- Email: [email protected]
Reduction of serum IgG level and peripheral T-cell counts are correlated with CTG repeat lengths in myotonic dystrophy patients
Neuromusc. Disord., Vol. 6. No. 3, pp. 203-210, 1996 Copyright g 1996 Elsevier Science Ltd. All rights reserved Printed in Great Britain 0960-8966/96 515.00 + .00
Pergamon
PII: S0960-8966(96)00010-7
REDUCTION COUNTS
OF SERUM
IgG LEVEL AND PERIPHERAL
ARE CORRELATED IN MYOTONIC
T-CELL
WITH CTG REPEAT LENGTHS
DYSTROPHY
PATIENTS
A K I N O R I N A K A M U R A * t , TORU KOJO*:~, KIICHI ARAHATA* and SHIN'ICHI TAKEDA*§ *Department of Neuromuscular Research, National Institute of Neuroscience, National Center of Neurology and Psychiatry, 4-1-1 Ogawahigashi-cho, Kodaira, Tokyo 187, Japan; tDepartment of Medicine (Neurology), Shinshu University School of Medicine, 3-1-1 Asahi, Matsumoto 390, Japan; *.Department of Neurology, Jichi Medical School, 3311-1 Yakushiji, Minamikawachi-machi, Kawachi-gun, Tochigi 329-04, Japan (Received 29 September 1995; accepted5 January 1996) Abstract--Myotonic dystrophy (DM) is an autosomal dominant multisystem disorder associated with expansion of the CTG repeat within the 3' non-coding region of the myotonin
protein kinase (MT-PK) gene. CTG repeat length has been shown to correlate with the clinical category and age at onset of the disease. The relationship between CTG repeat length and immunological parameters were analyzed in this study. We determined CTG repeat length in 14 DM patients and 15 normal controls using Southern and PCR analyses, and then correlated their CTG repeat lengths with their serum immunoglobulin (IgG, IgA, IgM) levels and the number of peripheral white blood cells, including lymphocyte subsets. In DM patients, increasing CTG repeat lengths correlated significantly with decreasing serum IgG levels, decreasing total lymphocyte counts, and decreasing CD2+, CD3 +, and CD4÷ cell counts. Immunological parameters were also influenced by the expansion of CTG repeat in DM patients. Copyright © 1996 Elsevier Science Ltd. Key words: Myotonic dystrophy, Myotonin protein kinase, CTG repeat, serum IgG, peripheral T-cell subsets.
INTRODUCTION
Myotonic dystrophy (DM) is an autosomal dominant multisystem disorder characterized by progressive muscle atrophy and weakness, myotonia, cataract, frontal baldness, arrhythmia, abnormal glucose tolerance and reduction of serum IgG [1]. The mutation that causes D M w a s identified recently and the gene affected has been mapped to chromosome 19q 13.3. The mutation is an expansion of a trinucleotide (CTG) repeat within the 3' non-coding region of the myotonin protein kinase (MT-PK or DM kinase) gene [2-7]. This CTG repeat exhibits length polymorphism ranging from five to 37 repeats [8] in normal populations, while in DM patients it ranges from 50 to 2000 or more [9]. MT-PK is expressed mainly in skele§To whom correspondence should be addressed at: Department of Molecular Genetics, National Institute of Neuroscience, National Center of Neurology and Psychiatry, 4-1-1, Ogawahigashi-cho, Kodaira, Tokyo 187, Japan.
tal and cardiac muscle [5, 10, 11] but its function is not yet known. In most cases of DM transmission, there is an earlier age at onset as well as an increase in severity of the clinical symptoms in successive generations within families ('anticipation') [12]. In addition, the expansion of the CTG repeat in MT-PK has been correlated with age at onset and the clinical category of the disease [9, 13, 141. However, the relationship of immunological parameters to the length of the CTG repeat has not been investigated. Therefore, we evaluated this relationship and found that not only the decrease in IgG levels, but also a decrease in lymphocyte counts found in DM patients are correlated with the increase in length of the CTG repeat. Immunological involvement is one phenotypic expression of DM and it is also influenced by the expansion of the CTG repeat of the MT-PK gene in DM patients.
203
204
A. Nakamura et al. PATIENTS AND METHODS
We studied 14 Japanese DM patients from eight families (10 males, four females; mean age: 44.6 yr; age range: 19-74 yr) and 15 normal healthy controls (11 males, four females; mean age: 44.4 yr; age range: 18-75 yr). The clinical manifestations of the 14 DM patients were classified into four categories [9, 15]: congenital (0), early childhood (four), classical (eight), and minimal (two). None of our patients were taking medications that could cause leukocytopenia, such as phenytoin, and routine examinations indicated that all were free from hematolgocial and immunological disorders as well as infectious diseases.
Measurement of serum immunoglobulin level and lymphocyte subset counts Serum IgG, IgA and IgM levels were measured using an automatic immunoprecipitation technique which utilizes laser-nephelometric analysis of antigen-antibody complexes (EPICS C System, Coulter Electronics Inc.). Lymphocyte subsets were assessed by direct immunofluorescence using monoclonal antibodies to T- and Bcells. FITC-conjugated OKT-11 (pan-T-cell marker, CD2), OKT-3 (pan-T-cell marker, CD3), OKT-4 (helper/ inducer subset CD4), OKT-8 (suppressor/cytotoxic subset, CDS) (Ortho) and B1 (pan-B-cell marker, CD20) (Coulter) antibodies were used. The number of fluorescenceactivated cells was determined by a flow cytometer (FCM-1, Nippon BunkS).
Genomic Southern analysis Southern analysis was used to determine the sizes of the patient's CTG repeats. Genomic DNA was isolated from peripheral leukocytes using the phenol/chloroform method [16]. Ten micrograms of DNA were digested by either SacI or PstI at 37°C for 16 h, as suggested by the manufacturer's protocol. DNA digests were then separated in 1 and 1.5% agarose gels for 16 h at 26 V, and then transferred by 0.4 M NaOH alkali blotting to Hybond-N+ ® membranes (Amersham). The membranes were subsequently incubated with the 32p-labeled pM10M-6N DNA probe. The original probe, pM10M-6, was provided by Drs Shaw and Harper and is a 1.4-kb BamHI genomic fragment containing the 3' end of the MT-PK gene [5]. For our probe we utilized a 0.66-kb
PstI/HincII subfragment of the original BamHI fragment which recognizes the same 1.2 kb Pst! and 3.5 kb SacI fragments, both containing the CTG repeat region that the original probe recognizes (Fig. 1B). The membranes were then washed twice, each time for 15 min at 65°C, in a solution containing 0.1× SSPE (18 mM NaC1, 1 mM sodium phosphate, 0.1 mM EDTA, pH 7.7) and 0.1% SDS (sodium dodecyl sulfate). Kodak X-OMAT films were then exposed for 1-3 days using two intensifying screens. If the identified fragments appeared as smears, the fragment sizes were measured at the midpoints of the smears. We then determined the CTG repeat length in each patient by calculating the difference between the size of the fragments generated from the normal alleles of a healthy control (five CTG repeats), and the size of the fragment generated from the expanded allele of each patient. The difference is the size of the patient's CTG repeat (Fig. 1A). Very short CTG repeat lengths, between 0.1 and 0.2 kb, were able to be identified by Southern analysis, but their precise sizes were only able to be determined by subsequent PCR amplification (see below). CTG repeat lengths of less than 0.1 kb were considered to be in the normal range. Analysis of products obtained by polymerase chain reaction Genomic DNA (20 ng) was PCR amplified using 20 ng of each of the primers 101 (5'CTTCCCAGGCCTGCAGTTTGCCCATC3') and 102 (5'-GAACGGGGCTCGAAGG GTCCTTGTAGC-3') [5] under the following conditions: 94°C for 1 min, 62°C for 1.5 min, and 72°C for 1.5 min, 30 cycles of amplification. Amplified products were separated by electrophoresis in 4% NuSieve ® (FMC BioProducts) gels using 1 × TBE buffer.
Statistical analysis Results are expressed as means + S.D. Statistical comparisons between two groups were carried out by the use of unpaired Student's t-test or Mann-Whitney U-tests where appropriate. Correlations between two groups were examined using the simple linear regression analysis. P values of less than 0.05 were considered to indicate statistical significance.
IgG and T-cell in Myotonic Dystrophy
205
DM family
A
1
2
C 1 2 3
C 1 2 3 ~
non-specific
-->.
non-specific (kb)
4.3*
3.5
(kb)
2.0* 0.8 kb
1.4"
--.>.
1.2
II Pst I
Sac I
C: normal control w h o has 5 C T G repeats *expanded fragment
B pMIOM-6 0.5 kb I
I
Sacl
5'
pMIOM-6N
I
i
|
I
I
I
I
I
I
BaroHI Pst I
t!
Hir~ll
Pst I
!
!
t
:
i
(CTG)n
BamHI
t
Sac I
3'
:
0.66 kb 1.2 kb
f
~" 3.5 kb ~'Fig. 1. (A) Southern analysis of genomic DNA obtained from one DM family and a healthy control. The DNA was digested by either Pstl or SacI and then separated in 1.5 or 1% agaraose gels, respectively. The gels were transferred to nylon membranes and then hybridized to a ~2p-labeled pMIOM-6N probe that recognizes fragments containing the CTG repeat. Subjects 2 and 3 are DM patients while subject 1 is a healthy sibling. Subject C is a healthy control from a family with no history of DM. Subject 3 had a CTG repeat length of 0.8 kb calculated from either the PstI digestion or the SacI digestion. The length of the the CTG repeat of subject 2 was determined to be 0.2 kb and was confirmed by PCR analysis. Each lane has non-specific bands resulting from both PstI and SacI digestions. (B) The pM10M-6N probe has been generated from the pM10M-6 probe by a PstI and HinclI double digestion. The probe recognizes a 1.2 kb PstI or 3.5 kb SacI fragment which contains the CTG repeat.
206
A. N a k a m u r a et al.
Table 1. CTG repeat length in DM patients and normal controls as determined by Southern analysis Clinical categories* Congenital Early childhood Classical Minimal Normal controls:
No. cases (n = 29)
CTG repeat length (kb)
0 4 8 2 15
1.5--2.6 1.4-3.4 0.19, 0.20 t 0-0.1
*The four graded clinical categories of DM by Harley et al. [2] tpCR analysis. eMatched to the DM patients with respect to age and sex.
RESULTS
Length of the CTG repeats We classified DM patients into four clinical categories according to criteria previously determined [9, 15]. In normal controls, CTG repeat lengths ranged from 0 to 0.1 kb, while in DM patients the lengths ranged from 0.2 to 3.4 kb. The normal alleles of the DM patients had CTG repeat lengths comparable to those of the normal controls (Table 1). Patients with early childhood or classical DM had longer CTG repeat lengths (1.4-3.4 kb) than those with minimal D M (0.19, 0.2 kb). All cases of early childhood D M in this study resulted from paternal transmission and their CTG repeat lengths were not longer than those of classical DM. Paternally transmitted DM sometimes results in shorter CTG repeat lengths in offspring exhibiting more severe DM, while maternally transmitted DM almost always results in a lengthening of the CTG repeat accompanied by an increase in severity of the disease.
Comparison of immunoglobulin levels and number of peripheral white blood cells including lymphocyte subsets in normal controls and DM patients Serum IgG levels in DM patients were significantly lower than those in normal controls (Table 2); serum IgA and IgM levels did not differ significantly between the two groups. The total number of white blood cells, the total number of lymphocytes and the lymphocyte subset counts of DM patients were slightly lower than those of normal controls but the differences were not statistically significant. Moreover, none of the lymphocyte subset counts, nor the CD4÷/CD8 + ratio, differed significantly between normal controls and DM patients (Table 2).
Correlation between CTG repeat lengths and immunological parameters in DM patients We found a significant correlation between increasing CTG repeat length and decreasing serum IgG level (r = -0.584, P = -0.028) (Fig. 2A). Although the difference in the total number of lymphocytes between normal controls and DM patients was not significant, as noted above, the decrease in the total number of lymphocytes was significantly correlated with CTG repeat lengths in DM patients (r = 0.638, P = 0.014) (Fig. 2B). Serum IgA and IgM levels and total white blood cell counts were not correlated significantly with CTG repeat lengths (r = -0.22; r = -0.196; r = -0.086, respectively). Since the decrease of the total number of lymphocytes correlated with CTG
Table 2. Comparison of serum immunoglobulins, number of peripheral white blood cells and lymphocytes including lymphocyte subsets in normal controls and DM patients* Normal controls t (n = 15) Sex (M/F) Age (yr) Serum immunoglobulins (rag d l) IgG IgA IgM White blood cells (per mm 3) Lymphocytes (per mm ~) Lymphocyte subsets (per mm 3) CD2 + cells CD3 + cells CD4 + cells CD8 + cells CD20 + cells CD4+/CD8 + ratio
DM patients (n = 14)
P value
11/4 44.6 (I 8-75)
10/4 44.4 (19-74)
0.97
1647 (1120-2340) 280 (180-466) 186 (112-346) 6052 (4701)-8200) 1951 (931-3528)
1347 (566-2250) 327 (148-620) 150 (46-288) 5414 (3200-8500) 1546 (738-3392)
0.03 0.66 0.33 0.17 0.13
1564 (713-2766) 1360 (646-2604) 848 (282-1803) 454 (258-900) 229 (72-574) 1.90 (1.05-2.81)
1273 (582-2829) 1056 (475-2249) 650 (286-1557) 391 (135-819) 160 (13-383) 1.75 (0.91-3.00)
0.18 0.13 0.14 0.41 0.13 0.41
*Values followed by values in parentheses are means and ranges. t Matched to the D M patients with respect to age and sex.
IgG and T-cell in Myotonic Dystrophy
207
C 3000
2000 2400
~
•
1500
1600 ~
•
500
•
1200 E
•
•
.
.
• ~
.
.
.
.
-
_9
CTG Repeat Length (kb)
8O0
D 400 .5
1
1.5
2
2.5
3
2400
3.5
-~
CTG Repeat Length (kb)
2ooo
1,6oo
B
tO 1200
• •
+
:=L
3500
"~
3000
E
2500
o
2000
800
•
|
400 0
.5
1
1.5
2
2.5
3
3.5
3
3.5
CTG Repeat Length (kb)
i
E
•
1500
1600
1000
~d. 1400
50O F--
0
.5
1
1.5
2
2.5
3
3.5
CTG Repeat Length (kb)
1000 O
800
600 ,00
200 .5
1
1.5
2
2.5
CTG Repeat Length (kb) Fig. 2. Correlation between CTG repeat length (kb) and serum IgG level (A), total lymphocyte count (B), CD2 ÷ cell count (C), CD3 ÷ cell count (D) and CD4* cell count (E) in 14 D M patients. The r and P values, and results of the comparisons between CTG repeat length and CD8 ÷, CD20 ÷ cell counts and CD4*/CD8 ÷ ratios are indicated in the text.
repeat length, we also determined the relationship between the lymphocyte subset counts and C T G repeat length. The reduction of CD2 ÷, CD3 + and C D 4 + cell counts significantly correlated with increasing C T G repeat lengths in D M patients (r = -0.642, P = 0.013; r = -0.623,
P = 0.017; r = -0.603, P = 0.022, respectively) (Fig. 2C-E); however, CD8 ÷ and CD20 ÷ cell counts as well as the CD4÷/CD8 ÷ ratio showed no significant correlation with C T G repeat lengths (r = - 0 . 5 1 1 ; r = - 0 . 4 8 4 ; r = 0 . 2 5 1 , respectively). S i m i l a r r e s u l t s w e r e f o u n d in all t h e
A. N a k a m u r a et aL
208
Table 3. Correlation between serum IgG levels and lymphocyte counts including subsets, or CD4+/CD8 ÷ ratio in 14 DM patients Cell count Lymphocyte count CD2 ÷ cell count CD3* cell count CD4 ÷ cell count CD8 ÷ cell count CD20 ÷ cell count CD4+/CD8 + ratio
r
P value
0.718 0.713 0.741 0.789 0.600 0.643 0.221
0.0038 0.0042 0.0024 0.0008 0.0234 0.0130 0.4486
categories of DM studied. We did not find any significant differences between the eight DM families in our immunological findings. Correlation between serum IgG levels, lymphocyte subset counts and the CD4+/CD8 ÷ ratio
After finding that both IgG levels and lymphocyte counts are significantly correlated with CTG repeat lengths in DM patients, we directly compared IgG levels and lymphocyte counts in normal controls and in DM patients. In normal controls, no significant correlations were found between serum IgG levels and total lymphocyte counts. In addition, lymphocyte subset counts and the CD4+/CD8 + ratio were not found to be correlated with IgG levels in the controls. However, in DM patients, decreased serum IgG levels and decreased total lymphocyte counts correlated significantly and all reductions in lymphocyte subset counts also correlated with reductions in IgG levels (Table 3). Among lymphocyte subsets, the T-cell subset counts, with the exception of CD8 +, were most significantly correlated, with serum IgG levels (Table 3). No correlation between serum IgG level and the CD4+/CD8 + ratio was found, probably owing to a less significant decrease of CD8 + cell counts. DISCUSSION
Serum IgG levels were significantly decreased in DM patients as compared with those in normal controls, but serum IgA and IgM levels did not differ significantly between the two groups. The reduction in serum ),globulin concentration in DM patients that was first reported in 1956 [17, 18], has been attributed to the selective reduction of serum IgG levels [19]. Although decreases of serum IgA [20] and IgM [21] levels have been reported, most investigators have found that serum immunoglobulin levels, except for IgG, remain within the normal
range in DM patients. Our results regarding immunoglobulin levels in DM patients are consistent with those previously reported [20-24]. We report here that decreased serum IgG levels, but not IgA and IgM levels, are correlated with increased CTG repeat lengths. While the number of peripheral circulating lymphocytes of DM patients in our study was slightly reduced, this reduction was not significant when compared to normal controls. Surprisingly, this reduction was significantly correlated with increasing CTG repeat length. Previous studies were also unable to detect a significant difference between DM patients and normal controls in peripheral lymphocyte counts, but our correlation analysis of these counts and CTG repeat lengths has allowed their small decreases to be revealed as cryptic abnormalities in DM patients. Moreover, the decrease in T-lymphocytes in lymphocyte subsets correlated with the expansion of CTG repeats, although the number of B-cells and the CD4+/CD8 ÷ ratio did not. Several authors have pointed out that DM patients show abnormalities in their cellular and humoral immunity [23, 25]. The decrease of T-cell counts in correlation with CTG repeat lengths may result in impaired cellular immunity in DM patients, although it has been reported that the susceptibility to both acute and chronic infection in DM patients does not differ from that in controls [24]. In DM patients, lymphocyte subset counts significantly correlated with serum IgG levels in this study. Reduction of serum IgG levels can be explained by decreased synthesis, abnormal distribution [24], or accelerated catabolism of IgG; it has been reported that the catabolism of IgG in DM patients is accelerated [19, 22], although another study refuted those findings using an IgG turnover study employing a newly developed 125I-labeled IgG [24]. There remains the possibility that decreased IgG levels and decreased total lymphocyte counts are independently influenced by CTG repeat length, but the decreased number of CD4 + cells suggests a possible impaired synthesis of IgG. Indeed, a decreased synthesis rate of IgG in B-cell subsets was found in DM patients by one investigator [26]. In the mouse, one subtype of helper T-cell, Thl, induces the secretion of IgG2a via ?qnterferon (IFN-~) [27], while another subtype, Th2, stimulates the secretion of IgG1 via interleukin-
IgG and T-cell in Myotonic Dystrophy
4 (IL-4) [28]. In the analysis of the IgG subclasses, it has been reported that serum IgG1 and/or IgG3 levels are significantly lower in DM patients compared to those in normal controls [20, 29, 30]. The decreased CD4 ÷ cell counts can explain the selective impairment of IgG subclasses in DM. Is MT-PK involved in the decreased IgG level and the decreased number of peripheral lymphocyte in DM? Although the function of MT-PK is still undetermined, MT-PK expression is known to be decreased in most DM patients [11, 31] and up-regulated in some patients with congenital DM [32]. Recently, a considerable homology to thymopoietins (TPs) was found at the N-terminal domain of MTPK [33]. The TPs are polypeptide hormones produced in the thymus and involved in T-cell differentiation. The thymopoietin-like domain in MT-PK might have an effect on T-cell proliferation, differentiation and function. DM is a muitisystem disorder whose clinical symptoms and laboratory findings differ among patients. We detected cryptic abnormalities using correlation analyses of immunological parameters and CTG repeat lengths in this study. The symptoms and pathogenesis of DM can be accounted for by an altered function of MT-PK with expanded CTG repeats and/or the existence of a trinucleotide repeat specific binding protein identified in fragile X syndrome [34]. The analysis of MT-PK expression in lymphocytes can provide a key to the understanding of immunological involvement in DM patients. Acknowledgements--This work was supported by grants for
Nervous and Mental Disorders from the Ministry of Health and Welfare, and by grants from the Ministry of Education, Science and Culture and the Fugaku Trust for Medical Research. We are indebted to Drs Duncan J. Shaw and Peter S. Harper for providing the pMIOM-6 probe as well as permission to use it and information about how to use it. We thank Drs Hiroshi Yamamoto and Hideo Sugita for critical reading of the manuscript.
REFERENCES
1. Harper P S. Myotonic Dystrophy. 2nd edn. Philadelphia: W B Saunders, 1989. 2. Harley H G, Brook J D, Rundle S A, et al. Expansion of an unstable DNA region and phenotypic variation in myotonic dystrophy. Nature 1992; 355: 545-546. 3. Buxton J, Shelbourne P, Davies J, et al. Detection of an unstable fragment of DNA specific to individuals with myotonic dystrophy. Nature 1992; 355: 547-548. 4. Aslanidis C, Jansen G, Amemiya C, et al. Cloning of the essential myotonic dystrophy region and mapping
209
of the putative defect. Nature 1992; 355: 548-551. 5. Brook J D, McCurrach M E, Harley H G, et al, Molecular basis of myotonic dystrophy: expansion of a trinucleotide (CTG) repeat at the 3' end of a transcript encoding a protein kinase family member. Cell 1992; 68: 799-808. 6. Mahadevan M, Tsilfidis C, Sabourin L, et al. Myotonic dystrophy mutation: an unstable CTG repeat in the 3' untranslated region of the gene. Science 1992; 255: 1253-1255. 7. Fu Y, Pizzuti A, Fenwick R G, et al, An unstable triplet repeat in a gene related to myotonic muscular dystrophy. Science 1992; 255: 1256-1258. 8. Brunner H G, Nillesen W, van Oost B A, et al. Presymptomatic diagnosis of myotonic dystrophy. J M e d Genet 1992; 29: 780-784. 9. Harley H G, Rundle S A, Reardon W, et al. Unstable DNA sequence in myotonic dystrophy. Lancet 1992; 339:1125-1128. 10. Jansen G, Mahadevan M, Amemiya C, et al. Characterization of the myotonic dystrophy region predicts multiple protein isoform-encoding mRNAs. Nature Genetics 1992; 1: 261-266. 11. Fu Y, Friedman D L, Richards S, et al. Decreased expression of myotonin-protein kinase messenger RNA and protein in adult form of myotonic dystrophy. Science 1993; 260: 235-238. 12. Harper P S, Harley H G, Reardon W, et al, Anticipation in myotonic dystrophy: new light on an old problem. A m J Hum Genet 1992; 51: 10-16. 13. Hunter A, Tsilfidis C, Mettler G, et al, The correlation of age of onset with CTG trinucleotide repeat amplification in myotonic dystrophy. J M e d Genet 1992; 29: 774--779. 14. Tsilfidis C, MacKenzie A E, Mettler G, et al. Correlation between CTG trinucleotide repeat length and frequency of severe congenital myotonic dystrophy. Nature Genet 1992; 1: 192-195. 15. Harley H G, Rundle S A, MacMillan J C, et al. Size of the unstable CTG repeat sequence in relation to phenotype and parental transmission in myotonic dystrophy. A m J Hum Genet 1993; 52:1164-1174. 16. Sambrook J, Fritsch E F, Maniatis T. Molecular Cloning: a Laboratory Manual. 2nd edn. New York: Cold Spring Harbor Laboratory Press, 1989. 17. Zinneman H H and Rotstein J. A study of gamma globulins in dystrophia myotonica. J Lab Clin M e d 1956; 47: 907-916. 18. Lowenthal A, van Sande M. Nouvelles d6terminations des fractions prot6iniques dans le s6rum de patients atteints d'affections musculaires. Rev franq Etud clin biol 1956; 1: 765-777. 19. Wochner R D, Drews G, Strober W, et al. Accelerated breakdown of immunoglobulin (IgG) in myotonic dystrophy: a hereditary error of immunoglobulin catabolism. J Clin Invest 1966; 45: 321-329. 20. Larsen B, Johnson G, van Loghem E, et aL Immunoglobulin concentration and Gm allotypes in a family with thirty-three cases of myotonic dystrophy. Clin Genet 1980; 18: 13-19. 21. Bundy S, Carter C O, Soothill L F. Early recognition of heterozygotes for the gene for dystrophia myotonica. J Neurol Neurosurg Psychiatry 1970; 33: 279-293. 22. Jensen H, Jensen K B, Jarnum S. Turnover of IgG and IgM in myotonic dystrophy. Neurology 1971; 21: 68-71. 23. Kuroiwa Y, Sugita H, Toyokura Y, et al. Immunologic derangement in myotonic dystrophy. Abnormal contact sensitization to dinitrochlorobenzene. J Neurol Sci 1980; 47: 231-239. 24. Suzumura A, Yamada H, Matsuoka Y, et al. Immunoglobulin abnormalities in patients with
210
25. 26. 27. 28.
29.
30.
A. Nakamura et al. myotonic dystrophy. Acta Neurol Scand 1986; 74: 132-139. Grove D I, O'Callaghan S J, Burston T O, et al. Immunological function in dystrophia myotonica. Br M e d J 1973; 3: 81-83. Ugawa Y, Sakuta M, Shinomiya N, et al. Lymphocyte function in myotonic dystrophy. Clin Neurol ( T o k y o ) 1983; 23:1196 Snapper C M, Paul W E. Interferon-Tand B cell stimulatory factor-1 reciprocally regulate Ig isotype production. Science 1987; 236: 944-947. Isakson P C, Put6 E, Vitetta E S, et al. T cell-derived B cell differentiation factor(s). Effect on the isotype switch of murine B ceils. J Exp M e d 1982; 155: 734-748. Bruyland M, Lissens W, De Waele M, et al. HypoIgG in myotonic dystrophy is due to a selective reduction of the IgGl-subclass serum level. Muscle Nerve 1994; 17: 1233-1234. Sofue F, Suzumura A, Yamamoto H. IgG subclasses
31.
32.
33.
34.
in the patients with myotonic dystrophy. Clin Neurol (Tokyo) 1994; 34: 788-792. Koga R, Nakao Y, Kurano Y, et al. Decreased myotonin-protein kinase in the skeletal and cardiac muscles in myotonic dystrophy. Biochem Biophys Res Commun 1994; 202: 577-585. Sabouri L A, Mahadevan M S, Narang M, et al. Effect of the myotonic dystrophy (DM) mutation on mRNA levels of the DM gene. Nature Genet 1993; 4: 233-238. Sasagawa N, Sorimachi H, Maruyama K, et al. Expression of a novel human myotonin protein kinase (MtPK) cDNA clone which encodes a protein with a thymopoietin-like domain in COS cells. F E B S Lett 1994; 351: 22-26. Richards R I, Holman K, Yu S, et al. Fragile X syndrome unstable element, p(CCG)n, and other simple tandem repeat sequences are binding sites for specific nuclear proteins. H u m M o l Genet 1993; 2: 1429-1453.
Pergamon
PII: S0960-8966(96)00010-7
REDUCTION COUNTS
OF SERUM
IgG LEVEL AND PERIPHERAL
ARE CORRELATED IN MYOTONIC
T-CELL
WITH CTG REPEAT LENGTHS
DYSTROPHY
PATIENTS
A K I N O R I N A K A M U R A * t , TORU KOJO*:~, KIICHI ARAHATA* and SHIN'ICHI TAKEDA*§ *Department of Neuromuscular Research, National Institute of Neuroscience, National Center of Neurology and Psychiatry, 4-1-1 Ogawahigashi-cho, Kodaira, Tokyo 187, Japan; tDepartment of Medicine (Neurology), Shinshu University School of Medicine, 3-1-1 Asahi, Matsumoto 390, Japan; *.Department of Neurology, Jichi Medical School, 3311-1 Yakushiji, Minamikawachi-machi, Kawachi-gun, Tochigi 329-04, Japan (Received 29 September 1995; accepted5 January 1996) Abstract--Myotonic dystrophy (DM) is an autosomal dominant multisystem disorder associated with expansion of the CTG repeat within the 3' non-coding region of the myotonin
protein kinase (MT-PK) gene. CTG repeat length has been shown to correlate with the clinical category and age at onset of the disease. The relationship between CTG repeat length and immunological parameters were analyzed in this study. We determined CTG repeat length in 14 DM patients and 15 normal controls using Southern and PCR analyses, and then correlated their CTG repeat lengths with their serum immunoglobulin (IgG, IgA, IgM) levels and the number of peripheral white blood cells, including lymphocyte subsets. In DM patients, increasing CTG repeat lengths correlated significantly with decreasing serum IgG levels, decreasing total lymphocyte counts, and decreasing CD2+, CD3 +, and CD4÷ cell counts. Immunological parameters were also influenced by the expansion of CTG repeat in DM patients. Copyright © 1996 Elsevier Science Ltd. Key words: Myotonic dystrophy, Myotonin protein kinase, CTG repeat, serum IgG, peripheral T-cell subsets.
INTRODUCTION
Myotonic dystrophy (DM) is an autosomal dominant multisystem disorder characterized by progressive muscle atrophy and weakness, myotonia, cataract, frontal baldness, arrhythmia, abnormal glucose tolerance and reduction of serum IgG [1]. The mutation that causes D M w a s identified recently and the gene affected has been mapped to chromosome 19q 13.3. The mutation is an expansion of a trinucleotide (CTG) repeat within the 3' non-coding region of the myotonin protein kinase (MT-PK or DM kinase) gene [2-7]. This CTG repeat exhibits length polymorphism ranging from five to 37 repeats [8] in normal populations, while in DM patients it ranges from 50 to 2000 or more [9]. MT-PK is expressed mainly in skele§To whom correspondence should be addressed at: Department of Molecular Genetics, National Institute of Neuroscience, National Center of Neurology and Psychiatry, 4-1-1, Ogawahigashi-cho, Kodaira, Tokyo 187, Japan.
tal and cardiac muscle [5, 10, 11] but its function is not yet known. In most cases of DM transmission, there is an earlier age at onset as well as an increase in severity of the clinical symptoms in successive generations within families ('anticipation') [12]. In addition, the expansion of the CTG repeat in MT-PK has been correlated with age at onset and the clinical category of the disease [9, 13, 141. However, the relationship of immunological parameters to the length of the CTG repeat has not been investigated. Therefore, we evaluated this relationship and found that not only the decrease in IgG levels, but also a decrease in lymphocyte counts found in DM patients are correlated with the increase in length of the CTG repeat. Immunological involvement is one phenotypic expression of DM and it is also influenced by the expansion of the CTG repeat of the MT-PK gene in DM patients.
203
204
A. Nakamura et al. PATIENTS AND METHODS
We studied 14 Japanese DM patients from eight families (10 males, four females; mean age: 44.6 yr; age range: 19-74 yr) and 15 normal healthy controls (11 males, four females; mean age: 44.4 yr; age range: 18-75 yr). The clinical manifestations of the 14 DM patients were classified into four categories [9, 15]: congenital (0), early childhood (four), classical (eight), and minimal (two). None of our patients were taking medications that could cause leukocytopenia, such as phenytoin, and routine examinations indicated that all were free from hematolgocial and immunological disorders as well as infectious diseases.
Measurement of serum immunoglobulin level and lymphocyte subset counts Serum IgG, IgA and IgM levels were measured using an automatic immunoprecipitation technique which utilizes laser-nephelometric analysis of antigen-antibody complexes (EPICS C System, Coulter Electronics Inc.). Lymphocyte subsets were assessed by direct immunofluorescence using monoclonal antibodies to T- and Bcells. FITC-conjugated OKT-11 (pan-T-cell marker, CD2), OKT-3 (pan-T-cell marker, CD3), OKT-4 (helper/ inducer subset CD4), OKT-8 (suppressor/cytotoxic subset, CDS) (Ortho) and B1 (pan-B-cell marker, CD20) (Coulter) antibodies were used. The number of fluorescenceactivated cells was determined by a flow cytometer (FCM-1, Nippon BunkS).
Genomic Southern analysis Southern analysis was used to determine the sizes of the patient's CTG repeats. Genomic DNA was isolated from peripheral leukocytes using the phenol/chloroform method [16]. Ten micrograms of DNA were digested by either SacI or PstI at 37°C for 16 h, as suggested by the manufacturer's protocol. DNA digests were then separated in 1 and 1.5% agarose gels for 16 h at 26 V, and then transferred by 0.4 M NaOH alkali blotting to Hybond-N+ ® membranes (Amersham). The membranes were subsequently incubated with the 32p-labeled pM10M-6N DNA probe. The original probe, pM10M-6, was provided by Drs Shaw and Harper and is a 1.4-kb BamHI genomic fragment containing the 3' end of the MT-PK gene [5]. For our probe we utilized a 0.66-kb
PstI/HincII subfragment of the original BamHI fragment which recognizes the same 1.2 kb Pst! and 3.5 kb SacI fragments, both containing the CTG repeat region that the original probe recognizes (Fig. 1B). The membranes were then washed twice, each time for 15 min at 65°C, in a solution containing 0.1× SSPE (18 mM NaC1, 1 mM sodium phosphate, 0.1 mM EDTA, pH 7.7) and 0.1% SDS (sodium dodecyl sulfate). Kodak X-OMAT films were then exposed for 1-3 days using two intensifying screens. If the identified fragments appeared as smears, the fragment sizes were measured at the midpoints of the smears. We then determined the CTG repeat length in each patient by calculating the difference between the size of the fragments generated from the normal alleles of a healthy control (five CTG repeats), and the size of the fragment generated from the expanded allele of each patient. The difference is the size of the patient's CTG repeat (Fig. 1A). Very short CTG repeat lengths, between 0.1 and 0.2 kb, were able to be identified by Southern analysis, but their precise sizes were only able to be determined by subsequent PCR amplification (see below). CTG repeat lengths of less than 0.1 kb were considered to be in the normal range. Analysis of products obtained by polymerase chain reaction Genomic DNA (20 ng) was PCR amplified using 20 ng of each of the primers 101 (5'CTTCCCAGGCCTGCAGTTTGCCCATC3') and 102 (5'-GAACGGGGCTCGAAGG GTCCTTGTAGC-3') [5] under the following conditions: 94°C for 1 min, 62°C for 1.5 min, and 72°C for 1.5 min, 30 cycles of amplification. Amplified products were separated by electrophoresis in 4% NuSieve ® (FMC BioProducts) gels using 1 × TBE buffer.
Statistical analysis Results are expressed as means + S.D. Statistical comparisons between two groups were carried out by the use of unpaired Student's t-test or Mann-Whitney U-tests where appropriate. Correlations between two groups were examined using the simple linear regression analysis. P values of less than 0.05 were considered to indicate statistical significance.
IgG and T-cell in Myotonic Dystrophy
205
DM family
A
1
2
C 1 2 3
C 1 2 3 ~
non-specific
-->.
non-specific (kb)
4.3*
3.5
(kb)
2.0* 0.8 kb
1.4"
--.>.
1.2
II Pst I
Sac I
C: normal control w h o has 5 C T G repeats *expanded fragment
B pMIOM-6 0.5 kb I
I
Sacl
5'
pMIOM-6N
I
i
|
I
I
I
I
I
I
BaroHI Pst I
t!
Hir~ll
Pst I
!
!
t
:
i
(CTG)n
BamHI
t
Sac I
3'
:
0.66 kb 1.2 kb
f
~" 3.5 kb ~'Fig. 1. (A) Southern analysis of genomic DNA obtained from one DM family and a healthy control. The DNA was digested by either Pstl or SacI and then separated in 1.5 or 1% agaraose gels, respectively. The gels were transferred to nylon membranes and then hybridized to a ~2p-labeled pMIOM-6N probe that recognizes fragments containing the CTG repeat. Subjects 2 and 3 are DM patients while subject 1 is a healthy sibling. Subject C is a healthy control from a family with no history of DM. Subject 3 had a CTG repeat length of 0.8 kb calculated from either the PstI digestion or the SacI digestion. The length of the the CTG repeat of subject 2 was determined to be 0.2 kb and was confirmed by PCR analysis. Each lane has non-specific bands resulting from both PstI and SacI digestions. (B) The pM10M-6N probe has been generated from the pM10M-6 probe by a PstI and HinclI double digestion. The probe recognizes a 1.2 kb PstI or 3.5 kb SacI fragment which contains the CTG repeat.
206
A. N a k a m u r a et al.
Table 1. CTG repeat length in DM patients and normal controls as determined by Southern analysis Clinical categories* Congenital Early childhood Classical Minimal Normal controls:
No. cases (n = 29)
CTG repeat length (kb)
0 4 8 2 15
1.5--2.6 1.4-3.4 0.19, 0.20 t 0-0.1
*The four graded clinical categories of DM by Harley et al. [2] tpCR analysis. eMatched to the DM patients with respect to age and sex.
RESULTS
Length of the CTG repeats We classified DM patients into four clinical categories according to criteria previously determined [9, 15]. In normal controls, CTG repeat lengths ranged from 0 to 0.1 kb, while in DM patients the lengths ranged from 0.2 to 3.4 kb. The normal alleles of the DM patients had CTG repeat lengths comparable to those of the normal controls (Table 1). Patients with early childhood or classical DM had longer CTG repeat lengths (1.4-3.4 kb) than those with minimal D M (0.19, 0.2 kb). All cases of early childhood D M in this study resulted from paternal transmission and their CTG repeat lengths were not longer than those of classical DM. Paternally transmitted DM sometimes results in shorter CTG repeat lengths in offspring exhibiting more severe DM, while maternally transmitted DM almost always results in a lengthening of the CTG repeat accompanied by an increase in severity of the disease.
Comparison of immunoglobulin levels and number of peripheral white blood cells including lymphocyte subsets in normal controls and DM patients Serum IgG levels in DM patients were significantly lower than those in normal controls (Table 2); serum IgA and IgM levels did not differ significantly between the two groups. The total number of white blood cells, the total number of lymphocytes and the lymphocyte subset counts of DM patients were slightly lower than those of normal controls but the differences were not statistically significant. Moreover, none of the lymphocyte subset counts, nor the CD4÷/CD8 + ratio, differed significantly between normal controls and DM patients (Table 2).
Correlation between CTG repeat lengths and immunological parameters in DM patients We found a significant correlation between increasing CTG repeat length and decreasing serum IgG level (r = -0.584, P = -0.028) (Fig. 2A). Although the difference in the total number of lymphocytes between normal controls and DM patients was not significant, as noted above, the decrease in the total number of lymphocytes was significantly correlated with CTG repeat lengths in DM patients (r = 0.638, P = 0.014) (Fig. 2B). Serum IgA and IgM levels and total white blood cell counts were not correlated significantly with CTG repeat lengths (r = -0.22; r = -0.196; r = -0.086, respectively). Since the decrease of the total number of lymphocytes correlated with CTG
Table 2. Comparison of serum immunoglobulins, number of peripheral white blood cells and lymphocytes including lymphocyte subsets in normal controls and DM patients* Normal controls t (n = 15) Sex (M/F) Age (yr) Serum immunoglobulins (rag d l) IgG IgA IgM White blood cells (per mm 3) Lymphocytes (per mm ~) Lymphocyte subsets (per mm 3) CD2 + cells CD3 + cells CD4 + cells CD8 + cells CD20 + cells CD4+/CD8 + ratio
DM patients (n = 14)
P value
11/4 44.6 (I 8-75)
10/4 44.4 (19-74)
0.97
1647 (1120-2340) 280 (180-466) 186 (112-346) 6052 (4701)-8200) 1951 (931-3528)
1347 (566-2250) 327 (148-620) 150 (46-288) 5414 (3200-8500) 1546 (738-3392)
0.03 0.66 0.33 0.17 0.13
1564 (713-2766) 1360 (646-2604) 848 (282-1803) 454 (258-900) 229 (72-574) 1.90 (1.05-2.81)
1273 (582-2829) 1056 (475-2249) 650 (286-1557) 391 (135-819) 160 (13-383) 1.75 (0.91-3.00)
0.18 0.13 0.14 0.41 0.13 0.41
*Values followed by values in parentheses are means and ranges. t Matched to the D M patients with respect to age and sex.
IgG and T-cell in Myotonic Dystrophy
207
C 3000
2000 2400
~
•
1500
1600 ~
•
500
•
1200 E
•
•
.
.
• ~
.
.
.
.
-
_9
CTG Repeat Length (kb)
8O0
D 400 .5
1
1.5
2
2.5
3
2400
3.5
-~
CTG Repeat Length (kb)
2ooo
1,6oo
B
tO 1200
• •
+
:=L
3500
"~
3000
E
2500
o
2000
800
•
|
400 0
.5
1
1.5
2
2.5
3
3.5
3
3.5
CTG Repeat Length (kb)
i
E
•
1500
1600
1000
~d. 1400
50O F--
0
.5
1
1.5
2
2.5
3
3.5
CTG Repeat Length (kb)
1000 O
800
600 ,00
200 .5
1
1.5
2
2.5
CTG Repeat Length (kb) Fig. 2. Correlation between CTG repeat length (kb) and serum IgG level (A), total lymphocyte count (B), CD2 ÷ cell count (C), CD3 ÷ cell count (D) and CD4* cell count (E) in 14 D M patients. The r and P values, and results of the comparisons between CTG repeat length and CD8 ÷, CD20 ÷ cell counts and CD4*/CD8 ÷ ratios are indicated in the text.
repeat length, we also determined the relationship between the lymphocyte subset counts and C T G repeat length. The reduction of CD2 ÷, CD3 + and C D 4 + cell counts significantly correlated with increasing C T G repeat lengths in D M patients (r = -0.642, P = 0.013; r = -0.623,
P = 0.017; r = -0.603, P = 0.022, respectively) (Fig. 2C-E); however, CD8 ÷ and CD20 ÷ cell counts as well as the CD4÷/CD8 ÷ ratio showed no significant correlation with C T G repeat lengths (r = - 0 . 5 1 1 ; r = - 0 . 4 8 4 ; r = 0 . 2 5 1 , respectively). S i m i l a r r e s u l t s w e r e f o u n d in all t h e
A. N a k a m u r a et aL
208
Table 3. Correlation between serum IgG levels and lymphocyte counts including subsets, or CD4+/CD8 ÷ ratio in 14 DM patients Cell count Lymphocyte count CD2 ÷ cell count CD3* cell count CD4 ÷ cell count CD8 ÷ cell count CD20 ÷ cell count CD4+/CD8 + ratio
r
P value
0.718 0.713 0.741 0.789 0.600 0.643 0.221
0.0038 0.0042 0.0024 0.0008 0.0234 0.0130 0.4486
categories of DM studied. We did not find any significant differences between the eight DM families in our immunological findings. Correlation between serum IgG levels, lymphocyte subset counts and the CD4+/CD8 ÷ ratio
After finding that both IgG levels and lymphocyte counts are significantly correlated with CTG repeat lengths in DM patients, we directly compared IgG levels and lymphocyte counts in normal controls and in DM patients. In normal controls, no significant correlations were found between serum IgG levels and total lymphocyte counts. In addition, lymphocyte subset counts and the CD4+/CD8 + ratio were not found to be correlated with IgG levels in the controls. However, in DM patients, decreased serum IgG levels and decreased total lymphocyte counts correlated significantly and all reductions in lymphocyte subset counts also correlated with reductions in IgG levels (Table 3). Among lymphocyte subsets, the T-cell subset counts, with the exception of CD8 +, were most significantly correlated, with serum IgG levels (Table 3). No correlation between serum IgG level and the CD4+/CD8 + ratio was found, probably owing to a less significant decrease of CD8 + cell counts. DISCUSSION
Serum IgG levels were significantly decreased in DM patients as compared with those in normal controls, but serum IgA and IgM levels did not differ significantly between the two groups. The reduction in serum ),globulin concentration in DM patients that was first reported in 1956 [17, 18], has been attributed to the selective reduction of serum IgG levels [19]. Although decreases of serum IgA [20] and IgM [21] levels have been reported, most investigators have found that serum immunoglobulin levels, except for IgG, remain within the normal
range in DM patients. Our results regarding immunoglobulin levels in DM patients are consistent with those previously reported [20-24]. We report here that decreased serum IgG levels, but not IgA and IgM levels, are correlated with increased CTG repeat lengths. While the number of peripheral circulating lymphocytes of DM patients in our study was slightly reduced, this reduction was not significant when compared to normal controls. Surprisingly, this reduction was significantly correlated with increasing CTG repeat length. Previous studies were also unable to detect a significant difference between DM patients and normal controls in peripheral lymphocyte counts, but our correlation analysis of these counts and CTG repeat lengths has allowed their small decreases to be revealed as cryptic abnormalities in DM patients. Moreover, the decrease in T-lymphocytes in lymphocyte subsets correlated with the expansion of CTG repeats, although the number of B-cells and the CD4+/CD8 ÷ ratio did not. Several authors have pointed out that DM patients show abnormalities in their cellular and humoral immunity [23, 25]. The decrease of T-cell counts in correlation with CTG repeat lengths may result in impaired cellular immunity in DM patients, although it has been reported that the susceptibility to both acute and chronic infection in DM patients does not differ from that in controls [24]. In DM patients, lymphocyte subset counts significantly correlated with serum IgG levels in this study. Reduction of serum IgG levels can be explained by decreased synthesis, abnormal distribution [24], or accelerated catabolism of IgG; it has been reported that the catabolism of IgG in DM patients is accelerated [19, 22], although another study refuted those findings using an IgG turnover study employing a newly developed 125I-labeled IgG [24]. There remains the possibility that decreased IgG levels and decreased total lymphocyte counts are independently influenced by CTG repeat length, but the decreased number of CD4 + cells suggests a possible impaired synthesis of IgG. Indeed, a decreased synthesis rate of IgG in B-cell subsets was found in DM patients by one investigator [26]. In the mouse, one subtype of helper T-cell, Thl, induces the secretion of IgG2a via ?qnterferon (IFN-~) [27], while another subtype, Th2, stimulates the secretion of IgG1 via interleukin-
IgG and T-cell in Myotonic Dystrophy
4 (IL-4) [28]. In the analysis of the IgG subclasses, it has been reported that serum IgG1 and/or IgG3 levels are significantly lower in DM patients compared to those in normal controls [20, 29, 30]. The decreased CD4 ÷ cell counts can explain the selective impairment of IgG subclasses in DM. Is MT-PK involved in the decreased IgG level and the decreased number of peripheral lymphocyte in DM? Although the function of MT-PK is still undetermined, MT-PK expression is known to be decreased in most DM patients [11, 31] and up-regulated in some patients with congenital DM [32]. Recently, a considerable homology to thymopoietins (TPs) was found at the N-terminal domain of MTPK [33]. The TPs are polypeptide hormones produced in the thymus and involved in T-cell differentiation. The thymopoietin-like domain in MT-PK might have an effect on T-cell proliferation, differentiation and function. DM is a muitisystem disorder whose clinical symptoms and laboratory findings differ among patients. We detected cryptic abnormalities using correlation analyses of immunological parameters and CTG repeat lengths in this study. The symptoms and pathogenesis of DM can be accounted for by an altered function of MT-PK with expanded CTG repeats and/or the existence of a trinucleotide repeat specific binding protein identified in fragile X syndrome [34]. The analysis of MT-PK expression in lymphocytes can provide a key to the understanding of immunological involvement in DM patients. Acknowledgements--This work was supported by grants for
Nervous and Mental Disorders from the Ministry of Health and Welfare, and by grants from the Ministry of Education, Science and Culture and the Fugaku Trust for Medical Research. We are indebted to Drs Duncan J. Shaw and Peter S. Harper for providing the pMIOM-6 probe as well as permission to use it and information about how to use it. We thank Drs Hiroshi Yamamoto and Hideo Sugita for critical reading of the manuscript.
REFERENCES
1. Harper P S. Myotonic Dystrophy. 2nd edn. Philadelphia: W B Saunders, 1989. 2. Harley H G, Brook J D, Rundle S A, et al. Expansion of an unstable DNA region and phenotypic variation in myotonic dystrophy. Nature 1992; 355: 545-546. 3. Buxton J, Shelbourne P, Davies J, et al. Detection of an unstable fragment of DNA specific to individuals with myotonic dystrophy. Nature 1992; 355: 547-548. 4. Aslanidis C, Jansen G, Amemiya C, et al. Cloning of the essential myotonic dystrophy region and mapping
209
of the putative defect. Nature 1992; 355: 548-551. 5. Brook J D, McCurrach M E, Harley H G, et al, Molecular basis of myotonic dystrophy: expansion of a trinucleotide (CTG) repeat at the 3' end of a transcript encoding a protein kinase family member. Cell 1992; 68: 799-808. 6. Mahadevan M, Tsilfidis C, Sabourin L, et al. Myotonic dystrophy mutation: an unstable CTG repeat in the 3' untranslated region of the gene. Science 1992; 255: 1253-1255. 7. Fu Y, Pizzuti A, Fenwick R G, et al, An unstable triplet repeat in a gene related to myotonic muscular dystrophy. Science 1992; 255: 1256-1258. 8. Brunner H G, Nillesen W, van Oost B A, et al. Presymptomatic diagnosis of myotonic dystrophy. J M e d Genet 1992; 29: 780-784. 9. Harley H G, Rundle S A, Reardon W, et al. Unstable DNA sequence in myotonic dystrophy. Lancet 1992; 339:1125-1128. 10. Jansen G, Mahadevan M, Amemiya C, et al. Characterization of the myotonic dystrophy region predicts multiple protein isoform-encoding mRNAs. Nature Genetics 1992; 1: 261-266. 11. Fu Y, Friedman D L, Richards S, et al. Decreased expression of myotonin-protein kinase messenger RNA and protein in adult form of myotonic dystrophy. Science 1993; 260: 235-238. 12. Harper P S, Harley H G, Reardon W, et al, Anticipation in myotonic dystrophy: new light on an old problem. A m J Hum Genet 1992; 51: 10-16. 13. Hunter A, Tsilfidis C, Mettler G, et al, The correlation of age of onset with CTG trinucleotide repeat amplification in myotonic dystrophy. J M e d Genet 1992; 29: 774--779. 14. Tsilfidis C, MacKenzie A E, Mettler G, et al. Correlation between CTG trinucleotide repeat length and frequency of severe congenital myotonic dystrophy. Nature Genet 1992; 1: 192-195. 15. Harley H G, Rundle S A, MacMillan J C, et al. Size of the unstable CTG repeat sequence in relation to phenotype and parental transmission in myotonic dystrophy. A m J Hum Genet 1993; 52:1164-1174. 16. Sambrook J, Fritsch E F, Maniatis T. Molecular Cloning: a Laboratory Manual. 2nd edn. New York: Cold Spring Harbor Laboratory Press, 1989. 17. Zinneman H H and Rotstein J. A study of gamma globulins in dystrophia myotonica. J Lab Clin M e d 1956; 47: 907-916. 18. Lowenthal A, van Sande M. Nouvelles d6terminations des fractions prot6iniques dans le s6rum de patients atteints d'affections musculaires. Rev franq Etud clin biol 1956; 1: 765-777. 19. Wochner R D, Drews G, Strober W, et al. Accelerated breakdown of immunoglobulin (IgG) in myotonic dystrophy: a hereditary error of immunoglobulin catabolism. J Clin Invest 1966; 45: 321-329. 20. Larsen B, Johnson G, van Loghem E, et aL Immunoglobulin concentration and Gm allotypes in a family with thirty-three cases of myotonic dystrophy. Clin Genet 1980; 18: 13-19. 21. Bundy S, Carter C O, Soothill L F. Early recognition of heterozygotes for the gene for dystrophia myotonica. J Neurol Neurosurg Psychiatry 1970; 33: 279-293. 22. Jensen H, Jensen K B, Jarnum S. Turnover of IgG and IgM in myotonic dystrophy. Neurology 1971; 21: 68-71. 23. Kuroiwa Y, Sugita H, Toyokura Y, et al. Immunologic derangement in myotonic dystrophy. Abnormal contact sensitization to dinitrochlorobenzene. J Neurol Sci 1980; 47: 231-239. 24. Suzumura A, Yamada H, Matsuoka Y, et al. Immunoglobulin abnormalities in patients with
210
25. 26. 27. 28.
29.
30.
A. Nakamura et al. myotonic dystrophy. Acta Neurol Scand 1986; 74: 132-139. Grove D I, O'Callaghan S J, Burston T O, et al. Immunological function in dystrophia myotonica. Br M e d J 1973; 3: 81-83. Ugawa Y, Sakuta M, Shinomiya N, et al. Lymphocyte function in myotonic dystrophy. Clin Neurol ( T o k y o ) 1983; 23:1196 Snapper C M, Paul W E. Interferon-Tand B cell stimulatory factor-1 reciprocally regulate Ig isotype production. Science 1987; 236: 944-947. Isakson P C, Put6 E, Vitetta E S, et al. T cell-derived B cell differentiation factor(s). Effect on the isotype switch of murine B ceils. J Exp M e d 1982; 155: 734-748. Bruyland M, Lissens W, De Waele M, et al. HypoIgG in myotonic dystrophy is due to a selective reduction of the IgGl-subclass serum level. Muscle Nerve 1994; 17: 1233-1234. Sofue F, Suzumura A, Yamamoto H. IgG subclasses
31.
32.
33.
34.
in the patients with myotonic dystrophy. Clin Neurol (Tokyo) 1994; 34: 788-792. Koga R, Nakao Y, Kurano Y, et al. Decreased myotonin-protein kinase in the skeletal and cardiac muscles in myotonic dystrophy. Biochem Biophys Res Commun 1994; 202: 577-585. Sabouri L A, Mahadevan M S, Narang M, et al. Effect of the myotonic dystrophy (DM) mutation on mRNA levels of the DM gene. Nature Genet 1993; 4: 233-238. Sasagawa N, Sorimachi H, Maruyama K, et al. Expression of a novel human myotonin protein kinase (MtPK) cDNA clone which encodes a protein with a thymopoietin-like domain in COS cells. F E B S Lett 1994; 351: 22-26. Richards R I, Holman K, Yu S, et al. Fragile X syndrome unstable element, p(CCG)n, and other simple tandem repeat sequences are binding sites for specific nuclear proteins. H u m M o l Genet 1993; 2: 1429-1453.