- Email: [email protected]
Reduced proliferation of non-megakaryocytic acute myelogenous leukemia and other leukemia and lymphoma cell lines in response to eltrombopag
Leukemia Research 34 (2010) 1224–1231
Contents lists available at ScienceDirect
Leukemia Research journal homepage: www.elsevier.com/locate/leukres
Reduced proliferation of non-megakaryocytic acute myelogenous leukemia and other leukemia and lymphoma cell lines in response to eltrombopag Connie L. Erickson-Miller a,∗ , Jennifer Kirchner a , Manuel Aivado b , Richard May c , Parrish Payne c , Antony Chadderton a a b c
Oncology Translational Research, GlaxoSmithKline, 1250 South Collegeville Road, Collegeville, PA, USA Oncology Global Clinical Development, GlaxoSmithKline, Collegeville, PA, USA Southern Research Institute, Birmingham, AL, USA
a r t i c l e
i n f o
Article history: Received 7 October 2009 Received in revised form 12 January 2010 Accepted 5 February 2010 Available online 3 March 2010 Keywords: Apoptosis qRT-PCR TpoR MPL Differentiation FAB
a b s t r a c t Leukemia cell lines were treated with eltrombopag or thrombopoietin and their proliferative response was determined. Eltrombopag did not increase proliferation of cell lines that did not express high levels of megakaryocyte markers. Instead, treatment with eltrombopag alone inhibited proliferation of many cell lines (IC50 range = 0.56–21 g/mL). The addition of other cytokines, such as G-CSF, Epo or Tpo, did not affect the decrease in proliferation. The decrease in proliferation appears to be through a TpoRindependent, nonapoptotic mechanism. These findings suggest that eltrombopag does not enhance, but rather inhibits, proliferation of leukemia cell lines in vitro. © 2010 Elsevier Ltd. All rights reserved.
1. Introduction Thrombocytopenia in leukemia patients can result from incompetent marrow due to the disease or damage of the marrow due to chemotherapy. The development of targeted thrombopoietic agents has implications for improving therapy for patients suffering low platelet counts due to their disease. Approximately 40–65% of patients with myelodysplastic syndrome (MDS) or acute myelogenous leukemia (AML) are reported to be thrombocytopenic [1,2]. Eltrombopag (SB-497115, PROMACTA® ; GlaxoSmithKline, USA) represents the first oral, small molecule, non-peptide thrombopoietin receptor (TpoR) agonists. Eltrombopag has been approved for treatment of adults with chronic idiopathic thrombocytopenic purpura (ITP) in the USA, and is in clinical trials for the treatment of thrombocytopenia associated with chronic liver disease, Hepatitis C antiviral therapy, MDS and chemotherapy induced thrombocytopenia (www.clinicaltrials.gov). Eltrombopag increased platelet counts in normal subjects, as well as in patients with chronic ITP and chronic Hepatitis C patients [3–6]. Eltrombopag stimulates differentiation of normal CD34+ marrow cells into megakaryocytes, but its requirement for TpoR expression limits its specificity to the
∗ Corresponding author. Tel.: +1 610 917 4509; fax: +1 610 917 4989. E-mail address: Connie L [email protected] (C.L. Erickson-Miller). 0145-2126/$ – see front matter © 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.leukres.2010.02.005
megakaryocyte lineage [7,8]. However, there remains the question of whether eltrombopag might have the potential to induce proliferation of any TpoR expressing cell. Various reports found approximately 50% of AML patient blood or marrow expresses MPL, the gene for TpoR [9,10]. Additional reports investigating the proliferative response of AML patient samples to thrombopoietin (Tpo) or megakaryocyte growth and development factor (MGDF) demonstrated a range of proliferation responses (0–40%) in AML samples, although these did not correlate with the patient’s French American British (FAB) classification [11–21]. Several megakaryocytic cell lines were used to identify and characterize eltrombopag [8], but its effects on other leukemia cell lines had not been examined. This manuscript describes the expression of MPL on a number of AML and other leukemia and lymphoma cell lines and reports how eltrombopag affects the proliferation, apoptosis and differentiation of these cell lines. 2. Materials and methods 2.1. Cytokines and compound rhTpo, recombinant human stem cell factor (rhSCF), and recombinant murine interleukin-3 (rmIL-3) were obtained from R&D Systems, Inc. (Minneapolis, MN, USA). Recombinant human erythropoietin (rhEpo) and G-CSF were obtained from Amgen, Inc. (Thousand Oaks, CA, USA). Cytokines were diluted in Iscove’s Modified Dulbecco’s Medium (IMDM) and used at final concentrations of 1, 3, 10, 30 or 100 ng/mL. SB-497115-GR, the monoethanolamine salt form, was resus-
C.L. Erickson-Miller et al. / Leukemia Research 34 (2010) 1224–1231 Table 1 Tritiated-thymidine incorporation proliferation assay IC50 values for eltrombopag on various leukemia cell lines. Cell line
Cell Type [28]
IC50 (g/mL)
MOLT-4 CCRF-CEM SR K562 HL-60 HEL92.1.7 THP-1 F-36P RPMI-8226 OCI-AML2 OCI-AML3 U937 PLB-985 ML-2 N2C-Tpo OCI-M1 NOMO-1
T cell leukemia T cell leukemia Large cell lymphoma (T-cell) Myeloid/erythroid leukemia Myeloid leukemia Erythroid leukemia Monocytic leukemia Erythroid leukemia Multiple myeloma (pasma cell) Monocytic leukemia Monocytic leukemia Histiocytic lymphoma (monocytic) Myeloid leukemia AML (moncytic) AML (megakaryocytic leukemia) Erythroid leukemia Monocytic leukemia
0.56 0.74 0.77 1.8 2.2 2.3 2.4 4.1 5.9 6.0 8.2 11.4 15.4 15.4 20.7 >40 >40
pended in water and diluted in IMDM with 1% fetal calf serum (FCS) for use at 0.001–100 g/mL. 2.2. Cell lines The N2C-Tpo cell line is a human Tpo-dependent cell line with endogenous human Tpo receptor (TpoR), derived by growth of UT7-Epo cells in rhTpo and was graciously provided by Dr. Camille Abboud of Washington University (St. Louis, MO). The other cell lines and their cell type are listed in Table 1 and were obtained either from the American Type Culture Collection (ATCC; Rockville, MD) or the German Collection of Microorganisms and Cell Cultures (DSMZ; Braunschweig, Germany). 2.3. Annexin-V/7-AAD staining Apoptosis was assessed by Annexin-V staining plus 7-AAD staining and measured by flow cytometry. Cells were stained using the Annexin V apoptosis kit (BD Biosciences; San Jose, CA). Briefly, cells were resuspended to 1 × 106 /mL in Annexin-V staining buffer and 100 L transferred to a reaction tube. Five L of Annexin-V-FITC and 12.5 g/mL of 7-AAD were added to the tube which was then incubated at room temperature for 15 min in the dark. After incubation, 400 L of staining buffer was added and fluorescence was measured immediately using a standard compensated two color protocol on a Becton Dickinson LSRII flow cytometer. A minimum of 10,000 events were collected for each sample. 2.4. Proliferation measurements using 3 H-methyl-thymidine The CCRF-CEM, HL-60, K562, MOLT-4, RPMI-8226 and SR cell lines were cultured at 1 × 104 cells/well in 200 L medium in 96-well flat-bottom plates. Eltrombopag (100 ng/mL to 40 g/mL) was tested in the presence or in the absence of G-CSF (10 ng/mL), Tpo (100 ng/mL), or Epo (5 U/mL). Cells were tested in each condition alone to establish the 100% control values. After a 3-day incubation at 37 ◦ C in 5% CO2 , 3 H-thymidine (1 Ci/well) was added for 18 h. The plates were harvested on a Brandel harvester (Gaithersburg, MD) and radioactivity on the filtermats was measured in a Wallac Microbeta scintillation counter (PerkinElmer Inc., Foster City, CA). The effect of eltrombopag was reported as percent of control by comparing the results of cells treated with compound-treated wells versus control wells. The HEL92.1.7, THP-1, F-36P, OCI-AML2, OCI-AML3, U937, PLB-985, ML-2, N2CTpo, OCI-M1 and NOMO-1 cell lines were washed in medium and resuspended to 2.2 × 105 /mL. 2 × 104 cells (0.8 mL) were added to wells of a round bottom 96-well plate in triplicate. Eltrombopag was added to wells at concentrations of 0, 0.1, 0.4, 1, 4, 10 and 40 g/mL. Similarly 100 ng/mL Tpo was also added to separate wells. Plates were incubated for 72 h. At 18 h before the end of the incubation period 1 Ci of 3 Hmethyl-thymidine was added to all wells and the plates returned to the incubator. After 72 h cells were harvested using a TomTec plate harvester (TomTec; Hamden, CT) onto filter mats. The mats were allowed to dry overnight and the incorporated radioactivity measured the next day with a MicroBeta plate counter (PerkinElmer Inc., Foster City, CA). Mean measurements and standard deviations were calculated using Microsoft Excel. 2.5. Measurement of the acute myeloid leukemia phenotype Cells were evaluated using the antibody panel recommended by the FAB classification system for AML [22]. Briefly, the method was as follows: cell lines were washed and resuspended to 2 × 105 cells/mL in their respective growth medium. Eltrombopag was added to the flasks at concentrations of 0.1, 0.4, 1, 4, 10 and 40 g/mL and rhTPO added at 100 ng/mL. Flasks were incubated for 72 h at 37 ◦ C
1225
and 5% CO2. After 72 h cells were removed from flasks and washed in PBS and resuspended in 2 mL of PBS. 100 L of the cell suspension was transferred to reaction tubes and cells incubated for 30 min with 20 L of fluorescein isothiocyanate (FITC)-conjugated CD2, CD3, CD4, CD7, CD10, CD15, CD19, CD33, HLA-DR (BD Biosciences) and CD65 (AbCam) or similarly, 20 L of PE-conjugated CD11b, CD11c, CD13 and CD34 or 20 L of CD14-APC (BD Biosciences). In addition, 20 L of the erythroid markers CD36–FITC and CD235a-PE (glycophorin-A; BD Biosciences) were also added and incubated as above. After incubation, cells were washed in PBS supplemented with 0.2% BSA (Sigma–Aldrich Chemicals, St. Louis, MO) and resuspended in 0.5 mL PBS/0.2% BSA. Cell fluorescence was read upon the Becton Dickinson LSRII flow cytometer. The relevant isotype controls were evaluated simultaneously on the same cells to establish analysis gate boundaries. A minimum of 10,000 events were collected per sample. CD41 and CD61 (BD Biosciences) expression on the surface of several cell lines was assessed by flow cytometry to determine the megakaryocytic differentiation of the cell lines. 2.6. Quantitative reverse transcription-PCR for MPL (TpoR) Cells were cultured to sub-confluency and washed in media. Cells were then resuspended to 1–2 × 106 /mL, pelleted in a microfuge at 100 rpm and subsequently resuspended in 1 mL trizol reagent (Invitrogen; Carlsbad, CA). RNA was then extracted according to the vendor’s supplied instructions. Total RNA was resuspended in 25 L DEPC treated water and quantified by UV spectrophotometry at 260 and 280 nm. One g of RNA was DNase treated with 1 U DNAase I (Invitrogen). The reaction was stopped by adding 1 L of 25 M EDTA with heating to 65 ◦ C for 10 min. After cooling the volume was brought to 50 L with DEPC treated water. cDNA was produced using the cDNA archive kit (Applied Biosytems, Foster City, CA) according to the supplied instructions. The total volume used for cDNA production was 100 L. The expression of MPL, the TpoR gene, was determined using FAM-TAMRA labeled primers and probe in a 7900HT thermal cycler using a standard 40-cycle profile with 9600 emulation. Following amplification, calculations were performed using GSK mathematical algorithm that calculated the relative abundance of MPL normalized to three housekeeping genes, GAPDH (glyceraldehyde-3-phosphate dehydrogenase), ACTB (-actin) and PPIA (cyclophilin A), whose primer and probe sequences are below. Each result is presented as a normalized value of mRNA. A normalized abundance of <50 is below the level of detection of the method. The primers and probes used for real time quantitative reverse transcriptionPCR (qRT-PCR) were custom made by Integrated DNA Technologies (Coralville, IA), sequences listed below. MPL (thrombopoietin receptor) Forward: AGTGGAACCCAGCCTCCTTG Reverse: CTGCAATCTTCGGTAGTCCATCTG Probe: CAAGTCCTCAGAGGACTCCTTTGCCC GAPDH Forward: CAA GGT CAT CCA TGA CAA CTT TG Reverse: GGG CCA TCC ACA GTC TTC TG Probe: ACC ACA GTC CAT GCC ATC ACT GCC A PPIA Forward: CAT CTG CAC TGC CAA GAC TGA Reverse: TGC CTT CTT TCA CTT TGC CA Probe: CAC CAC ATG CTT GCC ATC CAA CCA ACTB Forward: GAG CTA CGA GCT GCC TGA CG Reverse: GAT GTT TCG TGG ATG CCA CAG GAC Probe: CAT CAC CAT TGG CAA TGA GCG GTT CC 2.7. Western blot for TpoR Cell lysates were prepared from cells in log phase growth. Electrophoresis was performed on cell lysates (50 g/well) on NuPage 4–12% Bis–Tris gels (Invitrogen; Carlsbad, CA) with MOPS running buffer under reducing conditions. Precision Protein Dual Color Standards (Bio-Rad; Hercules, CA) were used for molecular weight markers. The gels were transferred to nitrocellulose and stained with a rabbit polyclonal anti-TpoR primary antibody (Upstate Biotechnology Inc.; Lake Placid, NY; Cat# 06-944). 2.8. Data analysis Calculations of the mean and standard deviation were calculated by Microsoft Excel. Curve-fitting and IC50 values for the thymidine incorporation data were generated using a Microsoft Excel XLfit 4.0 curve fit algorithm.
1226
C.L. Erickson-Miller et al. / Leukemia Research 34 (2010) 1224–1231
Fig. 1. Representative graphs demonstrating effect of 72 h treatment with eltrombopag on thymidine incorporation in (A) OCI-AML3, (B) THP-1, (C) ML-2 and (D) NOMO-1 cell lines. CPM = counts per minute.
3. Results 3.1. Proliferation results The human leukemia and lymphoma cell lines tested, CCRFCEM, HL-60, K562, MOLT-4, RPMI-8226, SR, OCI-AML2, OCI-AML3, ML-2, THP-1, F-36P, U937 and PLB-985, demonstrated no increase in proliferation following 72 h treatment with eltrombopag. In fact, there was a decrease in proliferation in these cell lines, generally at eltrombopag concentration greater than 1 g/mL (Fig. 1A–C). These data were fit to curves and IC50 values for the decrease in proliferation ranging from 0.5 to 21 g/mL (Table 1). Two cell lines, NOMO-1 (Fig. 1D) and OCI-M1 (data not shown) demonstrated either no, or an incomplete, inhibition of proliferation at these doses thus, the IC50 of these two cell lines was reported as >40 g/mL, the maximal concentration of eltrombopag tested. All cell lines with decreased proliferation reached 100% inhibition of thymidine incorporation at approximately 40 g/mL.
Viable cell counts, using trypan blue exclusion, confirmed that the decrease in tritiated thymidine incorporation, which measures DNA replication, was representative of a decrease in the number of viable cells (data not shown), suggesting true cell death. The N2C-Tpo cell line, a megakaryoblastic leukemia cell line initially used in the discovery of eltrombopag [8], demonstrated a 3.5-fold increase in proliferation at 0.006–1.7 g/mL eltrombopag (Fig. 2A). However, at higher concentrations of eltrombopag, this line also demonstrated the decreased proliferation with an IC50 = 20.7 g/mL, similar to the response seen in other leukemic lines (Table 1). HEL92.1.7 cells, an erythroleukemia cell line, demonstrated a 1.1- to 1.2-fold, statistically significant (p < 0.01), enhancement in proliferation at 0.1–0.4 g/mL in two of the five proliferation experiments in which it was tested (Fig. 2B). This cell line also exhibited a decrease in proliferation at higher eltrombopag concentrations with an IC50 = 2.3 g/mL (Table 1). These two cell lines expressed the highest levels of TpoR mRNA as determined by qRT-PCR, at 1000- to 5000-fold higher levels than most
Fig. 2. Thymidine incorporation following 72 h treatment with eltrombopag in (A) N2C-Tpo cells and (B) HEL92.1.7 cells. The counts per minute at each data point are expressed as a percent of the untreated control samples. The expression of CD41 and CD61 as determined by flow cytometry is shown below each proliferation graph.
C.L. Erickson-Miller et al. / Leukemia Research 34 (2010) 1224–1231
1227
Table 2 IC50 values of eltrombopag and MPL (TpoR) mRNA expression by qRT-PCR of various leukemia cell lines. MPL is expressed as relative abundance after normalization to the housekeeping genes ACTB, PPIA and GAPDH. Cell line
IC50 (g/mL)
K562 HEL92.1.7 F-36P OCI-AML2 OCI-AML3 U937 PLB-985 ML-2 N2C-Tpo NOMO-1
1.8 2.3 4.1 6.0 8.2 11.4 15.4 15.4 20.7 >40
MPL mRNA (normalized abundance) <50 11,770 <50 <50 1050 <50 <50 <50 20,453 <50
MPL mRNA was analyzed by qRT-PCR. Abundance was normalized to the housekeeping genes, GAPDH, PPIA and ACTB. Normalized abundance <50 are below the limits of detection of the method.
of the other lines (Table 2). These two cell lines were also found to express high levels of the megakaryocyte markers, CD41 and CD61, although the expression did not change following eltrombopag treatment. 3.2. Response to additional cytokines In the AML cell lines OCI-AML2, OCI-AML3, ML-2 and HL-60, eltrombopag was tested in combination with G-CSF, a cytokine frequently used in the treatment of AML patients. Two concentrations of G-CSF were used (4 and 40 ng/mL) with 40 ng/mL reflecting a 5-fold the Cmax concentration of G-CSF used in the clinic to relieve neutropenia. The OCI-AML2 cell line was the only line which responded to G-CSF (40 ng/mL) with increased proliferation (Fig. 3A). In spite of the higher baseline of proliferation due to 40 ng/mL G-CSF response, a decrease in proliferation occurred in the presence of eltrombopag. There was an approximately 1.7-fold shift in the IC50 in the presence of G-CSF (12.2 g/mL) as opposed to its absence (7.0 g/mL). There was little effect of G-CSF on ML2, OCI-AML3 and HL-60 cells and these cell lines demonstrated a decrease in proliferation in response to eltrombopag, regardless of the addition of G-CSF (data not shown). Recombinant Tpo was tested in these proliferation assays at a set concentration of 100 ng/mL, a level that supports maximal stimulation of the N2C-Tpo cells [7,8]. Tpo enhanced proliferation in a small, but statistically significant (p < 0.05 by Student’s t-test) manner in the CCRF-CEM and RPMI-8226 cell lines (Fig. 3B and C). In addition to Tpo, Epo and G-CSF also exhibited a small, but statistically significant increase in proliferation of the plasmacytoma cell line RPMI-8226 (Fig. 3C). However, eltrombopag alone did not increase proliferation in the cell lines that respond to Tpo. Eltrombopag, combined with these cytokines, continued to demonstrate a decrease in proliferation, overriding any proliferative enhancement of Epo, G-CSF or Tpo (Fig. 3B and C). 3.3. MPL (TpoR) expression The level of MPL mRNA expressed on a set of AML lines was determined by qRT-PCR. The abundance of MPL mRNA, normalized to a set of housekeeping genes, GAPDH, ACTB (-actin) and PPIA (cyclophilin A), for these leukemia cell lines is shown in Table 2. There was no apparent relationship between TpoR message expression and the IC50 of decreased proliferation. The two cell lines expressing the highest levels of MPL mRNA, N2C-Tpo and HEL92.1.7, were the only two lines demonstrating detectable levels of TpoR by western blot analysis of cell lysates (data not shown). The OCI-AML3 cell line had detectable levels of
Fig. 3. Effects of eltrombopag on proliferation of (A) OCI-AML2 cells in combination with 4 or 40 ng/mL G-CSF, (B) CCRF-CEM in combination with recombinant Tpo (100 ng/mL), Epo (5 U/mL) or G-CSF (10 ng/mL) and (C) RPMI-8226 cells in combination with recombinant Tpo, Epo or G-CSF.
MPL mRNA expression (relative abundance ≥50), but no protein was observed by western blot. 3.4. Apoptosis To determine if apoptosis was the mechanism of decreased proliferation, three AML cell lines, OCI-AML2, OCI-AML3 and ML-2, were selected for further examination of apoptosis by flow cytometry using the Annexin-V/7-AAD method. In this method, live cells are Annexin-V−/7-AAD−, apoptotic cells are Annexin-V+/7-AAD− and necrotic or dead cells are Annexin-V+/7-AAD+. The data for a representative cell line, ML-2 is shown in Fig. 4. Up to 18% apoptotic cells at 4 and 10 g/mL eltrombopag were seen in the ML-2 and OVI-AML2 cell lines, however, the majority of the cells at 10 and 40 g/mL were observed in the Annexin-V+/7-AAD+ necrotic quadrant at 48 and 72 h in all three lines (represented by the ML-2 cell line in Fig. 5, top). The small amount of apoptosis would not be sufficient to explain the decrease in proliferation. To determine if apoptosis was occurring rapidly and transiently, before 24 h, additional experiments were performed to measure apoptosis at 2-, 4- and 8-h time points. No apoptotic cells were apparent and the
1228
C.L. Erickson-Miller et al. / Leukemia Research 34 (2010) 1224–1231
Fig. 4. Representative graph of Annexin-V/7-AAD measured by flow cytometry of ML-2 cells treated for 72 h with 0, 4, or 10 g/mL eltrombopag or 100 ng/mL Tpo, demonstrating the live, apoptotic and necrotic quadrants.
cells became necrotic/dead as early as 2 h after 4, 10 and 40 g/mL eltrombopag treatment (Fig. 5, bottom). These data suggest that eltrombopag may kill cells via a mechanism that does not involve apoptosis. 3.5. Differentiation A decrease in proliferation of leukemia cells may be caused by differentiation into non-proliferative, end stage cells. The expression of cell surface markers was used to classify and identify the extent of differentiation of these cell lines. The FAB phenotype panel used here consisted of CD2, CD3, CD4, CD7, CD10, CD11b, CD11c, CD13, CD14, CD15, CD19, CD33, CD34, HLA-DR and CD65 [22]. CD36 and CD235a were added to determine the erythroid component of these cell lines. OCI-AML2, OCI-AML3, ML-2, HEL92.1.7, U937, K562 and PLB-985 were treated with eltrombopag (0.1–40 g/mL) over 72 h and the change in differentiation compared to vehicle treated cells was measured by marker specific antibody binding and flow cytometry. Representative data for the ML-2 cell line, which showed enhanced CD36 and CD235a erythroid differentiation, is shown in Fig. 6. While some markers decreased in some cell lines and other increased, there were no large or consistent changes in the differentiation of the cell lines in response to eltrombopag (Table 3). This was particularly true of the phenotypes that would be expected to be more proliferative, such as CD34 or CD33 expressing cells. Tpo (100 ng/mL) was used as a control, and there were no changes in marker expression due to Tpo treatment (data not shown).
4. Discussion Patients with AML or MDS frequently have neutropenia or thrombopcytopenia [1,2]. The first step in determining the utility of the non-peptide, small molecule TpoR agonist, eltrombopag, in these patients is to determine its effects on AML cell lines. Eltrombopag did not increase the proliferation of the 15 leukemia and lymphoma cell lines that were not of megakaryocytic origin. Interestingly, there was a decrease in proliferation (thymidine incorporation) at higher concentrations of eltromobopag which is confirmed by a decrease in viable cell number both by trypan blue exclusion and flow cytometry with 7-AAD staining. In considering the potential impact of these results in the clinic, it is important to note that the concentrations of eltrombopag that induce the decrease in proliferation of leukemia cell lines reported here, are physiologically achievable in patients. The maximum concentration in ITP patients (Cmax ) dosed at 75 mg was 11.4 ug/mL and the minimum concentration detected after 24 h (prior to the next daily dose) was ∼5.3 g/mL in these subjects. Thrombocytopenia in patients in the clinic frequently occurs in conjunction with other cytopenias, and patients may be treated with cytokines, such as G-CSF or Epo. In the two cell lines (OCIAML2 and RPMI-8226) that demonstrated enhanced proliferation in the presence of cytokines such as G-CSF, Tpo or Epo, there was no proliferative effect of eltrombopag added to those cytokines. Again, there was a decrease in proliferation at higher concentrations of eltrombopag and in the OCI-AML2 was there a 2-fold shift in IC50 ,
C.L. Erickson-Miller et al. / Leukemia Research 34 (2010) 1224–1231
1229
Fig. 5. Annexin-V/7-AAD apoptotic and necrotic quadrants measured by flow cytometry of ML-2 cells after 24, 48 or 72 h (top panels) and 2, 4 and 8 h (bottom panels) incubation with eltrombopag. The bar at the left of each graph represents Tpo (100 ng/mL) treatment at these time points.
however, this was the only cell line with a robust response to G-CSF, alone. One explanation for the decrease in proliferation of the leukemia cell lines is that they are differentiating into cells of a more mature, non-proliferative myeloid or lymphoid phenotype. While there were some changes in the expression of the markers used in the FAB classification, it seems unlikely that these small changes could account for the complete inhibition of proliferation that occurred at most of the cell lines once the concentration of eltrombopag was ≥4 ug/mL. The decrease in proliferation of the leukemia cell lines was apparently not a result of apoptosis of the cell lines, as measured by Annexin-V. Rather, cells accumulated in the necrotic region and this death occurred as early as 4 h following 40 ug/mL of eltrom-
bopag treatment. This suggests that eltrombopag may kill cells via a mechanism that does not involve apoptosis. Preliminary results demonstrated no expression of Beclin-1, a marker of autophagy [23], however, further examination of mechanisms other than apoptosis, such as autophagy and entosis [24] is warranted to further understand the effects of eltrombopag. The expression of high levels of TpoR mRNA in these leukemia cell lines appears in conjunction with the megakaryocyte markers, CD41 and CD61, and may indicate a megakaryocytic phenotype that can proliferate in response to eltrombopag. This is not unexpected, as the megakaryoblastic leukemia cell line, N2C-Tpo, was used to identify and characterize eltrombopag [8]. Reports of proliferation in response to Tpo or MGDF were noted in the M7 subtype of AML samples [12,14,16,17,21]. However, there does not appear to be any
Fig. 6. Expression of FAB panel cell surface markers on the ML-2 cell line after 72 h treatment with vehicle, 0.1, 1, 10 or 100 g/mL eltrombopag or 100 ng/mL Tpo.
1230
C.L. Erickson-Miller et al. / Leukemia Research 34 (2010) 1224–1231
Table 3 Differentiation of cell lines in response to 72 h treatment of eltrombopag as measured by flow cytometry. Gray boxes represent no change from untreated cells, white boxes represent an increase, and dark gray boxes represent a decrease in marker expression. CD marker
HEL92.1.7
2 3 4 7 10 11b 11c 13 14 15 19 33 34 65 HLA-DR Gly-A CD36
OCI-AML2
OCI-AML3
PLB-985
↑ ↑ ↑ ↑ ↑
ML-2
↓
↓
↑ ↑
↓
↑
↓
↑
↓
CLEM, JK, MA and AC are employees of GlaxoSmithKline, CLEM, MA and AC own GSK stock, CLEM is named on GSK patents. RM and PP have no conflicts of interest. Author contributions CLEM designed research, analyzed data, supervised the project and wrote the manuscript. JK and PP carried out research and analyzed data. MA critically reviewed the manuscript and analyzed data. RM designed experiments and analyzed data. AC designed experiments, carried out research and analyzed data. Acknowledgments Disclosures: This work was fully funded by GlaxoSmithKline. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.leukres.2010.02.005.
↓
↓
↓
↑ ↑
↑
Conflict of interest statement
↓
↑ ↑ ↑
relationship between the inhibition of leukemia cell proliferation by eltrombopag and the level of TpoR message expression in the cells. Thus the effect seems to be a TpoR-independent, nonapoptotic cell death. To treat neutropenia in AML and MDS patients, G-CSF has been found to be safe and is frequently used [25], even though it is reported to stimulate proliferation of blasts in the blood of AML patients. Drugs to treat thrombocytopenia have not yet been extensively tested in this patient population. A recent report by Kantarjian [26] describes the effects of the Tpo mimetic, AMG531, which demonstrated an enhancement of bone marrow blasts in low-risk MDS patients, which decreased when the drug was removed. The data presented here suggest that eltrombopag has activity different to recombinant Tpo in that it, in general, does not induce proliferation in AML cell lines, but rather decreases proliferation at achievable physiological concentrations. While the leukemia cell lines in these studies have been extensively cultured, Will et al. recently observed no increase in proliferation in experiments with eltrombopag treatment of primary marrow and blood cells derived directly from AML patients [27].
↓
↑
↓
↑ ↑ ↑
U937
↓
↓
↓ ↓
K562
References [1] Kantarjian H, Giles F, List A, Lyons R, Sekeres M, Pierce S, et al. The incidence and impact of thrombocytopenia in myelodysplastic syndromes. Cancer 2007;109:1705–14. [2] Atallah E, Cortes J, O’Brien S, Pierce S, Rios MB, Estey E, et al. Establishment of baseline toxicity expectations with standard frontline chemotherapy in acute myelogenous leukemia. Blood 2007;110:3547–51. [3] Jenkins JM, Williams D, Deng Y, Uhl J, Kitchen V, Collins D, et al. Phase I clinical study of eltrombopag, an oral, nonpeptide thrombopoietin receptor agonist. Blood 2007;109:4739–41. [4] Bussel J, Cheng G, Saleh MN, Psaila B, Kovaleva K, Meddeb B, et al. Eltrombopag for the treatment of chronic idiopathic thrombocytopenic purpura. N Engl J Med 2007;357:2237–47. [5] Bussel J, Provan D, Shamsi T, Cheng G, Psaila B, Kovaleva L, et al. Effect of eltrombopag on platelet counts and bleeding during treatment of chronic idiopathic thrombocytopenic purpura: a randomized, double-blind, placebo-controlled trial. The Lancet 2009;373:641–8. [6] McHutchison JG, Dusheiko G, Shiffman ML, Rodriguez-Torres M, Sigal S, Bourlier M, et al. Eltrombopag for thrombocytopenia in patients with cirrhosis associated with hepatitis C. N Engl J Med 2007;357:2227–36. [7] Duffy KJ, Erickson-Miller CL. The discovery of eltrombopag, an orally bioavailable TpoR agonist. In: Metcalf BW, Dillon S, editors. Target validation in drug discovery. 1st ed. Burlington, MA: Academic Press; 2007. p. 241–54. [8] Erickson-Miller CL, Delorme E, Tian S-S, Hopson CB, Landis A, Valoret EI, et al. Preclinical activity of eltrombopag (SB-497115), an oral, nonpeptide thrombopoietin receptor agonist. Stem Cells 2009;27:424–30. [9] Vignon I, Dreyfus F, Melle J, Viguie F, Ribrag V, Cocault L, et al. Expression of the c-mpl proto-oncogene in human hematologic malignancies. Blood 1993;82:877–83. [10] Schroder JK, Kolkenbrock S, Tins J, Kasimir-Bauer S, Seeber S, Schutte J. Analysis of thrombopoietin receptor (c-mpl) mRNA expression in de novo acute myeloid leukemia. Leukemia Research 2000;24:401–9. [11] Tokunaga Y, Miyamoto T, Gondo H, Okamura T, Niho Y. Effect of thrombopoietin on acute myelogenous leukemia blasts. Leuk Lymphoma 2000;37:27–37. [12] Matsumura I, Kanakura Y, Kato T, Ikeda H, Ishikawa J, Horikawa Y, et al. Growth response of acute myeloblastic leukemia cells to recombinant human thrombopoietin. Blood 1995;86:703–9. [13] Motoji T, Takanashi M, Motomura S, Yan-Hua W, Shiozaki H, Aoyama M, et al. Growth stimulatory effect of thrombopoietin on the blast cells of acute myelogenous leukaemia. Brit J Haematol 1996;94:513–6. [14] Takeshita A, Shinjo K, Izumi M, Ling P, Nakamura S, Naito K, et al. Quantitative expression of thrombopoietin receptor on leukaemia cells from patients with acute myeloid leukaemia and acute lymphoblastic leukaemia. Brit J Haematol 1998;100:283–90. [15] Wetzler M, Baer MR, Bernstein SH, Blumenson L, Stewart C, Barcos M, et al. Expression of c-mpl mRNA, the receptor for thrombopoietin, in acute myeloid leukemia blasts identifies a group of patients with poor response to intensive chemotherapy. J Clin Oncol 1997;15:2262–8. [16] Piacibello W, Sanavio F, Brizzi MF, Garetto L, Severino A, Aronica MG, et al. Megakaryocyte growth and development factor (MGDF)-induced acute leukemia cell proliferation and clonal growth is associated with functional c-mpl. Leukemia 1997;11:531–40. [17] Hirai H, Shimazaki C, Yamagata N, Goto H, Inaba T, Kikuta T, et al. Effects of thrombopoietin (c-mpl ligand) on growth of blast cells from patients with transient abnormal myelopoiesis and acute myeloblastic leukemia. Eur J Haematol 1997;59:38–46. [18] Adams JA, Liu Yin JA, Brereton ML, Briggs M, Burgess R, Hyde K. The in vitro effect of pegylated recombinant human megakaryocyte growth and development factor (PEG rHuMGDF) on megakaryopoiesis in normal subjects and
C.L. Erickson-Miller et al. / Leukemia Research 34 (2010) 1224–1231
[19]
[20]
[21]
[22]
[23]
patients with myelodysplasia and acute myeloid leukaemia. Br J Haematol 1997;99:139–46. Murayama T, Imoto S, Natazuka T, Chihara K, Matsui T. Proliferative reaction of myelogenous leukemia cells with cytokines G-CSF, GM-CSF, M-CSF, SCF and TPO. Leukemia Research 1998;22:557–60. Quentmeier H, Zaborski M, Graf G, Ludwig WD, Drexler HG. Expression of the receptor MPL and proliferative effects of its ligand thrombopoietin on human leukemia cells. Leukemia 1996;10:297–310. Petrucci MT, Ricciardi MR, Gregorj C, Ariola C, Mazzola F, Fogli M, et al. Thrombopoietin, interleukin-11, and early-acting megakaryocyte growth factors in human myeloid leukemia cells. Leuk Lymphoma 2000;40:179–90. Bennett JM, Catovsky D, Daniel MT, Flandrin G, Galton DAG, Gralnick HR, et al. Proposals for the classification of the myelodysplastic syndromes. Brit J Haematol 1982;51:189–99. Maiuri MC, Tasdemir E, Criollo A, Morselli E, Vicencio JM, Cornuccio R, et al. Control of autophagy by oncogenes and tumor suppressor genes. Cell Death Differ 2009;16:87–93.
1231
[24] Overholtzer M, Mailleux A, Mouneimne G, Normand G, Schnitt SJ, King RW, et al. A nonapoptotic cell death process, entosis, that occurs by cell-in-cell invasion. Cell 2007;131:966–79. [25] Estey EH. Growth factors in acute myeloid leukemia. Best Pract Res: Clin Haematol 2001;14:175–87. [26] Kantarjian H, Fenaux P, Sekeres MA, Becker P, Boruchov A, Bowen D, et al. Phase 1/2 study of AMG531 in thrombocytopenic patients (pts) with lowrisk myelodysplastic syndrome (MDS): update including extended treatment. Blood 2007;110:250. [27] Will B, Kawahara M, Luciano JP, Bruns I, Erickson-Miller CL, Aivado MA, et al. Effect of the non-peptide thrombopoietin receptor agonist Eltrombopag on bone marrow cells from patients with acute myeloid leukemia and myelodysplastic syndromes. Blood 2009;14:3899–908. [28] Drexler HG. Guide to leukemia–lymphoma cell lines. Germany: Braunshweig; 2005. Available from: www.celllines.de.
Contents lists available at ScienceDirect
Leukemia Research journal homepage: www.elsevier.com/locate/leukres
Reduced proliferation of non-megakaryocytic acute myelogenous leukemia and other leukemia and lymphoma cell lines in response to eltrombopag Connie L. Erickson-Miller a,∗ , Jennifer Kirchner a , Manuel Aivado b , Richard May c , Parrish Payne c , Antony Chadderton a a b c
Oncology Translational Research, GlaxoSmithKline, 1250 South Collegeville Road, Collegeville, PA, USA Oncology Global Clinical Development, GlaxoSmithKline, Collegeville, PA, USA Southern Research Institute, Birmingham, AL, USA
a r t i c l e
i n f o
Article history: Received 7 October 2009 Received in revised form 12 January 2010 Accepted 5 February 2010 Available online 3 March 2010 Keywords: Apoptosis qRT-PCR TpoR MPL Differentiation FAB
a b s t r a c t Leukemia cell lines were treated with eltrombopag or thrombopoietin and their proliferative response was determined. Eltrombopag did not increase proliferation of cell lines that did not express high levels of megakaryocyte markers. Instead, treatment with eltrombopag alone inhibited proliferation of many cell lines (IC50 range = 0.56–21 g/mL). The addition of other cytokines, such as G-CSF, Epo or Tpo, did not affect the decrease in proliferation. The decrease in proliferation appears to be through a TpoRindependent, nonapoptotic mechanism. These findings suggest that eltrombopag does not enhance, but rather inhibits, proliferation of leukemia cell lines in vitro. © 2010 Elsevier Ltd. All rights reserved.
1. Introduction Thrombocytopenia in leukemia patients can result from incompetent marrow due to the disease or damage of the marrow due to chemotherapy. The development of targeted thrombopoietic agents has implications for improving therapy for patients suffering low platelet counts due to their disease. Approximately 40–65% of patients with myelodysplastic syndrome (MDS) or acute myelogenous leukemia (AML) are reported to be thrombocytopenic [1,2]. Eltrombopag (SB-497115, PROMACTA® ; GlaxoSmithKline, USA) represents the first oral, small molecule, non-peptide thrombopoietin receptor (TpoR) agonists. Eltrombopag has been approved for treatment of adults with chronic idiopathic thrombocytopenic purpura (ITP) in the USA, and is in clinical trials for the treatment of thrombocytopenia associated with chronic liver disease, Hepatitis C antiviral therapy, MDS and chemotherapy induced thrombocytopenia (www.clinicaltrials.gov). Eltrombopag increased platelet counts in normal subjects, as well as in patients with chronic ITP and chronic Hepatitis C patients [3–6]. Eltrombopag stimulates differentiation of normal CD34+ marrow cells into megakaryocytes, but its requirement for TpoR expression limits its specificity to the
∗ Corresponding author. Tel.: +1 610 917 4509; fax: +1 610 917 4989. E-mail address: Connie L [email protected] (C.L. Erickson-Miller). 0145-2126/$ – see front matter © 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.leukres.2010.02.005
megakaryocyte lineage [7,8]. However, there remains the question of whether eltrombopag might have the potential to induce proliferation of any TpoR expressing cell. Various reports found approximately 50% of AML patient blood or marrow expresses MPL, the gene for TpoR [9,10]. Additional reports investigating the proliferative response of AML patient samples to thrombopoietin (Tpo) or megakaryocyte growth and development factor (MGDF) demonstrated a range of proliferation responses (0–40%) in AML samples, although these did not correlate with the patient’s French American British (FAB) classification [11–21]. Several megakaryocytic cell lines were used to identify and characterize eltrombopag [8], but its effects on other leukemia cell lines had not been examined. This manuscript describes the expression of MPL on a number of AML and other leukemia and lymphoma cell lines and reports how eltrombopag affects the proliferation, apoptosis and differentiation of these cell lines. 2. Materials and methods 2.1. Cytokines and compound rhTpo, recombinant human stem cell factor (rhSCF), and recombinant murine interleukin-3 (rmIL-3) were obtained from R&D Systems, Inc. (Minneapolis, MN, USA). Recombinant human erythropoietin (rhEpo) and G-CSF were obtained from Amgen, Inc. (Thousand Oaks, CA, USA). Cytokines were diluted in Iscove’s Modified Dulbecco’s Medium (IMDM) and used at final concentrations of 1, 3, 10, 30 or 100 ng/mL. SB-497115-GR, the monoethanolamine salt form, was resus-
C.L. Erickson-Miller et al. / Leukemia Research 34 (2010) 1224–1231 Table 1 Tritiated-thymidine incorporation proliferation assay IC50 values for eltrombopag on various leukemia cell lines. Cell line
Cell Type [28]
IC50 (g/mL)
MOLT-4 CCRF-CEM SR K562 HL-60 HEL92.1.7 THP-1 F-36P RPMI-8226 OCI-AML2 OCI-AML3 U937 PLB-985 ML-2 N2C-Tpo OCI-M1 NOMO-1
T cell leukemia T cell leukemia Large cell lymphoma (T-cell) Myeloid/erythroid leukemia Myeloid leukemia Erythroid leukemia Monocytic leukemia Erythroid leukemia Multiple myeloma (pasma cell) Monocytic leukemia Monocytic leukemia Histiocytic lymphoma (monocytic) Myeloid leukemia AML (moncytic) AML (megakaryocytic leukemia) Erythroid leukemia Monocytic leukemia
0.56 0.74 0.77 1.8 2.2 2.3 2.4 4.1 5.9 6.0 8.2 11.4 15.4 15.4 20.7 >40 >40
pended in water and diluted in IMDM with 1% fetal calf serum (FCS) for use at 0.001–100 g/mL. 2.2. Cell lines The N2C-Tpo cell line is a human Tpo-dependent cell line with endogenous human Tpo receptor (TpoR), derived by growth of UT7-Epo cells in rhTpo and was graciously provided by Dr. Camille Abboud of Washington University (St. Louis, MO). The other cell lines and their cell type are listed in Table 1 and were obtained either from the American Type Culture Collection (ATCC; Rockville, MD) or the German Collection of Microorganisms and Cell Cultures (DSMZ; Braunschweig, Germany). 2.3. Annexin-V/7-AAD staining Apoptosis was assessed by Annexin-V staining plus 7-AAD staining and measured by flow cytometry. Cells were stained using the Annexin V apoptosis kit (BD Biosciences; San Jose, CA). Briefly, cells were resuspended to 1 × 106 /mL in Annexin-V staining buffer and 100 L transferred to a reaction tube. Five L of Annexin-V-FITC and 12.5 g/mL of 7-AAD were added to the tube which was then incubated at room temperature for 15 min in the dark. After incubation, 400 L of staining buffer was added and fluorescence was measured immediately using a standard compensated two color protocol on a Becton Dickinson LSRII flow cytometer. A minimum of 10,000 events were collected for each sample. 2.4. Proliferation measurements using 3 H-methyl-thymidine The CCRF-CEM, HL-60, K562, MOLT-4, RPMI-8226 and SR cell lines were cultured at 1 × 104 cells/well in 200 L medium in 96-well flat-bottom plates. Eltrombopag (100 ng/mL to 40 g/mL) was tested in the presence or in the absence of G-CSF (10 ng/mL), Tpo (100 ng/mL), or Epo (5 U/mL). Cells were tested in each condition alone to establish the 100% control values. After a 3-day incubation at 37 ◦ C in 5% CO2 , 3 H-thymidine (1 Ci/well) was added for 18 h. The plates were harvested on a Brandel harvester (Gaithersburg, MD) and radioactivity on the filtermats was measured in a Wallac Microbeta scintillation counter (PerkinElmer Inc., Foster City, CA). The effect of eltrombopag was reported as percent of control by comparing the results of cells treated with compound-treated wells versus control wells. The HEL92.1.7, THP-1, F-36P, OCI-AML2, OCI-AML3, U937, PLB-985, ML-2, N2CTpo, OCI-M1 and NOMO-1 cell lines were washed in medium and resuspended to 2.2 × 105 /mL. 2 × 104 cells (0.8 mL) were added to wells of a round bottom 96-well plate in triplicate. Eltrombopag was added to wells at concentrations of 0, 0.1, 0.4, 1, 4, 10 and 40 g/mL. Similarly 100 ng/mL Tpo was also added to separate wells. Plates were incubated for 72 h. At 18 h before the end of the incubation period 1 Ci of 3 Hmethyl-thymidine was added to all wells and the plates returned to the incubator. After 72 h cells were harvested using a TomTec plate harvester (TomTec; Hamden, CT) onto filter mats. The mats were allowed to dry overnight and the incorporated radioactivity measured the next day with a MicroBeta plate counter (PerkinElmer Inc., Foster City, CA). Mean measurements and standard deviations were calculated using Microsoft Excel. 2.5. Measurement of the acute myeloid leukemia phenotype Cells were evaluated using the antibody panel recommended by the FAB classification system for AML [22]. Briefly, the method was as follows: cell lines were washed and resuspended to 2 × 105 cells/mL in their respective growth medium. Eltrombopag was added to the flasks at concentrations of 0.1, 0.4, 1, 4, 10 and 40 g/mL and rhTPO added at 100 ng/mL. Flasks were incubated for 72 h at 37 ◦ C
1225
and 5% CO2. After 72 h cells were removed from flasks and washed in PBS and resuspended in 2 mL of PBS. 100 L of the cell suspension was transferred to reaction tubes and cells incubated for 30 min with 20 L of fluorescein isothiocyanate (FITC)-conjugated CD2, CD3, CD4, CD7, CD10, CD15, CD19, CD33, HLA-DR (BD Biosciences) and CD65 (AbCam) or similarly, 20 L of PE-conjugated CD11b, CD11c, CD13 and CD34 or 20 L of CD14-APC (BD Biosciences). In addition, 20 L of the erythroid markers CD36–FITC and CD235a-PE (glycophorin-A; BD Biosciences) were also added and incubated as above. After incubation, cells were washed in PBS supplemented with 0.2% BSA (Sigma–Aldrich Chemicals, St. Louis, MO) and resuspended in 0.5 mL PBS/0.2% BSA. Cell fluorescence was read upon the Becton Dickinson LSRII flow cytometer. The relevant isotype controls were evaluated simultaneously on the same cells to establish analysis gate boundaries. A minimum of 10,000 events were collected per sample. CD41 and CD61 (BD Biosciences) expression on the surface of several cell lines was assessed by flow cytometry to determine the megakaryocytic differentiation of the cell lines. 2.6. Quantitative reverse transcription-PCR for MPL (TpoR) Cells were cultured to sub-confluency and washed in media. Cells were then resuspended to 1–2 × 106 /mL, pelleted in a microfuge at 100 rpm and subsequently resuspended in 1 mL trizol reagent (Invitrogen; Carlsbad, CA). RNA was then extracted according to the vendor’s supplied instructions. Total RNA was resuspended in 25 L DEPC treated water and quantified by UV spectrophotometry at 260 and 280 nm. One g of RNA was DNase treated with 1 U DNAase I (Invitrogen). The reaction was stopped by adding 1 L of 25 M EDTA with heating to 65 ◦ C for 10 min. After cooling the volume was brought to 50 L with DEPC treated water. cDNA was produced using the cDNA archive kit (Applied Biosytems, Foster City, CA) according to the supplied instructions. The total volume used for cDNA production was 100 L. The expression of MPL, the TpoR gene, was determined using FAM-TAMRA labeled primers and probe in a 7900HT thermal cycler using a standard 40-cycle profile with 9600 emulation. Following amplification, calculations were performed using GSK mathematical algorithm that calculated the relative abundance of MPL normalized to three housekeeping genes, GAPDH (glyceraldehyde-3-phosphate dehydrogenase), ACTB (-actin) and PPIA (cyclophilin A), whose primer and probe sequences are below. Each result is presented as a normalized value of mRNA. A normalized abundance of <50 is below the level of detection of the method. The primers and probes used for real time quantitative reverse transcriptionPCR (qRT-PCR) were custom made by Integrated DNA Technologies (Coralville, IA), sequences listed below. MPL (thrombopoietin receptor) Forward: AGTGGAACCCAGCCTCCTTG Reverse: CTGCAATCTTCGGTAGTCCATCTG Probe: CAAGTCCTCAGAGGACTCCTTTGCCC GAPDH Forward: CAA GGT CAT CCA TGA CAA CTT TG Reverse: GGG CCA TCC ACA GTC TTC TG Probe: ACC ACA GTC CAT GCC ATC ACT GCC A PPIA Forward: CAT CTG CAC TGC CAA GAC TGA Reverse: TGC CTT CTT TCA CTT TGC CA Probe: CAC CAC ATG CTT GCC ATC CAA CCA ACTB Forward: GAG CTA CGA GCT GCC TGA CG Reverse: GAT GTT TCG TGG ATG CCA CAG GAC Probe: CAT CAC CAT TGG CAA TGA GCG GTT CC 2.7. Western blot for TpoR Cell lysates were prepared from cells in log phase growth. Electrophoresis was performed on cell lysates (50 g/well) on NuPage 4–12% Bis–Tris gels (Invitrogen; Carlsbad, CA) with MOPS running buffer under reducing conditions. Precision Protein Dual Color Standards (Bio-Rad; Hercules, CA) were used for molecular weight markers. The gels were transferred to nitrocellulose and stained with a rabbit polyclonal anti-TpoR primary antibody (Upstate Biotechnology Inc.; Lake Placid, NY; Cat# 06-944). 2.8. Data analysis Calculations of the mean and standard deviation were calculated by Microsoft Excel. Curve-fitting and IC50 values for the thymidine incorporation data were generated using a Microsoft Excel XLfit 4.0 curve fit algorithm.
1226
C.L. Erickson-Miller et al. / Leukemia Research 34 (2010) 1224–1231
Fig. 1. Representative graphs demonstrating effect of 72 h treatment with eltrombopag on thymidine incorporation in (A) OCI-AML3, (B) THP-1, (C) ML-2 and (D) NOMO-1 cell lines. CPM = counts per minute.
3. Results 3.1. Proliferation results The human leukemia and lymphoma cell lines tested, CCRFCEM, HL-60, K562, MOLT-4, RPMI-8226, SR, OCI-AML2, OCI-AML3, ML-2, THP-1, F-36P, U937 and PLB-985, demonstrated no increase in proliferation following 72 h treatment with eltrombopag. In fact, there was a decrease in proliferation in these cell lines, generally at eltrombopag concentration greater than 1 g/mL (Fig. 1A–C). These data were fit to curves and IC50 values for the decrease in proliferation ranging from 0.5 to 21 g/mL (Table 1). Two cell lines, NOMO-1 (Fig. 1D) and OCI-M1 (data not shown) demonstrated either no, or an incomplete, inhibition of proliferation at these doses thus, the IC50 of these two cell lines was reported as >40 g/mL, the maximal concentration of eltrombopag tested. All cell lines with decreased proliferation reached 100% inhibition of thymidine incorporation at approximately 40 g/mL.
Viable cell counts, using trypan blue exclusion, confirmed that the decrease in tritiated thymidine incorporation, which measures DNA replication, was representative of a decrease in the number of viable cells (data not shown), suggesting true cell death. The N2C-Tpo cell line, a megakaryoblastic leukemia cell line initially used in the discovery of eltrombopag [8], demonstrated a 3.5-fold increase in proliferation at 0.006–1.7 g/mL eltrombopag (Fig. 2A). However, at higher concentrations of eltrombopag, this line also demonstrated the decreased proliferation with an IC50 = 20.7 g/mL, similar to the response seen in other leukemic lines (Table 1). HEL92.1.7 cells, an erythroleukemia cell line, demonstrated a 1.1- to 1.2-fold, statistically significant (p < 0.01), enhancement in proliferation at 0.1–0.4 g/mL in two of the five proliferation experiments in which it was tested (Fig. 2B). This cell line also exhibited a decrease in proliferation at higher eltrombopag concentrations with an IC50 = 2.3 g/mL (Table 1). These two cell lines expressed the highest levels of TpoR mRNA as determined by qRT-PCR, at 1000- to 5000-fold higher levels than most
Fig. 2. Thymidine incorporation following 72 h treatment with eltrombopag in (A) N2C-Tpo cells and (B) HEL92.1.7 cells. The counts per minute at each data point are expressed as a percent of the untreated control samples. The expression of CD41 and CD61 as determined by flow cytometry is shown below each proliferation graph.
C.L. Erickson-Miller et al. / Leukemia Research 34 (2010) 1224–1231
1227
Table 2 IC50 values of eltrombopag and MPL (TpoR) mRNA expression by qRT-PCR of various leukemia cell lines. MPL is expressed as relative abundance after normalization to the housekeeping genes ACTB, PPIA and GAPDH. Cell line
IC50 (g/mL)
K562 HEL92.1.7 F-36P OCI-AML2 OCI-AML3 U937 PLB-985 ML-2 N2C-Tpo NOMO-1
1.8 2.3 4.1 6.0 8.2 11.4 15.4 15.4 20.7 >40
MPL mRNA (normalized abundance) <50 11,770 <50 <50 1050 <50 <50 <50 20,453 <50
MPL mRNA was analyzed by qRT-PCR. Abundance was normalized to the housekeeping genes, GAPDH, PPIA and ACTB. Normalized abundance <50 are below the limits of detection of the method.
of the other lines (Table 2). These two cell lines were also found to express high levels of the megakaryocyte markers, CD41 and CD61, although the expression did not change following eltrombopag treatment. 3.2. Response to additional cytokines In the AML cell lines OCI-AML2, OCI-AML3, ML-2 and HL-60, eltrombopag was tested in combination with G-CSF, a cytokine frequently used in the treatment of AML patients. Two concentrations of G-CSF were used (4 and 40 ng/mL) with 40 ng/mL reflecting a 5-fold the Cmax concentration of G-CSF used in the clinic to relieve neutropenia. The OCI-AML2 cell line was the only line which responded to G-CSF (40 ng/mL) with increased proliferation (Fig. 3A). In spite of the higher baseline of proliferation due to 40 ng/mL G-CSF response, a decrease in proliferation occurred in the presence of eltrombopag. There was an approximately 1.7-fold shift in the IC50 in the presence of G-CSF (12.2 g/mL) as opposed to its absence (7.0 g/mL). There was little effect of G-CSF on ML2, OCI-AML3 and HL-60 cells and these cell lines demonstrated a decrease in proliferation in response to eltrombopag, regardless of the addition of G-CSF (data not shown). Recombinant Tpo was tested in these proliferation assays at a set concentration of 100 ng/mL, a level that supports maximal stimulation of the N2C-Tpo cells [7,8]. Tpo enhanced proliferation in a small, but statistically significant (p < 0.05 by Student’s t-test) manner in the CCRF-CEM and RPMI-8226 cell lines (Fig. 3B and C). In addition to Tpo, Epo and G-CSF also exhibited a small, but statistically significant increase in proliferation of the plasmacytoma cell line RPMI-8226 (Fig. 3C). However, eltrombopag alone did not increase proliferation in the cell lines that respond to Tpo. Eltrombopag, combined with these cytokines, continued to demonstrate a decrease in proliferation, overriding any proliferative enhancement of Epo, G-CSF or Tpo (Fig. 3B and C). 3.3. MPL (TpoR) expression The level of MPL mRNA expressed on a set of AML lines was determined by qRT-PCR. The abundance of MPL mRNA, normalized to a set of housekeeping genes, GAPDH, ACTB (-actin) and PPIA (cyclophilin A), for these leukemia cell lines is shown in Table 2. There was no apparent relationship between TpoR message expression and the IC50 of decreased proliferation. The two cell lines expressing the highest levels of MPL mRNA, N2C-Tpo and HEL92.1.7, were the only two lines demonstrating detectable levels of TpoR by western blot analysis of cell lysates (data not shown). The OCI-AML3 cell line had detectable levels of
Fig. 3. Effects of eltrombopag on proliferation of (A) OCI-AML2 cells in combination with 4 or 40 ng/mL G-CSF, (B) CCRF-CEM in combination with recombinant Tpo (100 ng/mL), Epo (5 U/mL) or G-CSF (10 ng/mL) and (C) RPMI-8226 cells in combination with recombinant Tpo, Epo or G-CSF.
MPL mRNA expression (relative abundance ≥50), but no protein was observed by western blot. 3.4. Apoptosis To determine if apoptosis was the mechanism of decreased proliferation, three AML cell lines, OCI-AML2, OCI-AML3 and ML-2, were selected for further examination of apoptosis by flow cytometry using the Annexin-V/7-AAD method. In this method, live cells are Annexin-V−/7-AAD−, apoptotic cells are Annexin-V+/7-AAD− and necrotic or dead cells are Annexin-V+/7-AAD+. The data for a representative cell line, ML-2 is shown in Fig. 4. Up to 18% apoptotic cells at 4 and 10 g/mL eltrombopag were seen in the ML-2 and OVI-AML2 cell lines, however, the majority of the cells at 10 and 40 g/mL were observed in the Annexin-V+/7-AAD+ necrotic quadrant at 48 and 72 h in all three lines (represented by the ML-2 cell line in Fig. 5, top). The small amount of apoptosis would not be sufficient to explain the decrease in proliferation. To determine if apoptosis was occurring rapidly and transiently, before 24 h, additional experiments were performed to measure apoptosis at 2-, 4- and 8-h time points. No apoptotic cells were apparent and the
1228
C.L. Erickson-Miller et al. / Leukemia Research 34 (2010) 1224–1231
Fig. 4. Representative graph of Annexin-V/7-AAD measured by flow cytometry of ML-2 cells treated for 72 h with 0, 4, or 10 g/mL eltrombopag or 100 ng/mL Tpo, demonstrating the live, apoptotic and necrotic quadrants.
cells became necrotic/dead as early as 2 h after 4, 10 and 40 g/mL eltrombopag treatment (Fig. 5, bottom). These data suggest that eltrombopag may kill cells via a mechanism that does not involve apoptosis. 3.5. Differentiation A decrease in proliferation of leukemia cells may be caused by differentiation into non-proliferative, end stage cells. The expression of cell surface markers was used to classify and identify the extent of differentiation of these cell lines. The FAB phenotype panel used here consisted of CD2, CD3, CD4, CD7, CD10, CD11b, CD11c, CD13, CD14, CD15, CD19, CD33, CD34, HLA-DR and CD65 [22]. CD36 and CD235a were added to determine the erythroid component of these cell lines. OCI-AML2, OCI-AML3, ML-2, HEL92.1.7, U937, K562 and PLB-985 were treated with eltrombopag (0.1–40 g/mL) over 72 h and the change in differentiation compared to vehicle treated cells was measured by marker specific antibody binding and flow cytometry. Representative data for the ML-2 cell line, which showed enhanced CD36 and CD235a erythroid differentiation, is shown in Fig. 6. While some markers decreased in some cell lines and other increased, there were no large or consistent changes in the differentiation of the cell lines in response to eltrombopag (Table 3). This was particularly true of the phenotypes that would be expected to be more proliferative, such as CD34 or CD33 expressing cells. Tpo (100 ng/mL) was used as a control, and there were no changes in marker expression due to Tpo treatment (data not shown).
4. Discussion Patients with AML or MDS frequently have neutropenia or thrombopcytopenia [1,2]. The first step in determining the utility of the non-peptide, small molecule TpoR agonist, eltrombopag, in these patients is to determine its effects on AML cell lines. Eltrombopag did not increase the proliferation of the 15 leukemia and lymphoma cell lines that were not of megakaryocytic origin. Interestingly, there was a decrease in proliferation (thymidine incorporation) at higher concentrations of eltromobopag which is confirmed by a decrease in viable cell number both by trypan blue exclusion and flow cytometry with 7-AAD staining. In considering the potential impact of these results in the clinic, it is important to note that the concentrations of eltrombopag that induce the decrease in proliferation of leukemia cell lines reported here, are physiologically achievable in patients. The maximum concentration in ITP patients (Cmax ) dosed at 75 mg was 11.4 ug/mL and the minimum concentration detected after 24 h (prior to the next daily dose) was ∼5.3 g/mL in these subjects. Thrombocytopenia in patients in the clinic frequently occurs in conjunction with other cytopenias, and patients may be treated with cytokines, such as G-CSF or Epo. In the two cell lines (OCIAML2 and RPMI-8226) that demonstrated enhanced proliferation in the presence of cytokines such as G-CSF, Tpo or Epo, there was no proliferative effect of eltrombopag added to those cytokines. Again, there was a decrease in proliferation at higher concentrations of eltrombopag and in the OCI-AML2 was there a 2-fold shift in IC50 ,
C.L. Erickson-Miller et al. / Leukemia Research 34 (2010) 1224–1231
1229
Fig. 5. Annexin-V/7-AAD apoptotic and necrotic quadrants measured by flow cytometry of ML-2 cells after 24, 48 or 72 h (top panels) and 2, 4 and 8 h (bottom panels) incubation with eltrombopag. The bar at the left of each graph represents Tpo (100 ng/mL) treatment at these time points.
however, this was the only cell line with a robust response to G-CSF, alone. One explanation for the decrease in proliferation of the leukemia cell lines is that they are differentiating into cells of a more mature, non-proliferative myeloid or lymphoid phenotype. While there were some changes in the expression of the markers used in the FAB classification, it seems unlikely that these small changes could account for the complete inhibition of proliferation that occurred at most of the cell lines once the concentration of eltrombopag was ≥4 ug/mL. The decrease in proliferation of the leukemia cell lines was apparently not a result of apoptosis of the cell lines, as measured by Annexin-V. Rather, cells accumulated in the necrotic region and this death occurred as early as 4 h following 40 ug/mL of eltrom-
bopag treatment. This suggests that eltrombopag may kill cells via a mechanism that does not involve apoptosis. Preliminary results demonstrated no expression of Beclin-1, a marker of autophagy [23], however, further examination of mechanisms other than apoptosis, such as autophagy and entosis [24] is warranted to further understand the effects of eltrombopag. The expression of high levels of TpoR mRNA in these leukemia cell lines appears in conjunction with the megakaryocyte markers, CD41 and CD61, and may indicate a megakaryocytic phenotype that can proliferate in response to eltrombopag. This is not unexpected, as the megakaryoblastic leukemia cell line, N2C-Tpo, was used to identify and characterize eltrombopag [8]. Reports of proliferation in response to Tpo or MGDF were noted in the M7 subtype of AML samples [12,14,16,17,21]. However, there does not appear to be any
Fig. 6. Expression of FAB panel cell surface markers on the ML-2 cell line after 72 h treatment with vehicle, 0.1, 1, 10 or 100 g/mL eltrombopag or 100 ng/mL Tpo.
1230
C.L. Erickson-Miller et al. / Leukemia Research 34 (2010) 1224–1231
Table 3 Differentiation of cell lines in response to 72 h treatment of eltrombopag as measured by flow cytometry. Gray boxes represent no change from untreated cells, white boxes represent an increase, and dark gray boxes represent a decrease in marker expression. CD marker
HEL92.1.7
2 3 4 7 10 11b 11c 13 14 15 19 33 34 65 HLA-DR Gly-A CD36
OCI-AML2
OCI-AML3
PLB-985
↑ ↑ ↑ ↑ ↑
ML-2
↓
↓
↑ ↑
↓
↑
↓
↑
↓
CLEM, JK, MA and AC are employees of GlaxoSmithKline, CLEM, MA and AC own GSK stock, CLEM is named on GSK patents. RM and PP have no conflicts of interest. Author contributions CLEM designed research, analyzed data, supervised the project and wrote the manuscript. JK and PP carried out research and analyzed data. MA critically reviewed the manuscript and analyzed data. RM designed experiments and analyzed data. AC designed experiments, carried out research and analyzed data. Acknowledgments Disclosures: This work was fully funded by GlaxoSmithKline. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.leukres.2010.02.005.
↓
↓
↓
↑ ↑
↑
Conflict of interest statement
↓
↑ ↑ ↑
relationship between the inhibition of leukemia cell proliferation by eltrombopag and the level of TpoR message expression in the cells. Thus the effect seems to be a TpoR-independent, nonapoptotic cell death. To treat neutropenia in AML and MDS patients, G-CSF has been found to be safe and is frequently used [25], even though it is reported to stimulate proliferation of blasts in the blood of AML patients. Drugs to treat thrombocytopenia have not yet been extensively tested in this patient population. A recent report by Kantarjian [26] describes the effects of the Tpo mimetic, AMG531, which demonstrated an enhancement of bone marrow blasts in low-risk MDS patients, which decreased when the drug was removed. The data presented here suggest that eltrombopag has activity different to recombinant Tpo in that it, in general, does not induce proliferation in AML cell lines, but rather decreases proliferation at achievable physiological concentrations. While the leukemia cell lines in these studies have been extensively cultured, Will et al. recently observed no increase in proliferation in experiments with eltrombopag treatment of primary marrow and blood cells derived directly from AML patients [27].
↓
↑
↓
↑ ↑ ↑
U937
↓
↓
↓ ↓
K562
References [1] Kantarjian H, Giles F, List A, Lyons R, Sekeres M, Pierce S, et al. The incidence and impact of thrombocytopenia in myelodysplastic syndromes. Cancer 2007;109:1705–14. [2] Atallah E, Cortes J, O’Brien S, Pierce S, Rios MB, Estey E, et al. Establishment of baseline toxicity expectations with standard frontline chemotherapy in acute myelogenous leukemia. Blood 2007;110:3547–51. [3] Jenkins JM, Williams D, Deng Y, Uhl J, Kitchen V, Collins D, et al. Phase I clinical study of eltrombopag, an oral, nonpeptide thrombopoietin receptor agonist. Blood 2007;109:4739–41. [4] Bussel J, Cheng G, Saleh MN, Psaila B, Kovaleva K, Meddeb B, et al. Eltrombopag for the treatment of chronic idiopathic thrombocytopenic purpura. N Engl J Med 2007;357:2237–47. [5] Bussel J, Provan D, Shamsi T, Cheng G, Psaila B, Kovaleva L, et al. Effect of eltrombopag on platelet counts and bleeding during treatment of chronic idiopathic thrombocytopenic purpura: a randomized, double-blind, placebo-controlled trial. The Lancet 2009;373:641–8. [6] McHutchison JG, Dusheiko G, Shiffman ML, Rodriguez-Torres M, Sigal S, Bourlier M, et al. Eltrombopag for thrombocytopenia in patients with cirrhosis associated with hepatitis C. N Engl J Med 2007;357:2227–36. [7] Duffy KJ, Erickson-Miller CL. The discovery of eltrombopag, an orally bioavailable TpoR agonist. In: Metcalf BW, Dillon S, editors. Target validation in drug discovery. 1st ed. Burlington, MA: Academic Press; 2007. p. 241–54. [8] Erickson-Miller CL, Delorme E, Tian S-S, Hopson CB, Landis A, Valoret EI, et al. Preclinical activity of eltrombopag (SB-497115), an oral, nonpeptide thrombopoietin receptor agonist. Stem Cells 2009;27:424–30. [9] Vignon I, Dreyfus F, Melle J, Viguie F, Ribrag V, Cocault L, et al. Expression of the c-mpl proto-oncogene in human hematologic malignancies. Blood 1993;82:877–83. [10] Schroder JK, Kolkenbrock S, Tins J, Kasimir-Bauer S, Seeber S, Schutte J. Analysis of thrombopoietin receptor (c-mpl) mRNA expression in de novo acute myeloid leukemia. Leukemia Research 2000;24:401–9. [11] Tokunaga Y, Miyamoto T, Gondo H, Okamura T, Niho Y. Effect of thrombopoietin on acute myelogenous leukemia blasts. Leuk Lymphoma 2000;37:27–37. [12] Matsumura I, Kanakura Y, Kato T, Ikeda H, Ishikawa J, Horikawa Y, et al. Growth response of acute myeloblastic leukemia cells to recombinant human thrombopoietin. Blood 1995;86:703–9. [13] Motoji T, Takanashi M, Motomura S, Yan-Hua W, Shiozaki H, Aoyama M, et al. Growth stimulatory effect of thrombopoietin on the blast cells of acute myelogenous leukaemia. Brit J Haematol 1996;94:513–6. [14] Takeshita A, Shinjo K, Izumi M, Ling P, Nakamura S, Naito K, et al. Quantitative expression of thrombopoietin receptor on leukaemia cells from patients with acute myeloid leukaemia and acute lymphoblastic leukaemia. Brit J Haematol 1998;100:283–90. [15] Wetzler M, Baer MR, Bernstein SH, Blumenson L, Stewart C, Barcos M, et al. Expression of c-mpl mRNA, the receptor for thrombopoietin, in acute myeloid leukemia blasts identifies a group of patients with poor response to intensive chemotherapy. J Clin Oncol 1997;15:2262–8. [16] Piacibello W, Sanavio F, Brizzi MF, Garetto L, Severino A, Aronica MG, et al. Megakaryocyte growth and development factor (MGDF)-induced acute leukemia cell proliferation and clonal growth is associated with functional c-mpl. Leukemia 1997;11:531–40. [17] Hirai H, Shimazaki C, Yamagata N, Goto H, Inaba T, Kikuta T, et al. Effects of thrombopoietin (c-mpl ligand) on growth of blast cells from patients with transient abnormal myelopoiesis and acute myeloblastic leukemia. Eur J Haematol 1997;59:38–46. [18] Adams JA, Liu Yin JA, Brereton ML, Briggs M, Burgess R, Hyde K. The in vitro effect of pegylated recombinant human megakaryocyte growth and development factor (PEG rHuMGDF) on megakaryopoiesis in normal subjects and
C.L. Erickson-Miller et al. / Leukemia Research 34 (2010) 1224–1231
[19]
[20]
[21]
[22]
[23]
patients with myelodysplasia and acute myeloid leukaemia. Br J Haematol 1997;99:139–46. Murayama T, Imoto S, Natazuka T, Chihara K, Matsui T. Proliferative reaction of myelogenous leukemia cells with cytokines G-CSF, GM-CSF, M-CSF, SCF and TPO. Leukemia Research 1998;22:557–60. Quentmeier H, Zaborski M, Graf G, Ludwig WD, Drexler HG. Expression of the receptor MPL and proliferative effects of its ligand thrombopoietin on human leukemia cells. Leukemia 1996;10:297–310. Petrucci MT, Ricciardi MR, Gregorj C, Ariola C, Mazzola F, Fogli M, et al. Thrombopoietin, interleukin-11, and early-acting megakaryocyte growth factors in human myeloid leukemia cells. Leuk Lymphoma 2000;40:179–90. Bennett JM, Catovsky D, Daniel MT, Flandrin G, Galton DAG, Gralnick HR, et al. Proposals for the classification of the myelodysplastic syndromes. Brit J Haematol 1982;51:189–99. Maiuri MC, Tasdemir E, Criollo A, Morselli E, Vicencio JM, Cornuccio R, et al. Control of autophagy by oncogenes and tumor suppressor genes. Cell Death Differ 2009;16:87–93.
1231
[24] Overholtzer M, Mailleux A, Mouneimne G, Normand G, Schnitt SJ, King RW, et al. A nonapoptotic cell death process, entosis, that occurs by cell-in-cell invasion. Cell 2007;131:966–79. [25] Estey EH. Growth factors in acute myeloid leukemia. Best Pract Res: Clin Haematol 2001;14:175–87. [26] Kantarjian H, Fenaux P, Sekeres MA, Becker P, Boruchov A, Bowen D, et al. Phase 1/2 study of AMG531 in thrombocytopenic patients (pts) with lowrisk myelodysplastic syndrome (MDS): update including extended treatment. Blood 2007;110:250. [27] Will B, Kawahara M, Luciano JP, Bruns I, Erickson-Miller CL, Aivado MA, et al. Effect of the non-peptide thrombopoietin receptor agonist Eltrombopag on bone marrow cells from patients with acute myeloid leukemia and myelodysplastic syndromes. Blood 2009;14:3899–908. [28] Drexler HG. Guide to leukemia–lymphoma cell lines. Germany: Braunshweig; 2005. Available from: www.celllines.de.