- Email: [email protected]
Regulation of calcitonin gene-related peptide mRNA expression in the hearts of spontaneously hypertensive rats by testosterone
Neuroscience Letters, 125 (1991) 77-80
77
© 1991 Elsevier Scientific Publishers Ireland Ltd. 0304-3940/91/$ 03.50 ADONIS 0304394091001580 NSL 07674
Regulation of calcitonin gene-related peptide mRNA expression in the hearts of spontaneously hypertensive rats by testosterone F r a n k Gillardon, Ingo M o r a n o , Ursula G a n t e n and Manfred Z i m m e r m a n n H. Physiologisches Institut der Universitiit Heidelberg und Deutsches Institut fiir Bluthochdruckforschung und Pharmakologisches lnstitut ( U.G.) der Universitdt Heidelberg, Heidelberg (F.R.G.) (Received 10 January 1991; Revised version received 18 January 1991; Accepted 21 January 1991)
Key words: Calcitonin gene-related peptide; Polymerase chain reaction; Testosterone; Neuropeptide gene expression; Intracardiac nerve cell Previous studies have demonstrated the existence of calcitonin gene-related peptide (CGRP)-immunoreactive nerve fibres and nerve cell bodies in the rat heart. Using polymerase chain reaction we have investigated whether CGRP messenger RNA (mRNA) could be detected in heart tissue of spontaneously hypertensive rats, and whether CGRP-mRNA levels are affected by gonadectomy and testosterone substitution. Two weeks after castration CGRP-mRNA levels decreased to 65.2+6.4% of control values, whereas daily dihydrotestosterone substitution reversed this effect (88.0_+ 1.2% of control). Our results indicate that steroid hormones control the expression of intracardiac CGRP on a pretranslational level.
Calcitonin gene-related peptide (CGRP) is a neuropeptide composed of 37 amino acids and produced by alternative processing of mRNA from the rat calcitonin/ CGRP gene [1]. Histochemical studies have demonstrated that nerve fibres containing CGRP are present throughout the cardiovascular system, particularly in the conductive tissue and the epicardial arteries of the rat heart [15]. Besides its abundance in extrinsic sensory neurons originating from dorsal root ganglion cells (DRG), CGRP immunoreactivity has also been localized in nerve cell bodies within the rat heart (E. Weihe, personal communication) and in parasympathetic ganglia [11, 20]. However, there are no data concerning a possible synthesis of CGRP in intracardiac nerve cells and its regulation. This is an important issue since CGRP has a significant stimulatory effect on calcium influx in single heart cells and thus contraction and pacemaker activity [16, 18]. In addition, CGRP is a potent vasodilator and clinical trials revealed that intracoronary infusion of CGRP led to a marked dilatation of human epicardial coronary arteries [13]. In this study using polymerase chain reaction we demonstrate that CGRP mRNA can be detected in RNA extracts of the rat heart and that testosterone regulates steady-state levels of intracardiac CGRP mRNA. Six-week-old male spontaneously hypertensive rats of
Correspondence: F. Gillardon, II. Physiologisches Institut, Universit~it Heidelberg, Im Neuenheimer Feld 326, 6900 Heidelberg, F.R.G.
the stroke-prone strain (SHRSPs) were used for our investigation. In spontaneously hypertensive rats an agerelated decrease in the neuronal activity or in the population of capsaicin-sensitive, CGRP-containing vasodilator nerves innervating the mesenteric vessels seems to contribute to the hypertension [8], whereas the fractional distribution of cardiac output to the hypertrophied heart .is increased [17]. Animals were gonadectomized (G group), gonadectomized with 3 mg/day dihydrotestosterone substitution subcutaneously ( G + T group), or sham-operated (control group). Gonadectomy was performed under light ether anesthesia. At the time of sacrifice serum testosterone levels were determined in blood samples from the retroorbital venous plexus by standard radioimmunoassay [7]. After two weeks of treatment animals were killed by cervical dislocation. Subsequently hearts were excised and quickly frozen in liquid nitrogen. CGRP-mRNA levels were studied by the polymerasechain reaction (PCR). The method has been presented in detail elsewhere [6]. In short, after isolation of total DNAfree RNA from the ventricles 1 /tl RNA (1 /~g/ml) was incubated with 1/A Avian myeloblastosis virus (AMV)reverse transcriptase (26500 U/ml) and 25 pmol of an oligonucleotide (GCCCACATTGGTGGGCACAAA) specific for a homologous region at the 3' coding part of ~- and fl-CGRP mRNA (primer A) [2, 12]. The resulting single-stranded complementary DNA (cDNA) was used in the PCR to synthesize complementary strands to a defined segment of the CGRP cDNA by adding primer
78
A and primer B, an oligonucleotide (GCCACCTGTGTGACCCATCGG) complementary to a homologous sequence of the 5' noncoding part of ~- and fl-CGRP cDNA. cDNA products were amplified using 0.5 /d Thermus aquaticus (TAQ)-polymerase (5000 U/ml) in a medium containing 67 mM Tris-HC1, 1.5 mM magnesium chloride, 16.6 mM ammonium sulfate, 0.2 mM nucleotide triphosphate mix, 3 /11 [~-32p]dATP (15.0 mCi/ml), 25 pM primer A and B, 10% dimethyl sulfoxide and 4 mg/ml bovine serum albumin (pH 8.8). 90°C (1 min) for denaturation, 57°C (3 min) for primer annealing and 72°C (5 min) for primer extension, were used per cycle. PCR products were separated by polyacrylamide gel electrophoresis (8%) after 20 cycles [12]. Subsequently the gel was fixed with 10% acetic acid and washed in distilled water. The CGRP cDNA bands were detected by autoradiography (Kodak X-Omat AR) and quantified by liquid scintillation counting of the cut gel bands (Beckman) or film transmission sensitometry (Bio-Rad). Theoretically, amplification of cDNA products is given by the equation N = No × 2c, where N is the number of cDNA products synthesized, No is the number of cDNA molecules at the beginning of the reaction, c is the number of PCR cycles, and 2 is the amplification factor (doubling of the cDNA products after each cycle). Thus the amount of amplified cDNA products can be used to estimate the levels of CGRP m R N A provided that the amplification of the cDNA products is an exponential function of the number of cycles [14]. To check this prerequisite of quantitative PCR, aliquots of PCR products were analysed by polyacrylamide gel electrophoresis after 10, 15 and 20 cycles and the radioactivity of the cDNA bands was evaluated by liquid scintillation counting (Fig. 1). In our PCR system, the ratio between cDNA product amplification and the number of cycles could be described by the equation N = No × 1,3c (an increase of cDNA products by a factor of 1.3 after each cycle). This exponential amplification rate could be observed up to 20 cycles. The efficiency factor of 1,3 has been determined empirically from the radioactivity of the cDNA products. PCR of CGRP cDNA resulted in the amplification of two distinct cDNA products migrating close together. Plasmid pBR 322 DNA was subjected to complete AluI or HaellI restriction endonuclease digestion and the restriction fragments used as DNA size markers. Thus it could be verified that the PCR product had the expected molecular weight (87 bp), giving strong evidence that we specifically amplified a fragment of CGRP m R N A in our system. Additionally, negative controls were included containing no template cDNA. Serum testosterone levels decreased upon gonadec-
®
AutorQdiogrophy 10
®
15
IPCR 20 Eyctes
10000
1000
m~
100
10
1~
1'5
2'0 PCR c g c l e s
Fig 1. Efficiencyof the amplificationof ~- and fl-CGRP complementary DNA (cDNA) fragmentsin the polymerasechain reaction (PCR) using 3/d [cP2p]dATP(15 mCi/ml).A: after 10, 15 and 20 cycles,the PCR products were separated by polyacrylamidegel electrophoresis and the CGRP cDNA bands detected by autoradiography (6 h of exposure at 4°C). B: the amount of CGRP cDNA was determinedby liquid scintillationcounting.The counts per minute are plotted versus the number of polymerasechain reactioncycles.
tomy from 12+2 nM in the control group to 4+0.5 nM in the G group, whereas testosterone substitution led to an elevated level (77+10 riM). Values are mean___S.E.M. Seven animals per group were investigated. Twenty PCR cycles were sufficient to yield a product signal on the X-ray film. This is within the exponential phase of product amplification, therefore CGRP m R N A levels could be measured after 20 PCR cycles. The relative amounts of C G R P cDNA were determined geometrically from the peak areas after film sensitometry. Gonadectomy led to a significant decrease in CGRP m R N A levels in the rat ventricle (Fig. 2) to 65.2+6.4% of the control values (P < 0.05 by Student's t-test), whereas testosterone substitution in gonadectomized animals normalized CGRP gene expression to 88.0___ 1.2% of control ( P < 0.01 compared with the G group). Values are mean_4-S.E.M. Four animals per group were investigated. The present experiments suggest that CGRP is synthesized within the rat ventricle, probably in intracardiac parasympathetic ganglion cells, as it has been shown in the rat parasympathetic ciliary, sphenopalatine, otic and submandibular ganglia [11, 20]. In a recent study [5] vasoactive intestinal polypeptide (VIP) and neuropeptide Y (NPY) immunoreactivities have been detected in intracardiac ganglionic cells and postganglionic parasympathetic nerve fibres of the bovine heart supplying coronary vasculature and conductive system, strongly suggesting a peptidergic control of local cardiac blood
79
@
C
Autorodiogrophy
(3
(3+T
W
B
@ I" $EM
100
"////////~
50
" °1 ";~22222.~;,
0 C
G
G+T
*p<0.05, CvsO; ** p<0.01,O+TvsG
Fig. 2. Analysis of CGRP-mRNA levels in the hearts of spontaneously hypertensive rats after two weeks of treatment. The rats were divided into three groups: sham-operated controls (C), gonadectomized (G), and gonadectomized with dihydrotestosterone substitution (G+T). Complementary DNA (cDNA) products were derived from the reverse transcriptase reaction of CGRP mRNA and were amplified by polymerase chain reaction (PCR) using 3/~1[~-32p]dATP (15 mCi/ml). After 20 PCR cycles, products were analysed by polyacrylamide gel electrophoresis. The CGRP cDNA bands were detected by autoradiography (A) 6 h of exposure at 4°C) and evaluated geometrically by film sensitometry (B). (Values are mean_ S.E.M.; 4 animals per group were investigated.)
flow. In contrast to the VIPergic cardiac innervation, which may stem from intrinsic postganglionic parasympathetic neurons [23], CGRPergic nervous supply may mainly represent extrinsic, capsaicin-sensitive sensory afferents. However a distinct class offl-CGRP-containing nerve fibres which are insensitive to neonatal capsaicin treatment has been detected in the cardiovascular tissue and intestine of the rat [15, 16]. Since our primers are homologous to both 0t-CGRP and fl-CGRP, we were not able to distinguish whether in the rat heart the ~-CGRP/ calcitonin gene or the fl-CGRP gene which does not code for calcitonin or both are expressed [2]. It has been shown that receptor binding sites showing equal affinities for both peptides are present on membranes of the rat heart [16]. Our second important finding is that CGRP gene expression is activated by gonadal steroids, since gonadectomy significantly decreased CGRP mRNA levels while testosterone substitution normalized CGRP expression. Previous studies have shown that specific receptors for androgens exist in the rat heart, and that
testosterone treatment increased RNA concentrations of the ventricular myocardium [9, 10]. In analogy to our results, it has been demonstrated that the expression of the neuropeptide cholecystokinin [21] and the expresssion of ventricular myosin heavy chain isoenzymes [14] are regulated by steroid hormones at the mRNA level. Gonadectomy did not completely abolish serum testosterone levels, therefore the remaining concentrations could be sufficient to maintain a CGRP gene expression of approximately 65% of the controls. Steroid hormones regulate gene expression first by binding to their specific receptors and then by direct interaction of the hormone-receptor complex with specific hormone response elements on the DNA which function as transcriptional enhancers [4]. We could observe part of the consensus sequence for testosterone response elements (TGTACANNNTGTTCT) in the 5'-flanking region of the rat CGRP gene by sequence comparison [19, 22]. Whether the testosterone-receptor complex may directly bind to this genomic element and subsequently enhance CGRP gene expression awaits further investigations. Supported by the Deutsche Forschungsgemeinschaft, Grant Mo 362/4-1. F.G. is the recipient of a scholarship (Landesgraduiertenf6rderung).
1 Amara, S.G., Jonas, J., Rosenfeld, M.G., Ong, E.S. and Evans, R.M., Alternative RNA processing in calcitonin gene expression generates mRNAs encoding different polypeptide products, Nature, 298 (1982) 240-244. 2 Amara, S.G., Arriza, J.L, Left, S.E., Swanson, L.W., Evans, R.M. and Rosenfeld, M.G., Expression in brain of a messenger RNA encoding a novel neuropeptide homologous to calcitonin generelated peptide, Science, 229 (1985) 1094-1097. 3 Chomczynski, P. and Sacchi, N., Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction, Anal. Biochem., 162 (1987) 156-159. 4 Evans, R.M., The steroid and thyroid hormone receptor superfamily, Science, 240 (1988) 889-895. 5 Forsgren, S., Vasoactive intestinal polypeptide-like immunoreactivity in the bovine heart: high degree of coexistence with neuropeptide Y-like immunoreactivity, Cell Tissue Res., 256 (1989) 125-135. 6 Gillardon, F., Morano, I. and Zimmermann, M. Ultraviolet irradiation of the skin attenuates calcitonin gene-related peptide mRNA expression in rat dorsal root ganglion cells, Neurosci. Lett., 124 (1991) in press. 7 Hassan, S.H., On solid phase radioimmunoassay of steroids (abstr.), Horm. Metab. Res., 3 (1971) 113. 8 Kawasaki, H., Saito, A. and Takasaki, K., Age-related decrease of calcitonin gene-related peptide-containing vasodilator innervation in the mesenteric resistance vessel of the spontaneously hypertensive rat, Circ. Res., 67 (1990) 733-743. 9 Koenig, H., Goldstone, A. and Lu, C.Y., Testosterone-mediated sexual dimorphism of the rodent heart, Circ. Res., 50 (1982) 782787. I0 Krieg, M., Smith, K. and Bartsch, W., Demonstration of a specific androgen receptor in the rat heart muscle. Relationship between
80
ll
12
13
14
15
16
binding, metabolism, and tissue levels of androgens, Endocrinology, 103 (1978) 1686-1694. Lee, Y., Takami, K., Kawai, J., Girgis, S., Hillyard, C.J., MacIntyre, I., Emson, P.C. and Tohyama, M., Distribution of calcitonin gene-related peptide in the rat peripheral nervous system with reference to its coexistence with substance P, Neuroscience, 15 (1985) 1227-1237. Maniatis, T., Fritsch, E.F. and Sambrook, J., Molecular Cloning. In: A Laboratory Manual, Cold Spring Harbor Laboratory, New York, 1982. McEwan, J., Larkin, S., Davies, G., Chierchia, S., Brown, M., Stevenson, J., Maclntyre, I. and Maseri, A., Calcitonin gene-related peptide: a potent dilator of human epicardial coronary arteries, Circulation, 74 (1986) 1243-1247. Morano, I., Gerstner, J., Rfiegg, J.C., Ganten, U., Ganten, D. and Vosberg, H.P., Regulation of myosin heavy chain expression in the hearts of hypertensive rats by testosterone, Circ. Res., 66 (1990) 1585--1590. Mulderry, P.K., Ghatei, M.A., Rodrigo, J., Allen, J.M., Rosenfeld, M.G., Polak, J.M. and Bloom, S.R., Calcitonin gene-related peptide in cardiovascular tissues of the rat, Neuroscience, 14 (1985) 947-054. Mulderry, P.K., Ghatei, M.A., Spokes, R.A., Jones, P.M., Pierson, A.M., Hamid, Q.A., Kanse, S., Mara, S.G., Gurrin, J.M., Legon, S., Polak, J.M. and Bloom, S.R., Differential expression of ~CGRP and fl-CGRP by primary sensory neurons and enteric autonomic neurons in the rat, Neuroscience, 25 (1988) 195-205.
17 Nishiyma, K., Nishiyama, A. and Frohlich, E.D., Regional blood flow in normotensive and spontaneously hypertensive rats, Am. J. Physiol. 230 (1976) 691 698. 18 Ono, K., Delay, M., Nakajima, T., Irisawa, H. and Giles, W., Cal~ citonin gene-related peptide regulates calcium current in heart muscle, Nature, 340 (1989) 721 724. 19 Schmid, W., Strahle, U., Mestril, R., Glock, G., Ankenbauer, W. and Schutz, G., Steroid response elements. Definition of a minimal promoter and interaction with other activating sequences. In A.K. Roy and J.H. Clark (Eds.), Gene Regulation by Steroid Hormones, Vol. IV, Springer, New York, 1989, pp. 78-88. 20 Silverman, J.D. and Kruger, L., Calcitonin-gene-related-peptideimmunoreactive innervation of the rat head with emphasis on specialized sensory structures. J. Comp. Neurol., 280 (1989) 303 330. 21 Simerly, R.B., Hormonal control of neuropeptide gene expression in sexually dimorphic olfactory pathways, Trends Neurosci., 13 (1990) 104-1 I0. 22 Stolarsky-Fredman, L., Left, S.E., Klein, E.S., Crenshaw, E.B., Yeakley, J. and Rosenfeld, M.G., A tissue-specific enhancer in the rat-calcitonin/CGRP gene is active in both neural and endocrine cell types, Mol. Endocrinol., 4 (1990) 497-504. 23 Weihe, E., Reinecke, M. and Forssmann, W.G., Distribution of vasoactive intestinal polypeptide-like immunoreactivity in the mammalian heart, Cell Tissue Res., 236 (1984) 527 540.
77
© 1991 Elsevier Scientific Publishers Ireland Ltd. 0304-3940/91/$ 03.50 ADONIS 0304394091001580 NSL 07674
Regulation of calcitonin gene-related peptide mRNA expression in the hearts of spontaneously hypertensive rats by testosterone F r a n k Gillardon, Ingo M o r a n o , Ursula G a n t e n and Manfred Z i m m e r m a n n H. Physiologisches Institut der Universitiit Heidelberg und Deutsches Institut fiir Bluthochdruckforschung und Pharmakologisches lnstitut ( U.G.) der Universitdt Heidelberg, Heidelberg (F.R.G.) (Received 10 January 1991; Revised version received 18 January 1991; Accepted 21 January 1991)
Key words: Calcitonin gene-related peptide; Polymerase chain reaction; Testosterone; Neuropeptide gene expression; Intracardiac nerve cell Previous studies have demonstrated the existence of calcitonin gene-related peptide (CGRP)-immunoreactive nerve fibres and nerve cell bodies in the rat heart. Using polymerase chain reaction we have investigated whether CGRP messenger RNA (mRNA) could be detected in heart tissue of spontaneously hypertensive rats, and whether CGRP-mRNA levels are affected by gonadectomy and testosterone substitution. Two weeks after castration CGRP-mRNA levels decreased to 65.2+6.4% of control values, whereas daily dihydrotestosterone substitution reversed this effect (88.0_+ 1.2% of control). Our results indicate that steroid hormones control the expression of intracardiac CGRP on a pretranslational level.
Calcitonin gene-related peptide (CGRP) is a neuropeptide composed of 37 amino acids and produced by alternative processing of mRNA from the rat calcitonin/ CGRP gene [1]. Histochemical studies have demonstrated that nerve fibres containing CGRP are present throughout the cardiovascular system, particularly in the conductive tissue and the epicardial arteries of the rat heart [15]. Besides its abundance in extrinsic sensory neurons originating from dorsal root ganglion cells (DRG), CGRP immunoreactivity has also been localized in nerve cell bodies within the rat heart (E. Weihe, personal communication) and in parasympathetic ganglia [11, 20]. However, there are no data concerning a possible synthesis of CGRP in intracardiac nerve cells and its regulation. This is an important issue since CGRP has a significant stimulatory effect on calcium influx in single heart cells and thus contraction and pacemaker activity [16, 18]. In addition, CGRP is a potent vasodilator and clinical trials revealed that intracoronary infusion of CGRP led to a marked dilatation of human epicardial coronary arteries [13]. In this study using polymerase chain reaction we demonstrate that CGRP mRNA can be detected in RNA extracts of the rat heart and that testosterone regulates steady-state levels of intracardiac CGRP mRNA. Six-week-old male spontaneously hypertensive rats of
Correspondence: F. Gillardon, II. Physiologisches Institut, Universit~it Heidelberg, Im Neuenheimer Feld 326, 6900 Heidelberg, F.R.G.
the stroke-prone strain (SHRSPs) were used for our investigation. In spontaneously hypertensive rats an agerelated decrease in the neuronal activity or in the population of capsaicin-sensitive, CGRP-containing vasodilator nerves innervating the mesenteric vessels seems to contribute to the hypertension [8], whereas the fractional distribution of cardiac output to the hypertrophied heart .is increased [17]. Animals were gonadectomized (G group), gonadectomized with 3 mg/day dihydrotestosterone substitution subcutaneously ( G + T group), or sham-operated (control group). Gonadectomy was performed under light ether anesthesia. At the time of sacrifice serum testosterone levels were determined in blood samples from the retroorbital venous plexus by standard radioimmunoassay [7]. After two weeks of treatment animals were killed by cervical dislocation. Subsequently hearts were excised and quickly frozen in liquid nitrogen. CGRP-mRNA levels were studied by the polymerasechain reaction (PCR). The method has been presented in detail elsewhere [6]. In short, after isolation of total DNAfree RNA from the ventricles 1 /tl RNA (1 /~g/ml) was incubated with 1/A Avian myeloblastosis virus (AMV)reverse transcriptase (26500 U/ml) and 25 pmol of an oligonucleotide (GCCCACATTGGTGGGCACAAA) specific for a homologous region at the 3' coding part of ~- and fl-CGRP mRNA (primer A) [2, 12]. The resulting single-stranded complementary DNA (cDNA) was used in the PCR to synthesize complementary strands to a defined segment of the CGRP cDNA by adding primer
78
A and primer B, an oligonucleotide (GCCACCTGTGTGACCCATCGG) complementary to a homologous sequence of the 5' noncoding part of ~- and fl-CGRP cDNA. cDNA products were amplified using 0.5 /d Thermus aquaticus (TAQ)-polymerase (5000 U/ml) in a medium containing 67 mM Tris-HC1, 1.5 mM magnesium chloride, 16.6 mM ammonium sulfate, 0.2 mM nucleotide triphosphate mix, 3 /11 [~-32p]dATP (15.0 mCi/ml), 25 pM primer A and B, 10% dimethyl sulfoxide and 4 mg/ml bovine serum albumin (pH 8.8). 90°C (1 min) for denaturation, 57°C (3 min) for primer annealing and 72°C (5 min) for primer extension, were used per cycle. PCR products were separated by polyacrylamide gel electrophoresis (8%) after 20 cycles [12]. Subsequently the gel was fixed with 10% acetic acid and washed in distilled water. The CGRP cDNA bands were detected by autoradiography (Kodak X-Omat AR) and quantified by liquid scintillation counting of the cut gel bands (Beckman) or film transmission sensitometry (Bio-Rad). Theoretically, amplification of cDNA products is given by the equation N = No × 2c, where N is the number of cDNA products synthesized, No is the number of cDNA molecules at the beginning of the reaction, c is the number of PCR cycles, and 2 is the amplification factor (doubling of the cDNA products after each cycle). Thus the amount of amplified cDNA products can be used to estimate the levels of CGRP m R N A provided that the amplification of the cDNA products is an exponential function of the number of cycles [14]. To check this prerequisite of quantitative PCR, aliquots of PCR products were analysed by polyacrylamide gel electrophoresis after 10, 15 and 20 cycles and the radioactivity of the cDNA bands was evaluated by liquid scintillation counting (Fig. 1). In our PCR system, the ratio between cDNA product amplification and the number of cycles could be described by the equation N = No × 1,3c (an increase of cDNA products by a factor of 1.3 after each cycle). This exponential amplification rate could be observed up to 20 cycles. The efficiency factor of 1,3 has been determined empirically from the radioactivity of the cDNA products. PCR of CGRP cDNA resulted in the amplification of two distinct cDNA products migrating close together. Plasmid pBR 322 DNA was subjected to complete AluI or HaellI restriction endonuclease digestion and the restriction fragments used as DNA size markers. Thus it could be verified that the PCR product had the expected molecular weight (87 bp), giving strong evidence that we specifically amplified a fragment of CGRP m R N A in our system. Additionally, negative controls were included containing no template cDNA. Serum testosterone levels decreased upon gonadec-
®
AutorQdiogrophy 10
®
15
IPCR 20 Eyctes
10000
1000
m~
100
10
1~
1'5
2'0 PCR c g c l e s
Fig 1. Efficiencyof the amplificationof ~- and fl-CGRP complementary DNA (cDNA) fragmentsin the polymerasechain reaction (PCR) using 3/d [cP2p]dATP(15 mCi/ml).A: after 10, 15 and 20 cycles,the PCR products were separated by polyacrylamidegel electrophoresis and the CGRP cDNA bands detected by autoradiography (6 h of exposure at 4°C). B: the amount of CGRP cDNA was determinedby liquid scintillationcounting.The counts per minute are plotted versus the number of polymerasechain reactioncycles.
tomy from 12+2 nM in the control group to 4+0.5 nM in the G group, whereas testosterone substitution led to an elevated level (77+10 riM). Values are mean___S.E.M. Seven animals per group were investigated. Twenty PCR cycles were sufficient to yield a product signal on the X-ray film. This is within the exponential phase of product amplification, therefore CGRP m R N A levels could be measured after 20 PCR cycles. The relative amounts of C G R P cDNA were determined geometrically from the peak areas after film sensitometry. Gonadectomy led to a significant decrease in CGRP m R N A levels in the rat ventricle (Fig. 2) to 65.2+6.4% of the control values (P < 0.05 by Student's t-test), whereas testosterone substitution in gonadectomized animals normalized CGRP gene expression to 88.0___ 1.2% of control ( P < 0.01 compared with the G group). Values are mean_4-S.E.M. Four animals per group were investigated. The present experiments suggest that CGRP is synthesized within the rat ventricle, probably in intracardiac parasympathetic ganglion cells, as it has been shown in the rat parasympathetic ciliary, sphenopalatine, otic and submandibular ganglia [11, 20]. In a recent study [5] vasoactive intestinal polypeptide (VIP) and neuropeptide Y (NPY) immunoreactivities have been detected in intracardiac ganglionic cells and postganglionic parasympathetic nerve fibres of the bovine heart supplying coronary vasculature and conductive system, strongly suggesting a peptidergic control of local cardiac blood
79
@
C
Autorodiogrophy
(3
(3+T
W
B
@ I" $EM
100
"////////~
50
" °1 ";~22222.~;,
0 C
G
G+T
*p<0.05, CvsO; ** p<0.01,O+TvsG
Fig. 2. Analysis of CGRP-mRNA levels in the hearts of spontaneously hypertensive rats after two weeks of treatment. The rats were divided into three groups: sham-operated controls (C), gonadectomized (G), and gonadectomized with dihydrotestosterone substitution (G+T). Complementary DNA (cDNA) products were derived from the reverse transcriptase reaction of CGRP mRNA and were amplified by polymerase chain reaction (PCR) using 3/~1[~-32p]dATP (15 mCi/ml). After 20 PCR cycles, products were analysed by polyacrylamide gel electrophoresis. The CGRP cDNA bands were detected by autoradiography (A) 6 h of exposure at 4°C) and evaluated geometrically by film sensitometry (B). (Values are mean_ S.E.M.; 4 animals per group were investigated.)
flow. In contrast to the VIPergic cardiac innervation, which may stem from intrinsic postganglionic parasympathetic neurons [23], CGRPergic nervous supply may mainly represent extrinsic, capsaicin-sensitive sensory afferents. However a distinct class offl-CGRP-containing nerve fibres which are insensitive to neonatal capsaicin treatment has been detected in the cardiovascular tissue and intestine of the rat [15, 16]. Since our primers are homologous to both 0t-CGRP and fl-CGRP, we were not able to distinguish whether in the rat heart the ~-CGRP/ calcitonin gene or the fl-CGRP gene which does not code for calcitonin or both are expressed [2]. It has been shown that receptor binding sites showing equal affinities for both peptides are present on membranes of the rat heart [16]. Our second important finding is that CGRP gene expression is activated by gonadal steroids, since gonadectomy significantly decreased CGRP mRNA levels while testosterone substitution normalized CGRP expression. Previous studies have shown that specific receptors for androgens exist in the rat heart, and that
testosterone treatment increased RNA concentrations of the ventricular myocardium [9, 10]. In analogy to our results, it has been demonstrated that the expression of the neuropeptide cholecystokinin [21] and the expresssion of ventricular myosin heavy chain isoenzymes [14] are regulated by steroid hormones at the mRNA level. Gonadectomy did not completely abolish serum testosterone levels, therefore the remaining concentrations could be sufficient to maintain a CGRP gene expression of approximately 65% of the controls. Steroid hormones regulate gene expression first by binding to their specific receptors and then by direct interaction of the hormone-receptor complex with specific hormone response elements on the DNA which function as transcriptional enhancers [4]. We could observe part of the consensus sequence for testosterone response elements (TGTACANNNTGTTCT) in the 5'-flanking region of the rat CGRP gene by sequence comparison [19, 22]. Whether the testosterone-receptor complex may directly bind to this genomic element and subsequently enhance CGRP gene expression awaits further investigations. Supported by the Deutsche Forschungsgemeinschaft, Grant Mo 362/4-1. F.G. is the recipient of a scholarship (Landesgraduiertenf6rderung).
1 Amara, S.G., Jonas, J., Rosenfeld, M.G., Ong, E.S. and Evans, R.M., Alternative RNA processing in calcitonin gene expression generates mRNAs encoding different polypeptide products, Nature, 298 (1982) 240-244. 2 Amara, S.G., Arriza, J.L, Left, S.E., Swanson, L.W., Evans, R.M. and Rosenfeld, M.G., Expression in brain of a messenger RNA encoding a novel neuropeptide homologous to calcitonin generelated peptide, Science, 229 (1985) 1094-1097. 3 Chomczynski, P. and Sacchi, N., Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction, Anal. Biochem., 162 (1987) 156-159. 4 Evans, R.M., The steroid and thyroid hormone receptor superfamily, Science, 240 (1988) 889-895. 5 Forsgren, S., Vasoactive intestinal polypeptide-like immunoreactivity in the bovine heart: high degree of coexistence with neuropeptide Y-like immunoreactivity, Cell Tissue Res., 256 (1989) 125-135. 6 Gillardon, F., Morano, I. and Zimmermann, M. Ultraviolet irradiation of the skin attenuates calcitonin gene-related peptide mRNA expression in rat dorsal root ganglion cells, Neurosci. Lett., 124 (1991) in press. 7 Hassan, S.H., On solid phase radioimmunoassay of steroids (abstr.), Horm. Metab. Res., 3 (1971) 113. 8 Kawasaki, H., Saito, A. and Takasaki, K., Age-related decrease of calcitonin gene-related peptide-containing vasodilator innervation in the mesenteric resistance vessel of the spontaneously hypertensive rat, Circ. Res., 67 (1990) 733-743. 9 Koenig, H., Goldstone, A. and Lu, C.Y., Testosterone-mediated sexual dimorphism of the rodent heart, Circ. Res., 50 (1982) 782787. I0 Krieg, M., Smith, K. and Bartsch, W., Demonstration of a specific androgen receptor in the rat heart muscle. Relationship between
80
ll
12
13
14
15
16
binding, metabolism, and tissue levels of androgens, Endocrinology, 103 (1978) 1686-1694. Lee, Y., Takami, K., Kawai, J., Girgis, S., Hillyard, C.J., MacIntyre, I., Emson, P.C. and Tohyama, M., Distribution of calcitonin gene-related peptide in the rat peripheral nervous system with reference to its coexistence with substance P, Neuroscience, 15 (1985) 1227-1237. Maniatis, T., Fritsch, E.F. and Sambrook, J., Molecular Cloning. In: A Laboratory Manual, Cold Spring Harbor Laboratory, New York, 1982. McEwan, J., Larkin, S., Davies, G., Chierchia, S., Brown, M., Stevenson, J., Maclntyre, I. and Maseri, A., Calcitonin gene-related peptide: a potent dilator of human epicardial coronary arteries, Circulation, 74 (1986) 1243-1247. Morano, I., Gerstner, J., Rfiegg, J.C., Ganten, U., Ganten, D. and Vosberg, H.P., Regulation of myosin heavy chain expression in the hearts of hypertensive rats by testosterone, Circ. Res., 66 (1990) 1585--1590. Mulderry, P.K., Ghatei, M.A., Rodrigo, J., Allen, J.M., Rosenfeld, M.G., Polak, J.M. and Bloom, S.R., Calcitonin gene-related peptide in cardiovascular tissues of the rat, Neuroscience, 14 (1985) 947-054. Mulderry, P.K., Ghatei, M.A., Spokes, R.A., Jones, P.M., Pierson, A.M., Hamid, Q.A., Kanse, S., Mara, S.G., Gurrin, J.M., Legon, S., Polak, J.M. and Bloom, S.R., Differential expression of ~CGRP and fl-CGRP by primary sensory neurons and enteric autonomic neurons in the rat, Neuroscience, 25 (1988) 195-205.
17 Nishiyma, K., Nishiyama, A. and Frohlich, E.D., Regional blood flow in normotensive and spontaneously hypertensive rats, Am. J. Physiol. 230 (1976) 691 698. 18 Ono, K., Delay, M., Nakajima, T., Irisawa, H. and Giles, W., Cal~ citonin gene-related peptide regulates calcium current in heart muscle, Nature, 340 (1989) 721 724. 19 Schmid, W., Strahle, U., Mestril, R., Glock, G., Ankenbauer, W. and Schutz, G., Steroid response elements. Definition of a minimal promoter and interaction with other activating sequences. In A.K. Roy and J.H. Clark (Eds.), Gene Regulation by Steroid Hormones, Vol. IV, Springer, New York, 1989, pp. 78-88. 20 Silverman, J.D. and Kruger, L., Calcitonin-gene-related-peptideimmunoreactive innervation of the rat head with emphasis on specialized sensory structures. J. Comp. Neurol., 280 (1989) 303 330. 21 Simerly, R.B., Hormonal control of neuropeptide gene expression in sexually dimorphic olfactory pathways, Trends Neurosci., 13 (1990) 104-1 I0. 22 Stolarsky-Fredman, L., Left, S.E., Klein, E.S., Crenshaw, E.B., Yeakley, J. and Rosenfeld, M.G., A tissue-specific enhancer in the rat-calcitonin/CGRP gene is active in both neural and endocrine cell types, Mol. Endocrinol., 4 (1990) 497-504. 23 Weihe, E., Reinecke, M. and Forssmann, W.G., Distribution of vasoactive intestinal polypeptide-like immunoreactivity in the mammalian heart, Cell Tissue Res., 236 (1984) 527 540.