- Email: [email protected]
Regulation of neurokinin-1 receptor messenger RNA expression in synovial fibroblasts of patients with rheumatoid arthritis
Neuropeptides Neuropeptides 39 (2005) 467–474 www.elsevier.com/locate/npep
Regulation of neurokinin-1 receptor messenger RNA expression in synovial fibroblasts of patients with rheumatoid arthritis Y. Akasaka, K. Abe, T. Sato, H. Inoue
*
Pharmacological Research Department, Minophagen Pharmaceutical Co., 2-2-3, Komatsubara, Zama-shi, Kanagawa 228-0002, Japan Received 13 May 2005; accepted 8 July 2005 Available online 9 September 2005
Abstract We examined whether soluble mediators regulate the expression of tachykinin receptor mRNAs in synovial fibroblasts of patients with rheumatoid arthritis (RA). mRNAs encoding long and short isomers of neurokinin 1 receptor (NK1R), and neurokinin 2 receptor (NK2R) were confirmed by reverse transcription-polymerase chain reaction (RT-PCR) analysis. Level of long, but not the short, of NK1R mRNA was increased by treatment with 10–100 ng/ml basic fibroblast growth factor (bFGF) or 20 ng/ml tumor necrosis factor-a (TNF-a), but not with 1 ng/ml interleukin 1b (IL-1b). TNF-a upregulated NK2R mRNA as well as long NK1R mRNA whereas bFGF had no effect on NK2R mRNA. Expression of neurokinin 3 receptor (NK3R) mRNA was not observed in RA fibroblasts, and its expression was not induced by bFGF and TNF-a. The basal and increased levels of long NK1R mRNA were inhibited by treatment with 20 lM SU5402, an inhibitor of the tyrosine kinase activity of FGF receptor 1 (FGFR1), or 10 ng/ml transforming growth factor-b1 (TGF-b1). SU5402 and TGF-b1 had no effect on the basal level of short NK1R mRNA. Immunocytochemistry revealed the enhancement by bFGF of immunoreactive NK1Rs in the cells at 24 h after treatment. These results suggest that bFGF, TGF-b1, and TNF-a in synovial tissue and fluid play a role in the regulation of long NK1R expression in synovial fibroblasts of RA patients. It appears that the pathway of downregulation by TGF-b1 is more dominant in the long NK1R mRNA expression than that of upregulation by bFGF or TNF-a. Furthermore, the regulation of short NK1R mRNA expression seems to be performed via a different pathway from that of long isomer mRNA. 2005 Elsevier Ltd. All rights reserved. Keywords: Tachykinin receptor; Neurokinin-1 receptor mRNA; RT-PCR; Substance P; bFGF; TGF-b1
1. Introduction The peripheral sensory nervous system contributes to the development of acute and chronic inflammatory processes through the local release of neuropeptides (Payan, 1989). Substance P (SP), one of the most characterized neuropeptides, released after stimulation of articular C nerve fibers mediates extravasation of plasma proteins into the synovial cavity (Ferrell and Russell, 1986) and is involved in inflammatory mechanisms that contribute to joint destruction in experimental arthritis *
Corresponding author. Tel.: +81 462 51 1965; fax: +81 462 51 5871. E-mail address: [email protected] (H. Inoue). 0143-4179/$ - see front matter 2005 Elsevier Ltd. All rights reserved. doi:10.1016/j.npep.2005.07.005
(Levine et al., 1984). In fact, SP induces the release of IL-1b and TNF-a by monocytes (Kimball et al., 1988; Lotz et al., 1988), and stimulates synoviocytes to produce prostaglandin E2, collagenase (Lotz et al., 1987), gelatinase (Hecker-Kia et al., 1997), and oxygen free radicals (Tanabe et al., 1996). At present, three types of tachykinin receptors; neurokinin-1 receptors (NK1Rs), neurokinin-2 receptors (NK2Rs), and neurokinin-3 receptors (NK3Rs), have been identified. The vasoactive responses to SP are mainly mediated by the activation of NK1Rs, a G-protein-coupled receptor with seven transmembrane domains (Nakanishi, 1991; Gerard et al., 1993). NK1Rs are known to be present in neural and non-neuronal
468
Y. Akasaka et al. / Neuropeptides 39 (2005) 467–474
cells (Otsuka and Yoshioka, 1993). It has been suggested that SP and NK1Rs are involved in the development of neurogenic inflammation in central and peripheral diseases (Pernow, 1985; Maggi and Meli, 1988). Many soluble mediators such as IL-1b, bFGF, and TNF-a have been found in synovial fluid of RA patients (Feldmann et al., 1996). They are participated in inflammatory response and bone destruction in rheumatoid arthritis (RA). There is evidence for the presence of SP in synovial tissue and synovial fluid from RA patients (Devillier et al., 1986; Menkes et al., 1993). We previously reported that synovial fibroblasts isolated from patients with RA are able to induce SP production in the presence of TGF-b1 and bFGF (Inoue et al., 2001). 125Iodine-Bolton Hunter–labeled SP binds to microvascular endothelium of arthritic synovium in human, and this binding is inhibited by the NK1R antagonist, indicating that NK1Rs are distributed in human synovium (Walsh et al., 1993). In fact, NK1R mRNA is expressed in RA synoviocytes but not in normal synoviocytes (Krause et al., 1995). The strong expression of NK1R mRNA has been observed in the synovial tissue of RA patients, and the facilitation of NK1R gene expression seems to effect the disease progression of RA (Sakai et al., 1998). These facts indicate a possibility that soluble mediators seen in synovial fluid play a role in the production of tachykinins and their receptors in synovial fibroblasts. However, it is unclear whether RA synovial fibroblasts express tachykinin receptors. In this study, we have investigated the regulation of tachykinin receptor mRNA expression in synovial fibroblasts of RA patients.
2. Experimental procedures 2.1. Cell culture Synovial fibroblasts of RA patients were purchased from Cell Applications Inc. (San Diego, CA, USA). Cells were cultured in a-minimum essential medium (a-MEM; Invitrogen Corp., Carlsbad, CA, USA) containing 10% heat-inactivated fetal calf serum (FCS; BioWhittaker, Walkersville, MD, USA) and 60 lg/ml kanamycin sulfate (Invitrogen Corp.) at 37 C in a humidified atmosphere of 5% CO2 and 95% O2 air. The culture medium was replaced twice each week. The confluent cells were dispersed with trypsinization and then transferred to new plastic dishes in a split ratio of 1:2 or 1:4. The cells at 6-12 PDL (population doubling level) were used for subsequent experiments. These cells consisted of fibroblasts alone, with no dendritic or monocytic cells. 2.2. Treatment of cells with cytokine and growth factor Synovial fibroblasts were seeded at a density of 5 · 104 cells in 35 mm dishes and cultured up to conflu-
ence in the standard condition. Confluent cells were replaced in a-MEM containing 0.5% FCS and kept overnight, and then exposed to various concentrations of basic fibroblast growth factor (bFGF; Becton Dickinson, Bedford, MA, USA), 20 ng/ml tumor necrosis factor-a (TNF-a; Becton Dickinson), 1 ng/ml interleukin 1b (IL-1b; Becton Dickinson) and/or 10 ng/ml transforming growth factor-b1 (TGF-b1; Becton Dickinson), and/or 20 lM SU5402 (Calbiochem, San Diego, CA, USA) for 24 h. SU5402 was pretreated 15 min before bFGF stimulation. All reagents and culture supplies used were free of endotoxin (Limulus amoebocyte lysate assay, sensitivity 0.03 endotoxin unit [EU]/ml). 2.3. RNA extraction and RT-PCR Total RNA was extracted from confluent cells (2 · 106 cells) with ISOGEN (Nippon Gene, Toyama, Japan). Total RNA isolated from human brain (BioChain Institute, Hayward, CA, USA) was used as a positive control. To avoid genomic DNA contamination, DNase treatment was performed with 0.25 unit of DNase I (Takara Bio Inc., Siga, Japan) per 1 lg of total RNA. cDNAs were reverse transcribed from total RNA by using RNA-PCR kit (Takara Bio Inc.) and served as a template for PCR. Gene specific primers were designed as described by Page and Bell (2002) to amplify the human NK1R, (forward 5 0 ggccatgagctccaccatgtacaacccc; reverse longer form 5 0 gcatgaagggaggcaggtcaaaggcagtgg; reverse shorter form 5 0 -aatcagtctactccgggctcccattcctgg), the human NK2R (forward 5 0 -tgctggtggtgctgacgtttgccatctgct; reverse 5 0 ctgttgactctcgtggagagggaggtcgt), the human NK3R (forward 5 0 -ggctggcaatgagctcaaccatgtacaatccca; reverse 5 0 -ccaccaccctgttgctgtag), the human glyceraldehyde-3phosphate dehydrogenase (GAPDH) (forward 5 0 accacagtccatgccatcac; reverse 5 0 -ccaccaccctgttgctgtag). PCR was proceeded using 1 ll of cDNA product as a template, 10 pmol of each primers, 0.25 mM of each dNTPs, 0.1 unit of Ampli Taq Gold (Perkin Elmer, Foster City, CA, USA) and supplemented buffer. PCR amplifications were performed by using of following parameters: initial denaturation at 95 C for 9 min, followed by 25 35 cycles (94 C for 45 s, 59 C for 45 s, and 72 C for 45 s) and final elongation at 72 C for 7 min. Each PCR products were run on a 2% agarose gel and visualized with SYBR Gold (Molecular Probes, Eugene, OR, USA). 2.4. Immunocytochemistry of NK1Rs in synovial fibroblasts RA fibroblasts were cultured in chamber slides (Nunc, Naperville, IL, USA) until confluence and kept in aMEM containing 0.5% FCS for 16 h. Then cells were treated with 50 ng/ml bFGF for 24 h and fixed in 4% paraformaldehyde (Merck, Darmstadt, Germany)/phosphate buffer (pH 7.4) for 10 min at room temperature.
Y. Akasaka et al. / Neuropeptides 39 (2005) 467–474
After permeabilizing with 0.5% Triton X-100/PBS (10 min at room temperature), cells were blocked for 60 min in 10% BSA/PBS and then exposed to 1:200 dilution of rabbit anti-human NK1R IgG (Novus Biologicals, Littleton, CO, USA) over night in PBS containing 1% BSA. Further, fixed cells were incubated for 60 min at room temperature with an Alexa 488-conjugated antirabbit IgG antibody (1:200, Molecular Probes) and 0.005% DAPI (Sigma, St. Louis, MO, USA). Immunoreactivity for NK1Rs was visualized by using a confocal microscope. In control experiments, the primary antibodies were replaced with normal IgG (Santa Cruz Biotechnology, Santa Cruz, CA, USA) or serum. No staining in the control was found (data not shown).
469
3.2. Effects of bFGF on the expression of tachykinin receptor mRNAs in RA synovial fibroblasts Previous our study showed that bFGF is a promoter for the expression of preprotachykinin-A mRNAs in RA synovial fibroblasts (Inoue et al., 2001). Thus, the effect of bFGF on the level of tachykinin receptor
2.5. Statistical analysis Data are presented as means ± standard error of mean (SEM). Statistical significance was tested by oneway analysis of variance followed by DunnettÕs test. A difference was considered to be statistically significant when the P value was less than p < 0.05. 3. Results 3.1. Expression of tachykinin receptor mRNAs in RA synovial fibroblasts We first examined whether mRNAs for tachykinin receptors were expressed in RA fibroblasts by RTPCR with specific primers for NK1R, NK2R, and NK3R mRNAs. Co-expression of NK1R and NK2R mRNAs was observed in total RNA isolated from fibroblasts (Fig. 1). However, expression of NK3R mRNA was not detected. Human brain expressed mRNA encoding NK1R, NK2R, and NK3R, respectively. NK1R and NK2R mRNAs, but not NK3R mRNA, were expressed in synovial fibroblasts obtained from other RA donors (data not shown). The NK1R mRNA is known to be having two types of isomers (Fong et al., 1992). Actually, expression of long and short NK1R mRNAs was found in RA fibroblasts (Fig. 2(a) and (b)). The amplified products were confirmed to be NK1R and NK2R genes by sequence analysis, respectively (data not shown).
Fig. 2. Dose dependency of bFGF on the expression of long NK1R mRNA in RA synovial fibroblasts. RT-PCR analysis of mRNA for long (a) and short (b) NK1R. Total RNA was isolated from cells at 8 h after treatment with bFGF at 10, 50 or 100 ng/ml. The cultures without bFGF treatment served as the control (0 ng/ml). The electrophoresis pattern illustrated is a representative of four independent experiments. The intensity of NK1R bands is shown relative to that of the GAPDH bands. (n = 4 independent experiments, bars show means ± SEM).
Fig. 1. Expression of NK1R, NK2R, and NK3R mRNAs in RA synovial fibroblasts. RT-PCR analysis of mRNA for NK1R, NK2R, and NK3R expression in total RNA isolated from confluent fibroblasts and human brain. The figure was a representative of three independent experiments. SF: synovial fibroblasts.
470
Y. Akasaka et al. / Neuropeptides 39 (2005) 467–474
Fig. 4. Expression of mRNA for NK1R and NK2R in RA synovial fibroblasts treated with TNF-a or IL-1b. Total RNA was isolated from synovial fibroblasts at 8 h after treatment with 20 ng/ml TNF-a or 1 ng/ml IL-1b. The figure is a representative of three independent experiments.
Fig. 3. Time-course of long NK1R mRNA expression in RA synovial fibroblasts treated with bFGF. RT-PCR analysis of mRNA for long (a) and short (b) NK1R, NK2R, and NK3R. Total RNA was isolated from cells at 1, 3, 8, 12 or 24 h after 50 ng/ml bFGF treatment. The cultures without bFGF treatment served as the control (0 h). The electrophoresis pattern illustrated is a representative of three to four independent experiments. The intensity of long NK1R bands is shown relative to that of the GAPDH bands. (n = 3–4 independent experiments, bars show means ± SEM). *P < 0.05 vs. 0 h (DunnettÕs test).
TNF-a (20 ng/ml) (Fig. 4). But expression of short isomer mRNA was not changed. IL-1b (1 ng/ml) had little effect on both levels of NK1R and NK2R mRNAs, though there is evidence for the upregulation by IL-1b of NK1R gene expression in human macrophage cells (Simeonidis et al., 2003). 3.4. Effects of SU5402 on the expression of NK1R mRNAs in synovial fibroblasts treated with bFGF
mRNAs was examined. As shown in Fig. 2(a), bFGF induced long NK1R mRNA in a dose-dependent manner from 0 to 50 ng/ml at 8 h after treatment. An increase in long NK1R mRNA level was plateau at 50 ng/ml bFGF. Levels of GAPDH were measured as a control. Expression of short NK1R mRNA did not increase in response to bFGF even at high concentration (Fig. 2(b)). Levels of long NK1R mRNA were significantly increased at 8 h, and this upregulation persisted for up to 24 h after treatment with bFGF at 50 ng/ml (Fig. 3a). No change of short NK1R mRNA expression was observed (Fig. 3(b)). bFGF also had little effect on expression of NK2R mRNA and NK3R mRNA expression.
To examine whether expression of NK1R mRNAs is regulated through the activation of FGF receptor-1 (FGFR1), the effect of SU5402, an inhibitor of the tyrosine kinase activity, on the upregulation by bFGF of NK1R mRNAs was examined. We confirmed the existence of FGFR1 mRNA in RA synovial fibroblasts (data not shown). Furthermore, the increase in expression of FGFR1 mRNA was not observed in cells treated with bFGF or TNF-a (data not shown), indicating that they do not regulate the long NK1R mRNA expression through the upregulation of FGFR1 expression. Level of long NK1R mRNA was increased in fibroblasts treated with bFGF at 8 h, and this upregulation was completely inhibited by pretreatment with 20 lM SU5402 (Fig. 5(a)). SU5402 also decreased the basal level of long NK1R mRNA in control cells. However, SU5402 had no effect on both levels of short NK1R mRNA in untreated and bFGF-treated cells (Fig. 5(b)).
3.3. Effects of IL-1b and TNF-a on the expression of tachykinin receptor mRNAs in RA synovial fibroblasts
3.5. Effects of TGF-b1 on the increase in NK1R mRNAs by bFGF in RA synovial fibroblast
Expression of tachykinin receptor mRNAs in cells in response to TNF-a or IL-1b was examined in synovial fibroblasts. An increase in long NK1R and NK2R mRNAs was observed at 8 h in cells treated with
In the previous study, we found that level of bFGFinduced preprotachykinin-A mRNAs was enhanced by TGF-b1 treatment (Inoue et al., 2001). Expression of NK1R mRNAs was, therefore, examined in cells treated
Y. Akasaka et al. / Neuropeptides 39 (2005) 467–474
471
bFGF or with bFGF and TGF-b1 (Fig. 6(b)). An increase in level of long NK1R mRNA in response to bFGF or TNF-a was abolished by TGF-b1 (Fig. 6(a) and (c)). TGF-b1 also upregulated preprotachykinin-A mRNAs (data not shown), indicating that the downregulation of long NK1R mRNA by TGF-b1 is not due to cytotoxic. 3.6. Immunoreactivity for NK1R in untreated and bFGF-treated synovial fibroblasts Cellular localization of NK1Rs was determined by immunofluorescence using a NK1R specific antibody. Specific immunostaining of NK1R protein was observed in untreated fibroblasts (Fig. 7(a)). Expression of NK1R protein localized in the cell surface and cytoplasma was increased when comparing untreated fibroblasts and fibroblasts that had been treated with 50 ng/ml bFGF for 24 h (Fig. 7(b)).
4. Discussion
Fig. 5. Effects of SU5402 on the expression of NK1R mRNAs by bFGF in RA synovial fibroblasts. RT-PCR analysis of mRNA for long (a) and short (b) NK1R in cells treated with 20 lM SU5402 and 50 ng/ml bFGF. Total RNA was isolated from synovial fibroblasts at 8 h after treatment with SU5402 and bFGF. SU5402 was pretreated for 15 min before bFGF treatment. The electrophoresis pattern illustrated is a representative of three independent experiments. The bar graph reports the densitometric analysis of PCR bands, normalized to the corresponding GAPDH signals (n = 3 independent experiments, bars show means ± SEM). #P < 0.05 vs. control, **P < 0.01 vs. bFGF (DunnettÕs test).
with both 10 ng/ml TGF-b1 and 50 ng/ml bFGF. TGFb1 itself decreased the basal level of long NK1R mRNA, whereas it had no effect on that of short NK1R mRNA in control cells (Fig. 6(a) and (b)). Basal level of short NK1R mRNA was not changed by treatment with
The involvement of SP in RA has been suggested through animal experiments and clinical studies (Matucci-Cerinic and Partsch, 1992; Keeble and Brain, 2004). It has been considered that SP released from sensory nerve terminals in response to several stimuli induces neurogenic inflammation (Pernow, 1985; Holzer, 1988). We recently found that synovial fibroblasts can participate in the production of SP (Inoue et al., 2001). However, there is no direct evidence that SP induces inflammatory response through the activation of NK1Rs in human joint disease. In this study, we demonstrated that NK1R and NK2R mRNAs, but not NK3R mRNA, were expressed in synovial fibroblasts of RA patients. This is consistent with evidence that NK1Rs and NK2Rs are widely expressed in both the central and the peripheral tissues whereas NK3Rs are present in high amounts in the central nervous system and confined to few peripheral tissues (Maggi et al., 1993; Otsuka and Yoshioka, 1993). Our results also indicate that synovial fibroblasts may be one of target cells for SP and neurokinin A in RA tissues. The NK1Rs have been cloned from several species including human (Yokota et al., 1989; Hershey and Krause, 1990), and pharmacological studies have shown the existence of two receptor isoforms that differ in the length of the carboxyl-terminals. Two isoforms of the human NK1R are generated through alternative splicing. The short form binds SP with lower affinity than the long one and is much less effective in stimulating an electrophysiological response (Fong et al., 1992), though the role of both isomers in biological and pharmacological actions is little known. Further, the long NK1R isoform is the most prevalent throughout the
472
Y. Akasaka et al. / Neuropeptides 39 (2005) 467–474
Fig. 6. Effect of TGF-b1 on the expression of NK1R mRNAs by bFGF or TNF-a in RA synovial fibroblasts. RT-PCR analysis of mRNA for long (a, c) and short (b) NK1R in cells treated with 50 ng/ml bFGF plus 10 ng/ml TGF-b1 (a, b) or 20 ng/ml TNF-a plus TGF-b1. Total RNA was isolated from synovial fibroblasts at 8 h after treatment with bFGF plus TGF-b1 or TNF-a plus TGF-b1. The electrophoresis pattern illustrated is a representative of three independent experiments. The bar graph reports the densitometric analysis of PCR bands, normalized to the corresponding GAPDH signals (n = 3 independent experiments, bars show means ± SEM). #P < 0.05, ##P < 0.01 vs. control, ***P < 0.001, **P < 0.01 vs. bFGF (DunnettÕs test).
Fig. 7. Immunostaining of NK1R protein in RA synovial fibroblasts. Cells were stained with the anti-NK1R antibody after either no stimulation (a) or stimulation with 50 ng/ml bFGF for 24 h (b). Green: NK1R staining, Blue: DAPI nuclear staining. (Magnification: 600·).
Y. Akasaka et al. / Neuropeptides 39 (2005) 467–474
human brain, while the short form is the most represented in peripheral tissues (Caberlotto et al., 2003). In this study, we found that both long and short NK1R mRNAs are expressed in RA fibroblasts. This is the first report showing the presence of the two splice variants in the human peripheral cells. IL-1b and TNF-a are the representative cytokine involved in the development of RA. bFGF is known to function both as a synovial fibroblasts mitogen and as an angiogenesis factor (Ivashkiv, 1996). Furthermore, it has been suggested that bFGF in the synovial fluid plays a role in the joint destruction of RA (Manabe et al., 1999; Yano et al., 2001). We found that bFGF induced long NK1R mRNA whereas it had no effect on the expression of mRNA for short NK1R and NK2R in RA fibroblasts. In contrast, TNF-a increased both levels of long NK1R and NK2R mRNAs, though short NK1R mRNA expression was not induced. These findings suggest that the regulation of long NK1R mRNA expression may be different from that of short isomer mRNA expression. At the present study, however, it is unclear whether the expression of NK2R mRNA is regulated by the same pathway as that of long NK1R mRNA. The upregulation of long NK1R mRNA expression in response to bFGF was inhibited by SU5402, an inhibitor of the tyrosine kinase activity of FGFR1 (Mohammadi et al., 1997), indicating that bFGF induces the long isomer mRNA expression through the activation of FGFR1. Also, it seems that in addition to bFGF, other soluble factors released spontaneously from RA synovial fibroblasts are involved in the regulation of long NK1R mRNA expression via tyrosine kinase activity. This is supported by the finding that SU5402 decreased the level of long NK1R mRNA in untreated fibroblasts. However, the signaling pathways after FGFR1 activation leading to the upregulation of long NK1R mRNA remain to be examined. We previously demonstrated that TGF-b1 induces preprotachykinin-A mRNAs in synovial fibroblasts of patients with rheumatoid arthritis (Inoue et al., 2001). However TGF-b1 inhibited both bFGF- or TNF-a-induced up-regulation and basal expression of mRNA for the long isomer of the NK1R receptor in untreated fibroblasts. Thus, it is conceivable that TGF-b1 plays a role as a modulator in the regulation of long NK1R mRNA in synovial fibroblasts. Moreover, it appears that the pathway of downregulation by TGF-b1 is more dominant in the long NK1R mRNA expression than that of upregulation by bFGF or TNF-a. TGF-b1 has been implicated to be an anti-inflammatory mediator in the synovium (Isomaki and Punnonen, 1997). This suggests that TGF-b1 may modulate the inflammatory response to SP through the inhibition of NK1Rs expression. Others have reported that TGF-b1 downregulates the gene expression of platelet-derived growth factor a-
473
receptor in human lung fibroblasts (Bonner et al., 1995). There is evidence that human nephroblastoma overexpressed gene is upregulated by bFGF and downregulated by TGF-b1 in the NCI H295R cell line derived from adrenocortical carcinoma (Lafont et al., 2002). Our study also indicates that the expression of long NK1R mRNA is regulated by bFGF and TGF-b1 in RA synovial fibroblasts. As co-expression of bFGF with TGF-b1 in RA synovial cells has been confirmed (Goddard et al., 1992), the balance of bFGF with TGF-b1 obtained in synovial tissue and fluid is an important factor in the production of NK1Rs. This balance may vary with the pathology of arthritis. Furthermore, it is possible that NK1Rs expression is both upregulated and downregulated at different stages during the time course of joint disease. We cannot exclude the possibility that other factors also influence the levels of NK1Rs expression through the arthritic process. In addition to the increase in long NK1R mRNA expression, bFGF enhanced the immunoreactive response to NK1Rs in RA fibroblasts. This may be due to the upregulation of long NK1R protein in response to bFGF, because short NK1R mRNA expression was not affected by bFGF. In conclusion, we have demonstrated that synovial fibroblasts of RA patients express both isomers of long and short NK1R mRNAs, and NK2R mRNA but not NK3R mRNA. bFGF upregulated long NK1R mRNA but not NK2R mRNA whereas TNF-a increased the levels of long NK1R and NK2R mRNAs, though two growth factors had no effect on short NK1R mRNA expression. The upregulation of long NK1R mRNA in response to bFGF or TNF-a was inhibited by TGFb1. Our results suggest that the expression of NK1R mRNA in RA fibroblasts is regulated by soluble mediators such bFGF, TNF-a, and TGF-b1 in synovial fluid and tissues. Furthermore, it seems that the regulation of long NK1R expression is different from that of short isoform expression.
Acknowledgement We are grateful to Dr. Hiroshi Kajigaya (Nippon Professional School of Medicinal Technology) for his helpful advice and support throughout this study.
References Bonner, J.C., Badgett, A., Lindroos, P.M., Osornio-Vargas, A.R., 1995. Transforming growth factor b1 downregulates the plateletderived growth factor a-receptor subtype on human lung fibroblasts in vitro. Am. J. Respir. Cell Mol. Biol. 13, 496–505. Caberlotto, L., Hurd, Y.L., Murdock, P., Wahlin, J.P., Melotto, S., Corsi, M., Carletti, R., 2003. Neurokinin 1 receptor and relative
474
Y. Akasaka et al. / Neuropeptides 39 (2005) 467–474
abundance of the short and long isoforms in the human brain. Eur. J. Neurosci. 17, 1736–1746. Devillier, P., Weill, B., Renoux, M., Menkes, C., Pradelles, P., 1986. Elevated levels of tachykinin-like immunoreactivity in joint fluids from patients with rheumatic inflammatory diseases. N. Engl. J. Med. 314, 1323. Feldmann, M., Brennan, F.M., Maini, R.N., 1996. Role of cytokines in rheumatoid arthritis. Ann. Rev. Immunol. 14, 397–440. Ferrell, W.R., Russell, N.J., 1986. Extravasation in the knee induced by antidromic stimulation of articular C fibre afferents of anaesthetized cat. J. Physiol. (London) 397, 407–416. Fong, T.M., Anderson, S.A., Yu, H., Huang, R.R., Strader, C.D., 1992. Differential activation of intracellular effector by two isoforms of human neurokinin-1 receptor. Mol. Pharmacol. 41, 24–30. Gerard, N.P., Bao, L., Xiao-Ping, H., Gerard, C., 1993. Molecular aspect of the tachykinin receptors. Regul. Peptides 43, 21–35. Goddard, D.H., Grossman, S.L., Williams, W.V., Weiner, D.B., Gross, J.L., Eidsvoog, K., Dasch, J.R., 1992. Regulation of synovial cell growth. Coexpression of transforming growth factor beta and basic fibroblast factor by cultured synovial cells. Arthritis Rheum. 35, 1296–1303. Hecker-Kia, A., Kolkenbrock, H., Orgel, D., Zimmermann, B., Sparmann, M., Ulbrich, N., 1997. Substance P induces the secretion of gelatinase A from synovial fibroblasts. Eur. J. Clin. Chem. Clin. Biochem. 35, 655–660. Hershey, A.D., Krause, J.E., 1990. Molecular characterization of a functional cDNA encoding the rat substance P receptor. Science 247, 958–962. Holzer, P., 1988. Local effector functions of capsaicin-sensitive sensory nerve endings: involvement of tachykinins, CGRP and other neuropeptides. Neuroscience 24, 739–768. Inoue, H., Shimoyama, Y., Hirabayashi, K., Kajigaya, H., Yamamoto, S., Oda, H., Koshihara, Y., 2001. Production of neuropeptide substance P by synovial fibroblasts from patients with rheumatoid arthritis and osteoarthritis. Neurosci. Lett. 303, 149–152. Isomaki, P., Punnonen, J., 1997. Pro- and anti-inflammatory cytokines in rheumatoid arthritis. Ann. Med. 29, 499–507. Ivashkiv, L.B., 1996. Cytokine expression and cell activation in inflammatory arthrtitis. Adv. Immunol. 63, 337–376. Keeble, J.E., Brain, S.D., 2004. A role for substance P in arthritis? Neurosci. Lett. 361, 176–179. Kimball, E.S., Persico, F.J., Vaught, J.L., 1988. Substance P, neruokinin A and neurokinin B induce generation of interleukin-1 like activity by P338D1 cells. Possible relevance to arthritic disease. J. Immunol. 141, 3564–3569. Krause, J.E., DiMaggio, D.A., McCarson, K.E., 1995. Alterations in neurokinin 1 receptor gene expression in models of pain and inflammation. Can. J. Physiol. Pharmacol. 73, 854–859. Lafont, J., Laurent, M., Thiout, H., Lallemand, F., Bouc, Y.L., Atfi, A., Martinerie, C., 2002. The expression of novH in adrenocortical cells is down-regulated by TGF-b1 through c-Jun in a Smadindependent manner. J. Biol. Chem. 277, 41220–41229. Levine, J.D., Clark, R., Devor, M., Helms, C., Moskowitz, M.A., Basbaum, A.I., 1984. Intraneuronal substance P contributes to the severity of experimental arthritis. Science 226, 547–549. Lotz, M., Carson, D.A., Vaughan, J.H., 1987. Substance P activation of rheumatoid synoviocytes: neural pathway in pathogenesis of arthritis. Science 235, 893–895.
Lotz, M., Vaughan, J.H., Carson, D.A., 1988. Effect of neuropeptides on production of inflammatory cytokines by human monocytes. Science 241, 1218–1221. Maggi, C.A., Meli, A., 1988. The sensory-efferent function of capsaicin-sensitive sensory neurons. Gen. Pharmacol. 19, 1–43. Maggi, C.A., Patacchini, R., Rovero, P., Giachett, A., 1993. Tachykinin receptors and tachykinin receptor antagonists. J. Auton. Pharmacol. 13, 23–93. Manabe, N., Oda, H., Nakamura, K., Kuga, Y., Uchida, S., Kawaguchi, H., 1999. Involvement of fibroblast growth factor-2 in joint destruction of rheumatoid arthritis patients. Rheumatology 38, 714–720. Matucci-Cerinic, M., Partsch, G., 1992. The contribution of the peripheral nervous system and the neuropeptide network to the development of synovial inflammation. Clin. Exper. Rheumatol. 10, 211–215. Menkes, C.J., Renoux, M., Laoussadi, S., Mauborgne, A., Bruxelle, J., Cesselin, F., 1993. Substance P levels in the synovium and synovial fluid from patients with rheumatoid arthritis and osteoarthritis. J. Rheumatol. 20, 714–717. Mohammadi, M., McMahon, G., Sun, L., Tang, C., Hirth, P., Yeh, B.K., Hubbard, S.R., Schlessinger, J., 1997. Structures of the tyrosine kinase domain of fibroblast growth factor receptor in complex with inhibitors. Science 276, 955–960. Nakanishi, S., 1991. Mammalian tachykinin receptors. Annu. Rev. Neurosci. 14, 123–136. Otsuka, M., Yoshioka, K., 1993. Neurotransmitter functions of mammalian tachykinins. Physiol. Rev. 73, 229–308. Page, N.M., Bell, N.J., 2002. The human tachykinin NK1 (short form) and tachykinin NK4 receptor: a reappraisal. Eur. J. Pharmacol. 437, 27–30. Payan, D.G., 1989. Neuropeptides and inflammation: the role of substance P. Annu. Rev. Med. 40, 341–352. Pernow, B., 1985. Role of tachykinins in neurogenic inflammation. J. Immunol. 135 (2 Suppl), 812s–815s. Sakai, K., Matsuno, H., Tsuji, H., Tohyama, M., 1998. Substance P receptor (NK1) gene expression in synovial tissue in rheumatoid arthritis and osteoarthritis. Scand. J. Rhematol. 27, 135–141. Simeonidis, S., Castagliuolo, I., Pan, A., Liu, J., Wang, C.C., Mykoniatis, A., Pasha, A., Valenick, L., Sougioultzis, S., Zhao, D., Pothoulakis, C., 2003. Regulation of the NK1 receptor gene expression in human macrophage cells via an NF-jB site on its promoter. PNAS 100, 2957–2962. Tanabe, T., Otani, H., Mishima, K., Ogawa, R., Inagaki, C., 1996. Mechanism of oxyradical production in substance P stimulated rheumatoid synovial cells. Rheumatol. Int. 16, 159–167. Walsh, D.A., Salmon, M., Mapp, P.I., Wharton, J., Garrett, N., Blake, D.R., Polak, J.M., 1993. Microvascular substance P binding to normal and inflamed rat and human synovium. J. Pharmacol. Exp. Ther. 267, 951–960. Yano, K., Nakagawa, N., Yasuda, H., Tsuda, E., Higashino, K., 2001. Synovial cells from a patient with rheumatoid arthritis produce osteoclastogenesis inhibitory factor/osteoprotegerin: reciprocal regulation of the production by inflammatory cytokines and basic fibroblast growth factor. J. Bone Miner. Metab. 19, 365–372. Yokota, Y., Sasaki, Y., Tanaka, K., Fujiwara, T., Tsuchida, K., Shigemoto, R., Kakizuka, A., Ohkubo, H., Nakanisi, S., 1989. Molecular characterization of a functional cDNA for rat substance P receptor. J. Biol. Chem. 264, 17649–17652.
Regulation of neurokinin-1 receptor messenger RNA expression in synovial fibroblasts of patients with rheumatoid arthritis Y. Akasaka, K. Abe, T. Sato, H. Inoue
*
Pharmacological Research Department, Minophagen Pharmaceutical Co., 2-2-3, Komatsubara, Zama-shi, Kanagawa 228-0002, Japan Received 13 May 2005; accepted 8 July 2005 Available online 9 September 2005
Abstract We examined whether soluble mediators regulate the expression of tachykinin receptor mRNAs in synovial fibroblasts of patients with rheumatoid arthritis (RA). mRNAs encoding long and short isomers of neurokinin 1 receptor (NK1R), and neurokinin 2 receptor (NK2R) were confirmed by reverse transcription-polymerase chain reaction (RT-PCR) analysis. Level of long, but not the short, of NK1R mRNA was increased by treatment with 10–100 ng/ml basic fibroblast growth factor (bFGF) or 20 ng/ml tumor necrosis factor-a (TNF-a), but not with 1 ng/ml interleukin 1b (IL-1b). TNF-a upregulated NK2R mRNA as well as long NK1R mRNA whereas bFGF had no effect on NK2R mRNA. Expression of neurokinin 3 receptor (NK3R) mRNA was not observed in RA fibroblasts, and its expression was not induced by bFGF and TNF-a. The basal and increased levels of long NK1R mRNA were inhibited by treatment with 20 lM SU5402, an inhibitor of the tyrosine kinase activity of FGF receptor 1 (FGFR1), or 10 ng/ml transforming growth factor-b1 (TGF-b1). SU5402 and TGF-b1 had no effect on the basal level of short NK1R mRNA. Immunocytochemistry revealed the enhancement by bFGF of immunoreactive NK1Rs in the cells at 24 h after treatment. These results suggest that bFGF, TGF-b1, and TNF-a in synovial tissue and fluid play a role in the regulation of long NK1R expression in synovial fibroblasts of RA patients. It appears that the pathway of downregulation by TGF-b1 is more dominant in the long NK1R mRNA expression than that of upregulation by bFGF or TNF-a. Furthermore, the regulation of short NK1R mRNA expression seems to be performed via a different pathway from that of long isomer mRNA. 2005 Elsevier Ltd. All rights reserved. Keywords: Tachykinin receptor; Neurokinin-1 receptor mRNA; RT-PCR; Substance P; bFGF; TGF-b1
1. Introduction The peripheral sensory nervous system contributes to the development of acute and chronic inflammatory processes through the local release of neuropeptides (Payan, 1989). Substance P (SP), one of the most characterized neuropeptides, released after stimulation of articular C nerve fibers mediates extravasation of plasma proteins into the synovial cavity (Ferrell and Russell, 1986) and is involved in inflammatory mechanisms that contribute to joint destruction in experimental arthritis *
Corresponding author. Tel.: +81 462 51 1965; fax: +81 462 51 5871. E-mail address: [email protected] (H. Inoue). 0143-4179/$ - see front matter 2005 Elsevier Ltd. All rights reserved. doi:10.1016/j.npep.2005.07.005
(Levine et al., 1984). In fact, SP induces the release of IL-1b and TNF-a by monocytes (Kimball et al., 1988; Lotz et al., 1988), and stimulates synoviocytes to produce prostaglandin E2, collagenase (Lotz et al., 1987), gelatinase (Hecker-Kia et al., 1997), and oxygen free radicals (Tanabe et al., 1996). At present, three types of tachykinin receptors; neurokinin-1 receptors (NK1Rs), neurokinin-2 receptors (NK2Rs), and neurokinin-3 receptors (NK3Rs), have been identified. The vasoactive responses to SP are mainly mediated by the activation of NK1Rs, a G-protein-coupled receptor with seven transmembrane domains (Nakanishi, 1991; Gerard et al., 1993). NK1Rs are known to be present in neural and non-neuronal
468
Y. Akasaka et al. / Neuropeptides 39 (2005) 467–474
cells (Otsuka and Yoshioka, 1993). It has been suggested that SP and NK1Rs are involved in the development of neurogenic inflammation in central and peripheral diseases (Pernow, 1985; Maggi and Meli, 1988). Many soluble mediators such as IL-1b, bFGF, and TNF-a have been found in synovial fluid of RA patients (Feldmann et al., 1996). They are participated in inflammatory response and bone destruction in rheumatoid arthritis (RA). There is evidence for the presence of SP in synovial tissue and synovial fluid from RA patients (Devillier et al., 1986; Menkes et al., 1993). We previously reported that synovial fibroblasts isolated from patients with RA are able to induce SP production in the presence of TGF-b1 and bFGF (Inoue et al., 2001). 125Iodine-Bolton Hunter–labeled SP binds to microvascular endothelium of arthritic synovium in human, and this binding is inhibited by the NK1R antagonist, indicating that NK1Rs are distributed in human synovium (Walsh et al., 1993). In fact, NK1R mRNA is expressed in RA synoviocytes but not in normal synoviocytes (Krause et al., 1995). The strong expression of NK1R mRNA has been observed in the synovial tissue of RA patients, and the facilitation of NK1R gene expression seems to effect the disease progression of RA (Sakai et al., 1998). These facts indicate a possibility that soluble mediators seen in synovial fluid play a role in the production of tachykinins and their receptors in synovial fibroblasts. However, it is unclear whether RA synovial fibroblasts express tachykinin receptors. In this study, we have investigated the regulation of tachykinin receptor mRNA expression in synovial fibroblasts of RA patients.
2. Experimental procedures 2.1. Cell culture Synovial fibroblasts of RA patients were purchased from Cell Applications Inc. (San Diego, CA, USA). Cells were cultured in a-minimum essential medium (a-MEM; Invitrogen Corp., Carlsbad, CA, USA) containing 10% heat-inactivated fetal calf serum (FCS; BioWhittaker, Walkersville, MD, USA) and 60 lg/ml kanamycin sulfate (Invitrogen Corp.) at 37 C in a humidified atmosphere of 5% CO2 and 95% O2 air. The culture medium was replaced twice each week. The confluent cells were dispersed with trypsinization and then transferred to new plastic dishes in a split ratio of 1:2 or 1:4. The cells at 6-12 PDL (population doubling level) were used for subsequent experiments. These cells consisted of fibroblasts alone, with no dendritic or monocytic cells. 2.2. Treatment of cells with cytokine and growth factor Synovial fibroblasts were seeded at a density of 5 · 104 cells in 35 mm dishes and cultured up to conflu-
ence in the standard condition. Confluent cells were replaced in a-MEM containing 0.5% FCS and kept overnight, and then exposed to various concentrations of basic fibroblast growth factor (bFGF; Becton Dickinson, Bedford, MA, USA), 20 ng/ml tumor necrosis factor-a (TNF-a; Becton Dickinson), 1 ng/ml interleukin 1b (IL-1b; Becton Dickinson) and/or 10 ng/ml transforming growth factor-b1 (TGF-b1; Becton Dickinson), and/or 20 lM SU5402 (Calbiochem, San Diego, CA, USA) for 24 h. SU5402 was pretreated 15 min before bFGF stimulation. All reagents and culture supplies used were free of endotoxin (Limulus amoebocyte lysate assay, sensitivity 0.03 endotoxin unit [EU]/ml). 2.3. RNA extraction and RT-PCR Total RNA was extracted from confluent cells (2 · 106 cells) with ISOGEN (Nippon Gene, Toyama, Japan). Total RNA isolated from human brain (BioChain Institute, Hayward, CA, USA) was used as a positive control. To avoid genomic DNA contamination, DNase treatment was performed with 0.25 unit of DNase I (Takara Bio Inc., Siga, Japan) per 1 lg of total RNA. cDNAs were reverse transcribed from total RNA by using RNA-PCR kit (Takara Bio Inc.) and served as a template for PCR. Gene specific primers were designed as described by Page and Bell (2002) to amplify the human NK1R, (forward 5 0 ggccatgagctccaccatgtacaacccc; reverse longer form 5 0 gcatgaagggaggcaggtcaaaggcagtgg; reverse shorter form 5 0 -aatcagtctactccgggctcccattcctgg), the human NK2R (forward 5 0 -tgctggtggtgctgacgtttgccatctgct; reverse 5 0 ctgttgactctcgtggagagggaggtcgt), the human NK3R (forward 5 0 -ggctggcaatgagctcaaccatgtacaatccca; reverse 5 0 -ccaccaccctgttgctgtag), the human glyceraldehyde-3phosphate dehydrogenase (GAPDH) (forward 5 0 accacagtccatgccatcac; reverse 5 0 -ccaccaccctgttgctgtag). PCR was proceeded using 1 ll of cDNA product as a template, 10 pmol of each primers, 0.25 mM of each dNTPs, 0.1 unit of Ampli Taq Gold (Perkin Elmer, Foster City, CA, USA) and supplemented buffer. PCR amplifications were performed by using of following parameters: initial denaturation at 95 C for 9 min, followed by 25 35 cycles (94 C for 45 s, 59 C for 45 s, and 72 C for 45 s) and final elongation at 72 C for 7 min. Each PCR products were run on a 2% agarose gel and visualized with SYBR Gold (Molecular Probes, Eugene, OR, USA). 2.4. Immunocytochemistry of NK1Rs in synovial fibroblasts RA fibroblasts were cultured in chamber slides (Nunc, Naperville, IL, USA) until confluence and kept in aMEM containing 0.5% FCS for 16 h. Then cells were treated with 50 ng/ml bFGF for 24 h and fixed in 4% paraformaldehyde (Merck, Darmstadt, Germany)/phosphate buffer (pH 7.4) for 10 min at room temperature.
Y. Akasaka et al. / Neuropeptides 39 (2005) 467–474
After permeabilizing with 0.5% Triton X-100/PBS (10 min at room temperature), cells were blocked for 60 min in 10% BSA/PBS and then exposed to 1:200 dilution of rabbit anti-human NK1R IgG (Novus Biologicals, Littleton, CO, USA) over night in PBS containing 1% BSA. Further, fixed cells were incubated for 60 min at room temperature with an Alexa 488-conjugated antirabbit IgG antibody (1:200, Molecular Probes) and 0.005% DAPI (Sigma, St. Louis, MO, USA). Immunoreactivity for NK1Rs was visualized by using a confocal microscope. In control experiments, the primary antibodies were replaced with normal IgG (Santa Cruz Biotechnology, Santa Cruz, CA, USA) or serum. No staining in the control was found (data not shown).
469
3.2. Effects of bFGF on the expression of tachykinin receptor mRNAs in RA synovial fibroblasts Previous our study showed that bFGF is a promoter for the expression of preprotachykinin-A mRNAs in RA synovial fibroblasts (Inoue et al., 2001). Thus, the effect of bFGF on the level of tachykinin receptor
2.5. Statistical analysis Data are presented as means ± standard error of mean (SEM). Statistical significance was tested by oneway analysis of variance followed by DunnettÕs test. A difference was considered to be statistically significant when the P value was less than p < 0.05. 3. Results 3.1. Expression of tachykinin receptor mRNAs in RA synovial fibroblasts We first examined whether mRNAs for tachykinin receptors were expressed in RA fibroblasts by RTPCR with specific primers for NK1R, NK2R, and NK3R mRNAs. Co-expression of NK1R and NK2R mRNAs was observed in total RNA isolated from fibroblasts (Fig. 1). However, expression of NK3R mRNA was not detected. Human brain expressed mRNA encoding NK1R, NK2R, and NK3R, respectively. NK1R and NK2R mRNAs, but not NK3R mRNA, were expressed in synovial fibroblasts obtained from other RA donors (data not shown). The NK1R mRNA is known to be having two types of isomers (Fong et al., 1992). Actually, expression of long and short NK1R mRNAs was found in RA fibroblasts (Fig. 2(a) and (b)). The amplified products were confirmed to be NK1R and NK2R genes by sequence analysis, respectively (data not shown).
Fig. 2. Dose dependency of bFGF on the expression of long NK1R mRNA in RA synovial fibroblasts. RT-PCR analysis of mRNA for long (a) and short (b) NK1R. Total RNA was isolated from cells at 8 h after treatment with bFGF at 10, 50 or 100 ng/ml. The cultures without bFGF treatment served as the control (0 ng/ml). The electrophoresis pattern illustrated is a representative of four independent experiments. The intensity of NK1R bands is shown relative to that of the GAPDH bands. (n = 4 independent experiments, bars show means ± SEM).
Fig. 1. Expression of NK1R, NK2R, and NK3R mRNAs in RA synovial fibroblasts. RT-PCR analysis of mRNA for NK1R, NK2R, and NK3R expression in total RNA isolated from confluent fibroblasts and human brain. The figure was a representative of three independent experiments. SF: synovial fibroblasts.
470
Y. Akasaka et al. / Neuropeptides 39 (2005) 467–474
Fig. 4. Expression of mRNA for NK1R and NK2R in RA synovial fibroblasts treated with TNF-a or IL-1b. Total RNA was isolated from synovial fibroblasts at 8 h after treatment with 20 ng/ml TNF-a or 1 ng/ml IL-1b. The figure is a representative of three independent experiments.
Fig. 3. Time-course of long NK1R mRNA expression in RA synovial fibroblasts treated with bFGF. RT-PCR analysis of mRNA for long (a) and short (b) NK1R, NK2R, and NK3R. Total RNA was isolated from cells at 1, 3, 8, 12 or 24 h after 50 ng/ml bFGF treatment. The cultures without bFGF treatment served as the control (0 h). The electrophoresis pattern illustrated is a representative of three to four independent experiments. The intensity of long NK1R bands is shown relative to that of the GAPDH bands. (n = 3–4 independent experiments, bars show means ± SEM). *P < 0.05 vs. 0 h (DunnettÕs test).
TNF-a (20 ng/ml) (Fig. 4). But expression of short isomer mRNA was not changed. IL-1b (1 ng/ml) had little effect on both levels of NK1R and NK2R mRNAs, though there is evidence for the upregulation by IL-1b of NK1R gene expression in human macrophage cells (Simeonidis et al., 2003). 3.4. Effects of SU5402 on the expression of NK1R mRNAs in synovial fibroblasts treated with bFGF
mRNAs was examined. As shown in Fig. 2(a), bFGF induced long NK1R mRNA in a dose-dependent manner from 0 to 50 ng/ml at 8 h after treatment. An increase in long NK1R mRNA level was plateau at 50 ng/ml bFGF. Levels of GAPDH were measured as a control. Expression of short NK1R mRNA did not increase in response to bFGF even at high concentration (Fig. 2(b)). Levels of long NK1R mRNA were significantly increased at 8 h, and this upregulation persisted for up to 24 h after treatment with bFGF at 50 ng/ml (Fig. 3a). No change of short NK1R mRNA expression was observed (Fig. 3(b)). bFGF also had little effect on expression of NK2R mRNA and NK3R mRNA expression.
To examine whether expression of NK1R mRNAs is regulated through the activation of FGF receptor-1 (FGFR1), the effect of SU5402, an inhibitor of the tyrosine kinase activity, on the upregulation by bFGF of NK1R mRNAs was examined. We confirmed the existence of FGFR1 mRNA in RA synovial fibroblasts (data not shown). Furthermore, the increase in expression of FGFR1 mRNA was not observed in cells treated with bFGF or TNF-a (data not shown), indicating that they do not regulate the long NK1R mRNA expression through the upregulation of FGFR1 expression. Level of long NK1R mRNA was increased in fibroblasts treated with bFGF at 8 h, and this upregulation was completely inhibited by pretreatment with 20 lM SU5402 (Fig. 5(a)). SU5402 also decreased the basal level of long NK1R mRNA in control cells. However, SU5402 had no effect on both levels of short NK1R mRNA in untreated and bFGF-treated cells (Fig. 5(b)).
3.3. Effects of IL-1b and TNF-a on the expression of tachykinin receptor mRNAs in RA synovial fibroblasts
3.5. Effects of TGF-b1 on the increase in NK1R mRNAs by bFGF in RA synovial fibroblast
Expression of tachykinin receptor mRNAs in cells in response to TNF-a or IL-1b was examined in synovial fibroblasts. An increase in long NK1R and NK2R mRNAs was observed at 8 h in cells treated with
In the previous study, we found that level of bFGFinduced preprotachykinin-A mRNAs was enhanced by TGF-b1 treatment (Inoue et al., 2001). Expression of NK1R mRNAs was, therefore, examined in cells treated
Y. Akasaka et al. / Neuropeptides 39 (2005) 467–474
471
bFGF or with bFGF and TGF-b1 (Fig. 6(b)). An increase in level of long NK1R mRNA in response to bFGF or TNF-a was abolished by TGF-b1 (Fig. 6(a) and (c)). TGF-b1 also upregulated preprotachykinin-A mRNAs (data not shown), indicating that the downregulation of long NK1R mRNA by TGF-b1 is not due to cytotoxic. 3.6. Immunoreactivity for NK1R in untreated and bFGF-treated synovial fibroblasts Cellular localization of NK1Rs was determined by immunofluorescence using a NK1R specific antibody. Specific immunostaining of NK1R protein was observed in untreated fibroblasts (Fig. 7(a)). Expression of NK1R protein localized in the cell surface and cytoplasma was increased when comparing untreated fibroblasts and fibroblasts that had been treated with 50 ng/ml bFGF for 24 h (Fig. 7(b)).
4. Discussion
Fig. 5. Effects of SU5402 on the expression of NK1R mRNAs by bFGF in RA synovial fibroblasts. RT-PCR analysis of mRNA for long (a) and short (b) NK1R in cells treated with 20 lM SU5402 and 50 ng/ml bFGF. Total RNA was isolated from synovial fibroblasts at 8 h after treatment with SU5402 and bFGF. SU5402 was pretreated for 15 min before bFGF treatment. The electrophoresis pattern illustrated is a representative of three independent experiments. The bar graph reports the densitometric analysis of PCR bands, normalized to the corresponding GAPDH signals (n = 3 independent experiments, bars show means ± SEM). #P < 0.05 vs. control, **P < 0.01 vs. bFGF (DunnettÕs test).
with both 10 ng/ml TGF-b1 and 50 ng/ml bFGF. TGFb1 itself decreased the basal level of long NK1R mRNA, whereas it had no effect on that of short NK1R mRNA in control cells (Fig. 6(a) and (b)). Basal level of short NK1R mRNA was not changed by treatment with
The involvement of SP in RA has been suggested through animal experiments and clinical studies (Matucci-Cerinic and Partsch, 1992; Keeble and Brain, 2004). It has been considered that SP released from sensory nerve terminals in response to several stimuli induces neurogenic inflammation (Pernow, 1985; Holzer, 1988). We recently found that synovial fibroblasts can participate in the production of SP (Inoue et al., 2001). However, there is no direct evidence that SP induces inflammatory response through the activation of NK1Rs in human joint disease. In this study, we demonstrated that NK1R and NK2R mRNAs, but not NK3R mRNA, were expressed in synovial fibroblasts of RA patients. This is consistent with evidence that NK1Rs and NK2Rs are widely expressed in both the central and the peripheral tissues whereas NK3Rs are present in high amounts in the central nervous system and confined to few peripheral tissues (Maggi et al., 1993; Otsuka and Yoshioka, 1993). Our results also indicate that synovial fibroblasts may be one of target cells for SP and neurokinin A in RA tissues. The NK1Rs have been cloned from several species including human (Yokota et al., 1989; Hershey and Krause, 1990), and pharmacological studies have shown the existence of two receptor isoforms that differ in the length of the carboxyl-terminals. Two isoforms of the human NK1R are generated through alternative splicing. The short form binds SP with lower affinity than the long one and is much less effective in stimulating an electrophysiological response (Fong et al., 1992), though the role of both isomers in biological and pharmacological actions is little known. Further, the long NK1R isoform is the most prevalent throughout the
472
Y. Akasaka et al. / Neuropeptides 39 (2005) 467–474
Fig. 6. Effect of TGF-b1 on the expression of NK1R mRNAs by bFGF or TNF-a in RA synovial fibroblasts. RT-PCR analysis of mRNA for long (a, c) and short (b) NK1R in cells treated with 50 ng/ml bFGF plus 10 ng/ml TGF-b1 (a, b) or 20 ng/ml TNF-a plus TGF-b1. Total RNA was isolated from synovial fibroblasts at 8 h after treatment with bFGF plus TGF-b1 or TNF-a plus TGF-b1. The electrophoresis pattern illustrated is a representative of three independent experiments. The bar graph reports the densitometric analysis of PCR bands, normalized to the corresponding GAPDH signals (n = 3 independent experiments, bars show means ± SEM). #P < 0.05, ##P < 0.01 vs. control, ***P < 0.001, **P < 0.01 vs. bFGF (DunnettÕs test).
Fig. 7. Immunostaining of NK1R protein in RA synovial fibroblasts. Cells were stained with the anti-NK1R antibody after either no stimulation (a) or stimulation with 50 ng/ml bFGF for 24 h (b). Green: NK1R staining, Blue: DAPI nuclear staining. (Magnification: 600·).
Y. Akasaka et al. / Neuropeptides 39 (2005) 467–474
human brain, while the short form is the most represented in peripheral tissues (Caberlotto et al., 2003). In this study, we found that both long and short NK1R mRNAs are expressed in RA fibroblasts. This is the first report showing the presence of the two splice variants in the human peripheral cells. IL-1b and TNF-a are the representative cytokine involved in the development of RA. bFGF is known to function both as a synovial fibroblasts mitogen and as an angiogenesis factor (Ivashkiv, 1996). Furthermore, it has been suggested that bFGF in the synovial fluid plays a role in the joint destruction of RA (Manabe et al., 1999; Yano et al., 2001). We found that bFGF induced long NK1R mRNA whereas it had no effect on the expression of mRNA for short NK1R and NK2R in RA fibroblasts. In contrast, TNF-a increased both levels of long NK1R and NK2R mRNAs, though short NK1R mRNA expression was not induced. These findings suggest that the regulation of long NK1R mRNA expression may be different from that of short isomer mRNA expression. At the present study, however, it is unclear whether the expression of NK2R mRNA is regulated by the same pathway as that of long NK1R mRNA. The upregulation of long NK1R mRNA expression in response to bFGF was inhibited by SU5402, an inhibitor of the tyrosine kinase activity of FGFR1 (Mohammadi et al., 1997), indicating that bFGF induces the long isomer mRNA expression through the activation of FGFR1. Also, it seems that in addition to bFGF, other soluble factors released spontaneously from RA synovial fibroblasts are involved in the regulation of long NK1R mRNA expression via tyrosine kinase activity. This is supported by the finding that SU5402 decreased the level of long NK1R mRNA in untreated fibroblasts. However, the signaling pathways after FGFR1 activation leading to the upregulation of long NK1R mRNA remain to be examined. We previously demonstrated that TGF-b1 induces preprotachykinin-A mRNAs in synovial fibroblasts of patients with rheumatoid arthritis (Inoue et al., 2001). However TGF-b1 inhibited both bFGF- or TNF-a-induced up-regulation and basal expression of mRNA for the long isomer of the NK1R receptor in untreated fibroblasts. Thus, it is conceivable that TGF-b1 plays a role as a modulator in the regulation of long NK1R mRNA in synovial fibroblasts. Moreover, it appears that the pathway of downregulation by TGF-b1 is more dominant in the long NK1R mRNA expression than that of upregulation by bFGF or TNF-a. TGF-b1 has been implicated to be an anti-inflammatory mediator in the synovium (Isomaki and Punnonen, 1997). This suggests that TGF-b1 may modulate the inflammatory response to SP through the inhibition of NK1Rs expression. Others have reported that TGF-b1 downregulates the gene expression of platelet-derived growth factor a-
473
receptor in human lung fibroblasts (Bonner et al., 1995). There is evidence that human nephroblastoma overexpressed gene is upregulated by bFGF and downregulated by TGF-b1 in the NCI H295R cell line derived from adrenocortical carcinoma (Lafont et al., 2002). Our study also indicates that the expression of long NK1R mRNA is regulated by bFGF and TGF-b1 in RA synovial fibroblasts. As co-expression of bFGF with TGF-b1 in RA synovial cells has been confirmed (Goddard et al., 1992), the balance of bFGF with TGF-b1 obtained in synovial tissue and fluid is an important factor in the production of NK1Rs. This balance may vary with the pathology of arthritis. Furthermore, it is possible that NK1Rs expression is both upregulated and downregulated at different stages during the time course of joint disease. We cannot exclude the possibility that other factors also influence the levels of NK1Rs expression through the arthritic process. In addition to the increase in long NK1R mRNA expression, bFGF enhanced the immunoreactive response to NK1Rs in RA fibroblasts. This may be due to the upregulation of long NK1R protein in response to bFGF, because short NK1R mRNA expression was not affected by bFGF. In conclusion, we have demonstrated that synovial fibroblasts of RA patients express both isomers of long and short NK1R mRNAs, and NK2R mRNA but not NK3R mRNA. bFGF upregulated long NK1R mRNA but not NK2R mRNA whereas TNF-a increased the levels of long NK1R and NK2R mRNAs, though two growth factors had no effect on short NK1R mRNA expression. The upregulation of long NK1R mRNA in response to bFGF or TNF-a was inhibited by TGFb1. Our results suggest that the expression of NK1R mRNA in RA fibroblasts is regulated by soluble mediators such bFGF, TNF-a, and TGF-b1 in synovial fluid and tissues. Furthermore, it seems that the regulation of long NK1R expression is different from that of short isoform expression.
Acknowledgement We are grateful to Dr. Hiroshi Kajigaya (Nippon Professional School of Medicinal Technology) for his helpful advice and support throughout this study.
References Bonner, J.C., Badgett, A., Lindroos, P.M., Osornio-Vargas, A.R., 1995. Transforming growth factor b1 downregulates the plateletderived growth factor a-receptor subtype on human lung fibroblasts in vitro. Am. J. Respir. Cell Mol. Biol. 13, 496–505. Caberlotto, L., Hurd, Y.L., Murdock, P., Wahlin, J.P., Melotto, S., Corsi, M., Carletti, R., 2003. Neurokinin 1 receptor and relative
474
Y. Akasaka et al. / Neuropeptides 39 (2005) 467–474
abundance of the short and long isoforms in the human brain. Eur. J. Neurosci. 17, 1736–1746. Devillier, P., Weill, B., Renoux, M., Menkes, C., Pradelles, P., 1986. Elevated levels of tachykinin-like immunoreactivity in joint fluids from patients with rheumatic inflammatory diseases. N. Engl. J. Med. 314, 1323. Feldmann, M., Brennan, F.M., Maini, R.N., 1996. Role of cytokines in rheumatoid arthritis. Ann. Rev. Immunol. 14, 397–440. Ferrell, W.R., Russell, N.J., 1986. Extravasation in the knee induced by antidromic stimulation of articular C fibre afferents of anaesthetized cat. J. Physiol. (London) 397, 407–416. Fong, T.M., Anderson, S.A., Yu, H., Huang, R.R., Strader, C.D., 1992. Differential activation of intracellular effector by two isoforms of human neurokinin-1 receptor. Mol. Pharmacol. 41, 24–30. Gerard, N.P., Bao, L., Xiao-Ping, H., Gerard, C., 1993. Molecular aspect of the tachykinin receptors. Regul. Peptides 43, 21–35. Goddard, D.H., Grossman, S.L., Williams, W.V., Weiner, D.B., Gross, J.L., Eidsvoog, K., Dasch, J.R., 1992. Regulation of synovial cell growth. Coexpression of transforming growth factor beta and basic fibroblast factor by cultured synovial cells. Arthritis Rheum. 35, 1296–1303. Hecker-Kia, A., Kolkenbrock, H., Orgel, D., Zimmermann, B., Sparmann, M., Ulbrich, N., 1997. Substance P induces the secretion of gelatinase A from synovial fibroblasts. Eur. J. Clin. Chem. Clin. Biochem. 35, 655–660. Hershey, A.D., Krause, J.E., 1990. Molecular characterization of a functional cDNA encoding the rat substance P receptor. Science 247, 958–962. Holzer, P., 1988. Local effector functions of capsaicin-sensitive sensory nerve endings: involvement of tachykinins, CGRP and other neuropeptides. Neuroscience 24, 739–768. Inoue, H., Shimoyama, Y., Hirabayashi, K., Kajigaya, H., Yamamoto, S., Oda, H., Koshihara, Y., 2001. Production of neuropeptide substance P by synovial fibroblasts from patients with rheumatoid arthritis and osteoarthritis. Neurosci. Lett. 303, 149–152. Isomaki, P., Punnonen, J., 1997. Pro- and anti-inflammatory cytokines in rheumatoid arthritis. Ann. Med. 29, 499–507. Ivashkiv, L.B., 1996. Cytokine expression and cell activation in inflammatory arthrtitis. Adv. Immunol. 63, 337–376. Keeble, J.E., Brain, S.D., 2004. A role for substance P in arthritis? Neurosci. Lett. 361, 176–179. Kimball, E.S., Persico, F.J., Vaught, J.L., 1988. Substance P, neruokinin A and neurokinin B induce generation of interleukin-1 like activity by P338D1 cells. Possible relevance to arthritic disease. J. Immunol. 141, 3564–3569. Krause, J.E., DiMaggio, D.A., McCarson, K.E., 1995. Alterations in neurokinin 1 receptor gene expression in models of pain and inflammation. Can. J. Physiol. Pharmacol. 73, 854–859. Lafont, J., Laurent, M., Thiout, H., Lallemand, F., Bouc, Y.L., Atfi, A., Martinerie, C., 2002. The expression of novH in adrenocortical cells is down-regulated by TGF-b1 through c-Jun in a Smadindependent manner. J. Biol. Chem. 277, 41220–41229. Levine, J.D., Clark, R., Devor, M., Helms, C., Moskowitz, M.A., Basbaum, A.I., 1984. Intraneuronal substance P contributes to the severity of experimental arthritis. Science 226, 547–549. Lotz, M., Carson, D.A., Vaughan, J.H., 1987. Substance P activation of rheumatoid synoviocytes: neural pathway in pathogenesis of arthritis. Science 235, 893–895.
Lotz, M., Vaughan, J.H., Carson, D.A., 1988. Effect of neuropeptides on production of inflammatory cytokines by human monocytes. Science 241, 1218–1221. Maggi, C.A., Meli, A., 1988. The sensory-efferent function of capsaicin-sensitive sensory neurons. Gen. Pharmacol. 19, 1–43. Maggi, C.A., Patacchini, R., Rovero, P., Giachett, A., 1993. Tachykinin receptors and tachykinin receptor antagonists. J. Auton. Pharmacol. 13, 23–93. Manabe, N., Oda, H., Nakamura, K., Kuga, Y., Uchida, S., Kawaguchi, H., 1999. Involvement of fibroblast growth factor-2 in joint destruction of rheumatoid arthritis patients. Rheumatology 38, 714–720. Matucci-Cerinic, M., Partsch, G., 1992. The contribution of the peripheral nervous system and the neuropeptide network to the development of synovial inflammation. Clin. Exper. Rheumatol. 10, 211–215. Menkes, C.J., Renoux, M., Laoussadi, S., Mauborgne, A., Bruxelle, J., Cesselin, F., 1993. Substance P levels in the synovium and synovial fluid from patients with rheumatoid arthritis and osteoarthritis. J. Rheumatol. 20, 714–717. Mohammadi, M., McMahon, G., Sun, L., Tang, C., Hirth, P., Yeh, B.K., Hubbard, S.R., Schlessinger, J., 1997. Structures of the tyrosine kinase domain of fibroblast growth factor receptor in complex with inhibitors. Science 276, 955–960. Nakanishi, S., 1991. Mammalian tachykinin receptors. Annu. Rev. Neurosci. 14, 123–136. Otsuka, M., Yoshioka, K., 1993. Neurotransmitter functions of mammalian tachykinins. Physiol. Rev. 73, 229–308. Page, N.M., Bell, N.J., 2002. The human tachykinin NK1 (short form) and tachykinin NK4 receptor: a reappraisal. Eur. J. Pharmacol. 437, 27–30. Payan, D.G., 1989. Neuropeptides and inflammation: the role of substance P. Annu. Rev. Med. 40, 341–352. Pernow, B., 1985. Role of tachykinins in neurogenic inflammation. J. Immunol. 135 (2 Suppl), 812s–815s. Sakai, K., Matsuno, H., Tsuji, H., Tohyama, M., 1998. Substance P receptor (NK1) gene expression in synovial tissue in rheumatoid arthritis and osteoarthritis. Scand. J. Rhematol. 27, 135–141. Simeonidis, S., Castagliuolo, I., Pan, A., Liu, J., Wang, C.C., Mykoniatis, A., Pasha, A., Valenick, L., Sougioultzis, S., Zhao, D., Pothoulakis, C., 2003. Regulation of the NK1 receptor gene expression in human macrophage cells via an NF-jB site on its promoter. PNAS 100, 2957–2962. Tanabe, T., Otani, H., Mishima, K., Ogawa, R., Inagaki, C., 1996. Mechanism of oxyradical production in substance P stimulated rheumatoid synovial cells. Rheumatol. Int. 16, 159–167. Walsh, D.A., Salmon, M., Mapp, P.I., Wharton, J., Garrett, N., Blake, D.R., Polak, J.M., 1993. Microvascular substance P binding to normal and inflamed rat and human synovium. J. Pharmacol. Exp. Ther. 267, 951–960. Yano, K., Nakagawa, N., Yasuda, H., Tsuda, E., Higashino, K., 2001. Synovial cells from a patient with rheumatoid arthritis produce osteoclastogenesis inhibitory factor/osteoprotegerin: reciprocal regulation of the production by inflammatory cytokines and basic fibroblast growth factor. J. Bone Miner. Metab. 19, 365–372. Yokota, Y., Sasaki, Y., Tanaka, K., Fujiwara, T., Tsuchida, K., Shigemoto, R., Kakizuka, A., Ohkubo, H., Nakanisi, S., 1989. Molecular characterization of a functional cDNA for rat substance P receptor. J. Biol. Chem. 264, 17649–17652.