Regulation of avian fibroblast growth factor receptor 1 (FGFR-1) gene expression during skeletal muscle differentiation

Gene 237 (1999) 265–276 www.elsevier.com/locate/gene

Regulation of avian fibroblast growth factor receptor 1 (FGFR-1) gene expression during skeletal muscle differentiation Suketu G. Patel, Phillip E. Funk, Joseph X. DiMario * Finch University of Health Sciences/The Chicago Medical School, Department of Cell Biology and Anatomy, 3333 Green Bay Road, North Chicago, IL 60064, USA Received 7 January 1999; received in revised form 7 June 1999; accepted 24 June 1999; Received by E. Boncinelli

Abstract Myogenic cell proliferation and differentiation are regulated by a fibroblast growth factor (FGF ) signal transduction cascade mediated by a high-affinity fibroblast growth factor receptor (FGFR). Exogenous FGF added to myogenic cultures has a mitogenic effect promoting myoblast proliferation while repressing differentiation. We have examined the regulation of the FGFR-1 gene (cek-1) in avian myogenic cultures by immunocytochemistry and Northern blot analysis. FGFR-1 protein was readily detected in undifferentiated myoblast cultures and was significantly reduced in differentiated muscle fiber cultures. Similarly, FGFR-1 mRNA was 2.5-fold more abundant in myoblast cultures than in differentiated cultures. To define the molecular mechanism regulating FGFR-1 gene expression in proliferating myoblasts and post-mitotic muscle fibers, we have isolated and partially characterized the avian FGFR-1 gene promoter. Transfection of FGFR-1 promoter-chloramphenicol acetyltransferase gene constructs into myogenic cultures identified two regions regulating expression of this gene in myoblasts. A distal region of 2226 bp conferred a high level of expression in myoblasts. This region functioned in an orientation-dependent manner and interacted with a promoter element(s) in a proximal 1058 bp promoter region to direct transcription. Deletion analysis revealed a 78 bp region that confers a high level of cek1 promoter activity in myoblasts. This DNA segment also contains Sp1 binding sites and interacts with a component in myoblast nuclear protein extracts. The proximal promoter region alone demonstrated no activity in directing transcription in either myoblasts or muscle fibers. Using the full-length promoter, gene expression was significantly decreased in differentiated muscle fibers relative to undifferentiated myoblasts indicating that the promoter-reporter gene constructs contain elements regulating expression of the endogenous FGFR-1 gene in both myoblasts and muscle fibers. © 1999 Elsevier Science B.V. All rights reserved. Keywords: Myogenesis; Proliferation; Promoter

1. Introduction Fibroblast growth factors ( FGFs) comprise a family of proteins that regulate growth and differentiation of cells of mesenchymal and neuroectodermal origin. The diverse array of biological activities of FGFs include embryonic mesoderm induction ( Kimelman et al., 1988), embryonic limb outgrowth (Niswander et al., 1993), skeletal muscle regeneration, and repression of myogenic differentiation (DiMario and Strohman, 1988; Abbreviations: AraC, cytosine arabinoside; CAT, chloramphenicol acetyltransferase; FGF, fibroblast growth factor; FGFR, fibroblast growth factor receptor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; MyHC, myosin heavy chain; tk, thymidine kinase. * Corresponding author. Tel.: +1-847-578-8633; fax: +1-847-578-3253. E-mail address: [email protected] (J.X. DiMario)

Allen and Boxhorn, 1989; DiMario et al., 1989; Anderson et al., 1995). Of the known members of the FGF protein family, mRNAs encoding FGF-1, FGF-2, FGF-4, FGF-5, FGF-6, and FGF-8 are present in myotomal regions of developing somites and developing limb muscle masses (Olwin et al., 1994). FGF-2 is present in developing and adult limb musculature and is associated with extracellular matrix components within the muscle fiber basal lamina (DiMario et al., 1989). The biological activities of FGFs are mediated through high-affinity membrane-bound receptor tyrosine kinases ( Ullrich and Schlessinger, 1990). cDNAs encoding four high-affinity FGF receptors, FGFR1-4, have been identified in addition to the high-affinity FGF receptor, FREK, which is expressed in developing avian muscle (Dionne et al., 1990; Marcelle et al., 1994). FGF

0378-1119/99/$ – see front matter © 1999 Elsevier Science B.V. All rights reserved. PII: S0 3 7 8 -1 1 1 9 ( 9 9 ) 0 0 27 8 - 4

266

S.G. Patel et al. / Gene 237 (1999) 265–276

receptors possess structural similarities that identify them as members of a separate class of tyrosine kinase receptors. FGF receptors possess three immunoglobulinlike extracellular domains, an acidic box of eight amino acids between the first and second immunoglobulin domains, a single transmembrane domain, and an intracellular tyrosine kinase domain split by a short 13 amino acid segment. Multiple cDNA variants encoding FGF receptors have also been described and are the products of alternative splicing mechanisms ( Ullrich and Schlessinger, 1990; Givol and Yayon, 1992). Although the function of all cDNA variants is still somewhat unclear, they appear to encode receptors with different binding affinities for FGF ligands ( Werner et al., 1992). The structural similarities between different FGF receptors result in overlapping binding specificities for some individual FGF ligands. However, binding capacities of the FGF receptors for all FGFs are not identical. For example, FGFR-1 and FGFR-2 bind both FGF-1 and FGF-2 with high affinity, whereas FGFR-3 and FGFR-4 preferentially bind FGF-1 (Dionne et al., 1990; Ornitz and Leder, 1992). Binding of FGFs to these high-affinity receptors is facilitated by low-affinity association of FGF with heparan sulfate proteoglycan ( Klagsbrun and Baird, 1991; Ornitz and Leder, 1992). Although FGF-2 has been localized to differentiated muscle fiber basal lamina containing heparan sulfate proteoglycan, FGF binding to its high-affinity receptor is likely to be facilitated by low-affinity association with myoblast cell surface bound heparan sulfate. A lack of cell surface heparan sulfate proteoglycan and inhibition of heparan sulfation block FGF-receptor binding and resulting mitogenic effects ( Yayon et al., 1991). Although the binding specificities of the FGF receptors for members of the FGF protein family are complex and often redundant in vitro, tissue and cell-type restricted expression of receptors and ligands in vivo reduces the complexity of possible FGF-receptor associations. FGFRs have distinct distributions within the developing chicken (Patstone et al., 1993). FGFR-1, which binds FGFs-1 and 2, is abundant in mesenchyme of mouse organ rudiments, limb buds and developing skeletal, cardiac, and smooth muscle. FREK is also restricted to developing muscle and adult muscle satellite cells. FGFR-2 is primarily localized in epithelial cells of developing organs and skin. FGFR-3 is localized to the central nervous system and developing bone, and FGFR-4 is localized to striated muscle and mesodermderived organs. FGF ligand binding to myogenic cell surface receptors causes repression of myogenic differentiation. FGF-2 added in vitro to primary myogenic cells or permanent myogenic cell lines such as MM14 cells represses differentiation in a concentration-dependent manner. Therefore, myogenic differentiation occurs when FGF-2 and other mitogen concentrations decline

(DiMario and Strohman, 1988). Repression of muscle differentiation by FGF-receptor binding appears to be independent of cell proliferation and may be controlled by phosphorylation of transcription factors such as myogenic basic helix–loop–helix factors and/or associated E-proteins regulating muscle-specific gene expression (Li et al., 1992). In concert with myogenic differentiation, FGFR protein levels decline. Cell surface FGFR levels decrease to undetectable levels in differentiating MM14 myoblasts in culture. In vivo, FGFR protein levels also decline as limb muscle differentiates (Olwin and Hauschka, 1990). The role of FGFR-1 during limb and muscle development has been examined in transgenic mice in which FGFR-1 mutant embryos display abnormal limb bud growth and patterning during development (Deng et al., 1997). Introduction of dominant negative mutations demonstrated the importance of FGFR-1 gene expression in the growth of embryonic cardiac myocytes (Mima et al., 1995). Additionally, chick embryos expressing a dominant negative FGFR-1 mutant transgene demonstrated a failure of myogenic cells to migrate from somites into developing limbs with a resulting lack of limb musculature. Myogenic cells instead differentiated prematurely, indicating that normal FGFR-1 expression is critical for delayed myogenic differentiation within the somite and normal myogenic cell migration from the somite, as well as proliferation and differentiation within the limb. Conversely, differentiation was repressed for myogenic cells overexpressing FGFR-1 within the limb (Itoh et al., 1996). The regulation of expression of the FGFR-1 gene is a critical component in the development and growth of skeletal muscles, yet virtually no work has examined its regulation. Other growth factor receptor genes involved in growth and differentiation of mesenchymal cells include the insulin-like growth factor I (IGF-I ) and transforming growth factor b( TGFb) receptor genes. Structural analysis of the promoters of the human and rat IGF-I and human TGFb II receptor genes revealed a lack of consensus TATA and CCAAT sequences in the proximal promoter regions. These genes contained several potential Sp1 binding sites in the proximal promoter regions (Cooke et al., 1991; Humphries et al., 1994). Similarly, the FGFR-3 gene, which is involved in growth of bone at epiphyseal growth plates, also lacks a TATA element and is regulated by Sp1 cisregulatory binding sites (McEwen and Ornitz, 1998). The purpose of the present study was to gain a further understanding of the mechanism regulating expression of the FGFR-1 gene. To do so, we have assessed the expression of the endogenous FGFR-1 gene by immunocytochemistry and RNA analysis. In addition, we have cloned a portion of the avian FGFR-1 gene (cek1) with its promoter. Here, we demonstrate

S.G. Patel et al. / Gene 237 (1999) 265–276

that distal, upstream regulatory elements govern highlevel expression in undifferentiated myoblasts. Furthermore, proximal regulatory elements within the isolated promoter region are involved in the downregulation of the endogenous FGFR-1 gene observed at the protein and RNA levels during terminal myoblast differentiation.

2. Materials and methods 2.1. Myoblast cell culture Fetal ( ED12) chick myoblasts were isolated from leg muscles and cultured in collagen coated dishes as previously described (DiMario and Stockdale, 1995). Cells were cultured in 15% horse serum (Hyclone Labs), 5% chick embryo extract, 1.32 mM CaCl , 1× glutamine 2 (Gibco), and 1× penicillin/streptomycin/ Fungizone (Gibco) in F-10 base medium (Gibco) at 37°C in a 5% CO humidified incubator. Medium was replaced every 2 other day. Some cultures were treated with 10 mg/ml b--arabinofuranoside hydrochloride (AraC ) in culture medium on the third day of culture and then every other day. 2.2. Immunocytochemistry Myogenic cultures were immunostained 1, 4, or 10 days after plating. Cells were fixed according to Itoh et al. (1996) with some modifications. Cultures were washed three times with phosphate-buffered saline (PBS ) and then fixed for 10 min with 3.7% formaldehyde in PBS. Cultures were washed three times with PBS, then incubated in 1% Triton X-100 in PBS for 10 min at room temperature. Cultures were washed as before. Blocking solution (2% horse serum and 2% bovine serum albumin in PBS) was added to the cultures for 1 h at room temperature. An anti-FGFR-1 antibody (Chemicon) and F59, an anti-fast myosin heavy chain (MyHC ) monoclonal antibody (Crow and Stockdale, 1986), were diluted 1:150 and 1:10, respectively, in blocking solution. Cultures were incubated in primary antibodies for 1 h at room temperature and washed as before. Fluorescein-conjugated anti-mouse IgM (mu chain specific) diluted 1:100 in blocking solution and 7 mg/ml biotinylated anti-mouse IgG (gamma chain specific) ( Vector Labs) were added to the cultures for 1 h at room temperature and washed as before. Texas Red streptavidin (20 mg/ml ) in blocking solution was added to the cultures for 1 h at room temperature, and cultures were washed three times. Two drops of 2.5% diazabicyclooctane in glycerol:PBS (9:1) and cover slips were applied before viewing the cultures by epifluorescence.

267

2.3. Northern blot analysis and RNA quantitation Total RNAs were extracted from myogenic cultures ( RNA-Stat-60, Tel-Test, Inc.) and electrophoresed in a 1% agarose/formaldehyde gel. RNA was transferred to nitrocellulose (Schleicher and Schuell, BA-85) by capillary action and baked at 80°C. Blots were prehybridized in 50% formamide, 6× SSPE, 5× Denhardt’s solution, 0.5% SDS, 0.1 mg/ml of salmon sperm DNA at 42°C for 4 h. Blots were probed with a 476 bp SalI–ApaI FGFR-1 cDNA fragment or a 1.2 kb EcoR1 GAPDH DNA fragment. DNA fragments were labeled with a-32P-dCTP (Amersham; 6000 Ci/mmol ) using a random prime labeling kit (Pharmacia). Hybridizations were performed at 42°C overnight in prehybridization solution. Blots were washed four times with 500 ml 0.5× SSPE, 0.1% SDS at 50°C for 45 min. Autoradiograms of GAPDH and FGFR-1 mRNAs were exposed overnight and for 2 weeks, respectively. RNA was quantified by densitometry. RNA loadings were normalized by densitometry readings resulting from hybridization of total RNAs to the GAPDH probe. 2.4. Genomic DNA cloning and sequencing A chicken genomic phage library in LambdaGEM-11 vector (Promega) was used to isolate FGFR-1 genomic DNA. Approximately 3.0×105 plaque-forming units were screened with the 476 bp FGFR-1 cDNA labeled by random priming with a-32P-dCTP as above. Blots were processed as above except blots were washed four times in 500 ml 0.2× SSPE, 0.1% SDS at 58°C for 45 min. Positive plaques were purified, and phage DNA was isolated (Qiagen). Genomic DNA was digested with SacI and subcloned into the Bluescript KS+ phagemid vector (Stratagene). Bacterial colonies containing cloned genomic DNA were screened with an anti-sense oligonucleotide, cek1-1 (5∞ CTTGGTCGGGCAGCGTGGGGGC 3∞) labeled with T4 polynucleotide kinase. Blots were prehybridized in 6× SSC, 5× Denhardt’s solution, 0.5% SDS, 0.1 mg/ml of salmon sperm DNA at 42°C for 4 h. Blots were hybridized overnight at 42°C and then washed four times with 2× SSC, 0.01% sodium pyrophosphate at 45°C for 30 min. Autoradiograms were exposed overnight. Purified DNA was sequenced using dsDNA cycle sequencing (Gibco). All primers were commercially synthesized (Operon). Oligonucleotides cek1-8 (5∞ CTGGGACGGACGGC TGCTTCGG 3∞) and cek1-9 (5∞ GCTCACCTGGTGCTGCTCTGAC 3∞) were used to sequence and identify genomic fragments by hybridization for subcloning into reporter gene constructs. For initial analysis of promoter activity, genomic fragments were subcloned into pCAT3Basic, a promoterless chloramphenicol acetyltransferase (CAT ) reporter plasmid (Promega), using convenient restriction sites — SacI for

268

S.G. Patel et al. / Gene 237 (1999) 265–276

3284FGFR1CAT, SmaI/SacI for 1311FGFR1CAT, SacI/NcoI for 1058FGFR1CAT, and SacI/Bpu1102I for 481FGFR1CAT. Additional promoter fragments were generated using polymerase chain reactions primed with commercially synthesized oligonucleotides. All promoter fragments possessed a 3∞ end at nucleotide +9 relative to the start of transcription (Pasquale and Singer, 1989). Plasmid pBLCAT5 containing the HSV thymidine kinase minimal promoter and CAT gene (tkCAT ) and control plasmid, pBLCAT6, were provided by Dr G. Schu¨tz (Boshart et al., 1992). Correct insertion of cloned DNA fragments was determined by DNA sequencing. A DNA sequence analysis was performed using Genetics Computer Group (GCG) DNA analysis software. 2.5. DNA transfection and reporter gene analysis Myoblast cultures were transfected by calcium-phosphate precipitation approximately 24 h after plating. For all transfections, 10 mg of FGFR1CAT chimeric plasmid and 10 mg of pSVbGAL plasmid in 0.24 M CaCl were 2 slowly added with agitation to an equal volume of 2× high salt buffer (0.28 M NaCl, 50 mM Hepes, 1.4 mM Na HPO , 1.1 mM dextrose, pH 7.4). DNA was precipi2 4 tated for 20 min at room temperature. Cultures were washed with DMEM, and DNA was applied to cultures in 5 ml DMEM. Cultures were incubated for 1 h at 37°C and then washed with DMEM. Cultures were incubated in 15% glycerol in 1× high salt buffer for 1 min at 37°C and then washed with DMEM. Cultures were then fed with the appropriate culture medium. For each experiment, separate dishes were transfected with promoterless pCAT3Basic or tkCAT and constitutively expressed pSV40CAT (Promega). After 24 h and 10 days in culture, cells were washed twice with PBS, and 1 ml of 40 mM Tris, 1 mM EDTA, 150 mM NaCl, pH 7.5 was added to each 100 mm culture plate. Plates were set on ice for 5 min. Cells were scraped from the plates, briefly pelleted, and resuspended in 100 ml of ice-cold 250 mM Tris, pH 7.5. Cells were lysed by three rounds of freeze/thaw in dry ice/ethanol and incubation at 37°C for 5 min each. Cell lysates were spun in an Eppendorf centrifuge for 5 min at 14 000 rpm, and the supernatants were assayed for b-galactosidase and CAT activities. b-Galactosidase activity was determined spectrophotometrically. CAT activity was measured by acetylation of 14C-chloramphenicol (Amersham). Acetylated and non-acetylated products from the reaction were separated by thin-layer chromatography on silica gel plates (Baker). Autoradiograms were exposed overnight. Reaction products were cut from the silica plate and quantitated by liquid scintillation counting. Differences between transfection efficiencies of individual cultures within each experiment were normalized relative to b-galactosidase activities. For a comparison of results between expression of

FGFR1CAT constructs within and between experiments, CAT activities resulting from transfection of the constitutively expressed pSV40CAT were set at a level of 100% expression. CAT activities resulting from transfection of FGFR1CAT constructs were expressed as activities relative to SV40CAT activity. 2.6. Electrophoretic mobility shift assay Nuclear extracts were prepared according to Ausubel et al. (1987). The DNA probe was obtained by PCR amplification and end-labeled with T4 kinase. Binding reactions contained 2 mg of double-stranded poly (dI– dC ), 15 mg of nuclear extract protein, 75 mM HEPES, pH 7.9, 25% glycerol, 50 mM KCl, 1 mM EDTA, 1 M dithiothreitol in a 15 ml reaction volume. The mixture was incubated for 15 min at room temperature, after which the DNA probe (45,000 cpm) was added. The reaction was incubated for an additional 15 min at 4°C, immediately loaded onto a 5% polyacrylamide gel, and run in 0.5× TBE buffer for 2.5 h at 140 V. Gels were dried and exposed to autoradiographic film for 2 days. For competition assays, unlabeled oligonucleotides containing the consensus (ATTCGATCGGGGCGGGGCGAGC ) or mutated Sp1 site (ATTCGATCGGTTCGGGGCGAGC ) (Santa Cruz Biotech) were added in 100 M excess to the binding reactions prior to addition of the nuclear extracts.

3. Results 3.1. FGFR-1 protein immunoreactivity declines with myogenic differentiation Myogenic cultures were immunostained with an FGFR-1 antibody and an anti-fast myosin heavy chain (MyHC ) monoclonal antibody, F59, to determine the pattern of expression of FGFR-1 in undifferentiated myoblasts and differentiated muscle fibers. Myoblasts were isolated from ED12 chick leg muscles and cultured for either 1, 4, or 10 days. Primary avian myogenic cultures begin to differentiate on day 2 of incubation and contain well-formed muscle fibers by day 3. However, avian myoblast differentiation in vitro is not uniform and synchronous. Undifferentiated myoblasts persist in myogenic cultures beyond day 3 and possibly to day 10 of incubation. To distinguish clearly between FGFR-1 gene expression in undifferentiated myoblasts and differentiated muscle fibers in vitro, it was necessary to incubate cells cultured for 10 days in medium supplemented with 10 mg/ml AraC from days 3 to 10 to reduce the number of proliferating mononuclear cells. Addition of AraC to the medium did not affect the time course of myogenic differentiation since it was added after differentiation had begun. Differentiated muscle fibers

S.G. Patel et al. / Gene 237 (1999) 265–276

269

Fig. 1. Immunodetection of FGFR-1 in differentiating myogenic cultures. ED12 chick skeletal muscle myoblasts were cultured for 1 day (A, B), 4 days (C, D), and 10 days ( E, F ). Cultures maintained for 10 days were incubated in medium containing 10 mg/ml of AraC. Cultures were immunostained with an FGFR-1 antibody (A, C, E ) and with an anti-fast MyHC antibody (F59) (B,D,F ). FGFR-1 immunostaining declined from day 1 through day 10 of culture as muscle differentiation proceeded.

were morphologically normal throughout the culture period. Cells immunostained after 1 day in culture showed prominent staining for FGFR-1 in every cell and no staining for MyHC ( Fig. 1A and B). After 4 days in culture, myoblasts had begun to form muscle fibers that immunostained for MyHC. These muscle fibers periodically also immunostained for FGFR-1 but with less intensity than cells after 1 day in culture (Fig. 1C and D). After 10 days in culture, FGFR-1 immunostaining was negligible in muscle fibers expressing MyHC ( Fig. 1E and F ). The same pattern of FGFR-1 immunostaining with respect to cell type was observed in day 10 cultures incubated in medium without AraC. Muscle fibers that immunostained with F59 did not also immunostain with the anti-FGFR-1 antibody, and single, non-differentiated cells did immunostain for

FGFR-1. These results show a reduction of FGFR-1 protein as myogenic cells differentiate and indicate that FGFR-1 gene expression is downregulated during myogenic differentiation. 3.2. FGFR-1 mRNA levels decline as myoblasts differentiate To evaluate the level of FGFR-1 gene expression at the RNA level in undifferentiated myoblast versus differentiated muscle fiber cultures, total RNA was isolated from myogenic cultures 1 and 10 days after plating. To emphasize the differences between cultures of undifferentiated myoblasts versus post-mitotic differentiated muscle fiber cultures, cells maintained for 10 days were cultured in medium containing AraC after

270

S.G. Patel et al. / Gene 237 (1999) 265–276

Fig. 2. Northern blot analysis of FGFR-1 gene expression in undifferentiated myoblasts and differentiated muscle fibers from ED12 chick myogenic cultures. Total RNA was extracted from cultures at day 1 ( lane A) and day 10 ( lane B) of incubation. RNA (15 mg) was probed with an FGFR-1 cDNA fragment (see Section 2). Cultures of undifferentiated myoblasts contained 2.5 times more FGFR-1 RNA than differentiated muscle fiber cultures. Quantitation was normalized to hybridization of GAPDH RNA to a 1.2 kb GAPDH cDNA probe.

initial muscle fiber formation. Equal amounts of RNA, as determined by staining of rRNA in gel loadings, were electrophoresed, blotted, and probed with a 476 bp cDNA fragment encoding amino acids 396–554 within the FGFR-1 juxtamembrane region and part of the first kinase domain (Fig. 2). RNA loadings were also normalized by hybridization of GAPDH RNA to a 1.2 kb GAPDH cDNA fragment. Based on densitometric scans, total RNA isolated from day 1 myogenic cultures contained approximately 2.5 times more FGFR-1 RNA than day 10 differentiated muscle cultures. These results support the immunocytochemical results and indicate that FGFR-1 gene expression is reduced during myogenic differentiation in vitro. 3.3. Isolation and characterization of a chicken FGFR-1 genomic clone A chicken genomic phage library was screened with the FGFR-1 cDNA fragment. One phage plaque hybridized strongly to the cDNA probe, and the phage in this plaque was purified. Purified phage DNA was digested, subcloned, and screened with an anti-sense oligonucleo-

tide (cek1-1) complementary to nucleotides 125–146 of the FGFR-1 mRNA sequence (Pasquale and Singer, 1989). Initially, a 1.2 kb fragment was obtained. This fragment contained 146 bp that encodes exon 1 and 13 bp of the 5∞ end of the first intron. Sequence divergence between this genomic fragment and mRNA sequence occurred at a GT dinucleotide 13 bp from the 3∞ end of the genomic fragment. This fragment also contained 1049 bp of DNA upstream from published mRNA sequence. Analysis of the upstream region proximal to the start of transcription revealed no consensus TATA or CCAAT elements (Fig. 3). Similarly, proximal promoter regions for other growth factor receptor genes have also been shown to be devoid of TATA and CCAAT elements (Cooke et al., 1991; Humphries et al., 1994). Also similar to other growth factor receptor genes, the FGFR-1 proximal promoter has several potential Sp1 binding sites. To obtain additional upstream DNA, phage clone genomic insert DNA was sequenced using an oligonucleotide (cek1–8) near the 5∞ end of the 1.2 kb FGFR-1 fragment. Another oligonucleotide (cek1–9) was generated from sequence 5∞ to the 1.2 kb fragment and was used to identify a recombinant bacterial clone containing a 2.2 kb SacI fragment. This fragment was confirmed by sequencing of phage clone DNA to be contiguous with the proximal 1.2 kb promoter fragment. 3.4. Cloned FGFR-1 full length promoter regulates reporter gene transcription similarly to endogenous FGFR-1 gene promoter A series of deletions of the FGFR-1 5∞ flanking DNA was generated to identify regions that positively direct transcription of the gene in proliferating, undifferentiated myoblasts and to identify regions involved in the down-regulation of the gene in differentiated muscle fibers ( Fig. 4). The 1.2 kb SacI DNA fragment was digested with NcoI and cloned into pCAT3Basic to generate 1058FGFR1CAT. 3284FGFR1CAT contains the additional 2.2 kb distal SacI fragment. Reporter gene constructs, except those with the HSV thymidine kinase minimal promoter, contained FGFR-1 promoter DNA with a 3∞ end at position +9 relative to FGFR-1 mRNA sequence (Pasquale and Singer, 1989).

Fig. 3. Proximal promoter sequence of the chicken FGFR-1 gene. The proximal promoter sequence contains several potential Sp1 regulatory sites (boxes) implicated in the transcriptional regulation of growth factor receptor genes. The arrow indicates the start of published mRNA sequence (Pasquale and Singer, 1989). No obvious TATA or CAAT elements are present.

S.G. Patel et al. / Gene 237 (1999) 265–276

271

Fig. 4. Reporter gene constructs containing 5∞ regions of the FGFR-1 promoter linked to a CAT reporter gene. (A) Four constructs in which the endogenous FGFR-1 full-length promoter is partially deleted. (B) Two constructs in which the distal promoter fragment is in a reverse 5∞-3∞ orientation and the distal fragment is cloned immediately upstream from the CAT gene sequence. (C ) Deletion constructs of the distal promoter fragment coupled to the HSV minimal thymidine kinase promoter and CAT gene. Numbers above each construct indicate the length of the fragment in base pairs. The construct nomenclature used throughout the text is provided to the right of each construct representation.

FGFR-1 reporter constructs and pSVbGAL were cotransfected by calcium-phosphate precipitation into cultures of ED12 chick myoblasts 24 h after plating. After an additional 24 h or 9 days in culture, cells were harvested, and CAT and b-galactosidase activities were determined ( Fig. 5). For cultures maintained for

10 days, cytosine arabinoside (AraC ) at 10 mg/ml was added on day 3 to the culture medium to reduce the number of proliferating, mononucleated cells. Muscle fibers that had begun to form between days 2 and 3 were morphologically normal on day 10 compared to cultures without AraC. Myoblast and muscle fiber cul-

272

S.G. Patel et al. / Gene 237 (1999) 265–276

Fig. 5. Identification of regulatory regions in the FGFR-1 promoter that direct transcription in undifferentiated myoblasts versus differentiated muscle fibers. ED12 chick myoblasts (7×106 cells per 100 mm plate) were transfected 1 day after plating with the different FGFR1CAT constructs described in Fig. 4. CAT assays of myoblast and muscle fiber cultures were performed 24 h and 10 days after plating, respectively. (A) Comparative quantitation of CAT activities resulting from the different FGFR-1 promoter constructs tested. (B) Representative autoradiogram showing the results of the CAT assays performed. CAT activity in myoblast cultures transfected with 1311FGFR1CAT and 3284FGFR1CAT were significantly greater than in muscle fiber cultures and in myoblast cultures transfected with pCAT3Basic ( p=0.0033 and 0.0003, respectively). For each construct, n=7, and the CAT activity values are the means±SEM. Differences in transfection efficiencies were normalized relative to b-galactosidase activity. Reported CAT activities are relative to CAT activity from cultures transfected with pSV40CAT.

tures transfected with 481FGFR1CAT had CAT activities of 1.5±2.0 and 1.7±0.5, respectively, relative to maximal CAT activity (100%) from cultures transfected with pSV40CAT. Similarly, transfection of 1058FGFR1CAT resulted in negligible relative CAT activities of 1.8±1.0 and 1.9±0.8 in undifferentiated

and differentiated cultures. Relative CAT activities from expression of 481FGFR1CAT and 1058FGFR1CAT were not significantly different from background expression resulting from transfection of the promoterless pCAT3Basic vector. Inclusion of an additional 253 bp in 1311FGFR1CAT yielded a slight, approximately twofold, increase in CAT activity in undifferentiated myoblast cultures. Expression of 1311FGFR1CAT in differentiated muscle fibers was not significantly different from expression of pCAT3Basic, 481FGFR1CAT, or 1058FGFR1CAT. Addition of 2226 bp in 3284FGFR1CAT increased the relative CAT activity to 127.4±52.7 in undifferentiated myoblast cultures, an increase of approximately 71 times relative to CAT activity from transfection of 1058FGFR1CAT (Fig. 5). Expression of 3284FGFR1CAT in differentiated muscle fiber cultures was unchanged and remained at basal expression levels. To determine whether the 2226 bp fragment functioned in an orientation-dependent manner, the distal 2226 bp fragment was cloned in a reverse orientation relative to the proximal 1058 bp promoter (Fig. 4). Transfection of 2226rev1058FGFR1CAT resulted in a significant reduction in CAT activity in myoblast cultures compared to 3284FGFR1CAT indicating that the normal 5∞–3∞ orientation of the distal fragment relative to the proximal promoter region is required for full transcriptional activity ( Fig. 5). Expression of 2226rev1058FGFR1CAT in both myoblast and muscle fiber cultures was not significantly different from expression of pCAT3Basic. Since the distal 2226 bp fragment conferred high-level reporter gene expression, it was of interest to determine whether this fragment alone was sufficient for a high level of reporter gene expression. The construct, 2226D1058FGFR1CAT, containing only the distal 2226 bp fragment, did not direct any significant transcription of the reporter gene in undifferentiated or differentiated myogenic cultures. The relative CAT activities were not significantly different from activities from transfection of the promoterless CAT vector. These results indicate that the distal promoter region is necessary, but not sufficient, for significant transcriptional activity. These transfection studies indicate that the cloned full-length FGFR-1 promoter regulates transcription of the reporter CAT gene in a manner very similar to regulation of the FGFR-1 gene in myoblasts and muscle fibers. FGFR-1 promoter activity is high in undifferentiated myoblasts and declines in differentiated muscle fibers. The activity of the promoter in myoblasts and muscle fibers is in agreement with the results of FGFR-1 protein and mRNA levels in myoblasts and muscle fibers detected in Figs. 1 and 2. Furthermore, an interaction between the distal and proximal promoter elements is suggested since both distal and proximal

S.G. Patel et al. / Gene 237 (1999) 265–276

273

3.5. FGFR-1 promoter activity directing expression in myoblasts is located in a defined region near the 3∞ end of the distal promoter fragment

Fig. 6. Replacement of the endogenous FGFR-1 proximal promoter segment with the HSV thymidine kinase minimal promoter increases transcriptional activity in both myoblasts and muscle fibers. The proximal 1058 bp of the FGFR-1 promoter were replaced with the HSV tk minimal promoter and transfected into myoblasts. CAT reporter activity was determined in myoblast and muscle fiber cultures and compared to endogenous full-length FGFR-1 promoter activity and tk minimal promoter activity. CAT activities in both myoblast and muscle fiber cultures were significantly increased relative to CAT activities from both tkCAT and 3284FGFR1CAT ( p=0.005). For each construct, n=5. CAT activities in cultures transfected with 2226FGFR1tkCAT were not significantly different in myoblast versus muscle fiber cultures. Differences in reporter gene expression due to different transfection efficiencies of each construct were normalized to b-galactosidase activities. All CAT activities are expressed relative to CAT activities in cultures transfected with pSV40CAT control plasmid.

elements are required, but neither is sufficient for transcription within myoblasts. To further examine the function of the proximal FGFR-1 promoter fragment in directing transcription, the 1058 bp fragment was replaced with the HSV thymidine kinase minimal promoter in 2226FGFR1tkCAT (Fig. 4). Transfected myoblast cultures yielded CAT activity 215 times greater than activity from the minimal tkCAT promoter itself (Fig. 6). Interestingly, expression of 2226FGFR1tkCAT in muscle fibers was substantially greater than expression resulting from the endogenous promoter contained within 3284FGFR1CAT. Replacement of the proximal 1058 bp of the FGFR-1 promoter sequence with the minimal tk promoter led to significant increases in transcriptional activity in both undifferentiated myoblasts and differentiated muscle fibers. Such increases in transcriptional activities, particularly in muscle fiber cultures, suggest that a negative transcription element(s) is present in the proximal promoter region.

To begin to more narrowly define regions of the distal promoter regulating high levels of FGFR-1 gene expression in myoblasts, a series of deletion constructs were generated coupled to the tk minimal promoter. Transfection of deletion constructs 1175FGFR1tkCAT, 675FGFR1tkCAT, and 331FGFR1tkCAT all yielded CAT activities similar to the full-length distal fragment coupled to the tk promoter in both myoblast and muscle fiber cultures (Fig. 7). All CAT activities were approximately 200 times more than the activity from transfection of the tkCAT construct. Furthermore, since inclusion of 253 bp at the 3∞ end of the distal promoter fragment in 1311FGFR1CAT yielded only a modest twofold increase in transcriptional activity compared to the substantial increase in activity by inclusion of the 3∞ 331 bp, cis-regulatory element(s) involved in the positive regulation of the FGFR-1 gene in myoblasts appear to be located within the intermediate 78 bp. The 78 bp DNA segment contains two potential Sp1 binding sites. To determine whether this segment binds a component(s) in myoblast nuclear extracts, a 117 bp DNA fragment containing the two Sp1 sites was incubated with nuclear extracts and resolved in a polyacrylamide gel (Fig. 8). A specific, shifted band resulted from incubation of the labeled probe with nuclear extract.

Fig. 7. Potential positive transcriptional elements are located in the 3∞ end of the distal promoter fragment. A series of deletions of the distal 2226 bp promoter fragment were cloned upstream of the tk minimal promoter and transfected into myoblasts on day 1 of culture. On days 2 and 10 of culture, CAT activities were determined and compared among the different constructs and tkCAT within myoblasts and muscle fibers. Deletion of the upstream 1895 bp of the distal promoter fragment in the construct 331FGFR1tkCAT maintained high levels of transcriptional activity. Mean values are shown ±SEM (n=5).

274

S.G. Patel et al. / Gene 237 (1999) 265–276

Fig. 8. Distal promoter segment binds Sp1-like factor. (A) Sequence of the distal promoter fragment contained within 331FGFR1tkCAT that significantly increases CAT gene expression in both myoblasts and muscle fibers. This 117 bp segment contains two potential Sp1 binding sites (boxes) based on sequence comparison with transcription factor binding motifs. (B) Polyacrylamide gel showing electrophoretic mobility shift of the 117 bp promoter segment incubated with myoblast nuclear extract (arrow). Competition assays were performed with 100 M excess consensus wild-type Sp1 and mutated Sp1 oligonucleotides.

Formation of the nuclear extract-probe complex was inhibited by addition of 100 M excess unlabeled oligonucleotide with wild-type Sp1 sites, but not by 100 M excess oligonucleotide containing mutated Sp1 sites.

4. Discussion The family of fibroblast growth factor receptors mediates the diverse biological functions of their ligands. Within this FGFR family, FGFR-1 is critically important in the proliferation and differentiation of skeletal muscle myoblasts (Itoh et al., 1996). To begin to analyze the regulation of FGFR-1 gene expression in both proliferating myoblasts and differentiated muscle fibers, the level of expression of FGFR-1 was assessed in myogenic cultures. Cultures were immunostained with an anti-FGFR-1 antibody, and the relative amount of FGFR-1 mRNA in undifferentiated versus differentiated skeletal muscle cells was determined. In addition, the promoter for FGFR-1 was isolated and sequenced. FGFR-1 promoter-reporter gene constructs were transfected into myogenic cultures to identify promoter

regions involved in the regulation of expression in myoblasts and muscle fibers. Expression of the FGFR-1 gene is coordinated with skeletal muscle differentiation. Previous work has shown that proliferating, undifferentiated myoblasts respond to the mitogenic effect of FGFs via FGF receptors ( Ullrich and Schlessinger, 1990; Klagsbrun and Baird, 1991). By immunostaining cultures of myoblasts with an FGFR-1 antibody, we have shown that FGFR-1 protein was abundant in myoblasts cultured for 24 h. As myoblasts differentiated in day 4 cultures, immunostaining of FGFR-1 decreased on the cell surface. Newly differentiated muscle fibers in these cultures still retained some FGFR-1, but the intensity of immunostaining was much reduced. By day 10 in vitro, differentiated muscle fibers exhibited negligible immunostaining for FGFR-1. These results are in agreement with previous receptor-ligand binding studies, which demonstrated decreased FGF binding to differentiated muscle fibers relative to proliferating myoblasts in vitro (Olwin and Hauschka, 1988), and are in general agreement with studies in vivo showing loss of FGFR in embryos and limbs as development proceeds (Olwin and Hauschka, 1990). However,

S.G. Patel et al. / Gene 237 (1999) 265–276

these results also indicate that complete loss of FGFR-1 is not required for myogenic differentiation to occur. The continued presence of reduced amounts of FGFR-1 in newly differentiated muscle fibers in vitro raises at least three partially overlapping possibilities for the relationship between FGFR-1 activity and the dichotomous states of myogenic cell proliferation versus differentiation. The first possibility is that an initial loss of FGFR-1 occurs as a result of myogenic differentiation and continued loss of receptor occurs as muscle fibers mature. Secondly, loss of FGFR-1 may be a prerequisite for myogenic differentiation to occur and that differentiation occurs when FGFR-1 activity falls below a threshold activity above which differentiation is repressed. Lastly, loss of FGFR-1 activity is required for differentiation, and receptors remaining in newly differentiated muscle fibers are uncoupled from intracellular signaling cascades. Studies suggest that loss of FGFR-1 is required for myogenic differentiation and that loss of FGFR-1 is not simply a contemporaneous event associated with differentiation ( Itoh et al., 1996). However, it was not known from these studies whether complete loss of FGFR-1 activity was required for myogenic differentiation. Similar to the decrease in FGFR-1 immunostaining in muscle fibers, FGFR-1 mRNA steady-state levels decreased 2.5-fold with myogenic differentiation. It is interesting that FGFR-1 mRNA was still detectable, albeit in a decreased amount, in day 10 differentiated muscle fiber cultures. This remaining level of FGFR-1 mRNA may simply be long-lived RNA produced by cells at an earlier time in culture. Alternatively, the RNA present may be the product of low-level FGFR-1 gene transcription in differentiated muscle fibers. If so, it is not known whether the level of RNA at day 10 of culture is still declining or has reached a plateau. To analyze the molecular mechanism of FGFR-1 gene expression during myogenic differentiation, we have isolated and sequenced the avian FGFR-1 gene (cek1) promoter. Transfection of FGFR-1 promoter-CAT gene constructs into myogenic cultures revealed regions of the FGFR-1 promoter involved in the regulation of this gene in both myoblasts and muscle fibers. The FGFR-1 gene promoter contains two distinct regions with differing but interactive functions. The proximal region functions in two capacities. It is necessary for gene expression in myoblasts, but is also responsible for reduced gene expression in muscle fibers. The requirement for the proximal 1058 bp segment for promoter activity in myoblasts and the inability of this segment alone to direct significant gene expression suggest that it does not function simply as a minimal promoter segment. Its inability to confer any significant level of reporter gene expression differed from that observed by transfection of the HSV thymidine kinase promoter, which resulted

275

in minimal, but detectable, levels of CAT activity. This reduced basal transcriptional activity is likely due to the presence of negative transcription elements. Analysis of the proximal promoter DNA sequence revealed no consensus TATA or CCAAT elements. Identification of the promoter sequences, if any, that functionally substitute for the TATA and CCAAT elements in the FGFR-1 gene is currently being investigated. It is possible that the multiple Sp1 consensus binding sites located in the proximal region may function in these capacities as in other growth factor receptor genes (Cooke et al., 1991; Humphries et al., 1994). The distal 2226 bp region directs transcription positively in myoblasts. Its general activity was unchanged in myoblasts whether it was coupled to the endogenous FGFR-1 proximal promoter region or to the thymidine kinase minimal promoter. The distal promoter fragments also directed gene transcription in differentiated muscle fibers when coupled to the thymidine kinase promoter. Therefore, the distal promoter region, in conjunction with the proximal 1058 bp promoter, functions as a positive transcription element in both myoblasts and muscle fibers. The distal promoter fragment interacts with a component in myoblast nuclear extracts that bind to the Sp1 consensus site. This region contains two potential Sp1 sites, and studies are underway to determine whether one or both sites interact with Sp1-like protein. It is also not yet known which member of the Sp1 transcription factor family binds to this region of the promoter. Sp1, Sp3, and Sp4 have similar binding specificities, and experiments are currently underway to determine which of these factors are present in the nuclear extracts and which bind to the FGFR-1 distal promoter region. The positive regulatory function of Sp1 in the expression of other growth factor receptor genes makes Sp1 a likely candidate. In-vitro and in-vivo studies suggest that FGF signaling via cell surface FGF receptors provides critical regulation in the processes of myogenic cell proliferation as well as differentiation. Therefore, regulation of transcription of the FGFR-1 gene can also provide an important means by which myogenic cells remain proliferative or commit toward terminal differentiation. It is anticipated that continued elucidation of the cis-elements and associated factors will provide an important insight into the mechanisms regulating these processes.

Acknowledgement We thank Dr Gu¨nther Schu¨tz for generously providing pBLCAT5 and pBLCAT6.

276

S.G. Patel et al. / Gene 237 (1999) 265–276

References Allen, R.E., Boxhorn, L.K., 1989. Regulation of skeletal muscle satellite cell proliferation and differentiation by transforming growth factor -beta, insulin-like growth factor I and fibroblast growth factor. J. Cell. Physiol. 138, 311–315. Anderson, J.E., Mitchell, C.M., McGeachie, J.K., Grounds, M.D., 1995. The time course of basic fibroblast growth factor expression in crush-injured skeletal muscles of SJL/J and BALB/c mice. Exp. Cell Res. 216, 325–334. Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.M., Seidman, J.G., Smith, J.A., Struhl, K., 1987. Current Protocols in Molecular Biology. Greene Publishing Associates & Wiley Interscience, New York. Boshart, M., Klu¨ppel, A., Schmidt, A., Schu¨tz, G., Luckow, B., 1992. Reporter constructs with low background activity utilizing the cat gene. Gene 110, 129–130. Cooke, D.W., Bankert, L.A., Roberts Jr., C.T., LeRoith, D., Casella, S.J., 1991. Analysis of the human type I insulin-like growth factor receptor promoter region. Biochem. Biophys. Res. Commun. 177, 1113–1120. Crow, M.T., Stockdale, F.E., 1986. Myosin expression and specialization among the earliest muscle fibers of the developing avian limb. Dev. Biol. 113, 238–254. Deng, C., Bedford, M., Li, C., Xu, X., Yang, X., Dunmore, J., Leder, P., 1997. Fibroblast growth factor receptor-1 ( FGFR-1) is essential for normal neural tube and limb development. Dev. Biol. 185, 42–54. DiMario, J., Strohman, R.C., 1988. Satellite cells from dystrophic (mdx) mouse muscle are stimulated by fibroblast growth factor in vitro. Differentiation 39, 42–49. DiMario, J., Buffinger, N., Yamada, S., Strohman, R.C., 1989. Fibroblast growth factor in the extracellular matrix of dystrophic (mdx) mouse muscle. Science 244, 688–690. DiMario, J.X., Stockdale, F.E., 1995. Differences in the developmental fate of cultured and noncultured myoblasts when transplanted into embryonic limbs. Exp. Cell Res. 216, 431–442. Dionne, C.A., Crumley, G., Bellot, F., Kaplow, J.M., Scartoss, G., Ruta, M., Burgess, W.H., Jaye, M., Schlessinger, J., 1990. Cloning and expression of two distinct high-affinity receptors cross-reacting with acidic and basic fibroblast growth factors. EMBO J. 9, 2685–2692. Givol, D., Yayon, A., 1992. Complexity of FGF receptors: genetic basis for structural diversity and functional specificity. FASEB J. 6, 3362–3369. Humphries, D.E., Bloom, B.B., Fine, A., Goldstein, R.H., 1994. Structure and expression of the promoter for the human type II transforming growth factor-b receptor. Biochem. Biophys. Res. Commun. 203, 1020–1027. Itoh, N., Mima, T., Mikawa, T., 1996. Loss of fibroblast growth factor receptors is necessary for terminal differentiation of embryonic limb muscle. Development 122, 291–300.

Kimelman, D., Abraham, J.A., Haaparanta, T., Palisi, T.M., Kirschner, M.W., 1988. The presence of fibroblast growth factor in the frog egg: Its role as a natural mesoderm inducer. Science 242, 1053–1056. Klagsbrun, M., Baird, A., 1991. A dual receptor system is required for basic fibroblast growth factor activity. Cell 67, 229–231. Li, L., Zhou, J., James, G., Heller-Harrison, R., Czech, M.P., Olson, E.N., 1992. FGF inactivates myogenic helix–loop–helix proteins through phosphorylation of a conserved protein kinase C site in their DNA-binding domains. Cell 71, 1181–1194. McEwen, D.G., Ornitz, D.M., 1998. Regulation of the fibroblast growth factor receptor 3 promoter and intron I enhancer by Sp1 family transcription factors. J. Biol. Chem. 273, 5349–5357. Marcelle, C., Eichmann, A., Halevy, O., Bre´ant, C., Le Douarin, N.M., 1994. Distinct developmental expression of a new avian fibroblast growth factor receptor. Development 120, 683–694. Mima, T., Ueno, H., Fischman, D.A., Williams, L.T., Mikawa, T., 1995. Fibroblast growth factor receptor is required for in vivo cardiac myocyte proliferation at early embryonic stages of heart development. Proc. Natl. Acad. Sci. USA 92, 467–471. Niswander, L., Tickle, C., Vogel, A., Booth, I., Martin, G.R., 1993. FGF-4 replaces the apical ectodermal ridge and directs outgrowth and patterning of the limb. Cell 75, 579–587. Olwin, B.B., Hauschka, S.D., 1988. Cell surface fibroblast growth factor and epidermal growth factor receptors are permanently lost during skeletal muscle terminal differentiation in culture. J. Cell Biol. 107, 761–769. Olwin, B.B., Hauschka, S.D., 1990. Fibroblast growth factor receptor levels decrease during chick embryogenesis. J. Cell Biol. 110, 503–509. Olwin, B.B., Hannon, K., Kudla, A.J., 1994. Are fibroblast growth factors regulators of myogenesis in vivo? Prog. Growth Factor Res. 5, 145–158. Ornitz, D., Leder, P., 1992. Ligand specificity and heparin dependence of fibroblast growth factor receptors 1 and 3. J. Biol. Chem. 267, 16305–16311. Pasquale, E.B., Singer, S.J., 1989. Identification of a developmentally regulated protein tyrosine kinase using a novel general method for the detection of tyrosine kinases. Proc. Natl. Acad. Sci. USA 86, 5449–5453. Patstone, G., Pasquale, E.B., Maher, P.A., 1993. Different members of the fibroblast growth factor receptor family are specific to distinct cell types in the developing chicken embryo. Dev. Biol. 155, 107–123. Ullrich, A., Schlessinger, J., 1990. Signal transduction by receptors with tyrosine kinase activity. Cell 61, 203–212. Werner, S., Duan, D.-S., de Vries, C., Paters, K., Johnson, D., Williams, L., 1992. Differential splicing in the extracellular region of fibroblast growth factor receptor 1 generates receptor variants with different ligand-binding capacities. Mol. Cell. Biol. 12, 82–88. Yayon, A., Klagsbrun, M., Esko, J.D., Leder, P., Ornitz, D.M., 1991. Cell surface, heparin-like molecules are required for binding of basic fibroblast growth factor to its high affinity receptor. Cell 64, 841–848.