SQSTM1-mediated sequestration and degradation

Cellular Signalling 26 (2014) 2470–2480

Contents lists available at ScienceDirect

Cellular Signalling journal homepage: www.elsevier.com/locate/cellsig

Regulation of C1-Ten protein tyrosine phosphatase by p62/SQSTM1-mediated sequestration and degradation Ara Koh a, Dohyun Park a, Heeyoon Jeong a, Jiyoun Lee a, Mi Nam Lee a, Pann-Ghill Suh b, Sung Ho Ryu a,⁎ a b

Department of Life Sciences, Pohang University of Science and Technology, Pohang 790-784, South Korea School of Nano-Biotechnology and Chemical Engineering, Ulsan National Institute of Science and Technology, Ulsan 689-798, South Korea

a r t i c l e

i n f o

Article history: Received 21 May 2014 Received in revised form 8 July 2014 Accepted 28 July 2014 Available online 4 August 2014 Keywords: C1-Ten Tensin2 p62 Sequestosome Degradation

a b s t r a c t C1-Ten is a member of the tensin family of focal adhesion molecules but recent studies suggest it plays a more active role in many biological processes because of its potential association with diabetes and cancers. However, relatively little is known about the regulation of C1-Ten, such as changes in its protein level or cellular localization. The cellular localization of C1-Ten is unique because it is expressed in cytoplasmic puncta but nothing is known about these puncta. Here, we show that p62 sequestrates C1-Ten into puncta, making C1-Ten diffuse into the cytoplasm upon p62 depletion. More importantly, p62-mediated C1-Ten sequestration promoted C1-Ten ubiquitination and proteasomal degradation. p62-mediated protein reduction was specific to C1-Ten, and not other tensins such as tensin1 and tensin3. Thus, our results link cellular localization of C1-Ten to an off-switch site for C1-Ten. Additionally, p62 expression increased but C1-Ten protein decreased during muscle differentiation, supporting a role for p62 as a physiological regulator of C1-Ten. © 2014 Elsevier Inc. All rights reserved.

1. Introduction C1-Ten (also known as Tensin2 or TENC1) is a member of the tensin family, which includes tensin1, tensin3, and cten. Roles for tensins have been suggested in cytoskeletal reorganization because of the actin binding domain/focal adhesion-binding region in tensin1, the most extensively studied tensin family member [1]. All four tensins contain C-terminal Src homology 2 (SH2) and phosphotyrosine binding (PTB) domains. Beyond their passive role as focal adhesion molecules, the tensin family has gained attention as a biological regulator for deleted in liver cancer 1 (DLC-1) through either or both of the SH2 and PTB domains regulating tumor suppressor function of DLC-1 [2–5]. Additionally, C1-Ten possesses a C1 domain and a protein tyrosine phosphatase (PTPase) domain, similar to PTEN [6]. We showed recently that C1-Ten has an active catalytic cysteine residue and is a relevant PTPase for insulin receptor substrate-1 (IRS-1) [7], suggesting a role for C1-Ten as an active enzyme. Because of its connection with DLC-1 and IRS-1, C1-Ten has the potential to be involved in catabolic disorders such as cancers and diabetes [2–5,7]. Gene levels of C1-Ten, and all other tensins, are downregulated in human kidney cancers [8] and those of C1-Ten increase in diabetic skeletal muscle undergoing atrophy [7]. However, almost no ⁎ Corresponding author at: Department of Life Sciences, Pohang University of Science and Technology (POSTECH), Pohang 790-784, South Korea. Tel.: +82 54 279 2292; fax: +82 54 279 0645. E-mail address: [email protected] (S.H. Ryu).

http://dx.doi.org/10.1016/j.cellsig.2014.07.033 0898-6568/© 2014 Elsevier Inc. All rights reserved.

information is available regarding the regulation of C1-Ten proteins at the post-translational level. We previously showed that C1-Ten protein levels decrease during myogenesis in vitro and during postnatal development of skeletal muscle in vivo [7]. However, the regulatory mechanism by which C1-Ten protein levels change under these physiological conditions remains unknown. Signaling adaptor p62 (also known as sequestosome-1; SQSTM1) has multiple binding domains for proteins involved in important biological processes [9–11]. The N-terminal PB1 (Phox/Bem 1p) domain interacts with components of the proteasomal system and the ubiquitinassociated domain (UBA) binds ubiquitin-conjugated proteins in a non-covalent manner, supporting a role for p62 as a cargo receptor by shuttling some ubiquitin-conjugated proteins for proteasomal degradation [12,13]. p62 is also thought to target polyubiquitinated proteins to autophagosomes for degradation by autophagy via a direct interaction with LC3 through its 22-amino acid sequence, the LC3 interacting region [14]. Thus, p62 plays important roles in the ubiquitin-proteasome system and autophagy-lysosome pathway, two major protein degradation systems in eukaryotes [15]. p62 acts as a signaling hub regulating NF-κB, mTOR, and the mitogen activated protein kinase pathways [16]. p62 is implicated in tumorigenesis and its increased accumulation has been reported in several types of cancers [17–19]. Global ablation of p62 in mice results in late-onset obesity, systemic glucose intolerance, and insulin resistance [11]. Additionally, defects in IRS-1/Akt signaling are observed in both fat and muscle, but not in the liver, in p62-deficient mice [11], suggesting a role for p62 in insulin signaling in fat and muscle. Thus, changes in the p62 level

A. Koh et al. / Cellular Signalling 26 (2014) 2470–2480

may be important in the pathogenesis of cancers and diabetes. However, relatively little is known about p62 expression changes during physiological processes such as myogenesis. In this study, we demonstrated that p62 sequestrates and degrades C1-Ten via the ubiquitin-proteasomal degradation pathway. We also show that p62 expression increases during muscle differentiation in vitro and in vivo, and an inverse correlation was observed with C1-Ten protein levels. Depletion of p62 not only regulated C1Ten protein levels affecting Akt/S6K1 signaling, but also affected C1-Ten localization. These results suggest that p62 is a physiological inhibitor of C1-Ten PTPase, determining the biological function of C1-Ten. 2. Materials and methods

2471

3′. GFP-p62 constructs were provided by Dr. Sung Ouk Kim (University of Western Ontario, London, ON, Canada) [20]. HA-PrxI and HA-PrxII were gifts from Dr. Nicholas H. Heintz (University of Vermont College of Medicine, Burlington, VT, USA). pGFP tensin1 was a gift from Dr. Kenneth M. Yamada (National Institute of Dental and Craniofacial Research, Bethesda, MD, USA), and pEGFP tensin3 was provided by Dr. Shawn Shun-Cheng Li (University of Western Ontario, London, ON, Canada). 2.4. Cell lysis Crushed, snap-frozen tissues, and harvested cells were lysed in buffer A containing 50 mM Tris–HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1 mM Na3VO4, 20 mM NaF, 10 mM glycerophosphate, 1 mM PMSF, 10% glycerol, 1% TX-100, and protease inhibitor cocktail.

2.1. Antibodies and reagents 2.5. Preparation of protein extracts for detecting ubiquitination Anti-phospho-Akt (S473, T308), anti-phospho-S6K1 (T389), antiphospho-IRS-1 (Y612), and anti-p62 antibodies were purchased from Cell Signaling Technology (Danvers, MA, USA). Anti-p62 and antiPTEN were acquired from Santa Cruz Biotechnology (Santa Cruz CA, USA). Anti-Tenc1 antibodies were obtained from GeneTex Inc. (Irvine, CA, USA) and Cell Signaling Technology and used at a 1:100 dilution. Anti-IRS-1 and anti-GFP antibodies were from Millipore (Billerica, MA, USA). MG132, bafilomycin A1, and hydrogen peroxide were purchased from Sigma Chemical Co (St. Louis, MO, USA). Horseradish peroxidase-conjugated goat anti-mouse IgA + IgM + IgG and peroxidase-conjugated goat anti-rabbit IgG were obtained from Kierkegaard and Perry Laboratories (Gaithersburg, MD, USA). The Enhanced Chemiluminescence kit was from Amersham Biosciences International (Buckinghamshire, UK).

Cells were lysed with 150 μL buffer A containing 2% SDS, and the cell lysates were transferred to a 1.5-mL microcentrifuge tube. The tube was placed on a hot plate immediately at 95 °C for 10 min. The cell lysates were sonicated and 850 μL of buffer A without SDS was added. The samples were incubated at 4 °C for 30 min, followed by centrifugation (14,000 rpm, 20 min). The supernatant was used for further experiments. 2.6. Immunoprecipitaton Aliquots (0.5–1 mg) of cell lysates were incubated with 2 μg of the antibodies for 4 h at 4 °C under gentle agitation. Immunocomplexes were collected with Protein A-Sepharose beads.

2.2. Cell culture

2.7. p62 knockdown experiments

HEK293, HeLa cells and L6 myoblasts were grown and maintained in high-glucose Dulbecco's modified Eagle's medium (DMEM) or lowglucose α-MEM with 10% (v/v) fetal bovine serum (FBS). As the ability of myoblast fusion into myotubes declines with passage, cells were used at low passages (≤6) for all experiments. The medium was switched to α-MEM with 2% (v/v) FBS for differentiation and was replaced every 2 days.

p62 siRNA targeting human p62 (GCATTGAAGTTGATATCGAT) was used based on reference [21]. For targeting rat p62, GAUUUG UGAUGGUUGCAAU (Bioneer, Daejeon, South Korea) was introduced to L6 myotubes using the DeliverX Plus siRNA Transfection kit (Panomics, Freemont, CA, USA) according to the manufacturer's instructions. 2.8. Quantitative real-time PCR analysis

2.3. Plasmids The full-length coding region of human C1-Ten (Tenc1 isoform 2, KIAA1075) cDNA was a gift from Kazusa DNA Research Institute (Chiba, Japan). Flag C1-en WT and Flag-C1-Ten C231S were generated as described previously [7]. Flag-C1-Ten WT was subcloned into the EcoRI/SacII site of pEGFP-C1 (Clontech, Palo Alto, CA, USA) for the green fluorescent protein (GFP) constructs using the following primers: 5′-TAGAATTCAATGAAGTCCAGCGGCCCTGTGGAG-3′ and 5′-TCCCCGCG GGGTCATTTTCTCTGGCCCAGTAG-3′. The Flag C1-Ten K172A mutant was generated with a QuickChange Site-directed Mutagenesis kit (Stratagene, La Jolla, CA, USA) using the following primers: 5′-AAGCAC CGGGACGCATACCTGCTCTTC-3′ and 5′-GAAGAGCAGGTATGCGTCCCGG TGCTT-3′. Flag C1-Ten dC1, 1–710, 720–1409, or dSH2dPTB was subcloned into the EcoRI/XbaI site of the pFlag-CMV2 vector using the following primers, respectively: 5′-TAGAATTCAATGGAGCGGCGCTGG GACTTA-3′ and 5′-GCTCTAGATCATTTTCTCTGGCCCAGTAGAAC-3′, 5′TAGAATTCAATGAAGTCCAGCGGCCCTGTGGAG-3′ and 5′-GCTCTAGAGC TCACTCCAGCCGCAGTCCATACAA-3′, 5′-TAGAATTCAGAGGCTGGCAAGC CTCTCCTGCAC-3′ and 5′-GCTCTAGATCATTTTCTCTGGCCCAGTAGAAC3′, or 5′-TAGAATTCAATGAAGTCCAGCGGCCCTGTGGAG-3′ and 5′-GCTC TAGAGCTCAGAACTTGGATGTATCCTGGAC-3′. mCherry-C1-Ten WT was generated using the following primers: 5′-CGGAATTCCATGAAGTCCAG CGGCCCTGTG-3′ and 5′-TCCCCGCGGGGATCATTT TCTCTGGCCCAGTAG-

Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), according to the manufacturer's protocol. Total RNA was reverse transcribed using the ImProm-II RT System (Promega, Madison, WI, USA), according to the manufacturer's instructions. The MyiQ Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA) was used for detection and quantification. PCR was performed using SYBR Premix Ex Taq II (Takara Bio, Shiga, Japan). PCR was carried out in a final volume of 20 μL using 0.5 μM of each primer (listed below), cDNA, and 10 μL of the supplied enzyme mixture, containing the DNA double-strand-specific SYBR Green I dye for detecting PCR products. PCR was performed with a 3-min preincubation at 95 °C, followed by 40 cycles of 15 s at 95 °C, and 30 s at 60 °C. PCR products were verified by melting curve analysis and agarose gel electrophoresis. The sequences of the primers (intron-spanning primers) were as follows: GAPDH: 5′-CCATGACAACTTTGGCATTG-3′ and 5′-CCTGCTTCACCACC TTCTTG-3′ C1-Ten: 5′-TCTCTTCCTGCACTATGTGTTTGTA-3′ and 5′-GTAGACCA GCTGCATAGACTGGTAG-3′ p62: 5′-TCTGACAGAGCAGATGAAGAAGATA-3′ and 5′-GTCCACTTCT TTAGAAGACAAATGC-3′.

2472

A. Koh et al. / Cellular Signalling 26 (2014) 2470–2480

2.9. Immunofluorescence

3. Results

prevalent regulatory mechanisms for PTPases is ROS-induced inactivation of PTPases [22–24]. Unexpectedly, we observed rapid reductions in both overexpressed and endogenous C1-Ten upon H2O2 stimulation (Fig. 1A and B). Because this reduction was very rapid and there was a recovery of C1-Ten protein beginning at 15 min treatment with H2O2 in the case of HEK293 cells, we determined whether C1-Ten had moved to another cellular fraction. Thus, cells were lysed with 1% Triton X-100 detergent-based buffer and separated into detergent-soluble (Sup) and detergent-insoluble (Pel) fractions. C1-Ten was present in both detergent-soluble and insoluble fractions in HEK293 and HeLa cells (Fig. 1C and D). When overexpressed or when endogenous C1-Ten disappeared from the Sup by ROS or ROS-inducing arsenite, there was an increase of C1-Ten in the Pel (Fig. 1C and D). However, PTEN, which has a similar PTPase domain as C1-Ten [6], did not show any decrease in their expression following arsenite treatment (Fig. 1D).

3.1. C1-Ten is rapidly sequestered into the Triton X-insoluble fraction

3.2. C1-Ten is a protein with aggresome-like characters

We tested the effects of reactive oxygen species (ROS) on C1-Ten to understand the regulation mechanism of C1-Ten PTPase. One of the

Aggregates or aggresomes are Triton X-100-insoluble [25,26]; thus, we assessed whether C1-Ten had aggresome-like characteristics. We

Cells were grown on coverslips coated with poly-L-lysine, fixed with 4% paraformaldehyde for 15 min at 37 °C and then washed extensively with PBS. Coverslips were mounted with Cytoseal mounting medium onto glass slides and analyzed using a confocal microscope (LSM-510 Meta; Carl Zeiss, Jena, Germany). 2.10. Statistical analysis Data are presented as means ± SEM. Comparisons between two groups were made using unpaired two-tailed Student's t-tests. p Values b0.05 were considered significant. *p b 0.05, **p b 0.01, ***p b 0.001.

A

B

HeLa Cell

Flag C1-Ten WT 1 mM H2O2 (min) 0 0.5 2 15 60

1 mM H2O2 (min) 0

2 15 60 C1-Ten

Flag C1-Ten

Actin Actin 100

100 80

C1-Ten/Actin

Flag C1-Ten/Actin

120 120

**

60 40

60

NT

0 1 mM H2O2

2 min

D

C 1 mM H2O2 (min)

**

40 20

20

0 1 mM H2O2

80

1 hr 2

60

60 min

HeLa Cell

Flag C1-Ten 0

NT

-

Flag C1-Ten (Sup)

C1-Ten (Sup)

Flag C1-Ten (pel)

C1-Ten (Pel)

Actin (Sup) Actin (Pel)

PTEN (Sup) Actin (Sup) Actin (Pel)

Fig. 1. Rapid sequestration of C1-Ten upon ROS stimulation. (A) Effects of ROS on exogenously expressed Flag C1-Ten in HEK293 cells. Bottom panel, quantified protein levels of Flag C1-Ten, relative to those of actin (n = 5). (B) Western blot showing the effects of ROS on endogenous C1-Ten in HeLa cells. Bottom panel, quantified protein levels of C1-Ten, relative to those of actin (n = 3). (C) Rapid sequestration of C1-Ten into TX-insoluble fractions on ROS exposure. HEK293 cells expressing Flag C1-Ten treated with 1 mM hydrogen peroxide for the indicated times were separated into TX-soluble (Sup) or -insoluble (Pel) parts. (D) Sequestration of C1-Ten, but not PTEN by ROS-inducing arsenite treatment. Cell lysates were separated into Sup or Pel parts after incubating HeLa cells with 500 mM arsenite for 1 h.

A. Koh et al. / Cellular Signalling 26 (2014) 2470–2480

first determined the localization of GFP-tagged C1-Ten under growing conditions. Interestingly, C1-Ten formed various structures. The major portion of C1-Ten formed punctate structures; the size of each puncta was smaller or larger than 3 μm in diameter (Fig. 2A and C). Some portion of the C1-Ten seemed to be “dispersed into cloud-like structures” (named DCLSs) throughout the cytosol (Fig. 2A and C). These dotted patterns of C1-Ten were also observed with endogenous C1-Ten [27, 28]. Although C1-Ten was first reported as a focal adhesion molecule, like Tensin1, we and others did not observe significant colocalization with F-actin (Fig. S1, [27]). Moreover, C1-Ten did not colocalize with the endoplasmic reticulum or endosomes [27]. Thus, there is a lack of information about these C1-Ten dots or aggregates. To test whether C1-Ten had aggresome-like characteristics, we used MG132 and trichostatin A (TSA) to make equilibrium shifts. Inhibition of the ubiquitin-proteasome system with MG132 accelerates and induces

2473

mature aggresome formation [26,29]. In contrast, inhibiting HDAC6 with TSA, a broad-spectrum inhibitor of HDACs, suppresses aggresome formation because HDAC6 plays an essential role in this process [30]. Incubating HEK293 cells with MG132 caused a shift of C1-Ten puncta into mature aggresomes (Fig. 2B and C). However, most of the C1-Ten existed as DCLS in the presence of TSA (Fig. 2B and C). To corroborate these observed changes in C1-Ten subcellular distribution with those in biochemical fractions, we separated C1-Ten-expressing cell lysates into Sup and Pel parts. MG132 treatment caused sequestration of overexpressed or endogenous C1-Ten in the Pel fraction (Fig. 2D and E). In contrast, C1-Ten was released from sequestration in the Pel and appeared in the Sup after TSA treatment, suggesting that C1-Ten DCLS might be a highly soluble form of C1-Ten (Fig. 2D). Unlike other proteins with aggresome-like characteristics, C1-Ten was expressed primarily in cytosolic speckles or aggregates. p62 is

A

B Dispersed into Cloud-Like Structures (DCLS)

small dots (< 3 μm)

Aggregates (> 3 μm)

5 μM MG132 15 hr

1 μM TSA 15 hr

C

D

E

HeLa cell

Flag C1-Ten WT ** 100

***

***

< 3 μm > 3 μm DCLS

Relative %

80 60 ** 40

12 hr

12 hr

Flag C1-Ten (Sup)

C1-Ten (Sup) Non-specific C1-Ten (Pel)

Flag C1-Ten (pel) p62 (Sup)

n.s.

p62 (Sup)

20 0

-

**

-

p62 (Pel) p62 (Pel) Actin (Sup) Actin (Pel)

Fig. 2. Aggresome-like characteristics of C1-Ten. (A) Patterns of C1-Ten localization under growing condition. HEK293 cells were transfected with GFP C1-Ten plasmids, grown for 48 h, and fixed with 4% paraformaldehyde in PBS for 20 min. Images were obtained by confocal microscopy (LSM-510 Meta; Carl Zeiss, Jena, Germany). Scale bar, 20 μm. The diameter of the largest puncta or foci in each cell was measured, and cells were categorized as DCLS, small dots, or aggregates depending on diameter. (B) Equilibrium shifts in C1-Ten. HEK293 cells expressing GFP C1-Ten were incubated with 5 μM MG132 or 1 μM TSA for 15 h, respectively. Scale bar, 20 μm. (C) Quantification for the distribution of C1-Ten localization patterns. The diameter of the largest puncta/cell was measured and grouped into cells having puncta above or below 3-μm in diameter. Cells having C1-Ten “dispersed in cloud-like structures” (DCLSs) were also measured. Over 100 cells were counted and diameters were calculated with ImageJ software (n = 3). Changes in biochemical properties of ectopically expressed C1-Ten (D) and endogenous C1-Ten (E) by equilibrium shifts.

2474

A. Koh et al. / Cellular Signalling 26 (2014) 2470–2480

expressed in cytosolic speckles or aggregates and resides in aggresomelike structures/sequestosomes [9]. Indeed, p62 was also sequestered in the Pel fractions upon proteasome inhibition, as C1-Ten did (Fig. 2D and E), suggesting a potential relationship between p62 and C1-Ten. 3.3. C1-Ten interacts with p62 As C1-Ten and p62 had similar biochemical properties (Fig. 2), we determined whether they could interact with each other to gain some mechanistic insight into the role of p62 with regard to C1-Ten. Ectopically expressed C1-Ten bound to overexpressed or endogenous p62 (Fig. 3A and B). Next, we determined which p62 domain was responsible for mediating the interaction. We used three GFP-tagged fragments of p62: PB1 (Phox/Bem1p), TRAF6 (TRAF6-binding domain), and UBA (ubiquitin-associated domain). Immunoprecipitation experiments with Flag-tagged C1-Ten demonstrated that the PB1 domain of p62 interacted with C1-Ten (Fig. 3C). The C1-Ten-p62 interaction seemed to be important in sequestrating C1-Ten to the Pel fraction because the kinetics of p62-C1-Ten binding correlated well with that of C1-Ten reduction in the detergent-soluble parts after ROS stimulation (Fig. 3B). A recent report demonstrated that p62 participates in the insulin signaling pathway by binding to IRS-1 [31]. The interaction between p62

A

Flag C1-Ten WT

Flag C1-Ten WT

- ++

- ++

GFP p62

and IRS-1 also involves the PB1 domain of p62 [31]. Because C1-Ten also affects insulin signaling through IRS-1 [7], we assessed whether C1-Ten affected the p62-IRS-1 interaction. As reported previously, we observed the interaction between p62 and IRS-1 (Fig. 3D). However, this interaction was almost completely abolished by C1-Ten (Fig. 3D), supporting that C1-Ten binds to the PB1 domain of p62. Previous reports suggested that p62-IRS-1 binding is critical for Akt activation [31]. Interestingly, a catalytically inactive C1-Ten C231S (CS) mutant also disrupted the p62-IRS-1 interaction despite the increase in Akt phosphorylation (Fig. 3D), suggesting that the status of C1-Ten, rather than the p62-IRS-1 interaction itself, might be important for Akt signaling. 3.4. p62 sequestrates C1-Ten into sequestosomes In that both p62 and C1-Ten are visible as puncta and bind together, we monitored their cellular localization. Despite their interaction under basal conditions, very few populations of cells co-expressing RFP C1-Ten and GFP p62 showed co-localization of these two proteins (Fig. 4A, upper panel). However, in most cases, RFP C1-Ten and GFP p62 were located in the same structures and next to each other (Fig. 4A, middle and bottom panels). This was also observed with mCherry C1-Ten

B 1mM H2O2 (min)

GFP p62 p62 Heavy chain

Flag C1-Ten WT 0

2 15 60

I.P.: Flag Flag

p62

p62 Heavy chain

p62

TCL

Flag

Flag

IgG

p62/ I.P.ed Flag C1-Ten

Flag C1-Ten

Actin

I.P. TCL

C

D

vec

I.P.: Flag

GFP p62

Flag IRS-1 GFP p62 YFP C1-Ten

Flag C1-Ten WT

-

*

1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0

+ + +

-

WT CS

GFP p62 Flag IRS-1

GFP I.P.: Flag GFP p62 TCL

Flag C1-Ten

YFP C1-Ten pAkt (T308)

TCL

GFP Actin

Fig. 3. C1-Ten-p62 interaction via p62 PB1 domain. (A) Immunoblots showing interaction between C1-Ten and p62. HEK293 cells expressing Flag C1-Ten WT and GFP p62 were subjected to immunoprecipitation (IP) with anti-Flag antibodies or control IgG antibodies and the immunoprecipitates were analyzed by immunoblotting (IB) with anti-GFP antibodies. (B) Interaction between endogenous p62 and Flag C1-Ten was detected by IP and subsequent IB using the indicated antibodies. Bottom panel, quantified p62 levels, normalized to IPed Flag C1-Ten (n = 3). (C) Mapping of C1-Ten binding region of p62. (D) Validation of C1-Ten as a p62-binding protein using another p62 PB1-interacting protein, IRS-1. Interruption of p62-IRS-1 binding by C1-Ten WT or CS mutant was measured after IP with Flag IRS-1 and subsequent IB with GFP p62 or YFP C1-Ten.

A. Koh et al. / Cellular Signalling 26 (2014) 2470–2480

RFP C1-Ten

GFP p62

Merged Intensity

A

2475

160 140 120 100 80 60 40 20 0

Intensity

0

10

15

140 120 100 80 60 40 20 0 0

Intensity

5

140 120 100 80 60 40 20 0

0

5

10

5

15

20

25

10

30

15

Distance (μm)

B

5 μM MG132 15 hr mCherry C1-Ten

GFP p62

C

Hoechst

Merged

p62 siRNA mCherry C1-Ten

GFP p62

Hoechst

Merged

Fig. 4. Sequestration of C1-Ten by p62. (A) Images of HEK293 cells expressing RFP C1-Ten and GFP p62 were taken by confocal microscopy. Scale bar, 20 μm. Left panel, a histogram showing localization of the two proteins along the white line that was generated using ImageJ software. (B) Colocalization of mCherry C1-Ten and GFP 62 by treatment with MG132 for 15 h. (C) Loss of C1-Ten puncta by p62 depletion. HEK293 cells expressing mCherry C1-Ten, GFP p62, and p62 siRNA were visualized by confocal microscopy and loss of GFP signal indicated the efficiency of p62 knockdown.

constructs (data not shown). Thus, we determined whether this was due to proteasomal degradation of C1-Ten by p62 because p62 mediates proteasomal degradation of some proteins [12,13]. If this was true, we considered that C1-Ten and p62 co-localization might be observed after blocking proteasomal degradation. Indeed, incubating cells expressing mCherry C1-Ten and GFP p62 with MG132 induced their co-

localization (Fig. 4B). Previous biochemical studies (Figs. 2D, E, and 3B) suggest the possibility that p62 sequestrates C1-Ten. Surprisingly, p62 silencing abrogated C1-Ten puncta formation, causing C1-Ten to be scattered in the cytoplasm (Fig. 4C). Taken together, p62 not only acts as a regulator for C1-Ten localization but also seems to be involved in targeting C1-Ten for proteasomal degradation.

2476

A. Koh et al. / Cellular Signalling 26 (2014) 2470–2480

3.5. p62 sequestrates C1-Ten, promoting C1-Ten ubiquitination

p62 levels in the Pel fraction (Fig. 5A). However, C1-Ten accumulated in the Pel fraction following MG132 treatment but not by bafilomycin A1 treatment (Fig. 5A), indicating specific involvement of the ubiquitin-proteasomal pathway in C1-Ten regulation. To gain insight into p62-mediated C1-Ten sequestration and the ubiquitin-proteasomal pathway, we monitored C1-Ten distribution

p62 accumulates with the inhibition of autophagy because it is a substrate for autophagy [32]. Thus, we determined whether C1-Ten sequestration was also affected by autophagy. Proteasome inhibition by MG132 or autophagy inhibition by bafilomycin A1 increased the

A

B

Flag C1-Ten WT

Flag C1-Ten WT GFP p62

Flag (Sup)

12 hr

-

-

Flag (Pel) C1-Ten (Pel)

Flag C1-Ten 2.5 2

p62

C1-Ten (Sup)

n.s.

1.5

1.2

1

0.8 0.6

0.5

Actin

0

Pellet

0.4 0.2

-

MG

0

BafA1

GFP p62

C

TX-100 MG132 GFP p62

- + - -

+ +

D

SDS

- + - -

C1-Ten (Pel)

1

LC3A/B

Sup

GFP

*

+ +

-

GFP p62

Flag C1-Ten

I.P.: Flag

GFP ubiquitin 200kDa C1-Ten

200kDa

Flag C1-Ten

116kDa

TCL

97kDa GFP p62 Actin

GFP ubiquitin

Flag C1-Ten

GFP ubiquitin/Flag C1-Ten

I.P.: Flag 250 200

**

*

150 100 50

**

0 WT dC1 1-710

720-1409

Fig. 5. C1-Ten ubiquitination by p62-induced C1-Ten sequestration. (A) Accumulation of C1-Ten by inhibiting proteasomes, not by autophagy. HEK293 cells expressing Flag C1-Ten were incubated with the proteasome inhibitor MG132 or the autophagosome inhibitor bafilomycin A1 (BafA1). Cell lysates were separated into Sup and Pel fractions to determine the accumulation of C1-Ten or p62 in each fraction. Right panel, bar graphs showing significant increases of C1-Ten in the Pel by MG132 but not by BafA1. (B) Rapid reduction of C1-Ten in the Sup by p62 expression. Distribution or levels of C1-Ten were monitored by increasing GFP p62 expression. Bottom panel, quantified protein levels of Flag C1-Ten, relative to C1-Ten levels without the ectopic expression of GFP p62. (C) C1-Ten ubiquitination in the Pel fraction. HEK293 cells expressing Flag C1-Ten, GFP p62, and GFP ubiquitin were lysed with a buffer containing 1% TX-100 or 2% SDS and subjected to IP with a Flag antibody. Eluents from IP were used for detecting ubiquitination of C1-Ten. (D) Identification of p62mediated C1-Ten ubiquitination region. The extent of C1-Ten ubiquitination was compared using C1-Ten fragments. Bottom panel, quantitation of ubiquitination was performed with the boxed region, normalized with the protein levels of each fragments.

A. Koh et al. / Cellular Signalling 26 (2014) 2470–2480

with increasing p62 expression. p62 overexpression caused a marked loss of C1-Ten in the Sup but reduced loss in the Pel (Fig. 5B). These results suggest that p62 sequestrated C1-Ten into the Pel, followed by C1-Ten ubiquitination/degradation in the Pel fraction. To confirm that Pel was a site where p62-mediated ubiquitination occurs, we compared C1-Ten ubiquitination under TX-100 and SDS conditions. This was based on the fact that SDS can solubilize the proteins that are insoluble with TX-100. After blocking the ubiquitin-proteasome pathway with MG132, we detected C1-Ten ubiquitination in both TX-soluble and SDS-soluble fractions (Fig. 5C). More importantly, p62 overexpression caused a tremendous increase in C1-Ten ubiquitination in the SDSsoluble but not in the TX-soluble fraction (Fig. 5C), supporting the notion that p62 mediated the sequestration of C1-Ten in the Pel, followed by C1-Ten ubiquitination. C1-Ten ubiquitination has not been reported; thus, we next sought to identify p62-mediated ubiquitination sites within C1-Ten. We generated fragments of C1-Ten: C1 domain deletion (dC1), N-terminal fragment (amino acids 1–710), or C-terminal fragment (amino acids 720–1409). No ubiquitination signal was detected in the C-terminal fragment but a significant increase in ubiquitination was observed in the dC1 and N-terminal fragments (Fig. 5D). Consistent with this ubiquitination pattern, the dC1 and N-terminal fragment (1–710) showed increased binding with the PB1 domain of p62 or endogenous p62 (Fig. S2A and B). The C-terminal fragment (720–1409) of C1-Ten did not interact with endogenous p62 (Fig. S2B). These results suggest that the C1 domain and the C-terminal region of C1-Ten (from amino acid 720) inhibit p62 binding to C1-Ten. Taken together, p62mediated ubiquitination sites are in the N-terminal region of C1-Ten, but not the C1 domain. 3.6. p62 regulates C1-Ten protein levels, affecting C1-Ten function As p62 sequestrates and promotes ubiquitination of C1-Ten, we investigated whether this ubiquitination event targeted C1-Ten for degradation. First, p62 knockdown was performed to determine whether p62 regulated the steady-state level of C1-Ten. siRNA targeting human p62 [21], effectively reduced p62 in HEK293 cells. p62 depletion not only increased C1-Ten protein levels but also decreased C1-Ten in the Pel fraction (Fig. 6A), supporting the idea that p62 is responsible for C1-Ten sequestration followed by ubiquitin-proteasomal degradation. Moreover, this event was specific to C1-Ten; p62 silencing did not increase tensin1 or tensin3 expression (Fig. 6B). To confirm this result, we tested whether p62 knockdown increased C1-Ten even with low levels of C1-Ten. First, we confirmed this result with 0.5 μg Flag C1Ten plasmid transfection, expression of which was barely detectable in the presence of p62 (Fig. S3A). However, a marked increase in Flag C1-Ten expression was observed following p62 knockdown even with 0.5 μg C1-Ten transfection, the level of which was comparable to that of 1.5 μg transfection (Fig. S3A). Next, we validated this event with endogenous C1-Ten in L6 myotubes, in which we showed that C1-Ten regulates Akt/S6K1 signaling [7]. As in overexpressed C1-Ten in HEK293 cells, p62 knockdown in L6 myotubes increased C1-Ten levels and reduced Akt/S6K1 phosphorylation (Fig. 6C). In a previous study, we reported that C1-Ten protein level decreases during myogenesis in vitro and postnatal development in vivo [7]. Thus, we determined whether p62 expression changed in this condition. An inverse relationship was observed between C1-Ten and p62 levels during myogenesis in vitro (Fig. 6D) and postnatal development of skeletal muscle in vivo (Fig. 6F). In contrast to the absence of significant changes in C1-Ten mRNA levels, a marked increase in p62 mRNA levels was detected in fully differentiated myotubes vs. that in undifferentiated myoblasts (Fig. 6E). These results suggest a physiological role for p62 in the regulation of C1-Ten protein levels during muscle differentiation. Thus, we tested whether C1-Ten expression during the early stage of differentiation could affect myogenesis. Transduction of an adenoviral construct of C1-Ten can be visualized with GFP signals, as described

2477

previously [7]. At 72 h after transducing C1-Ten on day 2 of differentiation, C1-Ten-expressing cells showed delayed myogenesis, as revealed by a myoblast phenotype rather than an elongated myotube and reduced levels of myogenin, a marker for muscle differentiation (Fig. 6G). Taken together, p62 seems to be a physiological negative regulator for C1-Ten, affecting protein levels and subsequently the biological function of C1-Ten. 4. Discussion The tensin family of proteins are known as focal adhesion molecules, linking β-integrin cytoplasmic tails through the C-terminal PTB domain and actin filaments via the N-terminal actin-binding domain [1]. However, many studies regarding the role of tensins as cytoskeletal adaptor molecules are based on work about tensin1. There was a breakthrough in the field of tensin family research after the discovery of its role in the regulation of the DLC-1 tumor suppressor. Even though all tensins share overall sequence homology, there are clearly many differences. For example, tensin1 and C1-Ten share a PTPase domain but only C1-Ten seems to be an active PTPase because a catalytic cysteine residue was replaced with asparagine in tensin1 [6,7]. Additionally, all tensins except C1-Ten use their SH2 domain for targeting DLC-1 to focal adhesion [33]. Instead, C1-Ten regulates DLC-1 through its PTB domain [4]. Epidermal growth factor (EGF) reciprocally regulates mRNA levels of tensin3 and cten, but not those of tensin1 or C1-Ten [34]. Caspasemediated regulation has been suggested for post-translational regulation in tensin1 and cten [1]. However, protein turnover using the ubiquitin-proteasome system has not been reported in the tensin family. In this study, we suggest a new type of regulation specific to C1-Ten, but no other tensin: p62-mediated sequestration and subsequent proteasomal degradation. Our observation may broaden the knowledge about C1-Ten. Many reports question the meaning of the C1-Ten puncta because they do not colocalize with F-actin or any organelle markers (i.e. endosome, ER, or Golgi). Here, we showed that p62 determines the C1-Ten localization in cytosolic puncta, which disperse throughout the cytosol following p62 depletion (Fig. 4C). Another intriguing observation is the difference in binding ability to p62 and the extent of ubiquitination between C1-Ten WT and C1 domain-deleted C1-Ten (dC1) (Figs. S2A, B, and 5D). Three alternative splicing variants of C1-Ten occur. The shortest variant of C1-Ten, variant 3, which lacks the C1 domain, similar to our dC1 mutant, has an opposite function to other C1-Ten variants. C1-Ten variant 3 is upregulated in hepatocellular carcinoma (HCC), expression of which is significantly associated with the aggressiveness of HCC [35]. This variant 3 expression promotes cell growth, migration, proliferation, and in vivo tumorigenesis, the opposite of the C1-Ten variants 1 and 2. However, there is no known function of the C1-Ten C1 domain. In this study, we suggest that p62-mediated sequestration of C1-Ten promoted ubiquitination and degradation of C1-Ten. Because the dC1 mutant of C1-Ten showed increased binding to p62 and a subsequent increase of ubiquitination, we suggest that C1-Ten variant 3 may be non-functional with p62 in HCC. Considering that C1-Ten has a role in inhibiting IRS-1/Akt signaling and in supporting DLC-1 function, a non-functional C1-Ten might enhance Akt signaling and inhibit the biological function of DLC-1, contributing to the aggressiveness of HCC. However, it remains to be addressed how the C1 domain can inhibit p62 binding to C1-Ten. A recent report showed that a lack of p62 in adipose tissue is sufficient to recapitulate the phenotype of whole body p62-deficient mice [36]. In contrast, p62 deletion in the skeletal muscle has no role in the control of obesity observed in global p62 knockout mice. Instead, the body weight of the muscle-specific p62 knockout mice was lower than that of the wild type (WT), which may be explained by a decrease in lean tissue mass. However, there has been no report about the role of p62 in muscle physiology. Our observation about increased expression of p62 during myogenesis in vitro and postnatal development of

2478

A. Koh et al. / Cellular Signalling 26 (2014) 2470–2480

A

B

C con

siRNA

p62

Flag C1-Ten WT GFP tensin1 p62 siRNA +

siRNA con p62 50nM

-

C1-Ten (Sup)

tensin3

C1-Ten

-

-

+

C1-Ten

+

p62

tensin1

C1-Ten

tensin3

p62

p62

p62

Actin

Actin

Actin

pAkt (S473)

C1-Ten (Pel)

pS6K1 (T389)

Actin (Sup) Actin (Pel) Non-specific p62

Actin

C1-Ten/Actin

C1-Ten

day1 day2 day4 C1-Ten p62 myogenin G3BP1 Actin

F

1.2 1 0.8 0.6 0.4 0.2 0

2 1.8 1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0

con

E

**

C1-Ten

p62

1.2

p62

***

1 0.8 0.6 0.4 0.2 0

GM GM

p62

siRNA

p62/gapdh

GM

*

C1-Ten

C1-Ten/gapdh

D

2 1.8 1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0

day8

8 7 6 5 4 3 2 1 0

**

GM

day8

day4

G Ad-GFP vec C1-Ten P0

P14

P21

Ad-GFP

C1-Ten

p62

p62

Actin

Ad-C1-Ten WT

GFP

Myogenin

GFP GAPDH myogenin/actin

p=0.01(**) 140 120 100 80 60 40 20 0

DIC merge

Akt1/2

p85

GFP C1-Ten WT

Fig. 6. C1-Ten level regulation by p62. (A) Loss of C1-Ten in the Pel and increase of C1-Ten in the Sup by p62 depletion. HEK293 cells expressing Flag C1-Ten with control siRNA or p62 siRNA were separated into Sup and Pel fractions. (B) Specificity of p62-mediated C1-Ten downregulation. HEK293 cells expressing GFP tensin1, GFP C1-Ten, or GFP tensin3 with control siRNA or p62 siRNA were used for IB detecting the changes of each GFP-tagged tensin expression. (C) Increase of endogenous C1-Ten level by p62 siRNA treatment in L6 myotubes. p62 siRNA was introduced to L6 myotubes on day 5 or 6 of differentiation and 48 h later, cells were harvested. Bottom panel, quantified C1-Ten levels, relative to actin (n = 5). (D) Western blot shows C1-Ten and p62 expression changes during L6 myogenesis in vitro. GM, growing media. Right panel, Relative protein levels of C1-Ten and p62 were shown (n = 4). (E) Comparison of mRNA levels of C1-Ten or p62 in undifferentiated myoblasts (GM) versus. fully-differentiated myotubes (day 8). C1-Ten and p62 mRNA levels were assessed by qRT-PCR and normalized to gapdh (n = 3). (F) IBs showing C1-Ten and p62 expression during the postnatal development of skeletal muscle in mice. P, postnatal. (G) Delay of L6 differentiation by ectopic C1-Ten expression. Myotubes at day 2 of differentiation were infected with Ad-GFP constructs for 3 days and subjected to immunoblotting. Bottom panel, quantified protein levels of myogenin, relative to those of actin (n = 3). Right panel, representative images showing the morphology of L6 muscle cells upon Ad-GFP constructs infection.

A. Koh et al. / Cellular Signalling 26 (2014) 2470–2480

skeletal muscle in vivo may provide a clue to understanding the role of p62 in lean mass control. Ectopic expression of C1-Ten in the early stages of muscle differentiation delayed myogenesis (Fig. 6G), which does not seem to block differentiation. Based on this result, we speculate that p62 may have a positive role in myogenesis but p62 deletion may not block this process. Thus, it would be interesting to study the role of p62 and C1-Ten during muscle regeneration after injury in which defects during the early stage of differentiation will make a visible difference in phenotype. Moreover, we suggest an active role of p62 in the regulation of protein tyrosine phosphorylation signaling by sequestering PTPases. We reported previously that C1-Ten is a PTPase of Y612 of IRS-1, one of the important binding sites for p85 of phosphatidylinositol 3-kinase (PI3K) [7]. A recent study suggested that p62 is a positive regulator of insulin signaling, which involves the interaction between the IRS-1 p62 and p85 binding sites [31]. Our results also support a positive function for p62 in insulin signaling (Fig. 6C). However, we showed that both C1-Ten WT and C1-Ten CS abrogated the interaction between IRS-1 and p62, the signaling outcomes of which are dependent on C1Ten WT or CS but not on the binding status of IRS-1 and p62 (Fig. 3D). Because of this result, we monitored the effects of p62 on IRS-1 Y612 phosphorylation and p85 binding in the absence or presence of C1-Ten in HEK293 cells where endogenous C1-Ten level was low. In the absence of C1-Ten, p62 knockdown did not cause any changes in IRS-1 Y612 phosphorylation or p85 binding to IRS-1 (Fig. S4A). However, p62 depletion inhibited IRS1 signaling in the presence of C1-Ten (Fig. S4A). Even with IRS-1 mutants in which the p85 binding site was mutated (IRS-1 Y612F or Y632F), p62 binding to IRS-1 was intact, compared with IRS-1 WT (Fig. S4B). Again, ectopic expression of C1-Ten completely inhibited the p62-IRS-1 interaction (Fig. S4B), suggesting that p62-IRS-1 complex formation is inhibited by C1-Ten binding to p62 not by IRS-1 tyrosine phosphorylation status. Additionally, C1Ten-induced Akt inhibition was blocked by p62 overexpression (Fig. S4C). These results suggest that p62 regulates insulin signaling in the presence of C1-Ten. It is intriguing that IRS-1 also forms cytosolic puncta (sequestration complex) with p85 on insulin stimulation, which has an inhibitory function in insulin signaling [37]. It would be interesting to study the dynamic relationship of sequestration complexes consisting of p62-C1-Ten or p85-IRS-1, which may delineate the spatiotemporal regulation of insulin signaling. We showed that C1-Ten is a cysteine-based PTPase [7], and that it is possible to test the effects of ROS on C1-Ten. Because of the low pKa value of the catalytic cysteine, it acts as a nucleophile, but this renders it susceptible to oxidation by ROS [38]. From this approach, we can understand the properties of C1-Ten and its regulatory mechanism in relation to p62. In HEK293 cells, ROS-induced C1-Ten sequestration was very transient and resolved within 1 h (Fig. 1A and C), unlike that in HeLa cells. For relief of C1-Ten from sequestration, we tested the effects of antioxidant enzymes such as peroxiredoxin I (PrxI), PrxII, and thioredoxinI (TrxI). Loss of C1-Ten upon ROS treatment was restored by TrxI, but not by PrxI or PrxII (Fig. S5A). Thus, differences in TrxI expression, depending on cell type, may account for the differences in the kinetics of C1-Ten sequestration by ROS. Based on the finding that ROS can inhibit PTPases by oxidizing the catalytic cysteine, it would be interesting to determine the protective mechanism for the C1-Ten catalytic cysteine: C1-Ten sequestration by p62 vs. relief by TrxI. In our study, both C1-Ten WT and the CS mutant interacted with p62 (Fig. S2B) and were sequestered by ROS (data not shown). Thus, the oxidation state of the C1-Ten catalytic cysteine may be independent or downstream of p62-mediated sequestration. However, monitoring the oxidation status of C1-Ten upon ROS exposure in the presence or absence of p62 will provide insight for understanding the relationship between the ROS-mediated regulation of the catalytic cysteine and p62-mediated sequestration. In this study, we showed that C1-Ten is a dynamic protein under delicate regulatory control during stress conditions, such as ROS, or

2479

physiological conditions, such as myogenesis. Finally, p62 seems to be at the center of the C1-Ten regulation. Here, we suggest that p62 is a physiological negative switch for C1-Ten. However there are open issues about the details of the p62-C1-Ten relationship not only in diabetes and cancers but also in muscle regeneration; addressing those will extend our understanding of both p62 and C1-Ten. 5. Conclusion C1-Ten has been suggested to play a role in the progression of pathological conditions, such as diabetes and cancer because of its connections with the tumor suppressor DLC-1 and the key insulin signaling regulator IRS-1 [4,7]. However, relatively little is known about the regulatory mechanism of C1-Ten itself; understanding this relationship may help in delineating the roles of C1-Ten in diabetes and cancers. Here, we proposed a new regulatory mechanism for C1-Ten PTPase: sequestration and degradation. That is, we identified p62/SQSTM1 as a negative regulator of C1-Ten, affecting the biological function of C1-Ten. More specifically, p62 not only sequestrated C1-Ten into sequestosomes but also reduced C1-Ten protein levels via the ubiquitin-proteasome pathway. Moreover, we suggest another type of PTPase regulation by ROS, other than ROS-induced inactivation: rapid sequestration of C1-Ten by ROS. Author contributions A.K. designed all experiments and carried out the experiments in the HEK293 and L6 muscle cells. D.P. performed experiments in HeLa cells and assisted in the ubiquitination experiments. H.J. performed the gene cloning and J.L. assisted in the cloning. A.K., M.N.L., and S.H.R. wrote the manuscript. Competing interests The authors declare that they have no competing financial interests. Acknowledgment This study was supported by the National Research Foundation of Korea (NRF) grant (No. 2010-0028684). This study was also supported by a NRF grant, funded by the Korean government (MEST) (No. 2013R1A2A1A03010110). Appendix A. Supplementary data Supplementary data to this article can be found online at http:// dx.doi.org/10.1016/j.cellsig.2014.07.033. References [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17] [18] [19] [20] [21]

S.H. Lo, Int. J. Biochem. Cell Biol. 36 (1) (2004) 31–34. X. Qian, et al., Proc. Natl. Acad. Sci. 104 (21) (2007) 9012–9017. Y.-C. Liao, et al., J. Cell Biol. 176 (1) (2007) 43–49. J.W.P. Yam, et al., Cancer Res. 66 (17) (2006) 8367–8372. X. Cao, et al., Proc. Natl. Acad. Sci. 109 (5) (2012) 1455–1460. S. Hafizi, F. Ibraimi, B. Dahlbäck, FASEB J. 19 (8) (2005) 971–973. A. Koh, et al., Mol. Cell. Biol. 33 (8) (2013) 1608–1620. D. Martuszewska, et al., PLoS ONE 4 (2) (2009) e4350. J. Moscat, M.T. Diaz-Meco, Cell 137 (6) (2009) 1001–1004. S.J. Lee, et al., EMBO Rep. 11 (3) (2010) 226–232. A. Rodriguez, et al., Cell Metab. 3 (3) (2006) 211–222. R.K. Vadlamudi, et al., J. Biol. Chem. 271 (34) (1996) 20235–20237. M.L. Seibenhener, et al., Mol. Cell. Biol. 24 (18) (2004) 8055–8068. V. Kirkin, et al., Mol. Cell 34 (3) (2009) 259–269. A.L. Goldberg, Nature 426 (6968) (2003) 895–899. A. Puissant, N. Fenouille, P. Auberger, Am. J. Cancer Res. 2 (4) (2012) 397–413. D. Inoue, et al., Cancer Sci. 103 (4) (2012) 760–766. H.G.R. Thompson, et al., Oncogene 22 (15) (2003) 2322–2333. P. Rolland, et al., Endocr. Relat. Cancer 14 (1) (2007) 73–80. S. Park, et al., PLoS ONE 8 (2) (2013) e57138. S. Pankiv, et al., J. Biol. Chem. 282 (33) (2007) 24131–24145.

2480 [22] [23] [24] [25] [26] [27] [28]

A. Koh et al. / Cellular Signalling 26 (2014) 2470–2480

B.G. Neel, N.K. Tonks, Curr. Opin. Cell Biol. 9 (2) (1997) 193–204. Y.S. Bae, et al., J. Biol. Chem. 272 (1) (1997) 217–221. M. Sundaresan, Z.X. Yu, et al., Science 270 (1995) 296–299 (0036–8075 (Print)). A. Iwata, et al., Proc. Natl. Acad. Sci. U. S. A. 102 (37) (2005) 13135–13140. Y. Sha, et al., Mol. Cell. Biol. 29 (1) (2009) 116–128. S. Hafizi, et al., Int. J. Biochem. Cell Biol. 42 (1) (2010) 52–61. K.D. Moon, et al., Biochim. Biophys. Acta (BBA) — Mol. Basis Dis. 1823 (2) (2012) 199–205. [29] J.A. Johnston, C.L. Ward, R.R. Kopito, J. Cell Biol. 143 (7) (1998) 1883–1898.

[30] [31] [32] [33] [34] [35] [36] [37] [38]

Y. Kawaguchi, et al., Cell 115 (6) (2003) 727–738. T. Geetha, et al., J. Biol. Chem. 287 (35) (2012) 29672–29678. G. Bjørkøy, et al., J. Cell Biol. 171 (4) (2005) 603–614. Y.-C. Liao, S.H. Lo, Int. J. Biochem. Cell Biol. 40 (5) (2008) 843–847. M. Katz, et al., Nat. Cell Biol. 9 (8) (2007) 961–969. J.W.P. Yam, et al., Hepatology 44 (4) (2006) 881–890. T.D. Müller, et al., J. Clin. Invest. 123 (1) (2013) 469–478. J. Luo, et al., J. Cell Biol. 170 (3) (2005) 455–464. A. Östman, et al., J. Biochem. 150 (4) (2011) 345–356.