- Email: [email protected]
Reduced serine racemase expression in aging rat cerebellum is associated with oxidative DNA stress and hypermethylation in the promoter
BRES : 44523
pp: 1210ðcol:fig: : NILÞ
Model7 brain research ] (]]]]) ]]]–]]]
121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180
Available online at www.sciencedirect.com
www.elsevier.com/locate/brainres
Research report
Reduced serine racemase expression in aging rat cerebellum is associated with oxidative DNA stress and hypermethylation in the promoter Q1
He Zhanga,b, Xiu-Li Kuanga,b, Yuhua Changa,b, Jinfang Luc, Haiyan Jianga,b, Shengzhou Wua,b,n a
School of Optometry and Ophthalmology and Eye Hospital, Wenzhou Medical University, 270 Xueyuan Road, Wenzhou, Zhejiang 325003, China b State Key Laboratory Cultivation Base and Key Laboratory of Vision Science, Ministry of Health and Zhejiang Provincial Key Laboratory of Ophthalmology and Optometry, 270 Xueyuan Road, Wenzhou, Zhejiang 325003, China c Department of Genetics, Dingli Clinical Medical School, Wenzhou Medical University, Key Laboratory of Birth Defects, Wenzhou, Zhejiang, China
art i cle i nfo
ab st rac t
Article history:
Regulation of serine racemase (SR) occurs at transcriptional and translational levels; post-
Accepted 17 October 2015
translational modification, cytosolic distribution as well as allosteric effect regulate SR activity. In this study, we report a new route of SR regulation, i.e. oxidative stress and hypermethylation of the srr (gene of SR) promoter correlate with its reduced transcription
Keywords:
in aging rat cerebella. We first showed that the mRNA and protein level of srr were
Gene regulation
decreased in the homogenates of rat cerebellum at age 12 months compared with the
Cerebellum
counterparts from age 20 days. The reduction of SR protein level in aging cerebella was
Aging
evidenced by decreased immunostaining observed in the cell body of granule cells or
Hypermethylation
Purkinje cells. Staining for 8-hydroxy-20 -deoxyguanosine (8-OHdG), a marker for oxidative
Epigenetics
stress to DNA, was much stronger in granule cell or Purkinje cell nuclei from rat cerebella at 12 months compared with staining at 20 days. We further detected srr promoter hypermethylation at 12 months compared with that at 20 days by use of bisulfite sequencing PCR, coinciding with elevated protein levels of DNA methyltransferase 1 (DNMT1) in homogenates of aging cerebella. In vitro, we demonstrated that chronic treatment with the oxidant, menadione (VK3), reduced srr mRNA levels, which was reversed by the DNA demethylating agent 5-Aza-dC-20 -deoxycytidine (5-Aza-dC) in
Abbreviations: SR, serine racemase; DAAOx, 1; 5-mC, BSP,
5-methylcytosine; 5-hmC,
D-amino acid oxidase; DNMT, DNA methyltransferase; HDAC1, histone deacetylase
5-methylcytosine; PCR,
bisulfite sequencing PCR; 5-Aza-dC,
polymerase chain reaction; qRT-PCR,
quantitative real-time PCR;
5-Aza-dC-20 -deoxycytidine; 8-OHdG, 8-hydroxy-20 -deoxyguanosine; rp-HPLC, reverse-
phase high performance liquid chromatography; AEC,
3-amino-9 ethylcarbazole; UPS,
ubiquitin–proteasome system; SD,
Sprague
Dawley n Corresponding author at: School of Optometry and Ophthalmology and the Eye Hospital, Wenzhou Medical University, 270 Xueyuan Road, Wenzhou, Zhejiang 325003, China. Fax: þ86 577 88067934. E-mail addresses: [email protected], [email protected] (S. Wu). http://dx.doi.org/10.1016/j.brainres.2015.10.034 0006-8993/& 2015 Published by Elsevier B.V.
Please cite this article as: Zhang, H., et al., Reduced serine racemase expression in aging rat cerebellum is associated with oxidative DNA stress and hypermethylation in the promoter. Brain Research (2015), http://dx.doi.org/10.1016/j. brainres.2015.10.034
181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240
BRES : 44523
2
241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300
brain research ] (]]]]) ]]]–]]]
primary cerebellar granule cell cultures. Together, the in vivo and ex vivo results suggest that oxidative DNA stress and srr promoter hypermethylation are associated with reduced srr gene transcription and corresponding reduced protein expression in aging cerebella. & 2015 Published by Elsevier B.V.
1.
Introduction
The cerebellum has well-known involvement in motor control, but it also participates in cognitive function, such as language and attention, and, in the limbic system, regulation of emotions such as fear and pleasure (Schmahmann and Caplan, 2006). The cerebellar cortex is tightly folded into lobules in which gray matter is located on the surface and white matter and some nuclei are located beneath. In adult mammalian species, the cerebellar cortex consists of the outer molecular layer, the granule cell layer in the deep cortex, and the Purkinje cell layer between. During maturation, granular cells in the molecular layer migrate inward along the processes of Bergmann glia, and finally settle in the inner nuclear layer; serine racemase (SR) and D-serine are critical for these events (Kim et al., 2005). SR is a pyridoxal 50 -phosphate (PLP)-dependent enzyme, which can catalyze synthesis of D-serine via its isomerization activity and simultaneous syntheses of pyruvate and ammonia from L-serine via its dehydratase activity (Neidle and Dunlop, 2002; Wu et al., 2004a). D-serine is more potent than glycine at the glycine-binding site of the N-methyl-D-aspartate receptor (NMDA-R), regulating NMDA-R-mediated neurotransmission, neurotoxicity, and synaptic plasticity (PaulaLima et al., 2013; Wolosker et al., 1999). Excessive production or release of D-serine is associated with excitotoxicity (Wu et al., 2004b, 2005). Administration of D-serine into rat brain increases oxidative stress (Armagan et al., 2011), whereas deficiency of D-serine results in inadequate activation of NMDA-R, as in schizophrenia (Hashimoto et al., 2003; Labrie et al., 2009). Considerable evidences indicate that SR and/or D-serine, have been implicated in neurodegenerative disorders (Sasabe et al., 2007; Wu et al., 2004b), simulated ischemia (Katsuki et al., 2004), and metabolic disorders such as diabetic mellitus (Shu et al., 2010; Tsai et al., 2010), and diabetic complication, diabetic retinopathy (Jiang et al., 2011,, 2014). Modulation of SR and D-serine production proves beneficial against neuronal death arising from NMDA-R mediated neurotoxicity (Inoue et al., 2008) and stroke (Mustafa et al., 2010). Thus, the exploration of SR regulation and the associated mechanism is invaluable. Catalytic activity of SR can be increased through elevating the production of SR mRNA and protein per se, for example, the induced transcription of srr by lipopolysaccharide and secreted amyloid precursor protein is dependent on transcription factor AP-1 (Wu and Barger, 2004; Wu et al., 2007); inhibition of the ubiquitin–proteasome system increases SR protein levels (Dumin et al., 2006). The enzymatic activity of SR is also enhanced by allosteric binding of ATP (Baumgart et al., 2007; De Miranda et al., 2002) and by divalent cations such as calcium, magnesium (Cook et al., 2002); by contrast,
SR membrane translocation (Balan et al., 2009) or SR nitrosylation by nitric oxide (Mustafa et al., 2007) inhibits its activity. In the central nervous system, more D-serine is found in the cerebral cortex than in the cerebellar cortex, possibly due to much greater expression of the D-serine degradative enzyme, D-amino acid oxidase (DAAOx), in the adult cerebellum (Wang and Zhu, 2003). SR expression and D-serine content are changed in an age-related reduction in retinal ganglion cells (Dun et al., 2008) and in the hippocampus, but not in the cerebrum or cerebellum, of Wistar rats (Turpin et al., 2009). In the present study, we demonstrate that srr transcription is reduced in aging cerebellum of Sprague–Dawley rats and that oxidative damage and hypermethylation of the srr promoter are associated with this age-related reduction in transcription.
2.
Results
2.1. Reduced srr mRNA and protein values in aging cerebellum Prior studies had indicated that Sprague–Dawley rats at 12 months have increasing 8-OHdG staining in brain, liver, and peripheral lymphocytes (Wolf et al., 2005), which is a characteristic of aging. Thus, we began by comparing srr mRNA and protein levels from several brain regions in rats at the age of 12 months to those at 20 days. To confirm antibody specificity, we conducted immunoblotting against SR with cerebral protein homogenate from C57BL/6 mice. We detected a band with molecular weight at 37 kD, consistent with the monomeric form of SR; by contrast, the corresponding band was absent from blots with cerebral homogenate from srr mutant mice (RIKEN BioResource Center (Rgsc01872, RBRCNO.GD000099)) (manuscript under revision). Interestingly, either srr mRNA or SR protein levels from hippocampi or cortices between 20 days and 12 months were not different (Supplemental Figs. 1 and 2). However, SR protein levels from cerebella at 12 months were only 20% of those at 20 days (Fig. 1A and B), and srr mRNA from the former was decreased to 61% of those from the latter (Fig. 1C). We examined the D-serine content in the rat cerebellar homogenates with reverse-phase HPLC; D-serine content was 51.2711.2 pmol/mg wet weight at 20 days vs. 27.771.25 pmol/ mg at 12 months (Fig. 1D). To explore the cellular localization of SR, we performed immunostaining in the paraffin sections from rat cerebella at 20 days and 12 months. To avoid non-specific staining, we conducted immunostaining by omitting the primary antibody as negative control, in which no staining was observed. When SR antibody was included in the experimental procedure, the staining was mostly present in the cytosol of Purkinje cells and
Please cite this article as: Zhang, H., et al., Reduced serine racemase expression in aging rat cerebellum is associated with oxidative DNA stress and hypermethylation in the promoter. Brain Research (2015), http://dx.doi.org/10.1016/j. brainres.2015.10.034
301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351
BRES : 44523 brain research ] (]]]]) ]]]–]]]
352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411
3
Fig. 1 – Decreased mRNA and protein levels of SR in aging rat cerebellum. (A) Homogenates of rat cerebella at age 20 days (n ¼10) and 12 months (n ¼10) were subjected to western blot detection for SR (1:500); α-Tubulin (1:1000) was used as an internal control. Typical blots were indicated and the optical density ratios for SR/α-Tubulin averaged from 10 samples were indicated in (B) Student's t-test result. *P¼ 0.001 vs. 20 days. (C) qRT-PCR was used to quantify srr mRNA level from rat cerebella at age 20 days (n¼ 8) and 12 months (n ¼ 8); α-Tubulin was used as a loading control. The results were represented as the ratios srr to α-Tubulin mRNA. Student's t-test results: *P¼ 0.01; 12 months vs. 20 days. (D) Reverse-phase HPLC was used to quantify D-serine content from rat cerebella at age 20 days (n ¼6) and 12 months (n¼ 6). The values of the ratios between Dserine concentration and tissue wet weight were used to represent the D-serine content. Student's t-test results: *P¼ 0.004 12 months vs. 20 days.
granular cells, and the staining intensity was significantly weaker in sections from 12 months than in the counterparts from 20 days (Fig. 2), a result which is compatible with the differential SR protein levels in the rat cerebella we had observed (Fig. 1A).
performed immunostaining in cerebellar paraffin sections against 8-OHdG, a marker of oxidative DNA damage. The staining was mostly present in Purkinje cell and granule cell nuclei from sections of rat cerebella at 12 months but absent at 20 days (Fig. 3).
2.2.
2.3. Promoter hypermethylation is crucial for srr transcription reduction in vivo and in vitro
Increased oxidative DNA damage in aging cerebellum
Strong evidence indicates that oxidative stress is intimately associated with aging (Berlett and Stadtman, 1997; Cadenas and Davies, 2000). Oxidative stress leads to production of reactive oxygen species and associated either hypermethylation or hypomethylation, resulting in reduction or elevation of gene transcription (Donkena et al., 2010; Franco et al., 2008). These lines of evidence prompted us to further examine oxidative stress in aging cerebella. For this purpose, we
Convincing evidence has demonstrated that methylation is associated with gene silencing (Baylin, 2005; Kawasaki and Taira, 2004). Thus, we explored whether methylation in the promoter contributes to the decreased transcription of srr mRNA. We used methprimer (Li and Dahiya, 2002) to scan 10,000 bp upstream of srr transcription start point and found two CpG islands: one is located between 3966 bp and 3733
Please cite this article as: Zhang, H., et al., Reduced serine racemase expression in aging rat cerebellum is associated with oxidative DNA stress and hypermethylation in the promoter. Brain Research (2015), http://dx.doi.org/10.1016/j. brainres.2015.10.034
412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471
BRES : 44523
4
472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531
brain research ] (]]]]) ]]]–]]]
Fig. 2 – Decreased SR immunostaining in granules and Purkinje cells in aging cerebellum. Paraffin sections from rat cerebella at age 20 days (n ¼3) and 12 months (n ¼ 3) were reacted immunohistochemically for SR (1:200), as described in Section 4.1. Typical images of Purkinje cells are presented. Frames on left are 100X; frames on the right are 400X. ML, molecular cell layer; PL, Purkinje cell layer; IGL, inner granule cell layer. Scale bar, 20 lM.
Fig. 3 – 8-OHdG immunostaining in granule and Purkinje cell nuclei of aging rat cerebellum but no staining in the counterpar from age 20 days. Paraffin sections of rat cerebellar cortex of age 20 days (n¼ 3) and 12 months (n¼ 3) were reacted immunohistochemically for 8-OHdG (1:100), as described in Section 4.1. Sections in left column are 100X; sections in the right column are 400X. In the right lower frame, arrowheads indicate staining in Purkinje cell nuclei, and arrows indicate staining in granule cell nuclei. ML, molecular cell layer; PL, Purkinje cell layer; IGL, inner granule cell layer. Scale bar, 20 lM. Please cite this article as: Zhang, H., et al., Reduced serine racemase expression in aging rat cerebellum is associated with oxidative DNA stress and hypermethylation in the promoter. Brain Research (2015), http://dx.doi.org/10.1016/j. brainres.2015.10.034
532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591
BRES : 44523
5
brain research ] (]]]]) ]]]–]]]
592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651
bp, containing 9 CpG dinucleotides (Fig. 4A,
Table 1); the
other is located between 481 bp and þ326 bp, containing 64 CpG dinucleotides (Table 1). With bisulfite-converted genomic DNA isolated from rat cerebella as template, we amplified the promoter region covering the first CpG island with bisulfite-
Fig. 4 – srr promoter hypermethylation in aging cerebellum. (A) Schematic diagram of srr mRNA composed of 50 untranslated region (UTR), open reading frame (ORF), and 30 untranslated region (UTR). The transcript contains two CpG islands in and around the promoter, and the sequence represents 234 bp (bp between 3966 and 3732). The 9 CpG dinucleotides are underlined. (B) The methylation level of the nine CpG dinucleotides compared between the rat cerebella at 12 months (n ¼10, total 150 clones) and 20 days (n¼ 10, total 150 clones), The Student's t-test was used to compare the difference of methylation status at each of the CpG dinucleotides; *P¼ 0.037.
specific primers (see Section 4.1). Methylation or unmethylated CpG dinucleotides for the promoter was documented for each clone; analysis of srr promoter methylation for the CpG island averaged from 10 genomic DNA, constituting a total of 150 clones for rat cerebella at either 20 days or 12 months. Compared to GenBank sequence (NC_005109.4), the methylation level of the first CpG island in the srr promoter from rat cerebella at 12 months was 93%, which is significantly higher than 90% from rat cerebella at 20 days (Po0.05). Also, the methylation value for the 9th CpG dinucleotides in the 12-month rats was 0.8770.10, which is significantly higher than 0.7770.086 in the 20 day rats (Fig. 4B, P¼ 0.037). Due to the oversize of the second CpG island, we divided it into three segments, conducted bisulfite sequencing PCR individually, and pooled the methylated and unmethylated CpG dinucleotides for each promoter segment when we calculated the percentage of methylation. Surprisingly, we identified hypomethylation in the second CpG island, i.e. the methylation level at 12 months is 0.04370.0019 (n¼ 10, 450 clones) vs. 0.03870.0027 at 20 days (n ¼10, 450 clones) (P¼ 0.121). To confirm the pivotal role of methylation in regulating srr transcription in aging, we conducted in vitro experiments. Previous study indicates that expression of SR mRNA and protein levels is decreased in aged WISTAR rat hippocampus (Turpin et al., 2009) and the reduction can be reversed by chronic feeding with reducing agent, N-acetyl-L-cystein (Haxaire et al., 2012). These results imply that oxidative stress, a common denominator in aging process, inhibits SR expression. Thus, we began to treat primary granule cell cultures by use of an oxidant, VK3, at 12 mM for five days; this treatment reduced the srr mRNA level significantly (Fig. 5B), thus confirming our hypothesis, i.e. oxidative stress inhibits SR expression. Further, pre-treatment with 5-Aza-dC, a DNA demethylating agent, reversed the reduction, and 5-Aza-dC treatment alone did not change the srr mRNA level (Fig. 5A and B). Thus, hypermethylation in the promoter is crucial for repressing srr transcription in aging or under oxidative stress, which is at least one of characteristics of aging. As the above
Table 1 – BSP primers and PCR products. Primer sequence
Relative to TSP (bp)
F: GGAATTAGTTGAGGATATAGATATTTG R: TCAAAAAAAATAACTAATAACTCTATCC
3966 to 3733
F: GGGTATAGGAGAAGTATTAAGGTAT R: CCCAACTACTAAACTAAACCTACC
481 to 274
13
F: GGCAGGCCCAGCCCAGCAGCTGGG R: CTTACTCTAACAAAAACCTAATTAAA
297 to þ25
32
F: TATTGGGAGTAAAAGTATTTAGTA R: ATCTTTATACTACACAATCCAAACCTA
28 to þ326
20
n
No. CpG dinucleotides 9
TSP, transcriptional start point; CpG, 50 cytosine-phospho-guanine.
Please cite this article as: Zhang, H., et al., Reduced serine racemase expression in aging rat cerebellum is associated with oxidative DNA stress and hypermethylation in the promoter. Brain Research (2015), http://dx.doi.org/10.1016/j. brainres.2015.10.034
652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711
BRES : 44523
6
712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771
brain research ] (]]]]) ]]]–]]]
Fig. 5 – In cerebellar granule cell culture, VK3 treatment reduced the srr mRNA level, which was partially but significantly reversed by pre-treatment with 5-Aza-dC. The cerebellar granule cell cultures were treated with 5-Aza-dC (5-Aza) at 2 lM for three days (A), or treated with VK3, at 12 lM, for five days; pre-treatment with 5-Aza-dC, at 2 lM, for three days, followed by VK3 treatment, at 12 lM, for five days (VK3þ5-Aza); or sham-washed treatment (B). RNA was extracted and subjected to qRT-PCR; αTubulin was used as a loading control. The results were represented as the ratios between srr and α-Tubulin mRNA. *Po0.05 vs. control; #P¼ 0.016, one-way ANOVA and Bonferroni post-hoc test was used in (B). The experiments were conducted in quadruplicate cultures in triplicate experiments; the presented data were the average of the three independent experiments. DNMT3A was decreased, whereas DNMT3B was not different in aging cerebella (Fig. 6).
3.
Fig. 6 – Increased DNMT1, but decreased DNMT3A protein levels in homogenates from aging rat cerebella. (A) Homogenates of rat cerebella at age 20 days (n¼ 5) and 12 months (n ¼ 5) were subjected to western blot detection for DNMT1 (1:200), DNMT3A (1:200), DNMT3B (1:200) and the typical blots were indicated; α-Tubulin was used as a loading control. The optical density ratios for DNMT1, DNMT3A, DNMT3B/α-Tubulin averaged from five samples were indicated in (B). Student's t-test results. *P ¼0.014 vs. 20 days; #P¼ 0.01 vs. 20 days.
study suggested that methylation in the promoter represses srr transcription in aging, we further characterized the protein level of DNA methyltransferase (DNMT), the enzyme responsible for adding methyl groups to cytosine. Interestingly, DNMT1 in rat cerebella at 12 months was increased compared to that from rat cerebella at 20 days; by contrast,
Discussion
In the present study, we documented that srr mRNA and protein levels were decreased in the rat cerebellum at 12 months compared with these values at 20 days. We continued to explore the underlying mechanism, i.e. srr promoter hypermethylation induced by oxidative stress is associated with reduction of its transcription in aging cerebella. Accumulating evidence has demonstrated that methylation can occur at CpG or non-CpG islands, regulating gene transcription (Han et al., 2011); however, it is impractical to determine the methylation status in each CpG dinucleotide of the srr promoter, particularly in the non-CpG island, so our analyses were limited to the CpG island. Prior study had demonstrated that 5-hydroxymethylation (5-hmC) in cerebella increases 10-fold from neonatal cerebella to adult cerebella (Szulwach et al., 2011); with BSP, 5-methylcytosine (5-mC) cannot be differentiated from 5-hmC. Thus, we used the oxidative bisulfite sequence (oxBS-Seq) to differentiate 5mC from 5-hmC (Booth et al., 2012); still, we did not detect 5hmC in the srr promoter CpG island. Thus, 5-mC readings from BSP in the assay were only from 5-mC conversion. Further, we imitated oxidation during the aging process with chronic VK3 treatment in vitro; the oxidation treatment reduced the srr mRNA level, which coincides with the in vivo result. Assessing the in vivo and ex vivo results, we project that oxidation creates hypermethylation, particularly of 5-mC in the srr promoter, leading to srr transcriptional reduction in the aging cerebellum. Our results suggest that increased expression of DNMT1, but not DNMT3A or DNMT3B, mediates srr promoter hypermethylation, and thus transcriptional reduction, in the aging rat cerebellum. DNMT1 can associate with histone deacetylase1 (HDAC1) to repress gene transcription, viz H2O2
Please cite this article as: Zhang, H., et al., Reduced serine racemase expression in aging rat cerebellum is associated with oxidative DNA stress and hypermethylation in the promoter. Brain Research (2015), http://dx.doi.org/10.1016/j. brainres.2015.10.034
772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831
BRES : 44523 brain research ] (]]]]) ]]]–]]]
832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890 891
treatment increases overexpression of DNMT1 and HDAC1, leading to their mutual interaction to repress CDX1 transcription (Zhang et al., 2013). Interestingly, we also demonstrated that the protein level of HDAC1 was increased in aging cerebella compared to levels in young cerebella (personal communication). Consistent with higher level of HDAC1 expression in aging cerebella, we also demonstrated that histone deacetylase inhibitor, trichostatin A (TSA), partially but significantly reversed SR mRNA reduction induced by VK3 (not shown). Thus, the potential interaction between DNMT1 and HDAC1 possibly contributes to reduced srr transcription reduction, as is currently under investigation In this study, we demonstrated a 39% reduction in srr mRNA level, but an 80% reduction in SR protein in older compared with younger cerebella. The difference may result from increased SR degradation in aging cerebella. For example, unpublished data in our hands indicated that Golgin subfamily A member 3 (Golga3), a protein assuming roles in vesicular trafficking (Ohta et al., 2003), was significantly reduced in 12-month cerebella as compared with those at 20 day. Prior study indicates that Golga3 stabilizes SR by decreasing its ubiquitylation (Dumin et al., 2006), thus reduced level of Golga3 in aging cerebella may promote SR degradation by ubiquitin–proteasome system, which may explain the further reduction of SR protein level in aging cerebella. Previous results have indicated that both mRNA and protein levels of SR are reduced in the hippocampus, but not in the cerebral cortex and cerebellum of aged rats of the Wistar or Lou/ C/Jall strains (Turpin et al., 2009). The age-related difference may stem from the inherent differences among different rat strains and the ages of the rats used; in our study, SD rats at 12 months were taken as aged, whereas in studies with Wistar rats, older animals (25–29 month) were used (Turpin et al., 2009). In studies with the C57BL/6 mouse strain, the cerebellar SR protein level decreased dramatically from postnatal day one to day 49, although the srr mRNA was not different (Wang and Zhu, 2003). By contrast, we have compared SR protein levels from rat cerebella at the ages of 20 days to three months and six months; although a trend towards decreasing values was observed, the difference was not significant (personal communication). Thus, post-transcriptional regulation contributes to reduction of SR protein level during the process of cerebellar maturation, differing with the mechanism, i.e. transcriptional regulation in aging. In summary, in vivo and ex vivo results together suggest that oxidative DNA stress and srr promoter hypermethylation are associated with reduced srr gene transcription and corresponding reduced protein expression in aging cerebella. This finding is novel and opens up a new avenue to understand srr gene regulation.
7
LI-COR IRDye 800CW secondary antibody (LI-COR, Lincoln, NE, USA); antibodies to SR (BD Biosciences, San Jose, CA, USA), 8-OHdG (Abcam, Cambridge, MA, USA), DNMT3A (Cell Signaling Technology, Danvers, MA, USA), and DNMT1, DNMT3B (Santa Cruz Biotechnology Inc, Santa Cruz, CA, USA); Neurobasal/B27 (Molecular Probes/Invitrogen, Carlsbad, CA, USA); full-range rainbow molecular-weight markers (GE Healthcare, Piscataway, NJ, USA); Trizol reagent, DNaseI (Invitrogen Corporation, Carlsbad, CA, USA); Takara Ex Taq, pMD18-T vector, PrimeScriptTM RT reagent kit with gDNA Eraser (Perfect Real Time) (Takara, Dalian, China); EZ DNA Methylation-GoldTM kit (Zymo Research, Irvine, CA, USA); GoTaqsHot Start Polymerase (Promega, Madison, WI, USA); Power SYBRs Green PCR Master Mix (Life Technology, NY, USA); and o-phthaldialdehyde, Boc-L-Cys, polyethylenimine (Sigma, St Louis, USA).
4.1.2.
Animals
Sprague–Dawley rats were purchased from the Shanghai Animal Experimental Center, Chinese Academy of Sciences and housed in standard pathogen-free animal facilities with a 12 h light on/off cycle in Wenzhou Medical University. All procedures with animals, including using the minimal number of animals and the minimal amount of animal discomfort, were approved by the Animal Use and Care Committee of Wenzhou Medical University.
4.2.
Methods
4.2.1.
Serine racemase and 8-OHdG immunohistochemistry
4.
Experimental procedure
4.1.
Materials and methods
The experimental rats were perfused transcardially with 4% paraformaldehyde in saline, and the cerebella were removed, dehydrated through graded ethanol and xylene, and embedded in paraffin. The embedded cerebellar tissue was cut sagittally to make 5 mM-thick sections and mounted on poly-D-lysine-coated slides. The sections were de-paraffinized in xylene and hydrated in graded ethanol. Endogenous peroxidase activity was eliminated by incubating the sections with 3% H2O2 in methanol for 15 min. Nonspecific reaction was blocked by incubation with goat serum. Prior to detecting SR and 8-OHdG in sections, the conditions for immunohistochemistry, e.g. antibody concentration and treatment time, were optimized. For SR or 8-OHdG staining, the sections were incubated with SR antibody (BD Biosciences; 1:200) or 8-OHdG antibody (Abcam; 1:100) for 1 h, then washed with PBS and incubated with biotinylated secondary antibody (Beyotime Biotechnology; 1:2000) for 30 min; the sections were washed with PBS and incubated with avidinhorseradish peroxidase complex for 30 min. The peroxidase activity was visualized with 3-amino-9 ethylcarbazole (AEC) as a chromogen. For 8-OHdG staining, the sections were pre-treated with proteinase K (20 mg/mL) for 45 min at 37 1C, 4 N HCl for 10 min, and 50 mM Tris-base for five minutes at room temperature before elimination of endogenous peroxidase activity. The remaining procedures were conducted as those for the detection of SR. Images were captured under a phase-contrast and brightfield microscope (Olympus BX41).
4.1.1.
Materials
4.2.2.
The following reagents and their suppliers were used in this study: biotinylated anti-mouse secondary antibody and 3-amino9 ethylcarbazole (AEC; Vector Laboratories, Burlingame, CA, USA);
Western blot analysis
After removing the skull and meninges, cerebella were dissociated. Individual cerebella were homogenized and sonicated in RIPA buffer containing protease-inhibitor cocktail
Please cite this article as: Zhang, H., et al., Reduced serine racemase expression in aging rat cerebellum is associated with oxidative DNA stress and hypermethylation in the promoter. Brain Research (2015), http://dx.doi.org/10.1016/j. brainres.2015.10.034
892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 951
BRES : 44523
8
952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000 1001 1002 1003 1004 1005 1006 1007 1008 1009 1010 1011
brain research ] (]]]]) ]]]–]]]
(Sigma). The homogenates were centrifuged at 13,000 rpm at 4 1C for 10 min, and the supernatant was collected for immunoblotting. An equal amount of protein (50 mg) was loaded to individual wells, subjected to SDS-PAGE analysis (12%), and transferred to nitrocellulose membranes. The membranes were cut before antigen blocking in order to detect SR or α-tubulin separately. The upper portions were incubated with primary antibody for SR (BD Biosciences; 1:500) and the lower portions with α-tubulin antibody (Cell Signaling Technology; 1:1000), at 4 1C overnight, followed by incubation with an infrared fluorescent dye-labeled secondary antibody, LI-COR IRDye 800CW (LI-COR; 1:5000), at ambient temperature for one hour. Images were acquired with LICOR Odyssey imager 9120, and the band optical densities were obtained in ImageJ. The blotting procedures for DNMT1 (Santa Cruz Biotechnology; 1:200), DNMT3A (Cell Signaling Biotechnology; 1:200), and DNMT3B (Santa Cruz Biotechnology; 1:200) were similar except that the concentration of methanol used in the transfer buffer was increased to 20% from 10% due to their relatively large molecular weight.
4.2.3.
Reverse-phase HPLC
Briefly, the weight of cerebellar tissue used for determination of D-serine was documented. The tissue was homogenized in PBS buffer and centrifuged at 12,000 rpm at 4 1C for 10 min; the supernatant was collected and mixed with an equal volume of acetonitrile. The mixture was vortexed and centrifuged at 12,000 rpm at 4 1C for 15 min. The supernatant was drained through a 0.2 mM filter (Shanghai Biotechnology, Inc.) and stored in 20 1C until determination of D-serine. Dserine was determined with reverse-phase HPLC by use of a fluorimetric method. O-phthaldialdehyde in combination with N-tert-butyloxycarbonyl-L-cysteine (Boc-L-Cys) was used for derivatization. A 3.5 m column (150 4.6 mm2, ZORBAX Eclipse AAA column) was used to detect D-serine. The detailed methods followed those of a reported protocol (Wu et al., 2004b). The content of D-serine was expressed by the ratio between the concentration of D-serine and the documented weight of derived cerebellar tissue.
4.2.4.
with 50 1C for 2 min, followed by 95 1C for 10 min. Dissociative curves were used to confirm the reaction specificity.
4.2.5. Bisulfite sequencing PCR and DNA methylation analysis The genomic DNA was extracted from rat cerebella at age 20 days (n¼ 10) and 12 months (n ¼10) according to a described protocol (Sambrook and Russell, 2006). Bisulfite modification of the 20 sets of genomic DNA was performed with EZ DNA Methylation-GoldTM kit, according to the manufacturer's instruction. Briefly, each set of genomic DNA (20 mL, 600 ng) was mixed with 130 mL CT Conversion reagent in a PCR tube and maintained in a PCR thermal cycler (Applied Biosystems) with reaction at 98 1C for 10 min and 64 1C for two and half hours; the reaction was terminated by incubation at 4 1C. Subsequent binding reactions were conducted in Zymo-spin IC columns (Zymo Research) by mixing the reaction product with 600 mL M-binding buffer (Zymo Research). The mixture was centrifuged then washed with M-wash buffer (Zymo Research) and desulphonated with M-desulphonation buffer (ZymoReseach). Finally, the converted DNA specimens were eluted with M-elution buffer (Zymo Research) into Eppendorf tubes. With the bisulfite-converted DNA as template, PCR products spanning the CpG island in the srr promoter (GenBank no. NC_005109.4) were generated. PCR reactions conducted with 40 cycles (95 1C for 30 s, 58 1C for 30 s, and 72 1C for 45 s) were performed with GoTaqsHot Start Polymerase (Promega), preceded by a 10 min denaturation at 95 1C and terminated with a 10 min extension at 72 1C. The primers for bisulfite sequencing PCR (BSP) were designed with Methprimer. PCR products relative to transcription start point are listed in Table 1. The resultant PCR products were ligated to pMD18-T vector (Takara) and transformed into DH5α (Invitrogen); 15 positive clones were picked from each transformed plate and subjected to sequencing (Invitrogen, Shanghai). The sequencing results were compared with srr promoter (GenBank no. NC_005109.4), using Vector NTIs11.1 to decide the methylation status of CpG dinucleotides.
Quantitative real-time PCR amplification of srr mRNA
Total RNA extracted from each cerebellum with Trizol reagent (Invitrogen) was treated with gDNA Eraser to eliminate genomic DNA. Purified RNA (400 ng) was used to synthesize the cDNA with random primer (PrimeScriptTM RT reagent kit with gDNA Eraser; Takara, Dalian, China), according to the manufacturer's instructions. The cDNA product (2 ng) was used as a template for amplifying srr mRNA with forward primer: CCAAGCCTACGGAGCATCTA spanning 683– 702 bp and reverse primer: TCCCTTGTCCCGCTATCACT spanning 803–822 bp referring to GenBank no. NM_198757.2. Tubulin α was used as an internal reference gene and amplified with forward primer: TGCCAATAACTATGCCCGTG spanning 793–812 bp and reverse primer: CCACCAAAGCTGTGGAAAACC spanning 1069–1089 bp referring to GenBank no.J00798.1. SYBR green was used as reaction dye, and all PCR reactions occurred in a 96-well ABI plate format in ABI7500 (Applied Biosystems). The relative quantification method (a delta-deltaC (T)) was adopted, and 40 cycles of PCR reactions (95 1C for 10 s and 60 1C for 1 min) were started
4.2.6.
Primary cerebellar granule cell culture
Primary cerebellar granule cell cultures were generated from seven-day postnatal rats, as described with some modification (Levi et al., 1984). Briefly, cerebellar tissue was dissociated and plated in neurobasal media supplemented with 10% B27, 20 mM KCl, 2 mM glutamine, and penicillin (100 U/ ml)/ streptomycin (0.1 mg/ml), named as granule cell culture medium (GCCM) in dishes pre-coated with polyethyleneimine. After culture overnight, the mitotic inhibitor, cytosine arabinoside (7 mM) (Sigma), was added for 24 h and the inhibitor was washed out, and the cultures were added with GCCM. For RNA or protein harvest, cells were plated at 4 105/dish in 35 mm dishes.
4.2.7.
Statistics
All results were expressed as mean7S.E.M. The significance in each experiment was tested with either Student's t-test, if two experimental groups were compared, or with one-way ANOVA and Bonferroni post-hoc test, if multiple experimental groups
Please cite this article as: Zhang, H., et al., Reduced serine racemase expression in aging rat cerebellum is associated with oxidative DNA stress and hypermethylation in the promoter. Brain Research (2015), http://dx.doi.org/10.1016/j. brainres.2015.10.034
1012 1013 1014 1015 1016 1017 1018 1019 1020 1021 1022 1023 1024 1025 1026 1027 1028 1029 1030 1031 1032 1033 1034 1035 1036 1037 1038 1039 1040 1041 1042 1043 1044 1045 1046 1047 1048 1049 1050 1051 1052 1053 1054 1055 1056 1057 1058 1059 1060 1061 1062 1063 1064 1065 1066 1067 1068 1069 1070 1071
BRES : 44523 brain research ] (]]]]) ]]]–]]]
1072 1073 1074 1075 1076 1077 1078 1079 1080 1081 1082 1083 1084 1085 1086 1087 1088 1089 1090 1091 1092 1093 Q3 Q2 1094 1095 1096 1097 1098 1099 1100 1101 1102 1103 1104 1105 1106 1107 1108 1109 1110 1111 1112 1113 1114 1115 1116 1117 1118 1119 1120 1121 1122 1123 1124 1125 1126 1127 1128 1129 1130 1131
were compared. All statistical analyses (ANOVAs AND t-tests) were conducted with SPSS 15.0.1 (SPSS, Inc., Chicago, IL). Po0.05 was used as the criterion to reject the null hypothesis.
Authors' contributions ZH designed and conducted the major experiments, analyzed the data; KXL did immunohistochemistry; CYH conducted HPLC assay and animal husbandry; LJF contributed to bisulfite sequencing PCR assay; JHY participated in HPLC assay; WSZ conceived of the project, designed the experiment, wrote the manuscript.
Conflict of interest The authors have found no conflict of interest to report.
Acknowledgment The study was supported by Natural Science Foundation of Zhejiang Province (LQ16C060002) and start-up funding (KYQD141109) from Wenzhou Medical University to Dr. He Zhang. It was also supported by National Natural Science Foundation of China (81171074), Chinese Ministry of Education (20133321120002), Wenzhou Medical University (89210001) to Dr. Shengzhou Wu. The funding resources had no roles in study design; data collection, analysis, and interpretation; the writing of the report; and the decision to submission.
Appendix A.
Supplementary material
Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.brainres. 2015.10.034.
r e f e r e n c e s
Armagan, G., Kanit, L., Yalcin, A., 2011. D-serine treatment induces oxidative stress in rat brain. Drug Chem. Toxicol. 34, 129–138. Balan, L., Foltyn, V.N., Zehl, M., Dumin, E., Dikopoltsev, E., Knoh, D., Ohno, Y., Kihara, A., Jensen, O.N., Radzishevsky, I.S., Wolosker, H., 2009. Feedback inactivation of D-serine synthesis by NMDA receptor-elicited translocation of serine racemase to the membrane. Proc. Natl. Acad. Sci. USA 106, 7589–7594. Baumgart, F., Mancheno, J.M., Rodriguez-Crespo, I., 2007. Insights into the activation of brain serine racemase by the multi-PDZ domain glutamate receptor interacting protein, divalent cations and ATP. FEBS J. 274, 4561–4571. Baylin, S.B., 2005. DNA methylation and gene silencing in cancer. Nat. Clin. Pract. Oncol. 2 (Suppl. 1), S4–S11. Berlett, B.S., Stadtman, E.R., 1997. Protein oxidation in aging, disease, and oxidative stress. J. Biol. Chem. 272, 20313–20316. Booth, M.J., Branco, M.R., Ficz, G., Oxley, D., Krueger, F., Reik, W., Balasubramanian, S., 2012. Quantitative sequencing of 5methylcytosine and 5-hydroxymethylcytosine at single-base resolution. Science 336, 934–937.
9
Cadenas, E., Davies, K.J., 2000. Mitochondrial free radical generation, oxidative stress, and aging. Free Radic. Biol. Med. 29, 222–230. Cook, S.P., Galve-Roperh, I., Martinez del Pozo, A., RodriguezCrespo, I., 2002. Direct calcium binding results in activation of brain serine racemase. J. Biol. Chem. 277, 27782–27792. De Miranda, J., Panizzutti, R., Foltyn, V.N., Wolosker, H., 2002. Cofactors of serine racemase that physiologically stimulate the synthesis of the N-methyl-D-aspartate (NMDA) receptor coagonist D-serine. Proc. Natl. Acad. Sci. USA 99, 14542–14547. Donkena, K.V., Young, C.Y., Tindall, D.J., 2010. Oxidative stress and DNA methylation in prostate cancer. Obstet. Gynecol. Int. 2010, 302051. Dumin, E., Bendikov, I., Foltyn, V.N., Misumi, Y., Ikehara, Y., Kartvelishvily, E., Wolosker, H., 2006. Modulation of D-serine levels via ubiquitin-dependent proteasomal degradation of serine racemase. J. Biol. Chem. 281, 20291–20302. Dun, Y., Duplantier, J., Roon, P., Martin, P.M., Ganapathy, V., Smith, S.B., 2008. Serine racemase expression and D-serine content are developmentally regulated in neuronal ganglion cells of the retina. J. Neurochem. 104, 970–978. Franco, R., Schoneveld, O., Georgakilas, A.G., Panayiotidis, M.I., 2008. Oxidative stress, DNA methylation and carcinogenesis. Cancer Lett. 266, 6–11. Han, H., Cortez, C.C., Yang, X., Nichols, P.W., Jones, P.A., Liang, G., 2011. DNA methylation directly silences genes with non-CpG island promoters and establishes a nucleosome occupied promoter. Hum. Mol. Genet. 20, 4299–4310. Hashimoto, K., Fukushima, T., Shimizu, E., Komatsu, N., Watanabe, H., Shinoda, N., Nakazato, M., Kumakiri, C., Okada, S., Hasegawa, H., Imai, K., Iyo, M., 2003. Decreased serum levels of D-serine in patients with schizophrenia: evidence in support of the N-methyl-D-aspartate receptor hypofunction hypothesis of schizophrenia. Arch. Gen. Psychiatry 60, 572–576. Haxaire, C., Turpin, F.R., Potier, B., Kervern, M., Sinet, P.M., Barbanel, G., Mothet, J.P., Dutar, P., Billard, J.M., 2012. Reversal of age-related oxidative stress prevents hippocampal synaptic plasticity deficits by protecting D-serine-dependent NMDA receptor activation. Aging Cell 11, 336–344. Inoue, R., Hashimoto, K., Harai, T., Mori, H., 2008. NMDA- and beta-amyloid1-42-induced neurotoxicity is attenuated in serine racemase knock-out mice. J. Neurosci. 28, 14486–14491. Jiang, H., Fang, J., Wu, B., Yin, G., Sun, L., Qu, J., Barger, S.W., Wu, S., 2011. Overexpression of serine racemase in retina and overproduction of D-serine in eyes of streptozotocin-induced diabetic retinopathy. J. Neuroinflamm. 8, 119. Jiang, H., Du, J., He, T., Qu, J., Song, Z., Wu, S., 2014. Increased D- Q4 serine in the aqueous and vitreous humor in patients with proliferative diabetic retinopathy. Clin. Exp. Ophthalmol.42841–845 Katsuki, H., Nonaka, M., Shirakawa, H., Kume, T., Akaike, A., 2004. Endogenous D-serine is involved in induction of neuronal death by N-methyl-D-aspartate and simulated ischemia in rat cerebrocortical slices. J. Pharmacol. Exp. Ther. 311, 836–844. Kawasaki, H., Taira, K., 2004. Induction of DNA methylation and gene silencing by short interfering RNAs in human cells. Nature 431, 211–217. Kim, P.M., Aizawa, H., Kim, P.S., Huang, A.S., Wickramasinghe, S.R., Kashani, A.H., Barrow, R.K., Huganir, R.L., Ghosh, A., Snyder, S.H., 2005. Serine racemase: activation by glutamate neurotransmission via glutamate receptor interacting protein and mediation of neuronal migration. Proc. Natl. Acad. Sci. USA 102, 2105–2110. Labrie, V., Fukumura, R., Rastogi, A., Fick, L.J., Wang, W., Boutros, P.C., Kennedy, J.L., Semeralul, M.O., Lee, F.H., Baker, G.B., Belsham, D.D., Barger, S.W., Gondo, Y., Wong, A.H., Roder, J.C., 2009. Serine racemase is associated with schizophrenia
Please cite this article as: Zhang, H., et al., Reduced serine racemase expression in aging rat cerebellum is associated with oxidative DNA stress and hypermethylation in the promoter. Brain Research (2015), http://dx.doi.org/10.1016/j. brainres.2015.10.034
1132 1133 1134 1135 1136 1137 1138 1139 1140 1141 1142 1143 1144 1145 1146 1147 1148 1149 1150 1151 1152 1153 1154 1155 1156 1157 1158 1159 1160 1161 1162 1163 1164 1165 1166 1167 1168 1169 1170 1171 1172 1173 1174 1175 1176 1177 1178 1179 1180 1181 1182 1183 1184 1185 1186 1187 1188 1189 1190 1191
BRES : 44523
10
1192 1193 1194 1195 1196 1197 1198 1199 1200 1201 1202 1203 1204 1205 1206 1207 1208 1209 1210 1211 1212 1213 1214 1215 Q5 1216 1217 1218 1219 1220 1221 1222 1223 1224 1225 1226 1227 1228 1229 1230 1231 1232 1233 1234 1235 1236 1237
brain research ] (]]]]) ]]]–]]]
susceptibility in humans and in a mouse model. Hum. Mol. Genet. 18, 3227–3243. Levi, G., Aloisi, F., Ciotti, M.T., Gallo, V., 1984. Autoradiographic localization and depolarization-induced release of acidic amino acids in differentiating cerebellar granule cell cultures. Brain Res. 290, 77–86. Li, L.C., Dahiya, R., 2002. MethPrimer: designing primers for methylation PCRs. Bioinformatics 18, 1427–1431. Mustafa, A.K., Kumar, M., Selvakumar, B., Ho, G.P., Ehmsen, J.T., Barrow, R.K., Amzel, L.M., Snyder, S.H., 2007. Nitric oxide Snitrosylates serine racemase, mediating feedback inhibition of D-serine formation. Proc. Natl. Acad. Sci. USA 104, 2950–2955. Mustafa, A.K., Ahmad, A.S., Zeynalov, E., Gazi, S.K., Sikka, G., Ehmsen, J.T., Barrow, R.K., Coyle, J.T., Snyder, S.H., Dore, S., 2010. Serine racemase deletion protects against cerebral ischemia and excitotoxicity. J. Neurosci. 30, 1413–1416. Neidle, A., Dunlop, D.S., 2002. Allosteric regulation of mouse brain serine racemase. Neurochem. Res. 27, 1719–1724. Ohta, E., Misumi, Y., Sohda, M., Fujiwara, T., Yano, A., Ikehara, Y., 2003. Identification and characterization of GCP16, a novel acylated Golgi protein that interacts with GCP170. J. Biol. Chem. 278, 51957–51967. Paula-Lima, A.C., Brito-Moreira, J., Ferreira, S.T., 2013. Deregulation of excitatory neurotransmission underlying synapse failure in Alzheimer’s disease. J. Neurochem. 126, 191–202. Sambrook, J., Russell, D.W., 2006. Preparation of genomic DNA from mouse tails and other small samples. CSH Protoc 2006. Sasabe, J., Chiba, T., Yamada, M., Okamoto, K., Nishimoto, I., Matsuoka, M., Aiso, S., 2007. D-serine is a key determinant of glutamate toxicity in amyotrophic lateral sclerosis. EMBO J. 26, 4149–4159. Schmahmann, J.D., Caplan, D., 2006. Cognition, emotion and the cerebellum. Brain 129, 290–292. Shu, X.O., Long, J., Cai, Q., Qi, L., Xiang, Y.B., Cho, Y.S., Tai, E.S., Li, X., Lin, X., Chow, W.H., Go, M.J., Seielstad, M., Bao, W., Li, H., Cornelis, M.C., Yu, K., Wen, W., Shi, J., Han, B.G., Sim, X.L., Liu, L., Qi, Q., Kim, H.L., Ng, D.P., Lee, J.Y., Kim, Y.J., Li, C., Gao, Y.T., Zheng, W., Hu, F.B., 2010. Identification of new genetic risk variants for type 2 diabetes. PLoS Genet. 6, e1001127. Szulwach, K.E., Li, X., Li, Y., Song, C.X., Wu, H., Dai, Q., Irier, H., Upadhyay, A.K., Gearing, M., Levey, A.I., Vasanthakumar, A., Godley, L.A., Chang, Q., Cheng, X., He, C., Jin, P., 2011. 5-hmCmediated epigenetic dynamics during postnatal neurodevelopment and aging. Nat. Neurosci. 14, 1607–1616.
Tsai, F.J., Yang, C.F., Chen, C.C., Chuang, L.M., Lu, C.H., Chang, C.T., Wang, T.Y., Chen, R.H., Shiu, C.F., Liu, Y.M., Chang, C.C., Chen, P., Chen, C.H., Fann, C.S., Chen, Y.T., Wu, J.Y., 2010. A genome-wide association study identifies susceptibility variants for type 2 diabetes in Han Chinese. PLoS Genet. 6, e1000847. Turpin, F.R., Potier, B., Dulong, J.R., Sinet, P.M., Alliot, J., Oliet, S.H., Dutar, P., Epelbaum, J., Mothet, J.P., Billard, J.M., 2009. Reduced serine racemase expression contributes to age-related deficits in hippocampal cognitive function. Neurobiol. Aging 32, 1495–1504. Wang, L.Z., Zhu, X.Z., 2003. Spatiotemporal relationships among D-serine, serine racemase, and D-amino acid oxidase during mouse postnatal development. Acta Pharmacol. Sin. 24, 965–974. Wolf, F.I., Fasanella, S., Tedesco, B., Cavallini, G., Donati, A., Bergamini, E., Cittadini, A., 2005. Peripheral lymphocyte 8OHdG levels correlate with age-associated increase of tissue oxidative DNA damage in Sprague–Dawley rats. Protective effects of caloric restriction. Exp. Gerontol. 40, 181–188. Wolosker, H., Sheth, K.N., Takahashi, M., Mothet, J.P., Brady Jr., R.O., Ferris, C.D., Snyder, S.H., 1999. Purification of serine racemase: biosynthesis of the neuromodulator D-serine. Proc. Natl. Acad. Sci. USA 96, 721–725. Wu, S., Barger, S.W., 2004. Induction of serine racemase by inflammatory stimuli is dependent on AP-1. Ann. N. Y. Acad. Sci. 1035, 133–146. Wu, S., Barger, S.W., Sims, T.J., 2004a. Schwann cell and epineural fibroblast expression of serine racemase. Brain Res. 1020, 161–166. Wu, S., Basile, A.S., Barger, S.W., 2007. Induction of serine racemase expression and D-serine release from microglia by secreted amyloid precursor protein (sAPP). Curr. Alzheimer Res. 4, 243–251. Wu, S.Z., Bodles, A.M., Porter, M.M., Griffin, W.S., Basile, A.S., Barger, S.W., 2004b. Induction of serine racemase expression and D-serine release from microglia by amyloid beta-peptide. J. Neuroinflammation 1, 2. Wu, S.Z., Jiang, S., Sims, T.J., Barger, S.W., 2005. Schwann cells exhibit excitotoxicity consistent with release of NMDA receptor agonists. J. Neurosci. Res. 79, 638–643. Zhang, R., Kang, K.A., Kim, K.C., Na, S.Y., Chang, W.Y., Kim, G.Y., Kim, H.S., Hyun, J.W., 2013. Oxidative stress causes epigenetic alteration of CDX1 expression in colorectal cancer cells. Gene 524, 214–219.
Please cite this article as: Zhang, H., et al., Reduced serine racemase expression in aging rat cerebellum is associated with oxidative DNA stress and hypermethylation in the promoter. Brain Research (2015), http://dx.doi.org/10.1016/j. brainres.2015.10.034
1238 1239 1240 1241 1242 1243 1244 1245 1246 1247 1248 1249 1250 1251 1252 1253 1254 1255 1256 1257 1258 1259 1260 1261 1262 1263 1264 1265 1266 1267 1268 1269 1270 1271 1272 1273 1274 1275 1276 1277 1278 1279 1280 1281 1282
pp: 1210ðcol:fig: : NILÞ
Model7 brain research ] (]]]]) ]]]–]]]
121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180
Available online at www.sciencedirect.com
www.elsevier.com/locate/brainres
Research report
Reduced serine racemase expression in aging rat cerebellum is associated with oxidative DNA stress and hypermethylation in the promoter Q1
He Zhanga,b, Xiu-Li Kuanga,b, Yuhua Changa,b, Jinfang Luc, Haiyan Jianga,b, Shengzhou Wua,b,n a
School of Optometry and Ophthalmology and Eye Hospital, Wenzhou Medical University, 270 Xueyuan Road, Wenzhou, Zhejiang 325003, China b State Key Laboratory Cultivation Base and Key Laboratory of Vision Science, Ministry of Health and Zhejiang Provincial Key Laboratory of Ophthalmology and Optometry, 270 Xueyuan Road, Wenzhou, Zhejiang 325003, China c Department of Genetics, Dingli Clinical Medical School, Wenzhou Medical University, Key Laboratory of Birth Defects, Wenzhou, Zhejiang, China
art i cle i nfo
ab st rac t
Article history:
Regulation of serine racemase (SR) occurs at transcriptional and translational levels; post-
Accepted 17 October 2015
translational modification, cytosolic distribution as well as allosteric effect regulate SR activity. In this study, we report a new route of SR regulation, i.e. oxidative stress and hypermethylation of the srr (gene of SR) promoter correlate with its reduced transcription
Keywords:
in aging rat cerebella. We first showed that the mRNA and protein level of srr were
Gene regulation
decreased in the homogenates of rat cerebellum at age 12 months compared with the
Cerebellum
counterparts from age 20 days. The reduction of SR protein level in aging cerebella was
Aging
evidenced by decreased immunostaining observed in the cell body of granule cells or
Hypermethylation
Purkinje cells. Staining for 8-hydroxy-20 -deoxyguanosine (8-OHdG), a marker for oxidative
Epigenetics
stress to DNA, was much stronger in granule cell or Purkinje cell nuclei from rat cerebella at 12 months compared with staining at 20 days. We further detected srr promoter hypermethylation at 12 months compared with that at 20 days by use of bisulfite sequencing PCR, coinciding with elevated protein levels of DNA methyltransferase 1 (DNMT1) in homogenates of aging cerebella. In vitro, we demonstrated that chronic treatment with the oxidant, menadione (VK3), reduced srr mRNA levels, which was reversed by the DNA demethylating agent 5-Aza-dC-20 -deoxycytidine (5-Aza-dC) in
Abbreviations: SR, serine racemase; DAAOx, 1; 5-mC, BSP,
5-methylcytosine; 5-hmC,
D-amino acid oxidase; DNMT, DNA methyltransferase; HDAC1, histone deacetylase
5-methylcytosine; PCR,
bisulfite sequencing PCR; 5-Aza-dC,
polymerase chain reaction; qRT-PCR,
quantitative real-time PCR;
5-Aza-dC-20 -deoxycytidine; 8-OHdG, 8-hydroxy-20 -deoxyguanosine; rp-HPLC, reverse-
phase high performance liquid chromatography; AEC,
3-amino-9 ethylcarbazole; UPS,
ubiquitin–proteasome system; SD,
Sprague
Dawley n Corresponding author at: School of Optometry and Ophthalmology and the Eye Hospital, Wenzhou Medical University, 270 Xueyuan Road, Wenzhou, Zhejiang 325003, China. Fax: þ86 577 88067934. E-mail addresses: [email protected], [email protected] (S. Wu). http://dx.doi.org/10.1016/j.brainres.2015.10.034 0006-8993/& 2015 Published by Elsevier B.V.
Please cite this article as: Zhang, H., et al., Reduced serine racemase expression in aging rat cerebellum is associated with oxidative DNA stress and hypermethylation in the promoter. Brain Research (2015), http://dx.doi.org/10.1016/j. brainres.2015.10.034
181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240
BRES : 44523
2
241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300
brain research ] (]]]]) ]]]–]]]
primary cerebellar granule cell cultures. Together, the in vivo and ex vivo results suggest that oxidative DNA stress and srr promoter hypermethylation are associated with reduced srr gene transcription and corresponding reduced protein expression in aging cerebella. & 2015 Published by Elsevier B.V.
1.
Introduction
The cerebellum has well-known involvement in motor control, but it also participates in cognitive function, such as language and attention, and, in the limbic system, regulation of emotions such as fear and pleasure (Schmahmann and Caplan, 2006). The cerebellar cortex is tightly folded into lobules in which gray matter is located on the surface and white matter and some nuclei are located beneath. In adult mammalian species, the cerebellar cortex consists of the outer molecular layer, the granule cell layer in the deep cortex, and the Purkinje cell layer between. During maturation, granular cells in the molecular layer migrate inward along the processes of Bergmann glia, and finally settle in the inner nuclear layer; serine racemase (SR) and D-serine are critical for these events (Kim et al., 2005). SR is a pyridoxal 50 -phosphate (PLP)-dependent enzyme, which can catalyze synthesis of D-serine via its isomerization activity and simultaneous syntheses of pyruvate and ammonia from L-serine via its dehydratase activity (Neidle and Dunlop, 2002; Wu et al., 2004a). D-serine is more potent than glycine at the glycine-binding site of the N-methyl-D-aspartate receptor (NMDA-R), regulating NMDA-R-mediated neurotransmission, neurotoxicity, and synaptic plasticity (PaulaLima et al., 2013; Wolosker et al., 1999). Excessive production or release of D-serine is associated with excitotoxicity (Wu et al., 2004b, 2005). Administration of D-serine into rat brain increases oxidative stress (Armagan et al., 2011), whereas deficiency of D-serine results in inadequate activation of NMDA-R, as in schizophrenia (Hashimoto et al., 2003; Labrie et al., 2009). Considerable evidences indicate that SR and/or D-serine, have been implicated in neurodegenerative disorders (Sasabe et al., 2007; Wu et al., 2004b), simulated ischemia (Katsuki et al., 2004), and metabolic disorders such as diabetic mellitus (Shu et al., 2010; Tsai et al., 2010), and diabetic complication, diabetic retinopathy (Jiang et al., 2011,, 2014). Modulation of SR and D-serine production proves beneficial against neuronal death arising from NMDA-R mediated neurotoxicity (Inoue et al., 2008) and stroke (Mustafa et al., 2010). Thus, the exploration of SR regulation and the associated mechanism is invaluable. Catalytic activity of SR can be increased through elevating the production of SR mRNA and protein per se, for example, the induced transcription of srr by lipopolysaccharide and secreted amyloid precursor protein is dependent on transcription factor AP-1 (Wu and Barger, 2004; Wu et al., 2007); inhibition of the ubiquitin–proteasome system increases SR protein levels (Dumin et al., 2006). The enzymatic activity of SR is also enhanced by allosteric binding of ATP (Baumgart et al., 2007; De Miranda et al., 2002) and by divalent cations such as calcium, magnesium (Cook et al., 2002); by contrast,
SR membrane translocation (Balan et al., 2009) or SR nitrosylation by nitric oxide (Mustafa et al., 2007) inhibits its activity. In the central nervous system, more D-serine is found in the cerebral cortex than in the cerebellar cortex, possibly due to much greater expression of the D-serine degradative enzyme, D-amino acid oxidase (DAAOx), in the adult cerebellum (Wang and Zhu, 2003). SR expression and D-serine content are changed in an age-related reduction in retinal ganglion cells (Dun et al., 2008) and in the hippocampus, but not in the cerebrum or cerebellum, of Wistar rats (Turpin et al., 2009). In the present study, we demonstrate that srr transcription is reduced in aging cerebellum of Sprague–Dawley rats and that oxidative damage and hypermethylation of the srr promoter are associated with this age-related reduction in transcription.
2.
Results
2.1. Reduced srr mRNA and protein values in aging cerebellum Prior studies had indicated that Sprague–Dawley rats at 12 months have increasing 8-OHdG staining in brain, liver, and peripheral lymphocytes (Wolf et al., 2005), which is a characteristic of aging. Thus, we began by comparing srr mRNA and protein levels from several brain regions in rats at the age of 12 months to those at 20 days. To confirm antibody specificity, we conducted immunoblotting against SR with cerebral protein homogenate from C57BL/6 mice. We detected a band with molecular weight at 37 kD, consistent with the monomeric form of SR; by contrast, the corresponding band was absent from blots with cerebral homogenate from srr mutant mice (RIKEN BioResource Center (Rgsc01872, RBRCNO.GD000099)) (manuscript under revision). Interestingly, either srr mRNA or SR protein levels from hippocampi or cortices between 20 days and 12 months were not different (Supplemental Figs. 1 and 2). However, SR protein levels from cerebella at 12 months were only 20% of those at 20 days (Fig. 1A and B), and srr mRNA from the former was decreased to 61% of those from the latter (Fig. 1C). We examined the D-serine content in the rat cerebellar homogenates with reverse-phase HPLC; D-serine content was 51.2711.2 pmol/mg wet weight at 20 days vs. 27.771.25 pmol/ mg at 12 months (Fig. 1D). To explore the cellular localization of SR, we performed immunostaining in the paraffin sections from rat cerebella at 20 days and 12 months. To avoid non-specific staining, we conducted immunostaining by omitting the primary antibody as negative control, in which no staining was observed. When SR antibody was included in the experimental procedure, the staining was mostly present in the cytosol of Purkinje cells and
Please cite this article as: Zhang, H., et al., Reduced serine racemase expression in aging rat cerebellum is associated with oxidative DNA stress and hypermethylation in the promoter. Brain Research (2015), http://dx.doi.org/10.1016/j. brainres.2015.10.034
301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351
BRES : 44523 brain research ] (]]]]) ]]]–]]]
352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411
3
Fig. 1 – Decreased mRNA and protein levels of SR in aging rat cerebellum. (A) Homogenates of rat cerebella at age 20 days (n ¼10) and 12 months (n ¼10) were subjected to western blot detection for SR (1:500); α-Tubulin (1:1000) was used as an internal control. Typical blots were indicated and the optical density ratios for SR/α-Tubulin averaged from 10 samples were indicated in (B) Student's t-test result. *P¼ 0.001 vs. 20 days. (C) qRT-PCR was used to quantify srr mRNA level from rat cerebella at age 20 days (n¼ 8) and 12 months (n ¼ 8); α-Tubulin was used as a loading control. The results were represented as the ratios srr to α-Tubulin mRNA. Student's t-test results: *P¼ 0.01; 12 months vs. 20 days. (D) Reverse-phase HPLC was used to quantify D-serine content from rat cerebella at age 20 days (n ¼6) and 12 months (n¼ 6). The values of the ratios between Dserine concentration and tissue wet weight were used to represent the D-serine content. Student's t-test results: *P¼ 0.004 12 months vs. 20 days.
granular cells, and the staining intensity was significantly weaker in sections from 12 months than in the counterparts from 20 days (Fig. 2), a result which is compatible with the differential SR protein levels in the rat cerebella we had observed (Fig. 1A).
performed immunostaining in cerebellar paraffin sections against 8-OHdG, a marker of oxidative DNA damage. The staining was mostly present in Purkinje cell and granule cell nuclei from sections of rat cerebella at 12 months but absent at 20 days (Fig. 3).
2.2.
2.3. Promoter hypermethylation is crucial for srr transcription reduction in vivo and in vitro
Increased oxidative DNA damage in aging cerebellum
Strong evidence indicates that oxidative stress is intimately associated with aging (Berlett and Stadtman, 1997; Cadenas and Davies, 2000). Oxidative stress leads to production of reactive oxygen species and associated either hypermethylation or hypomethylation, resulting in reduction or elevation of gene transcription (Donkena et al., 2010; Franco et al., 2008). These lines of evidence prompted us to further examine oxidative stress in aging cerebella. For this purpose, we
Convincing evidence has demonstrated that methylation is associated with gene silencing (Baylin, 2005; Kawasaki and Taira, 2004). Thus, we explored whether methylation in the promoter contributes to the decreased transcription of srr mRNA. We used methprimer (Li and Dahiya, 2002) to scan 10,000 bp upstream of srr transcription start point and found two CpG islands: one is located between 3966 bp and 3733
Please cite this article as: Zhang, H., et al., Reduced serine racemase expression in aging rat cerebellum is associated with oxidative DNA stress and hypermethylation in the promoter. Brain Research (2015), http://dx.doi.org/10.1016/j. brainres.2015.10.034
412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471
BRES : 44523
4
472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531
brain research ] (]]]]) ]]]–]]]
Fig. 2 – Decreased SR immunostaining in granules and Purkinje cells in aging cerebellum. Paraffin sections from rat cerebella at age 20 days (n ¼3) and 12 months (n ¼ 3) were reacted immunohistochemically for SR (1:200), as described in Section 4.1. Typical images of Purkinje cells are presented. Frames on left are 100X; frames on the right are 400X. ML, molecular cell layer; PL, Purkinje cell layer; IGL, inner granule cell layer. Scale bar, 20 lM.
Fig. 3 – 8-OHdG immunostaining in granule and Purkinje cell nuclei of aging rat cerebellum but no staining in the counterpar from age 20 days. Paraffin sections of rat cerebellar cortex of age 20 days (n¼ 3) and 12 months (n¼ 3) were reacted immunohistochemically for 8-OHdG (1:100), as described in Section 4.1. Sections in left column are 100X; sections in the right column are 400X. In the right lower frame, arrowheads indicate staining in Purkinje cell nuclei, and arrows indicate staining in granule cell nuclei. ML, molecular cell layer; PL, Purkinje cell layer; IGL, inner granule cell layer. Scale bar, 20 lM. Please cite this article as: Zhang, H., et al., Reduced serine racemase expression in aging rat cerebellum is associated with oxidative DNA stress and hypermethylation in the promoter. Brain Research (2015), http://dx.doi.org/10.1016/j. brainres.2015.10.034
532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591
BRES : 44523
5
brain research ] (]]]]) ]]]–]]]
592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651
bp, containing 9 CpG dinucleotides (Fig. 4A,
Table 1); the
other is located between 481 bp and þ326 bp, containing 64 CpG dinucleotides (Table 1). With bisulfite-converted genomic DNA isolated from rat cerebella as template, we amplified the promoter region covering the first CpG island with bisulfite-
Fig. 4 – srr promoter hypermethylation in aging cerebellum. (A) Schematic diagram of srr mRNA composed of 50 untranslated region (UTR), open reading frame (ORF), and 30 untranslated region (UTR). The transcript contains two CpG islands in and around the promoter, and the sequence represents 234 bp (bp between 3966 and 3732). The 9 CpG dinucleotides are underlined. (B) The methylation level of the nine CpG dinucleotides compared between the rat cerebella at 12 months (n ¼10, total 150 clones) and 20 days (n¼ 10, total 150 clones), The Student's t-test was used to compare the difference of methylation status at each of the CpG dinucleotides; *P¼ 0.037.
specific primers (see Section 4.1). Methylation or unmethylated CpG dinucleotides for the promoter was documented for each clone; analysis of srr promoter methylation for the CpG island averaged from 10 genomic DNA, constituting a total of 150 clones for rat cerebella at either 20 days or 12 months. Compared to GenBank sequence (NC_005109.4), the methylation level of the first CpG island in the srr promoter from rat cerebella at 12 months was 93%, which is significantly higher than 90% from rat cerebella at 20 days (Po0.05). Also, the methylation value for the 9th CpG dinucleotides in the 12-month rats was 0.8770.10, which is significantly higher than 0.7770.086 in the 20 day rats (Fig. 4B, P¼ 0.037). Due to the oversize of the second CpG island, we divided it into three segments, conducted bisulfite sequencing PCR individually, and pooled the methylated and unmethylated CpG dinucleotides for each promoter segment when we calculated the percentage of methylation. Surprisingly, we identified hypomethylation in the second CpG island, i.e. the methylation level at 12 months is 0.04370.0019 (n¼ 10, 450 clones) vs. 0.03870.0027 at 20 days (n ¼10, 450 clones) (P¼ 0.121). To confirm the pivotal role of methylation in regulating srr transcription in aging, we conducted in vitro experiments. Previous study indicates that expression of SR mRNA and protein levels is decreased in aged WISTAR rat hippocampus (Turpin et al., 2009) and the reduction can be reversed by chronic feeding with reducing agent, N-acetyl-L-cystein (Haxaire et al., 2012). These results imply that oxidative stress, a common denominator in aging process, inhibits SR expression. Thus, we began to treat primary granule cell cultures by use of an oxidant, VK3, at 12 mM for five days; this treatment reduced the srr mRNA level significantly (Fig. 5B), thus confirming our hypothesis, i.e. oxidative stress inhibits SR expression. Further, pre-treatment with 5-Aza-dC, a DNA demethylating agent, reversed the reduction, and 5-Aza-dC treatment alone did not change the srr mRNA level (Fig. 5A and B). Thus, hypermethylation in the promoter is crucial for repressing srr transcription in aging or under oxidative stress, which is at least one of characteristics of aging. As the above
Table 1 – BSP primers and PCR products. Primer sequence
Relative to TSP (bp)
F: GGAATTAGTTGAGGATATAGATATTTG R: TCAAAAAAAATAACTAATAACTCTATCC
3966 to 3733
F: GGGTATAGGAGAAGTATTAAGGTAT R: CCCAACTACTAAACTAAACCTACC
481 to 274
13
F: GGCAGGCCCAGCCCAGCAGCTGGG R: CTTACTCTAACAAAAACCTAATTAAA
297 to þ25
32
F: TATTGGGAGTAAAAGTATTTAGTA R: ATCTTTATACTACACAATCCAAACCTA
28 to þ326
20
n
No. CpG dinucleotides 9
TSP, transcriptional start point; CpG, 50 cytosine-phospho-guanine.
Please cite this article as: Zhang, H., et al., Reduced serine racemase expression in aging rat cerebellum is associated with oxidative DNA stress and hypermethylation in the promoter. Brain Research (2015), http://dx.doi.org/10.1016/j. brainres.2015.10.034
652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711
BRES : 44523
6
712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771
brain research ] (]]]]) ]]]–]]]
Fig. 5 – In cerebellar granule cell culture, VK3 treatment reduced the srr mRNA level, which was partially but significantly reversed by pre-treatment with 5-Aza-dC. The cerebellar granule cell cultures were treated with 5-Aza-dC (5-Aza) at 2 lM for three days (A), or treated with VK3, at 12 lM, for five days; pre-treatment with 5-Aza-dC, at 2 lM, for three days, followed by VK3 treatment, at 12 lM, for five days (VK3þ5-Aza); or sham-washed treatment (B). RNA was extracted and subjected to qRT-PCR; αTubulin was used as a loading control. The results were represented as the ratios between srr and α-Tubulin mRNA. *Po0.05 vs. control; #P¼ 0.016, one-way ANOVA and Bonferroni post-hoc test was used in (B). The experiments were conducted in quadruplicate cultures in triplicate experiments; the presented data were the average of the three independent experiments. DNMT3A was decreased, whereas DNMT3B was not different in aging cerebella (Fig. 6).
3.
Fig. 6 – Increased DNMT1, but decreased DNMT3A protein levels in homogenates from aging rat cerebella. (A) Homogenates of rat cerebella at age 20 days (n¼ 5) and 12 months (n ¼ 5) were subjected to western blot detection for DNMT1 (1:200), DNMT3A (1:200), DNMT3B (1:200) and the typical blots were indicated; α-Tubulin was used as a loading control. The optical density ratios for DNMT1, DNMT3A, DNMT3B/α-Tubulin averaged from five samples were indicated in (B). Student's t-test results. *P ¼0.014 vs. 20 days; #P¼ 0.01 vs. 20 days.
study suggested that methylation in the promoter represses srr transcription in aging, we further characterized the protein level of DNA methyltransferase (DNMT), the enzyme responsible for adding methyl groups to cytosine. Interestingly, DNMT1 in rat cerebella at 12 months was increased compared to that from rat cerebella at 20 days; by contrast,
Discussion
In the present study, we documented that srr mRNA and protein levels were decreased in the rat cerebellum at 12 months compared with these values at 20 days. We continued to explore the underlying mechanism, i.e. srr promoter hypermethylation induced by oxidative stress is associated with reduction of its transcription in aging cerebella. Accumulating evidence has demonstrated that methylation can occur at CpG or non-CpG islands, regulating gene transcription (Han et al., 2011); however, it is impractical to determine the methylation status in each CpG dinucleotide of the srr promoter, particularly in the non-CpG island, so our analyses were limited to the CpG island. Prior study had demonstrated that 5-hydroxymethylation (5-hmC) in cerebella increases 10-fold from neonatal cerebella to adult cerebella (Szulwach et al., 2011); with BSP, 5-methylcytosine (5-mC) cannot be differentiated from 5-hmC. Thus, we used the oxidative bisulfite sequence (oxBS-Seq) to differentiate 5mC from 5-hmC (Booth et al., 2012); still, we did not detect 5hmC in the srr promoter CpG island. Thus, 5-mC readings from BSP in the assay were only from 5-mC conversion. Further, we imitated oxidation during the aging process with chronic VK3 treatment in vitro; the oxidation treatment reduced the srr mRNA level, which coincides with the in vivo result. Assessing the in vivo and ex vivo results, we project that oxidation creates hypermethylation, particularly of 5-mC in the srr promoter, leading to srr transcriptional reduction in the aging cerebellum. Our results suggest that increased expression of DNMT1, but not DNMT3A or DNMT3B, mediates srr promoter hypermethylation, and thus transcriptional reduction, in the aging rat cerebellum. DNMT1 can associate with histone deacetylase1 (HDAC1) to repress gene transcription, viz H2O2
Please cite this article as: Zhang, H., et al., Reduced serine racemase expression in aging rat cerebellum is associated with oxidative DNA stress and hypermethylation in the promoter. Brain Research (2015), http://dx.doi.org/10.1016/j. brainres.2015.10.034
772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831
BRES : 44523 brain research ] (]]]]) ]]]–]]]
832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890 891
treatment increases overexpression of DNMT1 and HDAC1, leading to their mutual interaction to repress CDX1 transcription (Zhang et al., 2013). Interestingly, we also demonstrated that the protein level of HDAC1 was increased in aging cerebella compared to levels in young cerebella (personal communication). Consistent with higher level of HDAC1 expression in aging cerebella, we also demonstrated that histone deacetylase inhibitor, trichostatin A (TSA), partially but significantly reversed SR mRNA reduction induced by VK3 (not shown). Thus, the potential interaction between DNMT1 and HDAC1 possibly contributes to reduced srr transcription reduction, as is currently under investigation In this study, we demonstrated a 39% reduction in srr mRNA level, but an 80% reduction in SR protein in older compared with younger cerebella. The difference may result from increased SR degradation in aging cerebella. For example, unpublished data in our hands indicated that Golgin subfamily A member 3 (Golga3), a protein assuming roles in vesicular trafficking (Ohta et al., 2003), was significantly reduced in 12-month cerebella as compared with those at 20 day. Prior study indicates that Golga3 stabilizes SR by decreasing its ubiquitylation (Dumin et al., 2006), thus reduced level of Golga3 in aging cerebella may promote SR degradation by ubiquitin–proteasome system, which may explain the further reduction of SR protein level in aging cerebella. Previous results have indicated that both mRNA and protein levels of SR are reduced in the hippocampus, but not in the cerebral cortex and cerebellum of aged rats of the Wistar or Lou/ C/Jall strains (Turpin et al., 2009). The age-related difference may stem from the inherent differences among different rat strains and the ages of the rats used; in our study, SD rats at 12 months were taken as aged, whereas in studies with Wistar rats, older animals (25–29 month) were used (Turpin et al., 2009). In studies with the C57BL/6 mouse strain, the cerebellar SR protein level decreased dramatically from postnatal day one to day 49, although the srr mRNA was not different (Wang and Zhu, 2003). By contrast, we have compared SR protein levels from rat cerebella at the ages of 20 days to three months and six months; although a trend towards decreasing values was observed, the difference was not significant (personal communication). Thus, post-transcriptional regulation contributes to reduction of SR protein level during the process of cerebellar maturation, differing with the mechanism, i.e. transcriptional regulation in aging. In summary, in vivo and ex vivo results together suggest that oxidative DNA stress and srr promoter hypermethylation are associated with reduced srr gene transcription and corresponding reduced protein expression in aging cerebella. This finding is novel and opens up a new avenue to understand srr gene regulation.
7
LI-COR IRDye 800CW secondary antibody (LI-COR, Lincoln, NE, USA); antibodies to SR (BD Biosciences, San Jose, CA, USA), 8-OHdG (Abcam, Cambridge, MA, USA), DNMT3A (Cell Signaling Technology, Danvers, MA, USA), and DNMT1, DNMT3B (Santa Cruz Biotechnology Inc, Santa Cruz, CA, USA); Neurobasal/B27 (Molecular Probes/Invitrogen, Carlsbad, CA, USA); full-range rainbow molecular-weight markers (GE Healthcare, Piscataway, NJ, USA); Trizol reagent, DNaseI (Invitrogen Corporation, Carlsbad, CA, USA); Takara Ex Taq, pMD18-T vector, PrimeScriptTM RT reagent kit with gDNA Eraser (Perfect Real Time) (Takara, Dalian, China); EZ DNA Methylation-GoldTM kit (Zymo Research, Irvine, CA, USA); GoTaqsHot Start Polymerase (Promega, Madison, WI, USA); Power SYBRs Green PCR Master Mix (Life Technology, NY, USA); and o-phthaldialdehyde, Boc-L-Cys, polyethylenimine (Sigma, St Louis, USA).
4.1.2.
Animals
Sprague–Dawley rats were purchased from the Shanghai Animal Experimental Center, Chinese Academy of Sciences and housed in standard pathogen-free animal facilities with a 12 h light on/off cycle in Wenzhou Medical University. All procedures with animals, including using the minimal number of animals and the minimal amount of animal discomfort, were approved by the Animal Use and Care Committee of Wenzhou Medical University.
4.2.
Methods
4.2.1.
Serine racemase and 8-OHdG immunohistochemistry
4.
Experimental procedure
4.1.
Materials and methods
The experimental rats were perfused transcardially with 4% paraformaldehyde in saline, and the cerebella were removed, dehydrated through graded ethanol and xylene, and embedded in paraffin. The embedded cerebellar tissue was cut sagittally to make 5 mM-thick sections and mounted on poly-D-lysine-coated slides. The sections were de-paraffinized in xylene and hydrated in graded ethanol. Endogenous peroxidase activity was eliminated by incubating the sections with 3% H2O2 in methanol for 15 min. Nonspecific reaction was blocked by incubation with goat serum. Prior to detecting SR and 8-OHdG in sections, the conditions for immunohistochemistry, e.g. antibody concentration and treatment time, were optimized. For SR or 8-OHdG staining, the sections were incubated with SR antibody (BD Biosciences; 1:200) or 8-OHdG antibody (Abcam; 1:100) for 1 h, then washed with PBS and incubated with biotinylated secondary antibody (Beyotime Biotechnology; 1:2000) for 30 min; the sections were washed with PBS and incubated with avidinhorseradish peroxidase complex for 30 min. The peroxidase activity was visualized with 3-amino-9 ethylcarbazole (AEC) as a chromogen. For 8-OHdG staining, the sections were pre-treated with proteinase K (20 mg/mL) for 45 min at 37 1C, 4 N HCl for 10 min, and 50 mM Tris-base for five minutes at room temperature before elimination of endogenous peroxidase activity. The remaining procedures were conducted as those for the detection of SR. Images were captured under a phase-contrast and brightfield microscope (Olympus BX41).
4.1.1.
Materials
4.2.2.
The following reagents and their suppliers were used in this study: biotinylated anti-mouse secondary antibody and 3-amino9 ethylcarbazole (AEC; Vector Laboratories, Burlingame, CA, USA);
Western blot analysis
After removing the skull and meninges, cerebella were dissociated. Individual cerebella were homogenized and sonicated in RIPA buffer containing protease-inhibitor cocktail
Please cite this article as: Zhang, H., et al., Reduced serine racemase expression in aging rat cerebellum is associated with oxidative DNA stress and hypermethylation in the promoter. Brain Research (2015), http://dx.doi.org/10.1016/j. brainres.2015.10.034
892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 951
BRES : 44523
8
952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000 1001 1002 1003 1004 1005 1006 1007 1008 1009 1010 1011
brain research ] (]]]]) ]]]–]]]
(Sigma). The homogenates were centrifuged at 13,000 rpm at 4 1C for 10 min, and the supernatant was collected for immunoblotting. An equal amount of protein (50 mg) was loaded to individual wells, subjected to SDS-PAGE analysis (12%), and transferred to nitrocellulose membranes. The membranes were cut before antigen blocking in order to detect SR or α-tubulin separately. The upper portions were incubated with primary antibody for SR (BD Biosciences; 1:500) and the lower portions with α-tubulin antibody (Cell Signaling Technology; 1:1000), at 4 1C overnight, followed by incubation with an infrared fluorescent dye-labeled secondary antibody, LI-COR IRDye 800CW (LI-COR; 1:5000), at ambient temperature for one hour. Images were acquired with LICOR Odyssey imager 9120, and the band optical densities were obtained in ImageJ. The blotting procedures for DNMT1 (Santa Cruz Biotechnology; 1:200), DNMT3A (Cell Signaling Biotechnology; 1:200), and DNMT3B (Santa Cruz Biotechnology; 1:200) were similar except that the concentration of methanol used in the transfer buffer was increased to 20% from 10% due to their relatively large molecular weight.
4.2.3.
Reverse-phase HPLC
Briefly, the weight of cerebellar tissue used for determination of D-serine was documented. The tissue was homogenized in PBS buffer and centrifuged at 12,000 rpm at 4 1C for 10 min; the supernatant was collected and mixed with an equal volume of acetonitrile. The mixture was vortexed and centrifuged at 12,000 rpm at 4 1C for 15 min. The supernatant was drained through a 0.2 mM filter (Shanghai Biotechnology, Inc.) and stored in 20 1C until determination of D-serine. Dserine was determined with reverse-phase HPLC by use of a fluorimetric method. O-phthaldialdehyde in combination with N-tert-butyloxycarbonyl-L-cysteine (Boc-L-Cys) was used for derivatization. A 3.5 m column (150 4.6 mm2, ZORBAX Eclipse AAA column) was used to detect D-serine. The detailed methods followed those of a reported protocol (Wu et al., 2004b). The content of D-serine was expressed by the ratio between the concentration of D-serine and the documented weight of derived cerebellar tissue.
4.2.4.
with 50 1C for 2 min, followed by 95 1C for 10 min. Dissociative curves were used to confirm the reaction specificity.
4.2.5. Bisulfite sequencing PCR and DNA methylation analysis The genomic DNA was extracted from rat cerebella at age 20 days (n¼ 10) and 12 months (n ¼10) according to a described protocol (Sambrook and Russell, 2006). Bisulfite modification of the 20 sets of genomic DNA was performed with EZ DNA Methylation-GoldTM kit, according to the manufacturer's instruction. Briefly, each set of genomic DNA (20 mL, 600 ng) was mixed with 130 mL CT Conversion reagent in a PCR tube and maintained in a PCR thermal cycler (Applied Biosystems) with reaction at 98 1C for 10 min and 64 1C for two and half hours; the reaction was terminated by incubation at 4 1C. Subsequent binding reactions were conducted in Zymo-spin IC columns (Zymo Research) by mixing the reaction product with 600 mL M-binding buffer (Zymo Research). The mixture was centrifuged then washed with M-wash buffer (Zymo Research) and desulphonated with M-desulphonation buffer (ZymoReseach). Finally, the converted DNA specimens were eluted with M-elution buffer (Zymo Research) into Eppendorf tubes. With the bisulfite-converted DNA as template, PCR products spanning the CpG island in the srr promoter (GenBank no. NC_005109.4) were generated. PCR reactions conducted with 40 cycles (95 1C for 30 s, 58 1C for 30 s, and 72 1C for 45 s) were performed with GoTaqsHot Start Polymerase (Promega), preceded by a 10 min denaturation at 95 1C and terminated with a 10 min extension at 72 1C. The primers for bisulfite sequencing PCR (BSP) were designed with Methprimer. PCR products relative to transcription start point are listed in Table 1. The resultant PCR products were ligated to pMD18-T vector (Takara) and transformed into DH5α (Invitrogen); 15 positive clones were picked from each transformed plate and subjected to sequencing (Invitrogen, Shanghai). The sequencing results were compared with srr promoter (GenBank no. NC_005109.4), using Vector NTIs11.1 to decide the methylation status of CpG dinucleotides.
Quantitative real-time PCR amplification of srr mRNA
Total RNA extracted from each cerebellum with Trizol reagent (Invitrogen) was treated with gDNA Eraser to eliminate genomic DNA. Purified RNA (400 ng) was used to synthesize the cDNA with random primer (PrimeScriptTM RT reagent kit with gDNA Eraser; Takara, Dalian, China), according to the manufacturer's instructions. The cDNA product (2 ng) was used as a template for amplifying srr mRNA with forward primer: CCAAGCCTACGGAGCATCTA spanning 683– 702 bp and reverse primer: TCCCTTGTCCCGCTATCACT spanning 803–822 bp referring to GenBank no. NM_198757.2. Tubulin α was used as an internal reference gene and amplified with forward primer: TGCCAATAACTATGCCCGTG spanning 793–812 bp and reverse primer: CCACCAAAGCTGTGGAAAACC spanning 1069–1089 bp referring to GenBank no.J00798.1. SYBR green was used as reaction dye, and all PCR reactions occurred in a 96-well ABI plate format in ABI7500 (Applied Biosystems). The relative quantification method (a delta-deltaC (T)) was adopted, and 40 cycles of PCR reactions (95 1C for 10 s and 60 1C for 1 min) were started
4.2.6.
Primary cerebellar granule cell culture
Primary cerebellar granule cell cultures were generated from seven-day postnatal rats, as described with some modification (Levi et al., 1984). Briefly, cerebellar tissue was dissociated and plated in neurobasal media supplemented with 10% B27, 20 mM KCl, 2 mM glutamine, and penicillin (100 U/ ml)/ streptomycin (0.1 mg/ml), named as granule cell culture medium (GCCM) in dishes pre-coated with polyethyleneimine. After culture overnight, the mitotic inhibitor, cytosine arabinoside (7 mM) (Sigma), was added for 24 h and the inhibitor was washed out, and the cultures were added with GCCM. For RNA or protein harvest, cells were plated at 4 105/dish in 35 mm dishes.
4.2.7.
Statistics
All results were expressed as mean7S.E.M. The significance in each experiment was tested with either Student's t-test, if two experimental groups were compared, or with one-way ANOVA and Bonferroni post-hoc test, if multiple experimental groups
Please cite this article as: Zhang, H., et al., Reduced serine racemase expression in aging rat cerebellum is associated with oxidative DNA stress and hypermethylation in the promoter. Brain Research (2015), http://dx.doi.org/10.1016/j. brainres.2015.10.034
1012 1013 1014 1015 1016 1017 1018 1019 1020 1021 1022 1023 1024 1025 1026 1027 1028 1029 1030 1031 1032 1033 1034 1035 1036 1037 1038 1039 1040 1041 1042 1043 1044 1045 1046 1047 1048 1049 1050 1051 1052 1053 1054 1055 1056 1057 1058 1059 1060 1061 1062 1063 1064 1065 1066 1067 1068 1069 1070 1071
BRES : 44523 brain research ] (]]]]) ]]]–]]]
1072 1073 1074 1075 1076 1077 1078 1079 1080 1081 1082 1083 1084 1085 1086 1087 1088 1089 1090 1091 1092 1093 Q3 Q2 1094 1095 1096 1097 1098 1099 1100 1101 1102 1103 1104 1105 1106 1107 1108 1109 1110 1111 1112 1113 1114 1115 1116 1117 1118 1119 1120 1121 1122 1123 1124 1125 1126 1127 1128 1129 1130 1131
were compared. All statistical analyses (ANOVAs AND t-tests) were conducted with SPSS 15.0.1 (SPSS, Inc., Chicago, IL). Po0.05 was used as the criterion to reject the null hypothesis.
Authors' contributions ZH designed and conducted the major experiments, analyzed the data; KXL did immunohistochemistry; CYH conducted HPLC assay and animal husbandry; LJF contributed to bisulfite sequencing PCR assay; JHY participated in HPLC assay; WSZ conceived of the project, designed the experiment, wrote the manuscript.
Conflict of interest The authors have found no conflict of interest to report.
Acknowledgment The study was supported by Natural Science Foundation of Zhejiang Province (LQ16C060002) and start-up funding (KYQD141109) from Wenzhou Medical University to Dr. He Zhang. It was also supported by National Natural Science Foundation of China (81171074), Chinese Ministry of Education (20133321120002), Wenzhou Medical University (89210001) to Dr. Shengzhou Wu. The funding resources had no roles in study design; data collection, analysis, and interpretation; the writing of the report; and the decision to submission.
Appendix A.
Supplementary material
Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.brainres. 2015.10.034.
r e f e r e n c e s
Armagan, G., Kanit, L., Yalcin, A., 2011. D-serine treatment induces oxidative stress in rat brain. Drug Chem. Toxicol. 34, 129–138. Balan, L., Foltyn, V.N., Zehl, M., Dumin, E., Dikopoltsev, E., Knoh, D., Ohno, Y., Kihara, A., Jensen, O.N., Radzishevsky, I.S., Wolosker, H., 2009. Feedback inactivation of D-serine synthesis by NMDA receptor-elicited translocation of serine racemase to the membrane. Proc. Natl. Acad. Sci. USA 106, 7589–7594. Baumgart, F., Mancheno, J.M., Rodriguez-Crespo, I., 2007. Insights into the activation of brain serine racemase by the multi-PDZ domain glutamate receptor interacting protein, divalent cations and ATP. FEBS J. 274, 4561–4571. Baylin, S.B., 2005. DNA methylation and gene silencing in cancer. Nat. Clin. Pract. Oncol. 2 (Suppl. 1), S4–S11. Berlett, B.S., Stadtman, E.R., 1997. Protein oxidation in aging, disease, and oxidative stress. J. Biol. Chem. 272, 20313–20316. Booth, M.J., Branco, M.R., Ficz, G., Oxley, D., Krueger, F., Reik, W., Balasubramanian, S., 2012. Quantitative sequencing of 5methylcytosine and 5-hydroxymethylcytosine at single-base resolution. Science 336, 934–937.
9
Cadenas, E., Davies, K.J., 2000. Mitochondrial free radical generation, oxidative stress, and aging. Free Radic. Biol. Med. 29, 222–230. Cook, S.P., Galve-Roperh, I., Martinez del Pozo, A., RodriguezCrespo, I., 2002. Direct calcium binding results in activation of brain serine racemase. J. Biol. Chem. 277, 27782–27792. De Miranda, J., Panizzutti, R., Foltyn, V.N., Wolosker, H., 2002. Cofactors of serine racemase that physiologically stimulate the synthesis of the N-methyl-D-aspartate (NMDA) receptor coagonist D-serine. Proc. Natl. Acad. Sci. USA 99, 14542–14547. Donkena, K.V., Young, C.Y., Tindall, D.J., 2010. Oxidative stress and DNA methylation in prostate cancer. Obstet. Gynecol. Int. 2010, 302051. Dumin, E., Bendikov, I., Foltyn, V.N., Misumi, Y., Ikehara, Y., Kartvelishvily, E., Wolosker, H., 2006. Modulation of D-serine levels via ubiquitin-dependent proteasomal degradation of serine racemase. J. Biol. Chem. 281, 20291–20302. Dun, Y., Duplantier, J., Roon, P., Martin, P.M., Ganapathy, V., Smith, S.B., 2008. Serine racemase expression and D-serine content are developmentally regulated in neuronal ganglion cells of the retina. J. Neurochem. 104, 970–978. Franco, R., Schoneveld, O., Georgakilas, A.G., Panayiotidis, M.I., 2008. Oxidative stress, DNA methylation and carcinogenesis. Cancer Lett. 266, 6–11. Han, H., Cortez, C.C., Yang, X., Nichols, P.W., Jones, P.A., Liang, G., 2011. DNA methylation directly silences genes with non-CpG island promoters and establishes a nucleosome occupied promoter. Hum. Mol. Genet. 20, 4299–4310. Hashimoto, K., Fukushima, T., Shimizu, E., Komatsu, N., Watanabe, H., Shinoda, N., Nakazato, M., Kumakiri, C., Okada, S., Hasegawa, H., Imai, K., Iyo, M., 2003. Decreased serum levels of D-serine in patients with schizophrenia: evidence in support of the N-methyl-D-aspartate receptor hypofunction hypothesis of schizophrenia. Arch. Gen. Psychiatry 60, 572–576. Haxaire, C., Turpin, F.R., Potier, B., Kervern, M., Sinet, P.M., Barbanel, G., Mothet, J.P., Dutar, P., Billard, J.M., 2012. Reversal of age-related oxidative stress prevents hippocampal synaptic plasticity deficits by protecting D-serine-dependent NMDA receptor activation. Aging Cell 11, 336–344. Inoue, R., Hashimoto, K., Harai, T., Mori, H., 2008. NMDA- and beta-amyloid1-42-induced neurotoxicity is attenuated in serine racemase knock-out mice. J. Neurosci. 28, 14486–14491. Jiang, H., Fang, J., Wu, B., Yin, G., Sun, L., Qu, J., Barger, S.W., Wu, S., 2011. Overexpression of serine racemase in retina and overproduction of D-serine in eyes of streptozotocin-induced diabetic retinopathy. J. Neuroinflamm. 8, 119. Jiang, H., Du, J., He, T., Qu, J., Song, Z., Wu, S., 2014. Increased D- Q4 serine in the aqueous and vitreous humor in patients with proliferative diabetic retinopathy. Clin. Exp. Ophthalmol.42841–845 Katsuki, H., Nonaka, M., Shirakawa, H., Kume, T., Akaike, A., 2004. Endogenous D-serine is involved in induction of neuronal death by N-methyl-D-aspartate and simulated ischemia in rat cerebrocortical slices. J. Pharmacol. Exp. Ther. 311, 836–844. Kawasaki, H., Taira, K., 2004. Induction of DNA methylation and gene silencing by short interfering RNAs in human cells. Nature 431, 211–217. Kim, P.M., Aizawa, H., Kim, P.S., Huang, A.S., Wickramasinghe, S.R., Kashani, A.H., Barrow, R.K., Huganir, R.L., Ghosh, A., Snyder, S.H., 2005. Serine racemase: activation by glutamate neurotransmission via glutamate receptor interacting protein and mediation of neuronal migration. Proc. Natl. Acad. Sci. USA 102, 2105–2110. Labrie, V., Fukumura, R., Rastogi, A., Fick, L.J., Wang, W., Boutros, P.C., Kennedy, J.L., Semeralul, M.O., Lee, F.H., Baker, G.B., Belsham, D.D., Barger, S.W., Gondo, Y., Wong, A.H., Roder, J.C., 2009. Serine racemase is associated with schizophrenia
Please cite this article as: Zhang, H., et al., Reduced serine racemase expression in aging rat cerebellum is associated with oxidative DNA stress and hypermethylation in the promoter. Brain Research (2015), http://dx.doi.org/10.1016/j. brainres.2015.10.034
1132 1133 1134 1135 1136 1137 1138 1139 1140 1141 1142 1143 1144 1145 1146 1147 1148 1149 1150 1151 1152 1153 1154 1155 1156 1157 1158 1159 1160 1161 1162 1163 1164 1165 1166 1167 1168 1169 1170 1171 1172 1173 1174 1175 1176 1177 1178 1179 1180 1181 1182 1183 1184 1185 1186 1187 1188 1189 1190 1191
BRES : 44523
10
1192 1193 1194 1195 1196 1197 1198 1199 1200 1201 1202 1203 1204 1205 1206 1207 1208 1209 1210 1211 1212 1213 1214 1215 Q5 1216 1217 1218 1219 1220 1221 1222 1223 1224 1225 1226 1227 1228 1229 1230 1231 1232 1233 1234 1235 1236 1237
brain research ] (]]]]) ]]]–]]]
susceptibility in humans and in a mouse model. Hum. Mol. Genet. 18, 3227–3243. Levi, G., Aloisi, F., Ciotti, M.T., Gallo, V., 1984. Autoradiographic localization and depolarization-induced release of acidic amino acids in differentiating cerebellar granule cell cultures. Brain Res. 290, 77–86. Li, L.C., Dahiya, R., 2002. MethPrimer: designing primers for methylation PCRs. Bioinformatics 18, 1427–1431. Mustafa, A.K., Kumar, M., Selvakumar, B., Ho, G.P., Ehmsen, J.T., Barrow, R.K., Amzel, L.M., Snyder, S.H., 2007. Nitric oxide Snitrosylates serine racemase, mediating feedback inhibition of D-serine formation. Proc. Natl. Acad. Sci. USA 104, 2950–2955. Mustafa, A.K., Ahmad, A.S., Zeynalov, E., Gazi, S.K., Sikka, G., Ehmsen, J.T., Barrow, R.K., Coyle, J.T., Snyder, S.H., Dore, S., 2010. Serine racemase deletion protects against cerebral ischemia and excitotoxicity. J. Neurosci. 30, 1413–1416. Neidle, A., Dunlop, D.S., 2002. Allosteric regulation of mouse brain serine racemase. Neurochem. Res. 27, 1719–1724. Ohta, E., Misumi, Y., Sohda, M., Fujiwara, T., Yano, A., Ikehara, Y., 2003. Identification and characterization of GCP16, a novel acylated Golgi protein that interacts with GCP170. J. Biol. Chem. 278, 51957–51967. Paula-Lima, A.C., Brito-Moreira, J., Ferreira, S.T., 2013. Deregulation of excitatory neurotransmission underlying synapse failure in Alzheimer’s disease. J. Neurochem. 126, 191–202. Sambrook, J., Russell, D.W., 2006. Preparation of genomic DNA from mouse tails and other small samples. CSH Protoc 2006. Sasabe, J., Chiba, T., Yamada, M., Okamoto, K., Nishimoto, I., Matsuoka, M., Aiso, S., 2007. D-serine is a key determinant of glutamate toxicity in amyotrophic lateral sclerosis. EMBO J. 26, 4149–4159. Schmahmann, J.D., Caplan, D., 2006. Cognition, emotion and the cerebellum. Brain 129, 290–292. Shu, X.O., Long, J., Cai, Q., Qi, L., Xiang, Y.B., Cho, Y.S., Tai, E.S., Li, X., Lin, X., Chow, W.H., Go, M.J., Seielstad, M., Bao, W., Li, H., Cornelis, M.C., Yu, K., Wen, W., Shi, J., Han, B.G., Sim, X.L., Liu, L., Qi, Q., Kim, H.L., Ng, D.P., Lee, J.Y., Kim, Y.J., Li, C., Gao, Y.T., Zheng, W., Hu, F.B., 2010. Identification of new genetic risk variants for type 2 diabetes. PLoS Genet. 6, e1001127. Szulwach, K.E., Li, X., Li, Y., Song, C.X., Wu, H., Dai, Q., Irier, H., Upadhyay, A.K., Gearing, M., Levey, A.I., Vasanthakumar, A., Godley, L.A., Chang, Q., Cheng, X., He, C., Jin, P., 2011. 5-hmCmediated epigenetic dynamics during postnatal neurodevelopment and aging. Nat. Neurosci. 14, 1607–1616.
Tsai, F.J., Yang, C.F., Chen, C.C., Chuang, L.M., Lu, C.H., Chang, C.T., Wang, T.Y., Chen, R.H., Shiu, C.F., Liu, Y.M., Chang, C.C., Chen, P., Chen, C.H., Fann, C.S., Chen, Y.T., Wu, J.Y., 2010. A genome-wide association study identifies susceptibility variants for type 2 diabetes in Han Chinese. PLoS Genet. 6, e1000847. Turpin, F.R., Potier, B., Dulong, J.R., Sinet, P.M., Alliot, J., Oliet, S.H., Dutar, P., Epelbaum, J., Mothet, J.P., Billard, J.M., 2009. Reduced serine racemase expression contributes to age-related deficits in hippocampal cognitive function. Neurobiol. Aging 32, 1495–1504. Wang, L.Z., Zhu, X.Z., 2003. Spatiotemporal relationships among D-serine, serine racemase, and D-amino acid oxidase during mouse postnatal development. Acta Pharmacol. Sin. 24, 965–974. Wolf, F.I., Fasanella, S., Tedesco, B., Cavallini, G., Donati, A., Bergamini, E., Cittadini, A., 2005. Peripheral lymphocyte 8OHdG levels correlate with age-associated increase of tissue oxidative DNA damage in Sprague–Dawley rats. Protective effects of caloric restriction. Exp. Gerontol. 40, 181–188. Wolosker, H., Sheth, K.N., Takahashi, M., Mothet, J.P., Brady Jr., R.O., Ferris, C.D., Snyder, S.H., 1999. Purification of serine racemase: biosynthesis of the neuromodulator D-serine. Proc. Natl. Acad. Sci. USA 96, 721–725. Wu, S., Barger, S.W., 2004. Induction of serine racemase by inflammatory stimuli is dependent on AP-1. Ann. N. Y. Acad. Sci. 1035, 133–146. Wu, S., Barger, S.W., Sims, T.J., 2004a. Schwann cell and epineural fibroblast expression of serine racemase. Brain Res. 1020, 161–166. Wu, S., Basile, A.S., Barger, S.W., 2007. Induction of serine racemase expression and D-serine release from microglia by secreted amyloid precursor protein (sAPP). Curr. Alzheimer Res. 4, 243–251. Wu, S.Z., Bodles, A.M., Porter, M.M., Griffin, W.S., Basile, A.S., Barger, S.W., 2004b. Induction of serine racemase expression and D-serine release from microglia by amyloid beta-peptide. J. Neuroinflammation 1, 2. Wu, S.Z., Jiang, S., Sims, T.J., Barger, S.W., 2005. Schwann cells exhibit excitotoxicity consistent with release of NMDA receptor agonists. J. Neurosci. Res. 79, 638–643. Zhang, R., Kang, K.A., Kim, K.C., Na, S.Y., Chang, W.Y., Kim, G.Y., Kim, H.S., Hyun, J.W., 2013. Oxidative stress causes epigenetic alteration of CDX1 expression in colorectal cancer cells. Gene 524, 214–219.
Please cite this article as: Zhang, H., et al., Reduced serine racemase expression in aging rat cerebellum is associated with oxidative DNA stress and hypermethylation in the promoter. Brain Research (2015), http://dx.doi.org/10.1016/j. brainres.2015.10.034
1238 1239 1240 1241 1242 1243 1244 1245 1246 1247 1248 1249 1250 1251 1252 1253 1254 1255 1256 1257 1258 1259 1260 1261 1262 1263 1264 1265 1266 1267 1268 1269 1270 1271 1272 1273 1274 1275 1276 1277 1278 1279 1280 1281 1282