%) Clear cell RCC
50 (100)
Pathologic stage, n (%) T1 T2 T3
22 (44) 16 (32) 12 (24)
Furhman grade, n (%) 2
50 (100)
Cellular proliferation was measured with a 3-(4, 5dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Cells (approximately 5 103 cells) were seeded into 96-well culture plate and transfected for 48 h. The blank control was set up with medium only. Before 4 h of completion of transfection, 10 mL of MTT reagent was added to each well. After completion of transfection, MTT solution was removed and the blue crystalline precipitate in each well was dissolved in DMSO. Visible absorbance of each well at 540 nm was quantified using a microplate reader. Results were expressed as percentage of viable cells relative to cells alone. 2.14. Flow cytometry analysis of apoptosis
S.D. standard deviation.
homogenization buffer (1 mmol/L MgCl2, 1 mmol/L CaCl2, 20 mol/L ZnCl2, 0.1 mol/L NaCl, 0.1% Triton X-100, 0.05 mol/L TriseHCl, pH 7.4). The homogenate was used for the ALP assay, which was performed with p-nitrophenol phosphate as a substrate, according to Sharma et al. [8]. L/B/K ALP activity was normalized for the content of protein in the sample and termed as specific activity. Proteins were measured according to the Lowry et al. [19].
For apoptosis assays, floating and adherent cells were harvested 48 h after transfection and then combined and washed twice with cold PBS and re-suspended in 500 mL of PBS (pH 7.0). 2 mL Annexin V-FITC and 1 mL propidium iodide were added to the cells suspension. The samples were analyzed within 30 min of staining. The fluorescence was analyzed by flow cytometry using a FACScan flow cytometer with CellQuest software (BD Biosciences, USA), according to the manufacturer's instructions. 2.15. Statistical analysis
2.11. RNA extraction and real-time PCR analyses Total RNA was extracted from ACHN and A498 cells. Detail procedure as described in Section 2.6.
Data were presented as mean ± S.D. Statistical analysis was performed with SPSS program (version 11.5; SPSS Inc., Chicago, IL). Comparisons of mean values were performed using the two tailed
Fig. 1. Immunohistochemical analysis of alkaline phosphatase in tumor and adjacent normal tissue. (a) Normal tissue section with immunointensity 2 (b) Normal tissue section with immunointensity 3 (c) Normal tissue section with immunointensity 4 (d) Tumor tissue section with immunointensity 0 (e) Tumor tissue section with immunointensity 1 (f) Tumor tissue section with immunointensity 2. Bars show mean ± S.D. of the immuneintensities of 50 observations. Statistical analysis was done by means of paired Student's t-test. *P < 0.05 was considered as significant.
Please cite this article in press as: U. Sharma, et al., Reduced L/B/K alkaline phosphatase gene expression in renal cell carcinoma: Plausible role in tumorigenesis, Biochimie (2014), http://dx.doi.org/10.1016/j.biochi.2014.05.011
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 Q4 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
BIOCHI4462_proof ■ 9 June 2014 ■ 4/9
4
U. Sharma et al. / Biochimie xxx (2014) 1e9
Fig. 2. Immunofluorescence analysis of alkaline phosphatase in tumor and adjacent normal tissue. (a) Normal tissue section with immunointensity 2 (b) normal tissue section with immunointensity 3 (c) normal tissue section with immunointensity 4 (d) tumor tissue section with immunointensity 0 (e) tumor tissue section with immunointensity 1 (f) tumor tissue section with immunointensity 2. Bars show mean ± S.D. of the immuneintensities of 50 observations. Statistical analysis was done by means of paired Student's t-test. *P < 0.05 was considered as significant.
paired student's t-test and for transfection analysis independent samples student's t-test and ANOVA were performed. A P-value of <0.05 was considered significant. 3. Results 3.1. Patients characteristic A total of 50 cases of histopathologically proven RCC and corresponding normal tissue were included in this study. Table 1 shows the various clinical characteristics of the patients included in this study. There were 38 males and 12 females. The mean age of the patients was 53 ± 13.8 years, ranging 23e78 years. All these cases were histologically proven clear cell renal cell carcinoma. 3.2. Immunohistochemistry and immunofluorescence studies on ALP protein expression in RCC
percent of normal tissue samples showed immunointensity >2, and the mean L/B/K ALP immunointensity in all normal renal sections was 2.9 ± 0.9. One hundred percent of RCC sections showed immunointensity <2, and the mean L/B/K ALP immunointensity was 0.7 ± 0.5. The decrease in the immunointensity in RCC in comparison to normal tissues was statistically significant (P ¼ 0.035; Fig. 1). Similarly, immunofluorescence study also documented diminished expression of ALP protein in RCC as compared to normal kidney tissue. Ninety three percent of normal tissue samples showed immunointensity >2, and the mean L/B/K ALP immunointensity was 3.2 ± 0.7. All the samples of RCC showed immunointensity <2, and the mean L/B/K ALP immunointensity was 0.9 ± 0.4. Observed reduction in the immunointensity in RCC to that of normal tissues was statistically significant (P ¼ 0.042; Fig. 2). 3.3. Flow cytometric analysis for ALP protein in isolated renal cells
Tumor sections showed predominantly reduced staining for L/B/ K ALP in comparison to adjacent normal kidney sections. Ninety
Fig. 3. L/B/K ALP expression in renal cells isolated from RCC and normal tissue. Total mean fluorescence intensity (MFI, arbitrary unit) of L/B/K ALP expression on freshlyisolated renal cells from normal and RCC tissue. All the values are mean ± S.D. of 50 observations. Statistical analysis was done by means of paired Student's t-test. *P < 0.05 was considered as significant.
Additionally, flow cytometry analysis of ALP in isolated renal cells from tumor as well as normal renal tissue showed
Fig. 4. RT PCR analysis of alkaline phosphatase gene in tumor and adjacent normal renal tissue. mRNA expression in normal tissue was ascribed an arbitrary value of 1. All the values are mean ± S.D. of 50 observations. Statistical analysis was done by means of paired Student's t-test. *P < 0.05 was considered as significant.
Please cite this article in press as: U. Sharma, et al., Reduced L/B/K alkaline phosphatase gene expression in renal cell carcinoma: Plausible role in tumorigenesis, Biochimie (2014), http://dx.doi.org/10.1016/j.biochi.2014.05.011
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
BIOCHI4462_proof ■ 9 June 2014 ■ 5/9
U. Sharma et al. / Biochimie xxx (2014) 1e9
5
Fig. 5. Activity and expression of ALP in the cells transfected with ALP cDNA. (A) The ALP specific activity. The mean value specific activity of cells alone was ascribed an arbitrary value of 1. (B) The ALP mRNA expression was estimated by real time PCR. The ALP mRNA of cells alone relative to control was ascribed an arbitrary value of 1. All the values are mean ± S.D. of six independent experiments each with triplicate. Statistical analysis was done by means of independent Student's t-test. *P < 0.05 was considered as significant.
significant decreased in mean fluorescent intensity (MFI) of anti L/B/K ALP antibody in cells isolated from tumor as compared with cells from normal renal tissue (191 ± 15.9 vs 291.9 ± 16.8; P ¼ 0.005; Fig. 3). 3.4. Real time PCR analysis for ALP gene expression in RCC Further, to find out whether the decrease in the ALP protein in RCC is due to decreased transcription of its mRNA. The real time PCR of L/B/K/ALP using b actin as internal control was carried out. The mRNA expression of L/B/K ALP was significantly decreased in RCC tissue as compared to normal renal tissue (0.65 ± 0.09 vs 1.0 ± 0.18; P ¼ 0.009; Fig. 4). 3.5. Activity and expression of ALP in the cells transfected with ALP cDNA Further, to explore whether reduced expression of ALP has any role in tumorigenesis of RCC, full length cDNA of L/B/K ALP was transfected in RCC cell lines ACHN and A498. The transfection of
ALP cDNA in ACHN as well as A498 cell lines was confirmed by measuring gene expression of ALP in cells alone; vector alone transfected and ALP cDNA transfected. We observed a significant increase in the ALP gene expression in the cells transfected with ALP cDNA in comparison with cells transfected with vector alone or cells alone (P ¼ 0.000; Fig. 5A) in both the cell lines. Moreover, the specific activity of ALP was also found to be significantly increased in the ALP cDNA transfected cells as compared to vector alone transfected cells or cells alone (P ¼ 0.000; Fig. 5B) in both the cell lines. This confirms the transfection and expression of transfected L/B/K ALP cDNA in both the cells lines. 3.6. Decreased migration of cells transfected with ALP cDNA Cell monolayer migration test was performed to examine the role of ALP on cell migration. Interestingly, it was found that the cells which were transfected with ALP cDNA significantly lost their migratory properties. As shown in Fig. 6A, ALP cDNA decreased the migration rate of ACHN cells, as compared to that of nontransfected ACHN cells, indicating that ALP is involved in
Please cite this article in press as: U. Sharma, et al., Reduced L/B/K alkaline phosphatase gene expression in renal cell carcinoma: Plausible role in tumorigenesis, Biochimie (2014), http://dx.doi.org/10.1016/j.biochi.2014.05.011
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
BIOCHI4462_proof ■ 9 June 2014 ■ 6/9
6
U. Sharma et al. / Biochimie xxx (2014) 1e9
Fig. 6. Effect of L/B/K ALP cDNA transfection on cell viability. RCC cells (A) ACHN and (B) A498 were transfected with vector alone, vector containing ALP cDNA (2 mg/ml) and a cell viability assay was performed. The data represents as mean ± S.D. of six independent experiments each with triplicate. Statistical analysis was done by means of independent Student's t-test. *P < 0.05 was considered as significant.
migration capability of ACHN cells. Further, ALP cDNA transfected A498 cells also showed significant reduction in the migratory properties as compared with control A498 cells (Fig. 6B).
and A498 cells transfected with ALP cDNA to that of cells alone or transfected with vector alone (P ¼ 0.000; Fig. 7A, B). 3.8. ALP cDNA transfected cells showed increased apoptosis
3.7. Decreased cell viability in the cells transfected with ALP cDNA The MTT assay was performed to assess the viability of cells, which documented a significant reduction in the viability of ACHN
Finally, to determine whether the decreased cell viability is due to increased apoptosis, Annexin V-FITC/PI apoptosis assay kit was used to detect cell apoptosis. Non-transfected RCC cells as well as
Fig. 7. Effect of L/B/K ALP cDNA transfection on cell migration. The representative pictures of (A) ACHN (B) A-498, in cell wounding and migration assay. The pictures show the migration of RCC cells 0 h and after 48 h of scrape in different groups. The lines show the initial start point where the cell began the migration process and how far the cells have migrated after 48 h. All experiments data are expressed as means ± S.D. of the three measurements.*P < 0.05; **P < 0.01 compared to control.
Please cite this article in press as: U. Sharma, et al., Reduced L/B/K alkaline phosphatase gene expression in renal cell carcinoma: Plausible role in tumorigenesis, Biochimie (2014), http://dx.doi.org/10.1016/j.biochi.2014.05.011
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
BIOCHI4462_proof ■ 9 June 2014 ■ 7/9
U. Sharma et al. / Biochimie xxx (2014) 1e9
vector alone transfected cells were used as the control group. A significant increased apoptosis was observed in the cells (ACHN and A498) transfected with ALP cDNA (P ¼ 0.001; Fig. 8). ALP cDNA transfected ACHN cells underwent apoptosis as compared with cells alone and vector alone transfected cells (30.1%, 4.5% and 7.5%; Fig. 8A). Similarly, 36.5% of A498 cells transfected with ALP cDNA underwent apoptosis in comparison to corresponding cells alone (7.3%) and vector alone transfected cells (8.2%) (Fig. 8B). 4. Discussion Based on our previous investigation, L/B/K ALP activity was significantly reduced in BBM and cytosol of RCC tissue which was partly associated with alteration in lipid composition [8,15]. To find out whether observed reduced activity of L/B/K ALP is also due to reduced gene expression in RCC. The present study revealed the reduced ALP protein presentation on the microvillus membrane of RCC cells by immunohistochemistry, immunofluorescence and flow cytometry analysis (Figs. 1e3). Further, real time PCR analysis confirmed the decreased L/B/K ALP gene expression in RCC. Ectopic expression of ALPs is often observed in cancer cells [20e23]. The regan isoenzyme of ALP was found to be increased in serum of RCC patients [24]. However, it was a single case study. Notably, we have also checked the serum total ALP activity in 82 cases but did not find any alteration in the serum total ALP activity. Strikingly, the L/B/K ALP isoenzyme is prominently expressed in kidney, whilst, regan isoenzyme is prominently expressed in placenta [24]. Diminished expression of ALP was noticed in malignant tissues viz. osteosarcoma [25,26], oral cancer [27], meningiomas [28,29], colon cancer [30] and breast cancer [31]. Notwithstanding, the exact mechanism of decreased expression of ALP isoenzymes is not clear so far. L/B/K ALP is a marker of renal epithelial cells. However, its mechanism of action is still poorly understood in neoplastic
7
conditions. In L/B/K ALP transfected cells i.e. ACHN and A498, lower tumorigenic and metastatic ability has been found to be associated with high level of ALP activity in this study. Besides this, an inverse relationship has been found between cellular L/B/K ALP expression and aggressiveness in human osteosarcoma. Zucchini et al. have shown 79 differentially expressed genes between high and low L/B/ K ALP activity clones using cDNA microarray technology [32]. These differentially expressed genes could be responsible for broad range of functional categories like cell growth, cell cycle maintenance, signal transduction, DNA and RNA metabolism, cytoskeleton and motility. Strikingly, Cadherin 13 and Caveolin 1 genes were upregulated in high L/B/K ALP activity cells which are involved in cellecell adhesion and cell growth. Caveolin-1 in renal cell carcinoma promotes tumor cell invasion and in cooperation with pERK (phosphorylated ERK) predicts the metastasis in patients with clinically confined disease [33], suggesting an important and direct mediator of invasion in bonefide human RCC cells of clear cell origin. Recently, Yamasaki et al. [34] reported silencing of caveolin2 in 786-O and A498 cells reduced cell invasion and growth. Moreover, RCC is a highly vascular tumor and previous studies documented a significant positive correlation between tumor caveolin-1 levels and high microvessels density [35]. This may provide the explanation the lower level of malignancy found in RCC cell lines transfected with L/B/K ALP gene. Further, cell cycle and proliferative biomarkers viz. cyclin D, cyclin E, p16, p21, p27, p53, p57 and Ki67 analysis were performed using immunohistochemsitry on microarray constructs. It revealed aberrantly expressed cell cycle and correlation of proliferative biomarkers with aggressive pathologic features and inferior oncologic outcomes in patients with clear cell renal cell carcinoma [36]. In the present study, we also demonstrated decrease in cell migration in ALP cDNA transfected cells. Concomitantly, these L/B/K ALP cDNA transfected cells showed a high degree of apoptosis (Fig. 8).
Fig. 8. Effect of L/B/K ALP cDNA transfection on cell apoptosis. Apoptosis rates of RCC cells (A) ACHN and (B) A498 transiently transfected with empty vector and ALP cDNA, the percentage of apoptotic cells were measured by flow cytometry using the annexin V-PI assay. (a) Flow cytometry of cells alone (b) vector alone or empty vector transfected cells (c) ALP cDNA transfected cells (d) Bar diagram showing the percentage of cells undergone apoptosis. All experiments were repeated three times. Statistical analysis was carried out by means of ANOVA. *P < 0.05, **P < 0.01 compared to control.
Please cite this article in press as: U. Sharma, et al., Reduced L/B/K alkaline phosphatase gene expression in renal cell carcinoma: Plausible role in tumorigenesis, Biochimie (2014), http://dx.doi.org/10.1016/j.biochi.2014.05.011
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 Q1 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
BIOCHI4462_proof ■ 9 June 2014 ■ 8/9
8
U. Sharma et al. / Biochimie xxx (2014) 1e9
In addition, anti-proliferative agents in different human cancer cell lines led to enhanced ALP expression on membrane surface [37e39]. Moreover, retinoic acid a potent morphogen and differentiation factor up-regulates L/B/K ALP in a variety of cells such as neutrophils [40], osteoblast [41] and fibroblast [42]. Taken together, these findings also confirm the involvement of ALPs in cell proliferation and differentiation which was evidenced by demonstrating the correlation of enhanced cell membrane ALP expression and decreased cell proliferation in HeLa S3 cells [43]. Similarly, our study also documented increased membrane ALP expression associated with reduced cell viability. The functional consequences of L/B/K ALP activation also include a decrease in the activity of MMP-9, a metalloproteinase involved in tumor invasion and metastasis [25,44]. Taken together, the findings of this study suggest a significant association between L/B/K ALP expression and renal cell carcinoma which was evidenced by transfecting the RCC cell lines with L/B/K ALP cDNA led to decrease migratory property and increased apoptosis of RCC cell lines. Further, Identification and characterization of factors responsible for aberrant ALP gene expression and molecular mechanism and pathways involved in ALP induced apoptosis will further add our understanding to the mechanism responsible for role of ALP gene expression in RCC that might lead to future targeted therapy. Conflict of interest There is no conflict of interest. Acknowledgments This is a part of research project funded by DBT, New Delhi, India (vide letter no. BT/PR8372/MED/12/345/2006). The authors are thankful to Council of Scientific and Industrial Research, New Delhi, India for awarding junior and senior research fellowship (vide letter no. 09/141(0166)/2006-EMR-I). References [1] J. Jones, H. Out, D. Spentzos, S. Kolia, M. Inan, W.D.B. Eecken, C. Fellbaum, X. Gu, M. Joseph, A.J.P. Antuck, D. Jonas, T.A.L. Bermann, Gene signatures of progression and metastasis in renal cell cancer, Clin. Cancer Res. 11 (2005) 5730e5739. [2] U. Sharma, S.K. Singh, R. Prasad, Inverse correlation of intracellular calcium and cyclic AMP levels in renal cell carcinoma, Cell Biochem. Funct. 30 (2012) 619e622. [3] J.S.P. Yuen, Molecular targeted therapy in advanced renal cell carcinoma: a review of its recent past and a glimpse into the near future, Indian J. Urol. 25 (2009) 427e436. [4] B.J. Drucker, Renal cell carcinoma: current status and future prospects, Cancer Treat. Rev. 31 (2005) 536e545. [5] Y.S. Ahn, H. Zerban, R. Grobholz, P. Bannasch, Sequential changes in glycogen content, expression of glucose transporters and enzymic patterns during development of clear/acidophilic cell tumors in rat kidney, Carcinogenesis 13 (1992) 2329e2334. [6] R.K. Gane, in: K.B. Warren (Ed.), Intracellular transport, Academic Press, NY, 1996, p. 71. [7] S. Noguchi, T. Shuin, Y. Kubota, S. Watanabe, Y. Nagashima, M. Masuda, M. Yao, M. Hosaka, High alkaline phosphatase activity in 3P-induced human renal cancer cells, Cancer Lett. 131 (1998) 223e227. [8] U. Sharma, S.K. Singh, D. Pal, R. Khajuria, A.K. Mandal, R. Prasad, Implication of BBM lipid composition and fluidity in mitigated alkaline phosphatase activity in renal cell carcinoma, Mol. Cell. Biochem. 369 (2012) 287e293. [9] M. Bortolato, F. Besson, B. Roux, An infrared study of the thermal and pH stabilities of the GPI-alkaline phosphatase from bovine intestine, Biochem. Biophys. Res. Commun. 292 (2002) 874e879. [10] J.J. Buzzard, N.G. Wreford, J.R. Morrison, Thyroid hormone, retinoic acid and testosterone suppress proliferation and induce markers of differentiation in cultured rat sertoli cells, Endocrinology 144 (2003) 3722e3731. [11] U. Sharma, D. Pal, R. Prasad, Alkaline phosphatase: an overview, Ind. J. Clin. Biochem., http://dx.doi.org/10.1007/s12291-013-0408-y.
[12] I.W. McDicken, G.H. Stamp, P.J. McLaughlin, P.M. Johnson, Expression of human placental-type alkaline phosphates in primary breast cancer, Int. J. Cancer 32 (1983) 205e209. [13] S. Watanabe, T. Watanabe, W.B. Li, B.W. Soong, J.Y. Chou, Expression of the germ cell alkaline phosphatase gene in human choriocarcinoma cells, J. Biol. Chem. 264 (1989) 12611e12619. [14] K. Higashino, R. Otani, S. Kudo, Y. Yamamura, A fetal intestinal-type alkaline phosphatase in hepatocellular carcinoma tissue, Clin. Chim. 23 (1977) 1615e1623. [15] R. Prasad, S. Lambe, P. Kaler, S. Pathania, S. Kumar, S. Attari, S.K. Singh, Ectopic expression of alkaline phosphatase in proximal tubular brush border membrane of human renal cell carcinoma, Biochem. Biophys. Acta 1741 (2005) 240e245. [16] R. Kumar, R. Prasad, Purification and characterization of a major zinc binding protein from renal brush border membrane of rat, Biochem. Biophys. Acta 1419 (1999) 23e32. [17] H. Hanari, M. Ishida, C.T. Liang, B. Sacktor, Parathyroid hormone increases sodium/calcium exchange activity in renal cells and the blunting of the response in aging, J. Biol. Chem. 261 (1986) 5419e5425. [18] T.D. Schmittgen, K.J. Livak, Analyzing real-time PCR data by the comparative CT method, Nat. Protoc. 3 (2008) 1101e1108. [19] O.H. Lowry, N.J. Roserbrough, A.L. Farr, R.L. Randall, Protein measurement with folin phenol reagent, J. Biol. Chem. 193 (1951) 265e275. [20] J.L. Millan, Oncodevelopmental expression and structure of alkaline phosphatase genes, Anticancer Res. 8 (1988) 995e1004. [21] J.L. Millan, Alkaline phosphatase as a reporter of cancerous transformation, Clin. Chim. Acta 209 (1992) 123e129. [22] J.L. Millan, T. Manes, Seminoma-derived Nagao isozyme is encoded by a germ-cell alkaline phosphatase gene, Proc. Natl. Acad. Sci. 85 (1988) 3024e3028. [23] P. Dua, H.S. Kang, S.M. Hong, M.S. Tsao, S. Kim, D.K. Lee, Alkaline phosphatase ALPPL-2 is a novel pancreatic carcinoma-associated protein, Cancer Res. 73 (2013) 1934e1945. [24] J. Bukowczan, S. Pattman, F. Jenkinson, R. Quinton, Regan isoenzyme of alkaline phosphatase as a tumour maker for renal cell carcinoma, Ann. Clin. Biochem. (2014) [Epub ahead of print]. [25] M.C. Manara, N. Baldini, M. Serra, P.L. Lollini, C. De Giovanni, M. Vaccari, A. Argnani, S. Benini, D. Maurici, P. Picci, K. Scotlandi, Reversal of malignant phenotype in human osteosarcoma cells transduced with the alkaline phosphatase gene, Bone 26 (2000) 215e220. [26] H. Orimo, T. Shimada, Regulation of the human tissue-nonspecific alkaline phosphatase gene expression by all-trans-retinoic acid in SaOS-2 osteosarcoma cell line, Bone 36 (2005) 866e876. [27] B. Xiao, J. Guo, Y. Lou, D. Meng, W. Zhao, L. Zhang, C. Yan, D. Wang, Inhibition of growth and increase of alkaline phosphatase activity in cultured human oral cancer cells by all-trans retinoic acid, Int. J. Oral Maxillofac. Surg. 35 (2006) 643e648. [28] I. Niedermayer, W. Feiden, W. Henn, H. Steilen-Gimbel, W.I. Steudel, K.D. Zang, Loss of alkaline phosphatase activity in meningiomas: a rapid histochemical technique indicating progression-associated deletion of a putative tumor suppressor gene on the distal part of the short arm of chromosome 1, J. Neuropathol. Exp. Neurol. 56 (1997) 879e886. [29] P. Muller, W. Henn, I. Niedermayer, R. Ketter, W. Feiden, W.I. Steudel, K.D. Zang, H. Steilen-Gimbel, Deletion of chromosome 1p and loss of expression of alkaline phosphatase indicate progression of meningiomas, Clin. Cancer Res. 5 (1999) 3569e3577. [30] M.A. Lea, C. Ibeh, J.K. Deutsch, I. Hamid, C. desBordes, Inhibition of growth and induction of alkaline phosphatase in colon cancer cells by flavonols and flavonol glycosides, Anticancer Res. 30 (2010) 3629e3636. [31] L.C. Tsai, M.W. Hung, Y.H. Chen, W.C. Su, G.G. Chang, T.C. Chang, Expression and regulation of alkaline phosphatases in human breast cancer MCF-7 cells, Eur. J. Biochem. 267 (2000) 1330e1339. [32] C. Zucchini, M. Bianchini, L. Valvassori, S. Perdichizzi, S. Benini, M.C. Manara, R. Solmi, P. Strippoli, P. Picci, P. Carinci, K. Scotlandi, Identification of candidate genes involved in the reversal of malignant phenotype of osteosarcoma cells transfected with the liver/bone/kidney alkaline phosphatase gene, Bone 34 (2004) 672e679. [33] L. Campbell, G. Al-Jayyoussi, R. Gutteridge, N. Gumbleton, R. Griffiths, S. Gumbleton, M.W. Smith, D.F.R. Griffiths, M. Gumbleton, Caveolin-1 in renal cell carcinoma promotes tumour cell invasion, and in co-operation with perk predicts metastases in patients with clinically confined disease, J. Transl. Med. 11 (2013) 255e268. [34] T. Yamasaki, N. Seki, H. Yoshino, T. Itesako, H. Hidaka, Y. Yamada, S. Tatarano, T. Yonezawa, T. Kinoshita, M. Nakagawa, H. Enokida, MicroRNA-218 inhibits cell migration and invasion in renal cell carcinoma through targeting caveolin-2 involved in focal adhesion pathway, J. Urol. 190 (2013) 1059e1068. [35] H.J. Joo, D.K. Oh, Y.S. Kim, K.B. Lee, S.J. Kim, Increased expression of caveolin-1 and microvessel density correlates with metastasis and poor prognosis in clear cell renal cell carcinoma, BJU Int. 93 (2004) 291e296. [36] B.A. Gayed, R.F. Youssef, A. Bagrodia, P. Kapur, O.M. Darwish, L.M. Krabbe, A. Sagalowsky, Y. Lotan, V. Margulis, prognostic role of cell cycle and proliferative biomarkers in patients with clear cell renal cell carcinoma, J. Urol. 190 (2013) 1662e1667.
Please cite this article in press as: U. Sharma, et al., Reduced L/B/K alkaline phosphatase gene expression in renal cell carcinoma: Plausible role in tumorigenesis, Biochimie (2014), http://dx.doi.org/10.1016/j.biochi.2014.05.011
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11
BIOCHI4462_proof ■ 9 June 2014 ■ 9/9
U. Sharma et al. / Biochimie xxx (2014) 1e9 [37] H. Sadeghi, R. Yazdanparast, Effect of Dendrostellera lessertii on the intracellular alkaline phosphatase activity of four human cancer cell lines, J. Ethnopharmacol. 86 (2003) 11e14. [38] R. Yazdanparast, H. Sadeghi, Nucleic acid synthesis in cancerous cells under the effect of gnidilatimonoein from Daphne mucronata, Life Sci. 74 (2004) 1869e1876. [39] A. Sadeghirishi, R. Yazdanparast, Plasma membrane homing of tissue nonspecific alkaline phosphatase under the influence of 3-hydrogenkwadaphnin, an anti-proliferative agent from Dendrostellera lessertii, Acta Biochim. Pol. 54 (2007) 323e329. [40] N. Sato, O. Takatani, H.P. Koeffler, H. Sato, S. Asano, F. Takaku, Modulation by retinoids and interferons of alkaline phosphatase activity in granulocytes induced by granulocyte colony-stimulating factor, Exp. Hematol. 17 (1989) 258e262.
9
[41] H. Zhou, R.G. Hammonds, D.M. Findlay, P.J. Fuller, T.J. Martin, K.W. Ng, Retinoic acid modulation of mRNA levels in malignant, non-transformed and immortalized osteoblasts, J. Bone Miner. Res. 6 (1991) 767e777. [42] D.H. Reese, R.A. Larsen, F.J. Hornicek, Control of alkaline phosphatase activity in C3H10T1/2 cells: role of retinoic acid and cell density, J. Cell. Physiol. 151 (1992) 239e248. [43] J.F. Telfer, C.D. Green, Placental alkaline phosphatase activity is inversely related to cell growth rate in HeLa S3 cervical cancer cells, FEBS Lett. 329 (1993) 238e244. [44] B.P. Himelstein, R. Canete-Soler, E.J. Bernhard, D.W. Dilks, R.J. Muschel, Metalloproteinase in tumor progression: the contribution of MMP-9, Invas. Metast. 14 (194e95) 246e258. Q2
Please cite this article in press as: U. Sharma, et al., Reduced L/B/K alkaline phosphatase gene expression in renal cell carcinoma: Plausible role in tumorigenesis, Biochimie (2014), http://dx.doi.org/10.1016/j.biochi.2014.05.011
12 13 14 15 16 17 18 19 20 21 22
BIOCHI4462_proof ■ 9 June 2014 ■ 1/9
Biochimie xxx (2014) 1e9
Contents lists available at ScienceDirect
Biochimie journal homepage: www.elsevier.com/locate/biochi
Research paper
Reduced L/B/K alkaline phosphatase gene expression in renal cell carcinoma: Plausible role in tumorigenesis Q3
Ujjawal Sharma a, Deeksha Pal a, Shrawan Kumar Singh b, Nandita Kakkar c, Rajendra Prasad a, * a b c
Department of Biochemistry, PGIMER, Chandigarh, India Department of Urology, PGIMER, Chandigarh, India Department of Histopathology, PGIMER, Chandigarh, India
a r t i c l e i n f o
a b s t r a c t
Article history: Received 15 April 2014 Accepted 28 May 2014 Available online xxx
Renal cell carcinoma (RCC) is the most common kidney cancer in adults. Although several genes have been found to be involved in carcinogenesis of RCC, more great efforts are needed to identify new genes which are responsible for the process. Clear cell RCC, originated from proximal tubule cells, is the most common pathological type of RCC. Alkaline phosphatase (ALP) is a marker enzyme of brush border membrane of proximal tubular cells. Our previous studies showed a significant decreased activity of Liver/Bone/Kidney (L/B/K) alkaline phosphatase in RCC. In the present study, we explored the molecular basis of the decreased activity of ALP in RCC. Immunohistochemistry, immunofluorescence and flow cytometry analysis showed decreased ALP protein in RCC. Additionally, real time PCR documented significantly reduced ALP gene expression (P ¼ 0.009). Moreover, RCC cell lines (ACHN and A498) transfected with full length L/B/K cDNA showed decreased migratory property as well as viability of these cells as compared with controls (P ¼ 0.000). Further, L/B/K ALP cDNA transfected cells (ACHN and A498) showed significant increased apoptosis as compared to control (P ¼ 0.000). These findings suggest the new role of ALP in cell viability and apoptosis and involvement in RCC tumorigenesis. However, further studies are needed to explore the exact molecular mechanism. © 2014 Published by Elsevier Masson SAS.
Keywords: Alkaline phosphatase Renal cell carcinoma Transfection Apoptosis Cell lines
1. Introduction Renal cell carcinoma (RCC) is the most common type of kidney cancer which scores about 90e95% of neoplasm originating from proximal tubular epithelium of kidney [1]. It is the 10th leading cause of death, approximately 11,600 people die every year from this disease worldwide [2]. Strikingly, RCC is one of the most chemo and radio-resistant tumor [3]. Surgical excision is only curative treatment for localized RCC tumor using radical nephrectomy [4]. The plasma membrane of cancer cells behaved differently from that of normal cells [5]. Brush border membrane (BBM) of renal epithelial cells is a mosaic of structural and functional proteins intercalated in lipid bilayer [6]. It is reported that the BBM enzymes activity and lipid composition are altered in RCC [7,8] which may partially determine the biological behavior of tumors.
* Corresponding author. Tel.: þ91 172 2755178; fax: þ91 172 2744401, þ91 172 2745078. E-mail address: [email protected] (R. Prasad).
Alkaline phosphatases (orthophosphoric monoester phosphohydrolase, E.C. 3.1.3.1, alkaline optimum) are a group of phosphatidyl inositol-anchored membrane glycoproteins with wide substrate specificity [9,10]. Four major ALP isoenzymes have been characterized on the basis of physicochemical properties. The heat labile isoenzyme represents the Liver/Bone/Kidney (L/B/K) or tissue non specific form which is present in the most cell type [11]. Ectopic expression of ALP has been associated with a variety of cancers for instances, placental ALP and germ cell ALP are overexpressed in cells derived from breast cancer and choriocarcinoma respectively [12,13]. Increased expression of intestinal ALP has also been reported in hepato-cellular carcinoma [14]. However, the aberrant expression of ALP gene in cancer cell has led to connotation whether ALP isoenzyme may involved in tumorigenesis. In pertaining to RCC, we have previously demonstrated a drastically reduced activity of ALP [8,15]. In view of these facts, the present study was planned to investigate the L/B/K ALP gene expression in RCC. Further, we investigated the involvement of ALP gene expression in tumorigenesis by transfecting L/B/K ALP cDNA in renal cell carcinoma cell lines.
http://dx.doi.org/10.1016/j.biochi.2014.05.011 0300-9084/© 2014 Published by Elsevier Masson SAS.
Please cite this article in press as: U. Sharma, et al., Reduced L/B/K alkaline phosphatase gene expression in renal cell carcinoma: Plausible role in tumorigenesis, Biochimie (2014), http://dx.doi.org/10.1016/j.biochi.2014.05.011
55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
BIOCHI4462_proof ■ 9 June 2014 ■ 2/9
2
U. Sharma et al. / Biochimie xxx (2014) 1e9
2. Materials and methods 2.1. Patients The present study was approved by institute ethics committee and informed consent was obtained from patients. Tumorous tissues of RCC and corresponding adjacent normal kidney tissues were dissected out following nephrectomy. All tissue samples were snap frozen in liquid nitrogen and stored at 80 C till further use.
(Santa Cruz, USA). Unlabeled renal cells were used as control. Immunostaining acquisition and analysis were performed on 10,000 events gated on viable cells using a FACScan flow cytometer with CellQuest software (BD Biosciences, USA). Results were expressed as mean fluorescence intensity. 2.6. Total RNA isolation and real time-PCR
Goat polyclonal IgG antibody directed against the human L/B/K ALP (Santa Cruz, USA) was used to detect L/B/K ALP according to the method as previously described [16]. Briefly, 4 mm tissue sections were cut, dewaxed, and incubated in absolute methanol solution with 0.3 mL of hydrogen peroxide for 30 min. Antigen retrieval was carried out by boiling the slides in 10 mM citrate buffer, pH 6.0 for 15 min. Slides were then treated with blocking serum for 10 min after which they were incubated with 1:200 diluted primary antibody (anti L/B/K ALP) at 37 C for 60 min followed by 1:50 diluted HRP anti-goat IgG (Bangalore Geni, India). Chromogen detection was performed with diaminobenzidine (DAKO Corp., Carpinteria, CA) solution (0.5 mL of stock diaminobenzidine in 4.5 mL of Tris buffer with 20 mL of hydrogen peroxide). Slides were counterstained with hematoxylin and photographed. A modified visual semi quantification method was used. The semi quantification of immunointensity was scored on a scale of: 0, negative; 1, weak, 2, moderate; 3, strong; 4, very strong.
Total RNA was isolated from 100 mg tissue samples using PureLink™ RNA mini Kit (Invitrogen, CA, USA), according to the manufacturer's protocol. The RNA samples were then stored at 80 C until use. DNase treatment was given to all RNA samples prior to cDNA synthesis. Reverse transcription reaction was carried out in 20 mL volume, containing 1 mg of total RNA using Super scriptIII first strand synthesis system (Invitrogen, CA, USA). Oligonucleotide primers were L/B/K ALP, CGTGGATCCGTGTGTGTGATCAAAGGC and CGGAATTCATGGCAGGTGTAAGAGAAAGG; b-actin, CGTGACATTAA GGAGAAG CTG and CTAGAAGCATTTGCGGTGGAC. Real-time analysis was performed on 7300 RT-PCR system (Roche Indianapolis, IN) using the SYBR Green PCR Master Mix (TaKaRa, Madison, WI) using following conditions: initial denaturation for 5 min at 94 C followed by denaturation for 30 s at 94 C, annealing for 30 s at 55 C, elongation for 30 s at 72 C, totally 35 cycles, and ending with a final 5 min elongation at 72 C. Each assay included a no-template control and cDNA template (in triplicate). The expression levels of L/B/K ALP were calculated by relative quantification using b-actin transcript levels for normalization. The fold change in mRNA expression was calculated by comparative DDCt method [18].
2.3. Immunofluorescence
2.7. Cell lines
The immunofluorescence analysis of ALP in RCC and normal kidney sections was carried out as described earlier [16]. In brief, frozen sections of tissue were fixed by keeping at 80 C for one day. The 4 mm tissue sections were incubated with 1:100 diluted primary antibody (anti L/B/K ALP) (Santa Cruz, USA) at 37 C for 45 min in a humified chamber. After washing with PBS (pH 7.0), the slides were incubated with FITC labeled anti-goat IgG (1:50 dilution) at 37 C for 45 min. The slides were again washed with PBS (pH 7.0). The sections were mounted in 10% glycerin, viewed under fluorescence microscope (LEICA MPS52) and photographed. The semi quantification of immunointensity was scored on a scale of: 0, negative; 1, weak, 2, moderate; 3, strong; 4, very strong.
Renal cell carcinoma cell lines (ACHN and A498) were obtained from the National Centre for Cell Sciences (Pune, India), cultured in Dulbecco's modified Eagle's medium (Sigma, USA) supplemented with penicillin (100 U/mL), streptomycin (100 mg/mL) (Life Technologies, Paisley, Scotland), and 10% heat-inactivated fetal calf serum (FCS; Biological Industries, Kibbutz Beth Haemek, Israel). Cells were maintained at 37 C in a humidified 5% CO2 atmosphere.
2.2. Immunohistochemistry
2.8. Plasmid The ALP full length cDNA cloned in expression vector pcDNA 3.1 was purchased from Sino Biological Corp., China.
2.4. Renal cell isolation 2.9. Transient transfection Renal cells were isolated from both tumor and normal parenchyma as described by Hanari et al. [17]. The renal tissue from RCC as well as adjacent normal kidney were finely minced separately and suspended in 30 mL of the Hank's balanced salt solution (HBS) containing collagenase and hyaluronidase at a concentration of 1 mg/mL. The suspension was incubated for 30e40 min at 37 C and centrifuged at 130 g for 1 min. The pellet was suspended in 10e15 mL of HBS and re-centrifuged. Pellet was re-suspended in an incubation medium (140 mM KCl, 10 mM HEPES-Tris buffer (pH 7.4), 10 mM Mannose, 0.5 mM b-hydroxybutyrate, 2.5 mM Glutamine). Microscopic examination revealed that the preparation consisted of single cells with clusters of from 2 to 6 cells. 85% of the isolated cells were found viable on trypan blue staining.
ACHN and A498 cells (untransfected, cells alone) were grown until 60% confluence. Cells were washed with serum free medium and then transiently transfected with 2e3 mg of vector pcDNA 3.1 containing full-length ALP cDNA (ALP cDNA transfected) or vector alone (empty vector transfected) using LipofectAMINE reagent (Invitrogen) according to the manufacturer's protocol. Following transfection, cells were subjected to ALP expression/activity analysis at the time indicated in Results or in the figure legends by real time PCR and ALP activity assay according to the protocol described below. Untransfected and transfected cells were used for further experiments. 2.10. ALP activity
2.5. Flow cytometric analysis Cells isolated from normal and tumor renal tissue as described above were incubated with FITC labeled anti L/B/K ALP antibodies
Cellular ALP activity was analyzed in cells transfected with vector alone or with vector containing ALP cDNA and untransfected cells. Approximately 106 cells were homogenized in
Please cite this article in press as: U. Sharma, et al., Reduced L/B/K alkaline phosphatase gene expression in renal cell carcinoma: Plausible role in tumorigenesis, Biochimie (2014), http://dx.doi.org/10.1016/j.biochi.2014.05.011
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
BIOCHI4462_proof ■ 9 June 2014 ■ 3/9
U. Sharma et al. / Biochimie xxx (2014) 1e9
3
2.12. In vitro migration scratch assay
Table 1 Clinical and pathological characteristics of the patients. Patients (n) Gender, n (%) Male Female
50 38 (76) 12 (24)
Age (years), mean ± S.D.
53 ± 13.8
BMI, mean ± S.D.
23.67 ± 0.164
After 24 h of transfection, a pipette tip was used to make a scratch in the cell monolayer. The cells were then rinsed with PBS and replaced with fresh medium. Images of the scratches were acquired using a digital camera system coupled to a microscope after incubating the cells for 0 h, 24 h and 48 h of scratch generation. 2.13. Cell proliferation assessment by the MTT assay
Commonest presenting complaints Hematuria Flank pain Both Incidental radiological examination
30 (60) 22 (44) 18 (36) 5 (10)
Histologic subtype, n (%) Clear cell RCC
50 (100)
Pathologic stage, n (%) T1 T2 T3
22 (44) 16 (32) 12 (24)
Furhman grade, n (%) 2
50 (100)
Cellular proliferation was measured with a 3-(4, 5dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Cells (approximately 5 103 cells) were seeded into 96-well culture plate and transfected for 48 h. The blank control was set up with medium only. Before 4 h of completion of transfection, 10 mL of MTT reagent was added to each well. After completion of transfection, MTT solution was removed and the blue crystalline precipitate in each well was dissolved in DMSO. Visible absorbance of each well at 540 nm was quantified using a microplate reader. Results were expressed as percentage of viable cells relative to cells alone. 2.14. Flow cytometry analysis of apoptosis
S.D. standard deviation.
homogenization buffer (1 mmol/L MgCl2, 1 mmol/L CaCl2, 20 mol/L ZnCl2, 0.1 mol/L NaCl, 0.1% Triton X-100, 0.05 mol/L TriseHCl, pH 7.4). The homogenate was used for the ALP assay, which was performed with p-nitrophenol phosphate as a substrate, according to Sharma et al. [8]. L/B/K ALP activity was normalized for the content of protein in the sample and termed as specific activity. Proteins were measured according to the Lowry et al. [19].
For apoptosis assays, floating and adherent cells were harvested 48 h after transfection and then combined and washed twice with cold PBS and re-suspended in 500 mL of PBS (pH 7.0). 2 mL Annexin V-FITC and 1 mL propidium iodide were added to the cells suspension. The samples were analyzed within 30 min of staining. The fluorescence was analyzed by flow cytometry using a FACScan flow cytometer with CellQuest software (BD Biosciences, USA), according to the manufacturer's instructions. 2.15. Statistical analysis
2.11. RNA extraction and real-time PCR analyses Total RNA was extracted from ACHN and A498 cells. Detail procedure as described in Section 2.6.
Data were presented as mean ± S.D. Statistical analysis was performed with SPSS program (version 11.5; SPSS Inc., Chicago, IL). Comparisons of mean values were performed using the two tailed
Fig. 1. Immunohistochemical analysis of alkaline phosphatase in tumor and adjacent normal tissue. (a) Normal tissue section with immunointensity 2 (b) Normal tissue section with immunointensity 3 (c) Normal tissue section with immunointensity 4 (d) Tumor tissue section with immunointensity 0 (e) Tumor tissue section with immunointensity 1 (f) Tumor tissue section with immunointensity 2. Bars show mean ± S.D. of the immuneintensities of 50 observations. Statistical analysis was done by means of paired Student's t-test. *P < 0.05 was considered as significant.
Please cite this article in press as: U. Sharma, et al., Reduced L/B/K alkaline phosphatase gene expression in renal cell carcinoma: Plausible role in tumorigenesis, Biochimie (2014), http://dx.doi.org/10.1016/j.biochi.2014.05.011
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 Q4 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
BIOCHI4462_proof ■ 9 June 2014 ■ 4/9
4
U. Sharma et al. / Biochimie xxx (2014) 1e9
Fig. 2. Immunofluorescence analysis of alkaline phosphatase in tumor and adjacent normal tissue. (a) Normal tissue section with immunointensity 2 (b) normal tissue section with immunointensity 3 (c) normal tissue section with immunointensity 4 (d) tumor tissue section with immunointensity 0 (e) tumor tissue section with immunointensity 1 (f) tumor tissue section with immunointensity 2. Bars show mean ± S.D. of the immuneintensities of 50 observations. Statistical analysis was done by means of paired Student's t-test. *P < 0.05 was considered as significant.
paired student's t-test and for transfection analysis independent samples student's t-test and ANOVA were performed. A P-value of <0.05 was considered significant. 3. Results 3.1. Patients characteristic A total of 50 cases of histopathologically proven RCC and corresponding normal tissue were included in this study. Table 1 shows the various clinical characteristics of the patients included in this study. There were 38 males and 12 females. The mean age of the patients was 53 ± 13.8 years, ranging 23e78 years. All these cases were histologically proven clear cell renal cell carcinoma. 3.2. Immunohistochemistry and immunofluorescence studies on ALP protein expression in RCC
percent of normal tissue samples showed immunointensity >2, and the mean L/B/K ALP immunointensity in all normal renal sections was 2.9 ± 0.9. One hundred percent of RCC sections showed immunointensity <2, and the mean L/B/K ALP immunointensity was 0.7 ± 0.5. The decrease in the immunointensity in RCC in comparison to normal tissues was statistically significant (P ¼ 0.035; Fig. 1). Similarly, immunofluorescence study also documented diminished expression of ALP protein in RCC as compared to normal kidney tissue. Ninety three percent of normal tissue samples showed immunointensity >2, and the mean L/B/K ALP immunointensity was 3.2 ± 0.7. All the samples of RCC showed immunointensity <2, and the mean L/B/K ALP immunointensity was 0.9 ± 0.4. Observed reduction in the immunointensity in RCC to that of normal tissues was statistically significant (P ¼ 0.042; Fig. 2). 3.3. Flow cytometric analysis for ALP protein in isolated renal cells
Tumor sections showed predominantly reduced staining for L/B/ K ALP in comparison to adjacent normal kidney sections. Ninety
Fig. 3. L/B/K ALP expression in renal cells isolated from RCC and normal tissue. Total mean fluorescence intensity (MFI, arbitrary unit) of L/B/K ALP expression on freshlyisolated renal cells from normal and RCC tissue. All the values are mean ± S.D. of 50 observations. Statistical analysis was done by means of paired Student's t-test. *P < 0.05 was considered as significant.
Additionally, flow cytometry analysis of ALP in isolated renal cells from tumor as well as normal renal tissue showed
Fig. 4. RT PCR analysis of alkaline phosphatase gene in tumor and adjacent normal renal tissue. mRNA expression in normal tissue was ascribed an arbitrary value of 1. All the values are mean ± S.D. of 50 observations. Statistical analysis was done by means of paired Student's t-test. *P < 0.05 was considered as significant.
Please cite this article in press as: U. Sharma, et al., Reduced L/B/K alkaline phosphatase gene expression in renal cell carcinoma: Plausible role in tumorigenesis, Biochimie (2014), http://dx.doi.org/10.1016/j.biochi.2014.05.011
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
BIOCHI4462_proof ■ 9 June 2014 ■ 5/9
U. Sharma et al. / Biochimie xxx (2014) 1e9
5
Fig. 5. Activity and expression of ALP in the cells transfected with ALP cDNA. (A) The ALP specific activity. The mean value specific activity of cells alone was ascribed an arbitrary value of 1. (B) The ALP mRNA expression was estimated by real time PCR. The ALP mRNA of cells alone relative to control was ascribed an arbitrary value of 1. All the values are mean ± S.D. of six independent experiments each with triplicate. Statistical analysis was done by means of independent Student's t-test. *P < 0.05 was considered as significant.
significant decreased in mean fluorescent intensity (MFI) of anti L/B/K ALP antibody in cells isolated from tumor as compared with cells from normal renal tissue (191 ± 15.9 vs 291.9 ± 16.8; P ¼ 0.005; Fig. 3). 3.4. Real time PCR analysis for ALP gene expression in RCC Further, to find out whether the decrease in the ALP protein in RCC is due to decreased transcription of its mRNA. The real time PCR of L/B/K/ALP using b actin as internal control was carried out. The mRNA expression of L/B/K ALP was significantly decreased in RCC tissue as compared to normal renal tissue (0.65 ± 0.09 vs 1.0 ± 0.18; P ¼ 0.009; Fig. 4). 3.5. Activity and expression of ALP in the cells transfected with ALP cDNA Further, to explore whether reduced expression of ALP has any role in tumorigenesis of RCC, full length cDNA of L/B/K ALP was transfected in RCC cell lines ACHN and A498. The transfection of
ALP cDNA in ACHN as well as A498 cell lines was confirmed by measuring gene expression of ALP in cells alone; vector alone transfected and ALP cDNA transfected. We observed a significant increase in the ALP gene expression in the cells transfected with ALP cDNA in comparison with cells transfected with vector alone or cells alone (P ¼ 0.000; Fig. 5A) in both the cell lines. Moreover, the specific activity of ALP was also found to be significantly increased in the ALP cDNA transfected cells as compared to vector alone transfected cells or cells alone (P ¼ 0.000; Fig. 5B) in both the cell lines. This confirms the transfection and expression of transfected L/B/K ALP cDNA in both the cells lines. 3.6. Decreased migration of cells transfected with ALP cDNA Cell monolayer migration test was performed to examine the role of ALP on cell migration. Interestingly, it was found that the cells which were transfected with ALP cDNA significantly lost their migratory properties. As shown in Fig. 6A, ALP cDNA decreased the migration rate of ACHN cells, as compared to that of nontransfected ACHN cells, indicating that ALP is involved in
Please cite this article in press as: U. Sharma, et al., Reduced L/B/K alkaline phosphatase gene expression in renal cell carcinoma: Plausible role in tumorigenesis, Biochimie (2014), http://dx.doi.org/10.1016/j.biochi.2014.05.011
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
BIOCHI4462_proof ■ 9 June 2014 ■ 6/9
6
U. Sharma et al. / Biochimie xxx (2014) 1e9
Fig. 6. Effect of L/B/K ALP cDNA transfection on cell viability. RCC cells (A) ACHN and (B) A498 were transfected with vector alone, vector containing ALP cDNA (2 mg/ml) and a cell viability assay was performed. The data represents as mean ± S.D. of six independent experiments each with triplicate. Statistical analysis was done by means of independent Student's t-test. *P < 0.05 was considered as significant.
migration capability of ACHN cells. Further, ALP cDNA transfected A498 cells also showed significant reduction in the migratory properties as compared with control A498 cells (Fig. 6B).
and A498 cells transfected with ALP cDNA to that of cells alone or transfected with vector alone (P ¼ 0.000; Fig. 7A, B). 3.8. ALP cDNA transfected cells showed increased apoptosis
3.7. Decreased cell viability in the cells transfected with ALP cDNA The MTT assay was performed to assess the viability of cells, which documented a significant reduction in the viability of ACHN
Finally, to determine whether the decreased cell viability is due to increased apoptosis, Annexin V-FITC/PI apoptosis assay kit was used to detect cell apoptosis. Non-transfected RCC cells as well as
Fig. 7. Effect of L/B/K ALP cDNA transfection on cell migration. The representative pictures of (A) ACHN (B) A-498, in cell wounding and migration assay. The pictures show the migration of RCC cells 0 h and after 48 h of scrape in different groups. The lines show the initial start point where the cell began the migration process and how far the cells have migrated after 48 h. All experiments data are expressed as means ± S.D. of the three measurements.*P < 0.05; **P < 0.01 compared to control.
Please cite this article in press as: U. Sharma, et al., Reduced L/B/K alkaline phosphatase gene expression in renal cell carcinoma: Plausible role in tumorigenesis, Biochimie (2014), http://dx.doi.org/10.1016/j.biochi.2014.05.011
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
BIOCHI4462_proof ■ 9 June 2014 ■ 7/9
U. Sharma et al. / Biochimie xxx (2014) 1e9
vector alone transfected cells were used as the control group. A significant increased apoptosis was observed in the cells (ACHN and A498) transfected with ALP cDNA (P ¼ 0.001; Fig. 8). ALP cDNA transfected ACHN cells underwent apoptosis as compared with cells alone and vector alone transfected cells (30.1%, 4.5% and 7.5%; Fig. 8A). Similarly, 36.5% of A498 cells transfected with ALP cDNA underwent apoptosis in comparison to corresponding cells alone (7.3%) and vector alone transfected cells (8.2%) (Fig. 8B). 4. Discussion Based on our previous investigation, L/B/K ALP activity was significantly reduced in BBM and cytosol of RCC tissue which was partly associated with alteration in lipid composition [8,15]. To find out whether observed reduced activity of L/B/K ALP is also due to reduced gene expression in RCC. The present study revealed the reduced ALP protein presentation on the microvillus membrane of RCC cells by immunohistochemistry, immunofluorescence and flow cytometry analysis (Figs. 1e3). Further, real time PCR analysis confirmed the decreased L/B/K ALP gene expression in RCC. Ectopic expression of ALPs is often observed in cancer cells [20e23]. The regan isoenzyme of ALP was found to be increased in serum of RCC patients [24]. However, it was a single case study. Notably, we have also checked the serum total ALP activity in 82 cases but did not find any alteration in the serum total ALP activity. Strikingly, the L/B/K ALP isoenzyme is prominently expressed in kidney, whilst, regan isoenzyme is prominently expressed in placenta [24]. Diminished expression of ALP was noticed in malignant tissues viz. osteosarcoma [25,26], oral cancer [27], meningiomas [28,29], colon cancer [30] and breast cancer [31]. Notwithstanding, the exact mechanism of decreased expression of ALP isoenzymes is not clear so far. L/B/K ALP is a marker of renal epithelial cells. However, its mechanism of action is still poorly understood in neoplastic
7
conditions. In L/B/K ALP transfected cells i.e. ACHN and A498, lower tumorigenic and metastatic ability has been found to be associated with high level of ALP activity in this study. Besides this, an inverse relationship has been found between cellular L/B/K ALP expression and aggressiveness in human osteosarcoma. Zucchini et al. have shown 79 differentially expressed genes between high and low L/B/ K ALP activity clones using cDNA microarray technology [32]. These differentially expressed genes could be responsible for broad range of functional categories like cell growth, cell cycle maintenance, signal transduction, DNA and RNA metabolism, cytoskeleton and motility. Strikingly, Cadherin 13 and Caveolin 1 genes were upregulated in high L/B/K ALP activity cells which are involved in cellecell adhesion and cell growth. Caveolin-1 in renal cell carcinoma promotes tumor cell invasion and in cooperation with pERK (phosphorylated ERK) predicts the metastasis in patients with clinically confined disease [33], suggesting an important and direct mediator of invasion in bonefide human RCC cells of clear cell origin. Recently, Yamasaki et al. [34] reported silencing of caveolin2 in 786-O and A498 cells reduced cell invasion and growth. Moreover, RCC is a highly vascular tumor and previous studies documented a significant positive correlation between tumor caveolin-1 levels and high microvessels density [35]. This may provide the explanation the lower level of malignancy found in RCC cell lines transfected with L/B/K ALP gene. Further, cell cycle and proliferative biomarkers viz. cyclin D, cyclin E, p16, p21, p27, p53, p57 and Ki67 analysis were performed using immunohistochemsitry on microarray constructs. It revealed aberrantly expressed cell cycle and correlation of proliferative biomarkers with aggressive pathologic features and inferior oncologic outcomes in patients with clear cell renal cell carcinoma [36]. In the present study, we also demonstrated decrease in cell migration in ALP cDNA transfected cells. Concomitantly, these L/B/K ALP cDNA transfected cells showed a high degree of apoptosis (Fig. 8).
Fig. 8. Effect of L/B/K ALP cDNA transfection on cell apoptosis. Apoptosis rates of RCC cells (A) ACHN and (B) A498 transiently transfected with empty vector and ALP cDNA, the percentage of apoptotic cells were measured by flow cytometry using the annexin V-PI assay. (a) Flow cytometry of cells alone (b) vector alone or empty vector transfected cells (c) ALP cDNA transfected cells (d) Bar diagram showing the percentage of cells undergone apoptosis. All experiments were repeated three times. Statistical analysis was carried out by means of ANOVA. *P < 0.05, **P < 0.01 compared to control.
Please cite this article in press as: U. Sharma, et al., Reduced L/B/K alkaline phosphatase gene expression in renal cell carcinoma: Plausible role in tumorigenesis, Biochimie (2014), http://dx.doi.org/10.1016/j.biochi.2014.05.011
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 Q1 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
BIOCHI4462_proof ■ 9 June 2014 ■ 8/9
8
U. Sharma et al. / Biochimie xxx (2014) 1e9
In addition, anti-proliferative agents in different human cancer cell lines led to enhanced ALP expression on membrane surface [37e39]. Moreover, retinoic acid a potent morphogen and differentiation factor up-regulates L/B/K ALP in a variety of cells such as neutrophils [40], osteoblast [41] and fibroblast [42]. Taken together, these findings also confirm the involvement of ALPs in cell proliferation and differentiation which was evidenced by demonstrating the correlation of enhanced cell membrane ALP expression and decreased cell proliferation in HeLa S3 cells [43]. Similarly, our study also documented increased membrane ALP expression associated with reduced cell viability. The functional consequences of L/B/K ALP activation also include a decrease in the activity of MMP-9, a metalloproteinase involved in tumor invasion and metastasis [25,44]. Taken together, the findings of this study suggest a significant association between L/B/K ALP expression and renal cell carcinoma which was evidenced by transfecting the RCC cell lines with L/B/K ALP cDNA led to decrease migratory property and increased apoptosis of RCC cell lines. Further, Identification and characterization of factors responsible for aberrant ALP gene expression and molecular mechanism and pathways involved in ALP induced apoptosis will further add our understanding to the mechanism responsible for role of ALP gene expression in RCC that might lead to future targeted therapy. Conflict of interest There is no conflict of interest. Acknowledgments This is a part of research project funded by DBT, New Delhi, India (vide letter no. BT/PR8372/MED/12/345/2006). The authors are thankful to Council of Scientific and Industrial Research, New Delhi, India for awarding junior and senior research fellowship (vide letter no. 09/141(0166)/2006-EMR-I). References [1] J. Jones, H. Out, D. Spentzos, S. Kolia, M. Inan, W.D.B. Eecken, C. Fellbaum, X. Gu, M. Joseph, A.J.P. Antuck, D. Jonas, T.A.L. Bermann, Gene signatures of progression and metastasis in renal cell cancer, Clin. Cancer Res. 11 (2005) 5730e5739. [2] U. Sharma, S.K. Singh, R. Prasad, Inverse correlation of intracellular calcium and cyclic AMP levels in renal cell carcinoma, Cell Biochem. Funct. 30 (2012) 619e622. [3] J.S.P. Yuen, Molecular targeted therapy in advanced renal cell carcinoma: a review of its recent past and a glimpse into the near future, Indian J. Urol. 25 (2009) 427e436. [4] B.J. Drucker, Renal cell carcinoma: current status and future prospects, Cancer Treat. Rev. 31 (2005) 536e545. [5] Y.S. Ahn, H. Zerban, R. Grobholz, P. Bannasch, Sequential changes in glycogen content, expression of glucose transporters and enzymic patterns during development of clear/acidophilic cell tumors in rat kidney, Carcinogenesis 13 (1992) 2329e2334. [6] R.K. Gane, in: K.B. Warren (Ed.), Intracellular transport, Academic Press, NY, 1996, p. 71. [7] S. Noguchi, T. Shuin, Y. Kubota, S. Watanabe, Y. Nagashima, M. Masuda, M. Yao, M. Hosaka, High alkaline phosphatase activity in 3P-induced human renal cancer cells, Cancer Lett. 131 (1998) 223e227. [8] U. Sharma, S.K. Singh, D. Pal, R. Khajuria, A.K. Mandal, R. Prasad, Implication of BBM lipid composition and fluidity in mitigated alkaline phosphatase activity in renal cell carcinoma, Mol. Cell. Biochem. 369 (2012) 287e293. [9] M. Bortolato, F. Besson, B. Roux, An infrared study of the thermal and pH stabilities of the GPI-alkaline phosphatase from bovine intestine, Biochem. Biophys. Res. Commun. 292 (2002) 874e879. [10] J.J. Buzzard, N.G. Wreford, J.R. Morrison, Thyroid hormone, retinoic acid and testosterone suppress proliferation and induce markers of differentiation in cultured rat sertoli cells, Endocrinology 144 (2003) 3722e3731. [11] U. Sharma, D. Pal, R. Prasad, Alkaline phosphatase: an overview, Ind. J. Clin. Biochem., http://dx.doi.org/10.1007/s12291-013-0408-y.
[12] I.W. McDicken, G.H. Stamp, P.J. McLaughlin, P.M. Johnson, Expression of human placental-type alkaline phosphates in primary breast cancer, Int. J. Cancer 32 (1983) 205e209. [13] S. Watanabe, T. Watanabe, W.B. Li, B.W. Soong, J.Y. Chou, Expression of the germ cell alkaline phosphatase gene in human choriocarcinoma cells, J. Biol. Chem. 264 (1989) 12611e12619. [14] K. Higashino, R. Otani, S. Kudo, Y. Yamamura, A fetal intestinal-type alkaline phosphatase in hepatocellular carcinoma tissue, Clin. Chim. 23 (1977) 1615e1623. [15] R. Prasad, S. Lambe, P. Kaler, S. Pathania, S. Kumar, S. Attari, S.K. Singh, Ectopic expression of alkaline phosphatase in proximal tubular brush border membrane of human renal cell carcinoma, Biochem. Biophys. Acta 1741 (2005) 240e245. [16] R. Kumar, R. Prasad, Purification and characterization of a major zinc binding protein from renal brush border membrane of rat, Biochem. Biophys. Acta 1419 (1999) 23e32. [17] H. Hanari, M. Ishida, C.T. Liang, B. Sacktor, Parathyroid hormone increases sodium/calcium exchange activity in renal cells and the blunting of the response in aging, J. Biol. Chem. 261 (1986) 5419e5425. [18] T.D. Schmittgen, K.J. Livak, Analyzing real-time PCR data by the comparative CT method, Nat. Protoc. 3 (2008) 1101e1108. [19] O.H. Lowry, N.J. Roserbrough, A.L. Farr, R.L. Randall, Protein measurement with folin phenol reagent, J. Biol. Chem. 193 (1951) 265e275. [20] J.L. Millan, Oncodevelopmental expression and structure of alkaline phosphatase genes, Anticancer Res. 8 (1988) 995e1004. [21] J.L. Millan, Alkaline phosphatase as a reporter of cancerous transformation, Clin. Chim. Acta 209 (1992) 123e129. [22] J.L. Millan, T. Manes, Seminoma-derived Nagao isozyme is encoded by a germ-cell alkaline phosphatase gene, Proc. Natl. Acad. Sci. 85 (1988) 3024e3028. [23] P. Dua, H.S. Kang, S.M. Hong, M.S. Tsao, S. Kim, D.K. Lee, Alkaline phosphatase ALPPL-2 is a novel pancreatic carcinoma-associated protein, Cancer Res. 73 (2013) 1934e1945. [24] J. Bukowczan, S. Pattman, F. Jenkinson, R. Quinton, Regan isoenzyme of alkaline phosphatase as a tumour maker for renal cell carcinoma, Ann. Clin. Biochem. (2014) [Epub ahead of print]. [25] M.C. Manara, N. Baldini, M. Serra, P.L. Lollini, C. De Giovanni, M. Vaccari, A. Argnani, S. Benini, D. Maurici, P. Picci, K. Scotlandi, Reversal of malignant phenotype in human osteosarcoma cells transduced with the alkaline phosphatase gene, Bone 26 (2000) 215e220. [26] H. Orimo, T. Shimada, Regulation of the human tissue-nonspecific alkaline phosphatase gene expression by all-trans-retinoic acid in SaOS-2 osteosarcoma cell line, Bone 36 (2005) 866e876. [27] B. Xiao, J. Guo, Y. Lou, D. Meng, W. Zhao, L. Zhang, C. Yan, D. Wang, Inhibition of growth and increase of alkaline phosphatase activity in cultured human oral cancer cells by all-trans retinoic acid, Int. J. Oral Maxillofac. Surg. 35 (2006) 643e648. [28] I. Niedermayer, W. Feiden, W. Henn, H. Steilen-Gimbel, W.I. Steudel, K.D. Zang, Loss of alkaline phosphatase activity in meningiomas: a rapid histochemical technique indicating progression-associated deletion of a putative tumor suppressor gene on the distal part of the short arm of chromosome 1, J. Neuropathol. Exp. Neurol. 56 (1997) 879e886. [29] P. Muller, W. Henn, I. Niedermayer, R. Ketter, W. Feiden, W.I. Steudel, K.D. Zang, H. Steilen-Gimbel, Deletion of chromosome 1p and loss of expression of alkaline phosphatase indicate progression of meningiomas, Clin. Cancer Res. 5 (1999) 3569e3577. [30] M.A. Lea, C. Ibeh, J.K. Deutsch, I. Hamid, C. desBordes, Inhibition of growth and induction of alkaline phosphatase in colon cancer cells by flavonols and flavonol glycosides, Anticancer Res. 30 (2010) 3629e3636. [31] L.C. Tsai, M.W. Hung, Y.H. Chen, W.C. Su, G.G. Chang, T.C. Chang, Expression and regulation of alkaline phosphatases in human breast cancer MCF-7 cells, Eur. J. Biochem. 267 (2000) 1330e1339. [32] C. Zucchini, M. Bianchini, L. Valvassori, S. Perdichizzi, S. Benini, M.C. Manara, R. Solmi, P. Strippoli, P. Picci, P. Carinci, K. Scotlandi, Identification of candidate genes involved in the reversal of malignant phenotype of osteosarcoma cells transfected with the liver/bone/kidney alkaline phosphatase gene, Bone 34 (2004) 672e679. [33] L. Campbell, G. Al-Jayyoussi, R. Gutteridge, N. Gumbleton, R. Griffiths, S. Gumbleton, M.W. Smith, D.F.R. Griffiths, M. Gumbleton, Caveolin-1 in renal cell carcinoma promotes tumour cell invasion, and in co-operation with perk predicts metastases in patients with clinically confined disease, J. Transl. Med. 11 (2013) 255e268. [34] T. Yamasaki, N. Seki, H. Yoshino, T. Itesako, H. Hidaka, Y. Yamada, S. Tatarano, T. Yonezawa, T. Kinoshita, M. Nakagawa, H. Enokida, MicroRNA-218 inhibits cell migration and invasion in renal cell carcinoma through targeting caveolin-2 involved in focal adhesion pathway, J. Urol. 190 (2013) 1059e1068. [35] H.J. Joo, D.K. Oh, Y.S. Kim, K.B. Lee, S.J. Kim, Increased expression of caveolin-1 and microvessel density correlates with metastasis and poor prognosis in clear cell renal cell carcinoma, BJU Int. 93 (2004) 291e296. [36] B.A. Gayed, R.F. Youssef, A. Bagrodia, P. Kapur, O.M. Darwish, L.M. Krabbe, A. Sagalowsky, Y. Lotan, V. Margulis, prognostic role of cell cycle and proliferative biomarkers in patients with clear cell renal cell carcinoma, J. Urol. 190 (2013) 1662e1667.
Please cite this article in press as: U. Sharma, et al., Reduced L/B/K alkaline phosphatase gene expression in renal cell carcinoma: Plausible role in tumorigenesis, Biochimie (2014), http://dx.doi.org/10.1016/j.biochi.2014.05.011
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11
BIOCHI4462_proof ■ 9 June 2014 ■ 9/9
U. Sharma et al. / Biochimie xxx (2014) 1e9 [37] H. Sadeghi, R. Yazdanparast, Effect of Dendrostellera lessertii on the intracellular alkaline phosphatase activity of four human cancer cell lines, J. Ethnopharmacol. 86 (2003) 11e14. [38] R. Yazdanparast, H. Sadeghi, Nucleic acid synthesis in cancerous cells under the effect of gnidilatimonoein from Daphne mucronata, Life Sci. 74 (2004) 1869e1876. [39] A. Sadeghirishi, R. Yazdanparast, Plasma membrane homing of tissue nonspecific alkaline phosphatase under the influence of 3-hydrogenkwadaphnin, an anti-proliferative agent from Dendrostellera lessertii, Acta Biochim. Pol. 54 (2007) 323e329. [40] N. Sato, O. Takatani, H.P. Koeffler, H. Sato, S. Asano, F. Takaku, Modulation by retinoids and interferons of alkaline phosphatase activity in granulocytes induced by granulocyte colony-stimulating factor, Exp. Hematol. 17 (1989) 258e262.
9
[41] H. Zhou, R.G. Hammonds, D.M. Findlay, P.J. Fuller, T.J. Martin, K.W. Ng, Retinoic acid modulation of mRNA levels in malignant, non-transformed and immortalized osteoblasts, J. Bone Miner. Res. 6 (1991) 767e777. [42] D.H. Reese, R.A. Larsen, F.J. Hornicek, Control of alkaline phosphatase activity in C3H10T1/2 cells: role of retinoic acid and cell density, J. Cell. Physiol. 151 (1992) 239e248. [43] J.F. Telfer, C.D. Green, Placental alkaline phosphatase activity is inversely related to cell growth rate in HeLa S3 cervical cancer cells, FEBS Lett. 329 (1993) 238e244. [44] B.P. Himelstein, R. Canete-Soler, E.J. Bernhard, D.W. Dilks, R.J. Muschel, Metalloproteinase in tumor progression: the contribution of MMP-9, Invas. Metast. 14 (194e95) 246e258. Q2
Please cite this article in press as: U. Sharma, et al., Reduced L/B/K alkaline phosphatase gene expression in renal cell carcinoma: Plausible role in tumorigenesis, Biochimie (2014), http://dx.doi.org/10.1016/j.biochi.2014.05.011
12 13 14 15 16 17 18 19 20 21 22