IL-29) expression in human colon epithelial cells

Cytokine xxx (2013) xxx–xxx

Contents lists available at ScienceDirect

Cytokine journal homepage: www.journals.elsevier.com/cytokine

Regulation of interferon lambda-1 (IFNL1/IFN-k1/IL-29) expression in human colon epithelial cells Adam Swider, Rachael Siegel, Joyce Eskdale, Grant Gallagher ⇑ Genetic Immunology Laboratory, HUMIGEN LLC, 2439 Kuser Road, Hamilton, NJ 08690, United States1

a r t i c l e

i n f o

Article history: Received 12 March 2013 Received in revised form 14 August 2013 Accepted 23 September 2013 Available online xxxx Keywords: IFNL1 IL-29 IFN-k1 ZEB1 BLIMP-1

a b s t r a c t The efficient regulation of intestinal immune responses is critical to colon health. Viruses, for example noraviruses, are key pathogens of the intestine. The lambda interferons (comprising three ligands: IFNL1, L2 and L3 – the so-called ‘‘Type III’’ interferons) constitute the most recently discovered IFN family and are known to be important in intestinal anti-viral defense. A fourth family member, IFNL4, was recently described. Expression of the IFN-lambda receptor is restricted to epithelial and immune cells; together, these ligands and their receptor represent an important anti-viral and immunoregulatory component of the immune/epithelial inteface. We investigated control of IFNL1 expression in human colon epithelial cells. We used the TLR3 agonist poly I:C to drive expression of IFNL1 in SW480 cells, and small interfering RNA (siRNA) to knockdown target transcription factors. We identified ZEB1 and BLIMP-1 as transcription factors that strongly inhibited IFNL1 expression in SW480 cells. Interestingly, while BLIMP-1 inhibited both type-III and type-I interferons (IFN-b), the inhibitory action of ZEB1 was specific for IFNL1. We also defined the NF-jB family member, p65 as a key activator of IFNL1 and NF-jB p50 as a key inhibitor. Finally, we demonstrated that siRNA targeting of ZEB1 or NF-jB p50 resulted in a significant elevation of secreted IFN-k1 protein and expression of the anti-viral gene OAS1, while knockdown of p65 inhibited these events. Our data provide insight to the regulation of IFNL1 expression in the human colon and suggest novel therapeutic approaches to elevate IFNk-1 protein where required. Ó 2013 Published by Elsevier Ltd.

1. Introduction The type III IFNs were first described in 2003 in two independent studies, describing three highly related cytokines known as: IFN-k1, IFN-k2 and IFN-k3 (IL-29, IL-28A and IL-28B, respectively) [1,2]. These have since been found to have critical roles in coordinating anti-viral and other inflammatory responses. Type III IFNs are members of the IL10-IFN family, which also includes the IL10-like cytokines (IL-10, IL-19, IL-20, IL-22, IL-24 and IL-26), the type I IFNs (IFN-a, IFN-b, IFN-e, IFN-j, and IFN-x), and the type II IFN, IFN-c. The gene structures of the IFN-ks (IFNL1, IFNL2, and IFNL3; formerly termed IL29, IL28A, IL28B, respectively) have been reviewed in detail [3,4] and resemble those of the IL-10-like cytokines rather than those of the intron-less type I IFN genes, cytokines with which type III IFNs share many functional properties. The three IFN-k proteins are encoded on human chromosome 19q13 and display a high degree of homology (IFN-k2 and -k3 being nearly 96% identical at the protein level [1,3]). Recently, a fourth family member, IFNL4, was described. Interestingly, this

⇑ Corresponding author. Tel.: +1 609 570 1032; fax: +1 609 570 1039. 1

E-mail address: [email protected] (G. Gallagher). HUMIGEN LLC is part of the Genesis Biotechnology Group

gene encodes a functional protein only in primates and is disrupted in individuals of a particular genotype [5]. Expression of the IFNL genes has been found to be responsive to TLR signaling resulting from both viral and bacterial ligands and is most pronounced in plasmacytoid dendridic cells (pDCs) and epithelial cells [3,4,6]. Other cell-types, such as monocytes and fibroblasts, also express them [1–4,6]. All IFN-k ligands signal through a single heterodimeric receptor complex consisting of the IL-28Ra signaling chain and the accessory chain IL-10Rb [1,3]. While several cell types can be induced to produce the IFN-k ligands, expression of the type III IFN receptor is restricted to epithelial cells and leukocytes, including pDCs and T cells; therefore IFN-k ligands are selectively active on these cell types [7–16]. The primary outcome of type III IFN signaling is similar to that of type I IFNs. pSTAT1 homodimer and pSTAT1/2 heterodimer signal transduction leads to the activation of target-gene promoter GAS and ISRE elements, respectively [1], resulting in the expression of interferon-stimulated genes (ISGs) encoding anti-viral proteins such as 20 50 -oligoadenylate synthetase 1 and 2 (OAS1 and 2), Mx-1 and 2 proteins, and IFN-inducible dsRNA-activated protein kinase [4]. While the outcome of type I and type III IFN expression may appear redundant, differences in receptor distribution confer selectivity of effect. Type III IFN expression and response is most prominent at mucosal surfaces such as in the lungs and gastro-intestinal tract,

1043-4666/$ - see front matter Ó 2013 Published by Elsevier Ltd. http://dx.doi.org/10.1016/j.cyto.2013.09.020

Please cite this article in press as: Swider A et al. Regulation of interferon lambda-1 (IFNL1/IFN-k1/IL-29) expression in human colon epithelial cells. Cytokine (2013), http://dx.doi.org/10.1016/j.cyto.2013.09.020

2

A. Swider et al. / Cytokine xxx (2013) xxx–xxx

while type I IFN expression and response is most prominent in liver, spleen and kidneys [14]. This selective receptor expression confers tight regulation of the response to type III IFNs to epithelial cells at mucosal surfaces and to the pDCs that can survey those surfaces, pointing to an important regulatory function for type III IFNs at the interfaces between the body and the outside environment. Due to functional similarities between the type I and type III IFNs, promoter regulation studies have drawn comparisons between type III and type I IFNs. Initial work focused on proximal control elements contained within the first 600 bp 50 of the transcription start site (TSS); NF-jB and IRF sites were found to be occupied within the first 300 bases of the IFN-k1 promoter following Newcastle Disease Virus infection, for example [17]. The effect of NF-jB and IRF on IFNL promoter function was also investigated by Osterlund et al., whose overexpression studies suggested that IFNL1 was regulated by IRF3, while IFNL2 and IFNL3 were more responsive to IRF7 [18]. These authors drew comparison with type I IFN regulation; IFNB is regulated by IRF-3 while IFNA is more dependent on IRF-7 [19–21]. A more recent study of IFNL1 activation in response to bacteria found that activation was dependent upon distal NF-jB sites at 1137 and 1183 bp of the promoter in monocyte-derived dendritic cells (MDDC) [22], demonstrating that the regulation of IFNL1 can be both stimulation and cell-type specific. We recently presented the first characterization of IFNL1 transcriptional regulation in human bronchial epithelial cells. We studied both the endogenous gene and luciferase reporter constructs extending to 4 kb 50 of the transcription start site, and revealed a hitherto undescribed role for ZEB1 as a powerful and selective IFNL1 transcriptional repressor [23]. BLIMP-1 (previously characterized as an IFN-b repressor) was also shown to repress IFNL1. In addition, we further defined roles for NF-jB and IRF; NF-jB c-REL/p52 and c-REL/p65 heterodimers, and IRF1, were activators while the NF-jB-p50 homodimer was repressive. Thus, we demonstrated that while there is overlapping regulation of type I and type III IFNs in these cells, ZEB1 (also known as AREB6 and TCF8 [24]) represents a key point of differential regulation between IFNL1 and the type I IFNs, suggesting possible specific modulation of the type III IFNs. The type III IFNs show potentially important mucosal epithelia specificity and anti-viral properties within the gastro-intestinal tract. Mice lacking functional receptors for type III IFNs in their intestinal epithelia were impaired in their ability to control oral infection by rotavirus, while mice lacking functional receptors for type I IFN signaling were not. Treatment of mice with IFN-k repressed rotavirus replication in the gut while type I IFN did not [25]. In addition, using intestinal cell lines and murine and human colonic tissue, IFN-k1 and IFN-k2 were demonstrated to be strong inhibitors of HCMV protein expression, thereby causing an increased expression of anti-viral proteins such as Mx-1 and OAS1. This study also demonstrated that increased IFN-k1 led to induction of the neutrophil chemoattractant IL-8, which further associates type III IFNs with inflammatory responses [26] and confirms an earlier similar observation in human PBMC [8]. Mucosal epithelial cells such as those of the colon not only provide a physical barrier against pathogens such as viruses but also serve as regulators of innate and adaptive immune responses, secreting cytokinesin response to viral infection and so triggering cellular infiltration and polarization of T-cells [3]. Expression and subsequent secretion of IFN-k1 is thought to be a critical factor in maintaining the epithelial/immune cell interface particularly through its ability to inhibit Th2 polarization [3,9,11,12]. Thus it was of interest for us in this study to determine how IFN-k1 expression is regulated in colon epithelial cells exposed to viral insult. In the present study we identified the key transcription fac-

tors acting on endogenous IFNL1 expression in colon epithelia responding to the viral-mimic poly I:C. 2. Materials and methods 2.1. Cell culture and stimulation The SW480 (CCL-228) and HT-29 (HTB-28) cell lines were purchased from the American Tissue Culture Collection (ATCC; Rockville, MD). Both cell lines were maintained as described by ATCC; SW480 cells were maintained in DMEM (GIBCO, Grand Island, NY) containing 4.5 g/L D-glucose and L-glutamine, while HT-29 cells were maintained in McCoy’s 5A (GIBCO) containing L-glutamine. Both cell lines were grown to 80% confluence then passaged by trypsinization using TrypLETM (GIBCO). For stimulation of untransfected cells, the cells were plated at a density of 2  105 cells/well in DMEM supplemented with 10% v/v Fetal Calf Serum (GIBCO) and stimulated 24 h after plating with 50 lg/mL poly I:C (Sigma–Aldrich, St Louis, MO), 1 lg/mL LPS (S. typhimurium, Sigma–Aldrich), or 1.0 ng/mL recombinant IFN-a (Humanzyme, Chicago, IL) in 24-well plates. Cells were harvested over a time-course of 24–32 h as indicated. 2.2. Small interfering RNA (siRNA) knockdown ‘‘SmartPool’’ small interfering RNA (siRNA) targeting ZEB1, BLIMP-1, NF-jB1 (p50), NF-jB2 (p52), p65, RelB, or non-targeting (NT; control) were obtained from Dharmacon (Lafayette CO). For siRNA transfection, cells were plated at a density of 2  105 cells/ well in RPMI-1640 supplemented with 10% v/v Fetal Calf Serum and transfected 24 h after plating with siRNA using Lipofectamine RNAiMax and Opti-MEM (Inivitrogen, Carlsbad, CA) according to manufacturer’s instructions. The transfection medium was replaced at 24 h post-transfection with fresh RPMI-1640 supplemented with 10% w/v Fetal Calf Serum. Stimulation with 50 lg/ mL poly I:C was carried out 48 h-post-transfection. Supernatants, protein from whole-cell extracts and RNA were harvested at the indicated time points following stimulation with poly I:C. 2.3. Western blotting Cells were harvested 36 h post-transfection by trypsinization with TrypLE™ (GIBCO). Whole cell lysates and protein from transfected cells were obtained by lysis utilizing ProteoJET™ (Fermentas, Waltham, MA), with 10 mM PMSF and protease inhibitor cocktail (Sigma–Aldrich), separated by gel electrophoresis and subjected to semi-dry immunoblotting. Antibodies specific for ZEB1 (Santa Cruz, Dallas, TX), BLIMP-1 (Cell Signaling, Danvers, MA), NF-jB p50 (Santa Cruz), NF-jB p65 (Santa Cruz), RelB (Santa Cruz), and b-actin (Sigma–Aldrich) were used for primary detection. These were visualized using horseradish-peroxidase (HRP) conjugated secondary antibodies (Thermo Scientific, Waltham, MA). Image analysis was performed using Image J software (rsbweb.nih.gov/ij/) with b-actin serving as a loading control and normalizer to quantify the degree of siRNA-mediated knockdown. 2.4. qRT-PCR Quantitative RT-PCR (qRT-PCR) was used to analyze the mRNA levels of genes of interest. RNA was reverse transcribed using the ‘‘AffinityScript QPCR cDNA Synthesis Kit’’ (Agilent Technologies, Santa Clara, CA) and subsequent qPCRs were performed using ‘‘BrilliantÒSYBRÒGreen QPCR Master Mix’’ (Agilent Technologies). Reactions were performed on Stratagene 3000P or 3005P instruments and analyzed using the accompanying MxPro

Please cite this article in press as: Swider A et al. Regulation of interferon lambda-1 (IFNL1/IFN-k1/IL-29) expression in human colon epithelial cells. Cytokine (2013), http://dx.doi.org/10.1016/j.cyto.2013.09.020

3

A. Swider et al. / Cytokine xxx (2013) xxx–xxx

software (Agilent Technologies), using hypoxanthine phosphoribosyltransferase (HPRT) as the normalizer for all samples. The primer sequences were as follows:          

IFN-k1-F: 50 CTTCCAAGCCCACCACAACT 30 , IFN-k1-R: 50 GGCCTCCAGGACCTTCAGC 30 , IFN-b-F: 50 CAGCAATTTTCAGTGTCAGAAGC 30 , IFN-b-R: 50 TCATCCTGTCCTTGAGGCAGT 30 , ZEB1-F: 50 GCACCTGAAGAGGACCAGAG 30 , ZEB1-R: 50 GCCTCTATCACAATATGGACAGG 30 , OAS1-F: 50 AACTGCTTCCGACAATCAAC 30 , OAS1-R: 50 CCTCCTTCTCCCTCCAAAA 30 , HPRT-F: 50 CAGCCCTGGCGTCGTGATTAG 30 , HPRT-R: 50 GCAAGACGTTCAGTCCTGTCCATA 30 .

For all qRT-PCR experiments, the data represent normalized fold-changes calculated using the efficiency-calibration method [27].

and IFNL3 were also found to be induced, similarly to IFNL1 (data not shown). To ensure that we could properly induce IFNL1 in a model for expression in colon epithelia we used the SW480 and HT-29 cell lines stimulated with poly I:C. Both SW480 and HT-29 cells showed strong IFNL1 induction responses to poly I:C (Fig. 1A and B). The extent to which IFNL1 was induced in both cell lines was similar, but induction kinetics varied reproducibly between the cell lines (SW480, peak 6hrs; HT-29, peak 4.5hrs). This initial description of IFNL1 expression in colon epithelial cells confirms that despite some minor cell-line-related differences in expression, IFNL1 is inducible by poly I:C in human colon epithelial cell lines. Similarly, Lipopolysacharide (LPS) from Salmonella typhimurium, a TLR4 agonist, led to induction of IFNL1 gene expression but to a lesser extent than the induction mediated by poly I:C (Fig. 1C). As has been previously been reported in other cell types [28], treatment of SW480 cells with IFN-a also led to an induction of IFNL1 gene expression (Fig. 1D).

3.2. Repressors ZEB1 and BLIMP-1 regulate IFNL1 expression, IFN-k1 secretion and downstream OAS1 expression

2.5. Elisa The IFN-k1 ELISA was performed using the Ready-Set-Go ELISA (e-Bioscience) kit, according to the manufacturer’s protocol. 2.6. Statistical Analysis Where indicated, a Student’s two-tailed t-test was used for statistical analysis. A p-value of 60.05 was considered significant. 3. Results 3.1. IFN-k1 is inducible by poly I:C in human colon epithelial cells Previous studies have shown that the type III IFNs are inducible by viral signaling through TLR3 [6,17,18,28]. Since the intact IFNL1 gene is found in humans and not mice [29], our focus is on this member of the type III IFN family in the colon, although IFNL2

B

qPCR - IFN-λ1 (SW480)

30 25

Fold Change

Fold Change

A

20 15 10 5 0

The characterization of IFNL1 regulation in bronchial epithelial cells defined ZEB1 and BLIMP-1 as two key repressors acting to repress IFNL1 gene expression in viral infection models [18]. Targeting ZEB1 with siRNA led to a 4-fold reduction in ZEB1 protein as determined by Western blotting and image analysis (Inset, Fig. 2A). This reduction of ZEB1 by siRNA in SW480 cells led to significantly increased IFNL1 expression in response to poly I:C at both the 6 h peak expression time point (3.1-fold, p = 0.03) and at 8 h (2.1-fold, p = 0.03; Fig. 2A). BLIMP-1 knockdown resulted in a 2.7-fold (p = 0.01) and 3.3-fold (p = 0.002) increase in IFNL1 at 6 and 8 h, respectively (Fig. 2B). In contrast to our previous observations in airway cells, BLIMP-1 knockdown did not result in a significant change of IFN-k1 protein secretion levels (data not shown), despite having a significant effect on mRNA levels. IFN-k1 protein secretion levels were significantly increased by ZEB1 knockdown at 24 and 32 h (Fig. 2C). As with NF-jB p50

0

1.5

3

4.5

6

25 20 15 10 5 0

24

qPCR - IFN-λ1 (HT-29)

30

0

1.5

Time (Hours)

D

qPCR - IFN-λ1 (SW480)

30 25

Fold Change

Fold Change

C

20 15 10 5 0

0

1.5

3

Time (Hours)

3

4.5

6

24

Time (Hours)

6

24

qPCR - IFN-λ1 (SW480)

30 25 20 15 10 5 0

0

1.5

3

4.5

6

24

Time (Hours)

Fig. 1. IFNL1 is induced in response to poly I:C stimulation in colon epithelia. SW480 (A) and HT-29 (B) cells were stimulated with 50 lg/mL poly I:C. SW480 cells were stimulated with LPS (C) or recombinant IFN-a (D). IFNL1 mRNA levels were monitored by qRT-PCR over a 24 h time-course. Means + SD of three technical replicates are shown. The data are representative of three independent experiments.

Please cite this article in press as: Swider A et al. Regulation of interferon lambda-1 (IFNL1/IFN-k1/IL-29) expression in human colon epithelial cells. Cytokine (2013), http://dx.doi.org/10.1016/j.cyto.2013.09.020

4

A. Swider et al. / Cytokine xxx (2013) xxx–xxx

A

B

qPCR - IFN-λ1 NT ZEB1

1200 0.25 β-actin

800

0.03

600 400

1000

0

3

6

β-actin

600 400 200

8

0

24

0

Time (Hours) ELISA - IFN-λ1

25 20

0.03

NT ZEB1

D

6

8

24

10 5

qPCR - OAS1

10 8

0.03

15

0

3

Time (Hours)

Fold Change

IFN-λ1 (pg/mL)

C

0.002

BLIMP-1 0.47

800

0.03

200

NT BLIMP-1

1200

Fold Change

ZEB1

1000

Fold Change

0.01

1400

1400

0

qPCR - IFN-λ1

0.002

NT ZEB1 0.04

6 4 2

1.5

24

32

Time (Hours)

0

0

6

24

32

Time (Hours)

Fig. 2. ZEB1 and BLIMP-1 negatively regulate IFNL1 expression in SW480 cells responding to poly I:C. SW480 cells were transfected with non-targeting, ZEB1 or BLIMP-1 specific siRNA. Western analysis and Image analysis were performed to determine the degree of knockdown of the targeted proteins (inset) the values indicated represent the amount of ZEB1 or BLIMP-1 present following siRNA transfection, relative to the non-targeting (NT) control. Transfected cells were stimulated with 50 lg/mL poly I:C. IFNL1 mRNA levels were measured over 24 h by qRT-PCR for: (A) ZEB1 siRNA and, (B) BLIMP-1 siRNA. (C) IFN-k1 protein secretion was monitored over 32 h. (D) Following ZEB1 siRNA treatment, OAS1 mRNA levels were monitored by qRT-PCR over 32 h of poly I:C stimulation. Means + SD of three technical replicates are shown. Data are representative of three independent experiments.

knockdown, ZEB1 knockdown led to significantly increased OAS1 expression at 24 and 32 h (p = 0.04 and p = 0.002; Fig. 2D). These data are in concordance with our previous findings in airway epithelial cells and support the role of ZEB1 as a negative regulator of IFNL1 expression and IFN-k1 secretion in colon epithelial cells. Interestingly, while BLIMP-1 repressed IFNL1 transcription in this study, it left IFN-k1 secretion unaltered, in sharp contrast to its action in the airway [23]. 3.3. Activating and repressive roles of NF-jB family members The NF-jB family members are widely recognized as activating or repressing many immune and inflammatory genes [30–32]. The role of different NF-jB dimers binding to putative binding sites within the IFNL1 promoter has been demonstrated in several studies, including our previous study in airway cells [17,18,22,23]. Using siRNA knockdown, we showed that the relevant NF-jB subunits regulating the IFNL1 gene in response to poly I:C were p50 and p65. Specifically, p50 had a repressive function and p65 was found to be a powerful activator of IFNL1 expression. In the present study, p50 knockdown (Fig. 3A) resulted in a robust and sustained induction of IFNL1 mRNA (Fig. 3B) illustrated by significant increases at 3 and 8 h of 2.3-fold (p = 0.03) and 3.8-fold (p = 4  104), respectively; the increase suggested at 24 h was not statistically significant (p = 0.056). p65 knockdown (Fig. 3A) resulted in a significant and sustained loss of IFNL1 gene expression at all time points other than 24 h (Fig. 3C). mRNA levels were significantly decreased at 3 h (7.2-fold, p = 0.03), 6 h (17.9-fold, p = 2.0  103) and 8 h (8.6-fold, p = 0.02). RelB, which was previously shown to bind IFNL1 promoter elements in virally infected HEK293 cells [18], appeared to not regulate IFNL1 in colon cells

as its knockdown (Fig. 3A) did not significantly alter expression levels relative to control (Fig. 3D). p50 knockdown resulted in significant increases in secreted IFN-k1 (p = 2.8  105 and 1.6  105), while p65 knockdown resulted in significant decreases, at both the 24 and 32 h time points (p = 3  104 and 5.4  104, respectively; Fig. 3E). As expected, these changes in secreted IFN-k1 resulted in concomitant changes in OAS1 gene expression (Fig. 3F). p50 knockdown resulted in a 2-fold increase at 8 h (p = 0.04) and a 4.5-fold increase at 32 h (p = 3.8  103), while p65 knockdown resulted in a 2.7-fold decrease at 24 h (p = 0.005) and a 3.3-fold decrease at 32 h (p = 2.0  103). 3.4. ZEB1 knockdown may specifically enhance IFN-k1 mediated viral responses in the colon The characterization of ZEB1 as a negative regulator of type III and not type I IFN was an important and novel description of a difference in the mechanisms acting to regulate transcription between type I and type III IFNs in the airway [23]. Based on the evidence that ZEB1 did not regulate IFN-b in bronchial epithelial cells, we sought to determine if the same distinction was apparent in colon epithelia. ZEB1 knockdown did not significantly change IFN-b expression relative to the NT group (Fig. 4A). BLIMP-1 is well characterized as a negative regulator of IFN-b [33,34] and its knockdown resulted in a significant increase in IFN-b. BLIMP-1 knockdown resulted in a 4.4-fold increase seen at 3 h (p = 0.01) and supports the role of BLIMP-1 as a negative regulator of IFN-b. Like BLIMP-1, NF-jB is not a type III IFN specific regulator. NF-jB is well known to be a component of the enhanceosome, giving rise to activation of IFNB gene expression in response to virus [31–38]. More specifically, p50/p65 heterodimers are the subunits

Please cite this article in press as: Swider A et al. Regulation of interferon lambda-1 (IFNL1/IFN-k1/IL-29) expression in human colon epithelial cells. Cytokine (2013), http://dx.doi.org/10.1016/j.cyto.2013.09.020

5

A. Swider et al. / Cytokine xxx (2013) xxx–xxx

A

siRNA NT

p50

siRNA NT

p65

p65

RelB

0.12 p50

β-actin

0.27

Rel B 0.53

0.50

β-actin

60

NT p50 p50

50

C

qPCR - IFN-λ1 4x10-4

0.03

40 30 20 10 0

0

3

6

8

70 60 50

NT p65 p65 2.6x10-3

40 30

0.03

ELISA - IFNλ1

0

3

1.3x10-4 NT p50 p65

0

5.4x10-4

32

60 50

qPCR - IFN-λ1 NT RelB RelB

40 30 20

8

0

24

0

3

6

8

24

Time (Hours)

qPCR - OAS1

F

1.6x10-5

2.0x10-3

300

2.8x10-5

24

6

Time (Hours)

Fold Change

IFN-λ1 (pg/mL)

90 80 70 60 50 40 30 20 10 0

70

10

10

Time (Hours)

E

0.02

20 0

24

D

qPCR - IFN-λ1

Fold Change

70

Fold Change

Fold Change

B

250 200

3.8x10-3

NT p50 p65

150 100

0.005 0.04

50 0

0

Time (Hours)

8

24

32

Time (Hours)

Fig. 3. IFNL1 expression in SW480 cells is negatively regulated by p50 and positively regulated by p65 in response to poly I:C. SW480 cells were transfected with nontargeting, p50, p65 or RelB specific siRNA. (A) Western blot analysis was used to determine the degree of knockdown of the targeted genes. Transfected cells were stimulated with 50 lg/mL poly I:C. IFNL1 mRNA levels were measured over 24 h by qRT-PCR for: (B) NF-jB p50 siRNA, (C) NF-jB p65 siRNA, (D) RelB siRNA. (E) IFN-k1 protein secretion was monitored over 32 h. (F) Following NF-jB p50/p65 siRNA treatment, OAS1 mRNA levels were monitored by qRT-PCR over 32 h of poly I:C stimulation. Means + SD of three technical replicates are shown. Data are representative of three independent experiments.

representing NF-jB in the enhanceosome. Our results show a similar result of p50 knockdown on IFN-b to that seen on the type III IFNs (Fig. 4B). The 2.5-fold increase seen at 3 h is significant (p = 0.049), and so it may be that p50 forms a repressive dimer at this time point. In line with its role in the IFN-b enhanceosome, p65 knockdown resulted in significant decreases at 3 and 8 h (p = 0.02 and 0.03, respectively; Fig. 4B); p65 therefore appears to be an activator of both IFN families in SW480 cells. Therefore, these data demonstrate that, in response to poly I:C stimulation, ZEB1, uniquely of the transcription factors examined, does regulate IFNL1 but does not regulate IFN-b in colon epithelial cells, as previously observed in the airway [23].

4. Discussion The type III IFNs are an exciting family of genes that display potent immunological effects [3]. Along with their influence over adaptive immunity [9,11–13], the type III IFNs are known to induce potent anti-viral responses as part of innate immunity [1–3], a function they share with the type I IFNs. Nevertheless, the restricted response to the IFN-ks at epithelial-environment interfaces distinguishes this family from the more widely-expressed type I IFNs [10,25,26]. In the present report, we have identified key regulators controlling the transcription of IFNL1 in human colon epithelial cells in response to poly I:C stimulation (mimicking viral infection) and define ZEB1 as a key negative regulator of type III, but not type I IFN, in human colon epithelial cells.

We first induced IFNL1 expression in colon epithelial cell lines by poly I:C stimulation, as we had previously done in the airway. Using siRNA to knockdown candidate regulators, we examined the regulation of endogenous IFNL1 expression in the colon and compared it with our previous results from the airway [23]. We showed previously that the transcription factors negatively regulating expression of type I and type III differed in bronchial epithelial cells, where ZEB1 regulation acted on type III IFNs and not on type I IFNs [23]. We sought to make similar comparisons in the colon. Using siRNA knockdown, we showed that ZEB1 did regulate IFNL1 (Fig. 2A) but did not regulate IFNB (Fig. 4B). We can consequently speculate that the increases in IFN-k1 protein (Fig. 2C) and OAS1 mRNA (Fig. 2D) that resulted from ZEB1 knockdown were due to these increases in IFNL1 mRNA expression and subsequent IFN-k1 secretion (Fig. 2C). The contribution of increases of IFNL1 and IFN-b expression to increases in IFN-k1 protein levels and OAS1 expression is interesting because feedback relationships exist between the two. For example, using knockout mice for type I or type III IFN receptors, Ank et al. found that type I IFN could act in a positive feedback loop to induce both the type I and type III IFNs. In contrast, type III IFNs could not lead to the induction of either [28]. Several other studies support these feedback mechanisms in human cells, showing that pretreatment with type I IFNs can overcome lacking or limited induction of type I or type III IFN expression following virus infection or LPS stimulation [39–42]. Considering this, one would expect that the increased expression of IFN-b when BLIMP-1 was targeted by siRNA would modulate IFN-k1 levels in those groups.

Please cite this article in press as: Swider A et al. Regulation of interferon lambda-1 (IFNL1/IFN-k1/IL-29) expression in human colon epithelial cells. Cytokine (2013), http://dx.doi.org/10.1016/j.cyto.2013.09.020

6

A. Swider et al. / Cytokine xxx (2013) xxx–xxx

Fold Induction

A

qPCR - IFN-β

25 20

NT ZEB1 Blimp -1

0.01

15 10 5 0

0

3

6

8

24

Time (Hours)

B 40

Fold Change

35 30

NT p50 p65

0.02 0.05

qPCR - IFN-β

25 20 15

0.03

10 5 0

0

3

6

8

24

Time (Hours) Fig. 4. ZEB1 does not regulate the type I IFN, IFNB. IFNB mRNA levels were monitored by qRT-PCR in SW480 cells that had been transfected with: (A) ZEB1 or BLIMP-1, or (B) NF-jB p50 or NF-jB p65specific siRNA, were stimulated with 50 lg/ mL poly I:C 48-h post-transfection. All groups were compared to a non-targeting siRNA control. Means + SD of three technical replicates are shown. Data are representative of three independent experiments.

[18], the loss of p65 was sufficient to completely abrogate gene expression. Therefore, p65 is functionally characterized here to play a critical role in IFNL1 induction by TLR3 activation in SW480 cells. Due to the overlapping functions of the type I and type III IFNs [1–3,43,44], it is important to understand key regulatory differences between the two groups. As with the intracellular dissimilarities discussed above, intercellular distinctions between type I and type III IFN expression have also been reported. For instance, bronchial epithelial cells were found to preferentially express type III IFN over type I [45]. It may be that type III IFNs are more critical to anti-viral defenses at epithelial surfaces [46]. Pulverer et al. utilized transgenic mice possessing ISG reporter genes to show that the small and large intestines had a greater responsiveness to type III IFN than to type I IFN [11]. These findings concur with those of Pott et al., who suggested that IFN-k1 was critical to the host mucosal anti-viral defense in the small intestine against rotavirus, and that IFN-a/b could not compensate for a lack of IFN-k1 [25]. Thus, strong evidence suggests that type III IFNs appear to have a vital role at mucosal epithelial barriers to the environment; thus, determining specific regulators of type III IFNs may be an attractive strategy for modulating local epithelial host defense without the systemic side effects known to result from type I IFN therapy. In conclusion, we were able to support the role of ZEB-1, BLIMP1 and NF-jB p50 and p65 as IFNL1 transcriptional regulators and substantiate them as potential targets for modulating type III IFN levels and resulting anti-viral responses in the colon. Acknowledgements This work was supported intramurally by HUMIGEN LLC. All authors are employees of HUMIGEN LLC. References

IFNL1 mRNA levels were increased at 6 and 8 h but expression levels returned back to that of the NT group at 24 h (Fig. 2B). However, even though mRNA levels were increased, we did not see changes in IFN-k1 protein secretion in BLIMP-1 knockdown groups. While it is possible that, through positive feedback mechanisms, IFN-k1 protein expression increases occurred earlier or later than the times measured, our results do not support this; the increases in IFN-k1 protein secretion in response to ZEB1 knockdown translated to changes at the times indicated (Fig. 2C) and ZEB1 knockdown resulted in increased IFNL1 mRNA levels at the same times that BLIMP-1 knockdown did (Fig. 2A and B). These observations suggest that an as-yet undefined post-transcriptional regulation of IFN-k1 expression may exist. We showed that NF-jB family members regulate IFNL1 in colon epithelial cells similarly to airway epithelial cells. NF-jB p50 homodimers are known to be repressive while other family members can have activating roles as homo- or heterodimers [30–32]. Our data suggest a partial effect of p50 in suppressing the activation of IFNL1, as demonstrated at 3 h when IFNL1 gene expression is still approaching peak, as well as a role in the repression of gene expression after peak induction is over (Fig. 3B). On the other hand, p65 is seen to be necessary for the induction of IFNL1 and for its continued expression across the time-course (Fig. 3C). These data are in agreement with our previous characterization of IFNL1 regulation in the airway, where we demonstrated that both the proximal and distal NF-jB sites are occupied by p50 homodimers during periods of gene inactivity. p65/c-Rel heterodimers were seen to occupy the distal NF-jB site during gene activation, while the proximal NF-jB site was found to be occupied by p52/c-Rel heterodimers at periods of activation [23]. Despite IRF3 and IRF7 having been characterized as critical activators of IFNL1

[1] Kotenko SV, Gallagher G, Baurin VV, Lewis-Antes A, Shen M, Shah NK, et al. IFN-lambdas mediate antiviral protection through a distinct class II cytokine receptor complex. Nat Immunol 2003;4:69–77. [2] Sheppard P, Kindsvogel W, Xu W, Henderson K, Schlutsmeyer S, Whitmore TE, et al. IL-28, IL-29 and their class II cytokine receptor IL-28R. Nat Immunol 2003;4:63–8. [3] Gallagher G, Megjugorac NJ, Yu RY, Eskdale J, Gallagher GE, Siegel R, et al. The lambda interferons: guardians of the immune-epithelial interface and the Thelper 2 response. J Interferon Cytokine Res 2010;30:603–15. [4] Witte K, Witte E, Sabat R, Wolk K. IL-28A, IL-28B, and IL-29: promising cytokines with type I interferon-like properties. Cytokine Growth Factor Rev 2010;21:237–51. [5] Prokunina-Olsson L, Muchmore B, Tang W, Pfeiffer RM, Park H, Dickensheets H, et al. A variant upstream of IFNL3 (IL28B) creating a new interferon gene IFNL4 is associated with impaired clearance of hepatitis C virus. Nat Genet 2013;45: 164–71. [6] Coccia EM, Severa M, Giacomini E, Monneron D, Remoli ME, Julkunen I, et al. Viral infection and Toll-like receptor agonists induce a differential expression of type I and lambda interferons in human plasmacytoid and monocytederived dendritic cells. Eur J Immunol 2004;34:796–805. [7] Pekarek V, Srinivas S, Eskdale J, Gallagher G. Interferon lambda-1 (IFNlambda1/IL-29) induces ELR(-) CXC chemokine mRNA in human peripheral blood mononuclear cells, in an IFN-gamma-independent manner. Genes Immun 2007;8:177–80. [8] Jordan WJ, Eskdale J, Boniotto M, Rodia M, Kellner D, Gallagher G. Modulation of the human cytokine response by interferon lambda-1 (IFN-lambda1/IL-29). Genes Immun 2007;8:13–20. [9] Jordan WJ, Eskdale J, Srinivas S, Pekarek V, Kelner D, Rodia M, et al. Human interferon lambda-1 (IFN-lambda1/IL-29) modulates the Th1/Th2 response. Genes Immun 2007;8:254–61. [10] Sommereyns C, Paul S, Staeheli P, Michiels T. IFN-lambda (IFN-lambda) is expressed in a tissue-dependent fashion and primarily acts on epithelial cells in vivo. PLoS Pathog 2008;4:e1000017. [11] Srinivas S, Dai J, Eskdale J, Gallagher GE, Megjugorac NJ, Gallagher G. Interferon-lambda1 (interleukin-29) preferentially down-regulates interleukin-13 over other T helper type 2 cytokine responses in vitro. Immunology 2008;125:492–502. [12] Dai J, Megjugorac NJ, Gallagher GE, Yu RY, Gallagher G. IFN-lambda1 (IL-29) inhibits GATA3 expression and suppresses Th2 responses in human naive and memory T cells. Blood 2009;113:5829–38.

Please cite this article in press as: Swider A et al. Regulation of interferon lambda-1 (IFNL1/IFN-k1/IL-29) expression in human colon epithelial cells. Cytokine (2013), http://dx.doi.org/10.1016/j.cyto.2013.09.020

A. Swider et al. / Cytokine xxx (2013) xxx–xxx [13] Megjugorac NJ, Gallagher GE, Gallagher G. Modulation of human plasmacytoid DC function by IFN-lambda1 (IL-29). J Leukoc Biol 2009;86:1359–63. [14] Pulverer JE, Rand U, Lienenklaus S, Kugel D, Zietara N, Kochs G, et al. Temporal and spatial resolution of type I and III interferon responses in vivo. J Virol 2010;84:8626–38. [15] Megjugorac NJ, Gallagher GE, Gallagher G. IL-4 enhances IFN-lambda1 (IL-29) production by plasmacytoid DCs via monocyte secretion of IL-1Ra. Blood 2010;115:4185–90. [16] Yin Z, Dai J, Deng J, Sheikh F, Natalia M, Shih T, et al. Type III IFNs are produced by and stimulate human plasmacytoid dendritic cells. J Immunol 2012; 189:2735–45. [17] Onoguchi K, Yoneyama M, Takemura A, Akira S, Taniguchi T, Namiki H, et al. Viral infections activate types I and III interferon genes through a common mechanism. J Biol Chem 2007;282:7576–81. [18] Osterlund PI, Pietila TE, Veckman V, Kotenko SV, Julkunen I. IFN regulatory factor family members differentially regulate the expression of type III IFN (IFN-lambda) genes. J Immunol 2007;179:3434–42. [19] Marie I, Durbin JE, Levy DE. Differential viral induction of distinct interferonalpha genes by positive feedback through interferon regulatory factor-7. EMBO J 1998;17:6660–9. [20] Sato M, Hata N, Asagiri M, Nakaya T, Taniguchi T, Tanaka N. Positive feedback regulation of type I IFN genes by the IFN-inducible transcription factor IRF-7. FEBS Lett 1998;441:106–10. [21] Sato M, Suemori H, Hata N, Asagiri M, Ogasawara K, Nakao K, et al. Distinct and essential roles of transcription factors IRF-3 and IRF-7 in response to viruses for IFN-alpha/beta gene induction. Immunity 2000;13:539–48. [22] Thomson SJ, Goh FG, Banks H, Krausgruber T, Kotenko SV, Foxwell BM, et al. The role of transposable elements in the regulation of IFN-lambda1 gene expression. Proc Natl Acad Sci USA 2009;106:11564–9. [23] Siegel R, Eskdale J, Gallagher G. Regulation of IFN-lambda1 promoter activity (IFN-lambda1/IL-29) in human airway epithelial cells. J Immunol 2011;187: 5636–44. [24] Vandewalle C, Van Roy F, Berx G. The role of the ZEB family of transcription factors in development and disease. Cell Mol Life Sci 2009;66:773–87. [25] Pott J, Mahlakoiv T, Mordstein M, Duerr CU, Michiels T, Stockinger S, et al. IFNlambda determines the intestinal epithelial antiviral host defense. Proc Natl Acad Sci USA 2011;108:7944–9. [26] Brand S, Beigel F, Olszak T, Zitzmann K, Eichhorst ST, Otte JM, et al. IL-28A and IL-29 mediate antiproliferative and antiviral signals in intestinal epithelial cells and murine CMV infection increases colonic IL-28A expression. Am J Physiol Gastrointest Liver Physiol 2005;289:G960–8. [27] Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 2001;29:e45. [28] Ank N, Iversen MB, Bartholdy C, Staeheli P, Hartmann R, Jensen UB, et al. An important role for type III interferon (IFN-lambda/IL-28) in TLR-induced antiviral activity. J Immunol 2008;180:2474–85. [29] Bartlett NW, Buttigieg K, Kotenko SV, Smith GL. Murine interferon lambdas (type III interferons) exhibit potent antiviral activity in vivo in a poxvirus infection model. J Gen Virol 2005;86:1589–96. [30] Fujita T, Nolan GP, Ghosh S, Baltimore D. Independent modes of transcriptional activation by the p50 and p65 subunits of NF-kappa B. Genes Dev 1992;6: 775–87.

7

[31] Ganchi PA, Sun SC, Greene WC, Ballard DW. A novel NF-kappa B complex containing p65 homodimers: implications for transcriptional control at the level of subunit dimerization. Mol Cell Biol 1993;13:7826–35. [32] Zhong H, May MJ, Jimi E, Ghosh S. The phosphorylation status of nuclear NFkappa B determines its association with CBP/p300 or HDAC-1. Mol Cell 2002;9:625–36. [33] Keller AD, Maniatis T. Identification and characterization of a novel repressor of beta-interferon gene expression. Genes Dev 1991;5:868–79. [34] Ren B, Chee KJ, Kim TH, Maniatis T. PRDI-BF1/Blimp-1 repression is mediated by corepressors of the Groucho family of proteins. Genes Dev 1999;13:125–37. [35] Thanos D, Maniatis T. Virus induction of human IFN beta gene expression requires the assembly of an enhanceosome. Cell 1995;83:1091–100. [36] Thanos D, Maniatis T. Identification of the rel family members required for virus induction of the human beta interferon gene. Mol Cell Biol 1995;15: 152–64. [37] Agalioti T, Lomvardas S, Parekh B, Yie J, Maniatis T, Thanos D. Ordered recruitment of chromatin modifying and general transcription factors to the IFN-beta promoter. Cell 2000;103:667–78. [38] Wang J, Basagoudanavar SH, Wang X, Hopewell E, Albrecht R, Garcia-Sastre A, et al. NF-kappa B RelA subunit is crucial for early IFN-beta expression and resistance to RNA virus replication. J Immunol 2010;185:1720–9. [39] Siren J, Pirhonen J, Julkunen I, Matikainen S. IFN-alpha regulates TLRdependent gene expression of IFN-alpha, IFN-beta, IL-28, and IL-29. J Immunol 2005;174:1932–7. [40] Matikainen S, Siren J, Tissari J, Veckman V, Pirhonen J, Severa M, et al. Tumor necrosis factor alpha enhances influenza A virus-induced expression of antiviral cytokines by activating RIG-I gene expression. J Virol 2006;80: 3515–22. [41] Melchjorsen J, Siren J, Julkunen I, Paludan SR, Matikainen S. Induction of cytokine expression by herpes simplex virus in human monocyte-derived macrophages and dendritic cells is dependent on virus replication and is counteracted by ICP27 targeting NF-kappaB and IRF-3. J Gen Virol 2006;87: 1099–108. [42] Wolk K, Witte K, Witte E, Proesch S, Schulze-Tanzil G, Nasilowska K, et al. Maturing dendritic cells are an important source of IL-29 and IL-20 that may cooperatively increase the innate immunity of keratinocytes. J Leukoc Biol 2008;83:1181–93. [43] Osterlund P, Veckman V, Siren J, Klucher KM, Hiscott J, Matikainen S, et al. Gene expression and antiviral activity of alpha/beta interferons and interleukin-29 in virus-infected human myeloid dendritic cells. J Virol 2005;79:9608–17. [44] Ank N, West H, Bartholdy C, Eriksson K, Thomsen AR, Paludan SR. Lambda interferon (IFN-lambda), a type III IFN, is induced by viruses and IFNs and displays potent antiviral activity against select virus infections in vivo. J Virol 2006;80:4501–9. [45] Khaitov MR, Laza-Stanca V, Edwards MR, Walton RP, Rohde G, Contoli M, et al. Respiratory virus induction of alpha-, beta- and lambda-interferons in bronchial epithelial cells and peripheral blood mononuclear cells. Allergy 2009;64:375–86. [46] Mordstein M, Neugebauer E, Ditt V, Jessen B, Rieger T, Falcone V, et al. Lambda interferon renders epithelial cells of the respiratory and gastrointestinal tracts resistant to viral infections. J Virol 2010;84:5670–7.

Please cite this article in press as: Swider A et al. Regulation of interferon lambda-1 (IFNL1/IFN-k1/IL-29) expression in human colon epithelial cells. Cytokine (2013), http://dx.doi.org/10.1016/j.cyto.2013.09.020