Regulation of κ-opioid receptor mRNA level by cyclic AMP and growth factors in cultured rat glial cells

Molecular Brain Research 55 Ž1998. 141–150

Research report

Regulation of k-opioid receptor mRNA level by cyclic AMP and growth factors in cultured rat glial cells Petra Tryoen-Toth a

a,c

b , Claire Gaveriaux-Ruff , Katalin Maderspach c , Gerard Labourdette ´ ´

a,)

Laboratoire de Neurobiologie du DeÕeloppement et de la Regeneration, UPR 1352 CNRS, Centre de Neurochimie, 67084 Strasbourg, France ´ ´ ´ ´ b UPR 9050 CNRS, Ecole Superieure de Biotechnologie de Strasbourg, ULP, 67400 Illkirch, Strasbourg, France ´ c Institute of Biochemistry, Biological Research Center, Hungarian Academy of Sciences, Szeged, Hungary Accepted 2 December 1997

Abstract The mRNA of the k-opioid receptor ŽKOR. has been found recently in cultured astrocytes and in microglia. By using RT-PCR and Southern hybridization, we confirmed these observations and, in addition, we observed that KOR mRNA was expressed in oligodendrocytes and in the precursors of astrocytes and oligodendrocytes. KOR mRNA level was the highest in the immature astrocytes and decreased with their maturation. Very few data are available on the regulation of KOR level by extracellular signals. Therefore, we examined the effect of three growth factors known to be present in the adult brain, basic fibroblast growth factor ŽbFGF., platelet-derived growth factor ŽPDGF-BB. and leukemia inhibitory factor ŽLIF. and of two cyclic AMP ŽcAMP. generating systems, the cAMP analog, 8-Ž4-chlorophenylthio.-cAMP and forskolin, on this level. It was found that in astrocytes, KOR mRNA level decreased dramatically under the effect of cAMP and less under the effect of bFGF while it did not change significantly after LIF treatment. In oligodendrocytes, it also decreased with cAMP, but increased under the effect of bFGF and PDGF-BB. In microglia, a decrease was observed with cAMP and lipopolysaccharides ŽLPS., the most used activators of macrophages. These results shed new evidence on the expression of opioid receptor mRNA in the glial cells of the rat CNS. The regulation of KOR mRNA level under the effect of extracellular signals suggests that opioids take part in dynamic processes in glial cells, possibly related to glial–neuron communication. q 1998 Elsevier Science B.V. Keywords: k-opioid receptor; Astrocytes; Oligodendrocytes; Microglia; Growth factors; Cyclic AMP

1. Introduction The glial cells of the central nervous system ŽCNS. are known to exert various functions dealing mainly with metabolic and trophic support to neurons. In this respect, Abbreviations: bFGF, basic fibroblast growth factor; BSA, bovine serum albumin; CNS, central nervous system; dbcAMP, dibutyryl cyclic AMP; DDM, DMEM serum-free chemically defined medium; DMEM, Dulbecco’s modified Eagle’s medium; DOR, d-opioid receptor; DTT, dithiothreitol; FBS, fetal bovine serum; IL-1, interleukin-1; KOR, k-opioid receptor; LIF, leukemia inhibitory factor; LPS, lipopolysaccharides; MMLV, Moloney murine leukemia virus; MOR, m-opioid receptor; NGF, nerve growth factor; PBS, phosphate buffered saline; PDGF, platelet-derived growth factor type BB; TNF, tumor necrosis factor; cptcAMP, 8-Ž4-chlorophenylthio.-cyclic AMP; IBMX, 3-isobutyl-1-methylxanthine; SSC, saline sodium citrate; MBP, myelin basic protein; GFAP, glial fibrillary protein ) Corresponding author. Laboratoire de Neurobiologie du Developpe´ ment et de la Regeneration, UPR 1352 CNRS, Centre de Neurochimie, 5 ´ ´ ´ rue Blaise Pascal, 67084 Strasbourg Cedex, France. Fax: q33-388-4117-80; E-mail: [email protected] 0169-328Xr98r$19.00 q 1998 Elsevier Science B.V. All rights reserved. PII S 0 1 6 9 - 3 2 8 X Ž 9 7 . 0 0 3 7 3 - 2

oligodendrocytes make myelin which facilitates nerve conduction and astrocytes transport nutrients from capillaries to the neurons and secrete neurotrophic factors w33x. Many types of receptors are present on astrocytes including receptors for hormones, for growth factors w25x, for cytokines w38x and for neuropeptides and neurotransmitters w21x. These latter receptors might participate in the clearance of extra neurotransmitters around the synapse or even in the modulation of the transmission characteristics of neighboring neurons w22x. In addition, neurotransmitters elicit various effects on astrocytes such as modification of the cell morphology, modulation of the growth rate w18,51x or regulation of the release of neurotrophic factors w35x. Opioids have a potent analgesic capacity and they produce other pharmacological effects as well and their effects are not restricted to the CNS since they modulate endocrine, cardiovascular, gastrointestinal and immune functions. Three types of opioid receptors have been identified, d ŽDOR., k ŽKOR. and m ŽMOR.. Previous works have shown that opioids elicit some effects on astroglial cells in

142

P. Tryoen-Toth et al.r Molecular Brain Research 55 (1998) 141–150

vitro, specially, they modify the cell morphology and inhibit cell division, suggesting the presence of specific receptors on these cells w12,29,40,46x. In a recent report, mouse O4 immature oligodendrocytes have been shown to express MOR by using immunocytochemistry w23x. The cloning of the three types of opiate receptors, including KOR w8,57x, has allowed the direct determination of the expression of the receptor mRNA. While the present work was in progress, microglia, which are the resident macrophages in the CNS, have been shown to express KOR mRNA by the use of the RT-PCR method w7x and astrocytes cultured from several rat brain regions have been found to express MOR, DOR and KOR mRNA by using the solution–hybridization method w47x. Furthermore, astrocytes, but not oligodendrocytes or their precursor cells, synthesize and secrete proenkephalin w32,55x. This production is stimulated by isoproterenol, a b-adrenergic receptor agonist and cyclic AMP w32x and can be modulated by various cytokines w28x. In one report, these cells have been found not to produce the KOR agonist dynorphin w55x. The expression of opioid receptor mRNA in oligodendrocytes has not yet been investigated. Nothing is known about the regulation of the expression of opiate receptors by external signals Žothers than opioids. in neural cells, except the very recent observation of the stimulation of MOR mRNA expression in cultured astrocytes under the effect of IL-1 b w48x. KOR has a widespread distribution in the CNS w30x, so we studied its expression in astroglial cells, oligodendroglial cells and in microglia in vitro. We then investigated its regulation in these glial cell types under the effect of various extracellular signals. Since astrocytes respond to many hormones and peptides through an intracellular increase in cyclic AMP w54x, we first tested the effect of an elevation of the intracellular cAMP level. Cells of the astroglial and of the oligodendroglial lineages, as well as microglia, are also known to secrete and respond to many growth factors w10,42x which are present in the developing and in the adult brain, for example FGFs w16,39x. They participate in the complex network of intercellular communication which allows the correct development and functioning of the CNS. Microglial cells, when activated, are known to play a central role in gliosis by their secretion of many cytokines and growth factors like bFGF w15,50x. They also respond to various growth factors, including bFGF w10x and cAMP w45x. In order to determine if opioids are connected to the network of intercellular communication, we tested the effects of three growth factors, bFGF, PDGF-BB and LIF, on KOR mRNA level in cells of the two macroglial lineages in vitro because it is known that they are responsive to these factors w5,31,36,42x and because these factors and their receptors have a wide distribution in the CNS, suggesting that they play prominent roles there w16,39x. Since microglial cells are known to respond to bFGF but not to PDGF and LIF, only the effect of bFGF was examined on these cells. Because of the very

low level of opiate receptor expression and of the limited amount of material available with normal cells in primary culture, we used the semi-quantitative RT-PCR method associated to Southern blotting to determine the variations in KOR levels after the various treatments of the cells.

2. Materials and methods 2.1. Materials Tissue culture Petri dishes were from Falcon ŽBecton Dickinson, USA.. Basal culture media Waymouth MD 705r1 and DMEM, donor calf serum ŽCS., fetal bovine serum ŽFBS., DTT and MMLV reverse transcriptase were purchased from Gibco Life Technologies ŽCergy Pontoise, France.. Fatty acid-free bovine serum albumin, insulin, transferrin, penicillin, streptomycin, poly-L-lysine, LPS, dbcAMP, cptcAMP, forskolin, IBMX and dNTP were from Sigma ŽSt. Louis, USA.. Recombinant human bFGF was from Pharma Biotechnologie Hannover ŽGermany.. Recombinant PDGF was from R & D Systems ŽAbingdon, GB.. Recombinant human LIF was from PeproTech ŽCanton, MA, USA.. Guanidinium thiocyanate was from Fluka Biochemika ŽSt. Quentin Fallavier, France.. Hexamer oligonucleotides were from Pharmacia ŽUppsala, Sweden.. RNAsin was from Amersham ŽLittle Chalfont, GB., Taq polymerase from EuroBio ŽLes Ulis, France. and nylon membrane from Schleicher and Schuell ŽCERA-LABO, Ecquevilly, France.. LPS was dissolved in water Ž4 mgrml. and stored at 48C for 15 days, dbcAMP, cptcAMP and IBMX were dissolved in 0.9% NaCl and stored in aliquots at y208C. Forskolin was dissolved in dimethylsulfoxide Ž10 mM.. Basic FGF stock solution Ž10 m grml. was kept at 48C in 2 M NaCl. The other growth factors were dissolved in 0.9% NaCl containing 0.1% BSA and stored in aliquots at y208C. 2.2. Culture of astroglial cells Enriched cultures of astrocytes were established from newborn rat ŽWistar. brain w41x. In brief, cerebral hemispheres, were cleaned from their meninges and mechanically dissociated with a syringe and needle. Two hemispheres were dissociated in a small volume of nutrient medium composed of Waymouth MD 705r1 basal medium containing 10% FBS and antibiotics and diluted to a final volume of 60 ml. This cell suspension was dispensed in six uncoated plastic tissue culture Petri dishes of 100-mm diameter. Cells were grown for 6 to 40 days in a controlled atmosphere Ž378C, 5% CO 2 and 85% humidity.. Growth medium was first changed at day 5 in vitro and then twice a week. For treatments, the serum containing medium was replaced, 24 h before treatment, by a chemically defined

P. Tryoen-Toth et al.r Molecular Brain Research 55 (1998) 141–150

medium ŽDDM. composed of DMEM basal medium in which 5 mgrml fatty acid-free bovine serum albumin ŽBSA. and 5 m grml bovine insulin were added. 2.3. Culture of oligodendroglial cells Cultures of mature oligodendrocytes were derived from 40- to 60-day-old mixed primary glial cultures, as previously described w4,26x. These mixed cultures containing astrocytes and oligodendrocytes were prepared by the same dissociation technique used for the astroglial cultures, with some modifications w24x. The complete culture medium was composed of a basal medium ŽWaymouth MD 705r1. and 10% CS. After 40 to 60 days of cultivation, the mature oligodendroglial cells laying on the astrocyte monolayer could be mechanically detached from that strongly adhering layer by flushing culture medium in the dish with a syringe and needle. During a 4 h long pre-plating, microglial cells and the accidentally detached astrocytes had time to stick to the plastic surface, while the oligodendrocytes remained in suspension or were loosely attached to the plastic. These cells were detached by knocking gently the dishes on the side and were then collected, centrifuged Ž800 rpm, 10 min., resuspended in nutrient medium and counted. A total of 5 = 10 6 cells were seeded per 100 mm diameter tissue culture Petri dish, previously coated with poly-L-lysine, in 10 ml complete culture medium ŽWaymouth, 10% CS.. After 2 h, the serum containing medium was replaced by the chemically defined medium DDM described above in which 5 m grml transferrin were added. These secondary cultures were grown for 2 days. Oligodendroglial progenitor cells were obtained from similar mixed primary glial cultures but they were detached after 10–12 days of cultivation. These cells were collected and pre-plated as above. The loosely attached cells were harvested as described in the case of mature oligodendrocytes. The pellets were washed in PBS and the cells were used directly for RNA extraction. 2.4. Culture of microglial cells Microglial cells were derived from 40- to 60-day-old mixed glial cultures, while oligodendrocytes were prepared. During the pre-plating procedure, microglial and astroglial cells were attached to the plastic surface of the tissue culture Petri dishes. These cells were trypsinized Ž0.25% trypsin, 1 mM EDTA in PBS., centrifuged, resuspended and counted. About 3 = 10 6 cells in 10 ml medium ŽWaymouth, 10% FBS. were placed in 100-mm diameter Petri dishes not treated for tissue culture. After 30 min, when microglial cells were already fixed to the surface, the culture medium was changed to defined medium ŽDDM.. This medium change allowed the removal of unattached contaminating astrocytes and oligodendrocytes. These cultures were maintained for 1 or 2 days.

143

2.5. Treatments For the experiments shown, we used 25-day-old astroglial cell cultures, 40-day-old oligodendroglial cell cultures Ž24 h in subculture. and 40- to 60-day-old microglial cell cultures Ž24 h in subculture.. The cells were treated in DDM for 2 days, at times 0 and 24 h, with 1 mM dbcAMP or 2 mM sodium butyrate or 100 m M cptcAMP or 10 m M forskolin or 10 ngrml bFGF or 10 ngrml PDGF or 10 ngrml LIF. In addition, microglial cells Ž24 h in subculture. were treated with E. coli LPS Ž0.1 m grml.. Each sample was derived from two Petri dishes and the experiments were repeated 3 times. For the kinetic study, the cells were treated once, with forskolin Ž10 m M. q IBMX Ž0.5 mM.. 2.6. Total RNA extraction Cultures were rinsed three times with PBS, then the cells were lysed directly in the Petri dishes with 1.8 ml of a denaturing solution containing 4 M guanidinium thiocyanate, 25 mM sodium citrate, pH 7.0, 0.5% sarcosyl and 20 mM DTT. RNA was extracted with an equal volume of 1:1 H 2 O-saturated phenolrchloroform containing 0.2 M sodium acetate, pH 4.0 w9x. The mixture was centrifuged at 13,000 = g for 20 min at 48C. Total RNA was precipitated overnight with an equal volume of isopropanol at y208C. Precipitation was repeated once, then RNA was pelleted by a 13,000 = g spin for 20 min at 48C, washed with 75% ethanol and the final pellet was resuspended in diethyl pyrocarbonate-treated water. Concentrations were determined by the optical density at 260 nm. RNA integrity and concentration were controlled by agarose gel electrophoresis Ž1% agarose, 6% HCHO.. 2.7. ReÕerse-transcriptase polymerase-chain-reaction The cDNA was synthesized from 10 m g of total RNA at 378C for 1 h. The 50 m l reaction mixture contained 400 U of MMLV reverse transcriptase, 200 ng random hexamer oligonucleotides, 4 mM dNTP, 10 mM DTT and 10 U of RNAsin in 20% 5 = RT buffer Ž0.25 M Tris–HCl, pH 8.3; 0.375 M KCl, 15 mM MgCl 2 .. KOR transcripts were amplified by PCR following our strategy w17x. Specific primers, 5X GAGAGCTCGCGGCCGCGTCTACTTGATGAATTCTTGG3X Žforward. and 5X GGAAGCTTGAATTCGGAAGCAGGATCCTGAACTG3X Žreverse., were designed according to published mouse KOR sequences w57x. These two primers span an intron to prevent any possible amplification from trace amounts of genomic DNA possibly present in RNA preparations. We tested the correct amplification of rat KOR cDNA, using these primers Žonly one nucleotide difference. and the same pattern was found as in the case of the mouse cDNA Žnot shown.. One tenth of total cDNA was amplified using

144

P. Tryoen-Toth et al.r Molecular Brain Research 55 (1998) 141–150

1 U of the Taq polymerase, 0.2 mM of each primer and 0.2 mM dNTP in 1.5 mM Mg 2q, 5% dimethyl sulfoxide and 10% 10 = PCR buffer Ž670 mM Tris–HCl, pH 8.8; 160 mM ŽNH 4 . 2 SO4 , 0.1% Tween 20., in a 50 m l reaction volume. A total of 40 cycles were performed Ždenaturation: 30 s at 948C, annealing: 30 s at 558C, extension: 1 min at 728C. followed by an additional 10-min extension cycle at 728C, in a nucleic acid amplifier with heated cover ŽPerkin-Elmer 2400.. 2.8. Southern blot analysis A total of 10 m l of each PCR product were loaded on a 1% agarose gel and submitted to electrophoresis. The gel was treated with 0.25 M HCl for 20 min, then twice with 0.4 M NaOH for 20 min. The DNA bands were transferred by capillarity onto Nytran plus positively charged nylon membrane. After 10 min washing of the membrane with 6 = SSC solution, which was prepared from a 20 = SSC buffer Ž3 M NaCl, 0.3 M Na 3 citrate, pH 7.0., KOR PCR bands were detected by hybridization with 32 P-labeled KOR specific oligonucleotide Ž5X GCACCTCCCACAGCACAGCTGC3X . probe w17x. The probe Ž10 pmol. was previously kinased for 30 min at 378C with 10 pmol of dATPŽg 32 P. Ž7000 Cirmmol. using the T4 polynucleotide kinase. Prehybridization was performed at 378C for 2 h in a solution containing SSC 6 = , Denhardt’s 5 = Žfrom a 100 = solution containing in 100 ml: 2 g Ficoll 400, 2 g polyvinylpyrrolidone, 2 g BSA., 0.1% SDS, 0.005% NaPPi and 100 m grml single stranded DNA. Then, the radiolabeled probe Ž2 = 10 6 dpmrml. was added to the reaction mixture and incubated overnight at 378C while gently shaken. The next day, the membranes were washed three times Ž20 min at 378C, 20 min at 558C, 5 min at 658C. with SSC 6 = , 0.1% SDS. Southern blots were exposed for 30 min to 3 h onto Kodak film X-OMAT AR05. Semi-quantification was performed by phosphoimage-analyser ŽFUJIX BAS 1000..

GFAP positive cells Žcontaminating cells were macrophages and oligodendrocytes., secondary oligodendroglial cell cultures contained 85% MBP positive cells Žcontaminating cells were mainly oligodendrocyte progenitor cells and 1–2% astrocytes.. Oligodendroglial progenitor cells were characterized by their reaction with the monoclonal antibody A2B5 Ž94% positive cells in the culture., contaminating cells were oligodendrocytes and macrophages. Microglial cells were identified with the monoclonal antibody OX42 Ž98% positive cells in the culture.. Results not shown. 3.2. QuantitatiÕe aspect of PCR— Southern blot in our conditions Since all our data come from RT-PCR–Southern technique which is considered as a semi-quantitative method, we settled a dose–response experiment by submitting various amounts of cDNA from the same sample of control astrocytes to PCR and Southern blotting. Band intensity was plotted as a function of the amount of cDNA Žactually, of the amount of the total RNA used for the RT. ŽFig. 1.. We can observe that in the range we used, there is no saturation. In that respect, the much higher level found in the brain, where, probably, saturation is reached ŽFigs. 2, 3 and 6. shows that we are far from the plateau with the cell samples. This method was found to be reproducible as it can be seen in other figures and was considered suitable to detect large variations of KOR levels in cultured cells, possibly seen under the effect of some extracellular signals.

2.9. cAMP determination The cells were rinsed 3 times with ice-cold PBS. They were harvested by scraping in 4 ml of ice cold 65% ethanol. After centrifugation at 2000 = g for 15 min, the pellet was resuspended in 65% ethanol and sedimented again. The supernatant was dried at 608C under a stream of nitrogen. The cAMP concentration was determined by using the Biotrak cAMPŽ 125 I. assay system from Amersham.

3. Results 3.1. Cultured cells Under the different culture conditions described above, confluent primary astroglial cell cultures contained 96%

Fig. 1. Signal intensities of the RT-PCR bands, determined by densitometric scanning of the Southern blots, as a function of the amounts of cDNA of mature astrocytes Žactually, the amounts of starting mRNA used in the RT. added in the PCR reaction tubes. A cDNA preparation from astrocytes taken after 25 days in vitro was used. Results are means" S.E.M. of triplicates dishes.

P. Tryoen-Toth et al.r Molecular Brain Research 55 (1998) 141–150

145

medium enriched with FBS, only astroblasts survive and proliferate. These cells do not express the astroglial specific marker GFAP during the first few days of culture. Cell maturation then proceeds until around day 30 after seeding w6x. Consequently, in order to get one step closer to the understanding of some of the physiological roles of KOR in glial cells, we have examined its mRNA level in the two maturation stages of cultured astrocytes. We harvested astroblasts at day 6 and mature astrocytes at day 40 in vitro. We observed that the astroblasts reproducibly exhibited a higher level of KOR mRNA ŽFig. 3, lane 3. than the mature cells Žlane 2.. No such difference was observed between oligodendrocyte progenitor cells taken from mixed glial cultures at day 10 in vitro and mature oligodendrocytes taken at day 40 in vitro Žnot shown.. 3.5. Regulation of KOR mRNA expression in astroglial and oligodendroglial cells by growth factors and cyclic AMP

Fig. 2. Expression of KOR mRNA in rat macroglial and microglial cells in culture. Southern blot of RT-PCR product. The cells, all derived from newborn rat brain, were grown as described in Section 2. Astrocytes were taken after 25 days in vitro, oligodendrocytes at 45 days and microglia at 50 days. Adult rat brain was used for comparison. Total RNA was reverse transcribed and amplified with specific primers as described in Section 2. PCR product loaded per lane corresponded to 0.2 m g total RNA. Blots were hybridized with KOR specific probe. The results shown are representative of three independent experiments.

We tested the effect of dbcAMP and cptcAMP which are able to enter the cells and then release cAMP inside the cells and forskolin which activates adenylate cyclase. We found that a 48 h treatment with these compounds produced a strong decrease Žup to 80%. in KOR mRNA level, in astrocytes as well as in oligodendrocytes ŽFig. 4.. The effect of dbcAMP is not shown because we found that butyrate at the same concentration induced a similar decrease. Basic FGF and PDGF produced a decrease in the KOR mRNA level in astrocytes ŽFig. 4A, lanes 2 and 3., while their effects were opposite in oligodendrocytes, in our experimental and technical conditions. Administration of LIF was without significant effect on the level of KOR

3.3. Basal KOR mRNA expression in mature glial cells Using RT-PCR analysis followed by Southern hybridization, we investigated KOR mRNA expression in mature macroglia Žastrocytes and oligodendrocytes. and microglia. We found that the three glial cell types did express KOR mRNA in vitro. A representative result is shown in Fig. 2. This expression was lower in oligodendrocytes Žlane 3. than in astrocytes Žlane 2. and microglial cells Žlane 4.. In all experiments RT-PCR resulted in the generation of a band of the expected 788-bp length and this band hybridized with KOR probe; no hybridizing fragments were detected in control PCR reactions performed without cDNA template Žblank.. We used adult rat brain cDNA as positive control. The level of KOR mRNA in astrocytes is about 10% of that measured in adult brain Ždata not shown.. 3.4. KOR mRNA leÕel and macroglial differentiation In primary cultures derived from newborn rat brain hemispheres and maintained in the presence of a culture

Fig. 3. Variation of KOR mRNA expression with the differentiation status of the astroglial cells. Southern blot of RT-PCR product. Three independent experiments with ‘young’ and ‘old’ astrocytes gave similar results.

146

P. Tryoen-Toth et al.r Molecular Brain Research 55 (1998) 141–150

mRNA in both cell types. The percentages given are only indicative since RT-PCR and autoradiography were performed under semi-quantitative conditions. However, the results are validated by the fact that the data shown come from three independent experiments. Moreover, in our cultures, we observed some of the effects of the signaling molecules on cell morphology and cell proliferation as previously described by many authors. The astrocytes became fibrous, presenting different morphologies under the effects of cyclic AMP, bFGF and PDGF. They were re-induced to proliferate after treatments with bFGF and PDGF. A kinetic study was performed on astrocytes treated with forskolin combined with IBMX, an inhibitor of phosphodiesterase ŽFig. 5.. In these conditions, the level of cyclic AMP was very high after 1 h of treatment and then decreased rapidly during the next 2 h and slowly during the following 9 h. ŽFig. 5A.. It remained constant thereafter, but at a level 10 times as high as that determined in control untreated cells Žnot shown because it was too close to the axis, at around 24 pmolrmg protein.. The level of KOR mRNA was constant up to 3 h after the beginning of treatment and decreased drastically between 3 and 6 h, to remain roughly constant up to 24 h ŽFig. 5B..

Fig. 4. Regulation of KOR mRNA expression under the effect of growth factors and cAMP in mature astrocytes ŽA. and oligodendrocytes ŽB.. The cells were treated for 2 days in a chemically defined medium. Final concentrations were 10 ngrml for the three growth factors, 100 m M for cptcAMP and 10 m M for forskolin. Quantification was carried out on three independent experiments, the means"S.E.M. are shown in the upper panels. For both astrocytes and oligodendrocytes, bFGF, PDGF, cptcAMP and forskolin induced a significant modulation of KOR mRNA expression Ž P - 0.02.. Representative results of Southern blots of RTPCR products are shown.

Fig. 5. Kinetic study of the effect of forskolinqIBMX on intracellular cAMP level and on KOR mRNA expression in astrocytes. The cells were treated at time 0 and harvested at the times shown in B. In control, untreated cells, the cAMP level was 24"3 pmolrmg protein. ŽA. semi-quantitative results. KOR cDNA level was determined by the direct scanning of the radioactive Southern blot shown in B. cAMP was determined in three separate dishes. Results are mean"S.E.M. ŽB. Southern blot showing KOR cDNA levels at the various times studied.

P. Tryoen-Toth et al.r Molecular Brain Research 55 (1998) 141–150

147

nals. The most efficient one appeared to be cAMP. Additionally, bFGF and PDGF induced a decrease in KOR mRNA level in astrocytes and an increase in oligodendrocytes. 4.1. ConstitutiÕe expression of KOR mRNA in astrocytes

Fig. 6. Regulation of the expression of KOR mRNA in microglial cells. Southern blot of RT-PCR product. Quantification was carried out on three independent experiments, the means"S.E.M. are shown in the upper panels. The cells, derived from 40- to 60-day-old primary mixed glial cultures, were treated daily for 2 days with bFGF Ž10 ngrml. or cptcAMP Ž100 m M. or LPS Ž0.1 m grml.. KOR cDNA from brain is shown as a PCR control.

3.6. Regulation of KOR mRNA expression in rat microglial cells In these cells, as in the macroglial ones, treatment with cptcAMP led to a strong decrease in KOR mRNA level ŽFig. 6, lane 4.. In contrast, bFGF elicited a small stimulatory effect. LPS is the most used activating agent for macrophages or microglial cells in vitro w1x. Exposure of rat microglial cells to 0.1 m grml of LPS, produced a strong diminution of KOR mRNA level ŽFig. 6, lane 5.. The decrease of KOR mRNA level in the latest condition represented about 60% compared to control cells.

4. Discussion In the present study we have shown that KOR mRNA is expressed in the three main glial cell types of the rat CNS. Such expression in oligodendroglial cells has not been reported before. Additionally, we found that in astrocytes KOR mRNA level decreased with the maturation of the cells. This level could be modulated by extracellular sig-

Contradictory results have been reported concerning the effects of opiate agonists on astrocytes and particularly on their proliferation. Morphine was shown to inhibit the growth of these cells and to promote their morphological differentiation w20x. In our culture conditions, we did not find any effect of various agonists of the three types of opioid receptors on the proliferation rate of immature or mature astrocytes Žnot shown.. Indirect evidence of the presence of opiate receptors on astrocytes has been brought by the observation that a KOR agonist induced an increase in intracellular Ca2q w52x. Recently, the expression of the three opioid receptor types has been observed in astrocytes w47x. Our present results confirmed this observation but by using RT-PCR. The expression of KOR mRNA by astrocytes and the fact that these cells release proenkephalin w28x suggests that opioid peptides exert functions other than neuromodulators in the CNS, or that astrocytes participate themselves, in some way, to neuromodulatory activities. The higher level of KOR mRNA in immature astrocytes is compatible with a function of opioids in the control of astrocyte development. Moreover, it shows that KOR mRNA level is linked to the maturation stage of these cells. 4.2. Regulation of KOR mRNA leÕel in astrocytes Cyclic AMP has been known for a long time as a second messenger that mediates the effects of various hormones and active peptides. A characteristic effect of opioids is to inhibit adenylate cyclase activity stimulated by suitable inducers. In contrast, after the arrest of a chronic administration of an opioid agonist, there is a supersensitivity of induced adenylate cyclase activity w3,49x. However, in some cell types such supersensitization has not been seen w43x. Usually, cAMP is considered as an inhibitor of cell growth and as a promoter of cell differentiation. It elicits many effects on astrocytes such as a strong modification of the cell morphology, an inhibition of cell proliferation and the modulation of protein expression pattern. Cyclic AMP is generally considered as an inducer of the expression of different genes. However, in astrocytes, it has been shown by two-dimensional polyacrylamide gel electrophoresis, that cAMP regulates positively and negatively the expression of about the same number of genes w27x. We observed that the treatment of cultured astrocytes with cAMP generating agents resulted in a strong decrease in the level of KOR mRNA. Kinetic study showed that this decrease

148

P. Tryoen-Toth et al.r Molecular Brain Research 55 (1998) 141–150

occurred between 3 and 6 h after the beginning of treatment, while cAMP level increased within the first hour. The delay in the decrease in KOR mRNA level relative to cAMP increase could be the result of an indirect effect of cAMP with several intermediate steps before the down regulation of KOR gene transcription, or to a long half-life of the KOR mRNA which would not allow a fast decrease in its level. This important effect of cAMP suggests that this regulation plays a key role in the interplay between the opioids and astrocytes. Relationship between opioids and cAMP may also concern glial–glial and neuron–glial interactions as suggested by the observation of axon terminals containing enkephalin, apposed to astrocytic processes w53x. Since neurotransmitters like norepinephrine induce a strong intracellular burst of cAMP, the resulting blockade of the opioid connection could be physiologically significant. Moreover, acute activation of the three opioid receptor types in astrocytes inhibits adenylate cyclase w12,13x. Consequently, cAMP inducers will tend to block the effects of opioids, through the inhibition of KOR mRNA expression, while external opioids will tend to block the effects of cAMP inducers, through an inhibition of adenylate cyclase. This might work as a switch. The dominating agent neutralizing the effect of other. If neither dominates, a fine regulation could take place between the two systems. The down regulation of KOR by cAMP could also be involved in the phenomenon of opioid dependence since after opioid agonist withdrawal there is a supersensitization of adenylate cyclase and a strong increase in cAMP level. This increase would down regulate KOR leading to a blockade of the opioid basal action and to the need of higher opioid agonist concentration. The various hypotheses proposed above will be tested and further investigation will be carried out to study the possible regulation of DOR and MOR in glial cells under the effect of cAMP. These regulations will also be studied in neurons. The putative roles of growth factors in the CNS are related to the control of development and in the adult animal, to various poorly understood trophic functions and to the control of repair processes. Developing and adult brain produce and express many growth factors and their receptors. The only regulation of opiate receptor expression by growth factors has been reported to occur in PC12 cells in which NGF upregulates the expression of DOR protein and mRNA w2x. Basic FGF has been isolated from brain where it is present at high concentration w42x. It is the most studied growth factor in the CNS and it elicits pleiotropic effects on glial cells, increasing or decreasing the expression of many proteins in astrocytes w27x. From the fact that the production of bFGF increases in the sites of CNS injury w15x and that the injection of bFGF interferes with gliosis w11x, we could propose that the lower potential of the astrocytes to respond to specific ligands of KOR under the effect of bFGF Žas suggested by our results., is part of the gliosis phenomenon, but in a still

unknown fashion. Other functions related to neuromodulation cannot be excluded and that applies to all the regulators of KOR expression. Since astrocytes synthesize bFGF, PDGF and LIF w14,34,37x and respond to them w5,36,42x, the occurrence of autocrine loops is likely and the regulators of the expression of bFGF and PDGF or of their receptors will indirectly modulate the expression of KOR. The regulation of KOR expression as well as that of opioid peptides in astrocytes support the idea that opioid peptides take part in the intricate network of extracellular signalling molecules. 4.3. KOR mRNA leÕel and regulation in oligodendrocytes Two reports have been published concerning the relation between oligodendrocyte precursors and opioids. The first concluded that oligodendrocyte progenitor cells do not respond directly to opioids w19x. The second showed that these progenitors express MOR and that stimulation of this receptor induces cell proliferation w23x. We found that oligodendrocytes as well as their progenitors do express KOR mRNA. Moreover, its level was modulated by cAMP and growth factors. As in astrocytes, cAMP reduced the level of KOR mRNA in oligodendrocytes as well. Some effects of cAMP on oligodendroglial cells have been previously described, mainly an acceleration of differentiation and an inhibition of growth w44x. We found that bFGF and PDGF were able to increase KOR mRNA level, an effect opposite to that observed in astrocytes. Oligodendrocytes, whose main function is to make myelin, seem to express fewer types of receptors than astrocytes. However, their expression of a variety of factors and of receptors, including KOR and the regulation of the mRNA level of this receptor by growth factors and cAMP, indicates that these cells are also connected to the brain signalling network. These signals could participate in the regulation of myelination, or in other not yet defined functions of oligodendrocytes. 4.4. KOR mRNA leÕel and regulation in microglial cells We observed that microglia express KOR mRNA at a level at least equal to that found in astrocytes. Moreover, this expression decreased after the action of LPS and of cptcAMP. With bFGF there was a small but significant increase in KOR mRNA level. Considering that LPS treatment mimics the activation of microglia occurring in the process of reactive gliosis, these results suggest that the decrease in KOR mRNA level seen after activation of the cells is not related to the release of bFGF observed in reactive gliosis. The most salient result of this work is that KOR mRNA level is lowered by cAMP in the three cell types investigated. The question is now to determine if this regulation is restricted to the glial cells or if it is a general phenomenon. In the latter case, the KOR gene could bear a

P. Tryoen-Toth et al.r Molecular Brain Research 55 (1998) 141–150

cAMP responsive element ŽCRE. in its promoter. So far, such a response element has not been detected in the published sequence of the rat KOR gene w56x. However, we do not know if the whole promoter region is included in that sequence. Thus, in this line, neurons and other non-neural cells will be investigated. In contrast, bFGF did not modulate KOR mRNA level in the same way in the three glial cell types. This would provide arguments either for an indirect effect of bFGF through steps specific to each cell type, or for the existence, on KOR gene, of various elements responsive to bFGF, being accessible differently depending on the cell type. The same interpretation can be proposed for PDGF. No clear effect was seen with LIF. Since bFGF and PDGF receptors have tyrosine kinase activity, while LIF does not, it might be suggested that the transduction pathway leading to the modulation of KOR expression originates from such receptor-linked tyrosine kinase activity. To clarify this point, other growth factors and cytokines will be tested and the effect of kinase inhibitors will be investigated.

Acknowledgements We wish to thank Prof. B. Kieffer for her interest in this work and for helpful discussions and Prof. M. Wollemann and Dr. M. Sensenbrenner for reviewing the manuscript and for constructive comments. The contribution of M.-F. Knoetgen in providing cultures of astrocytes and oligodendrocytes is also acknowledged. This work was supported in part by a grant to G.L. from ARSEP ŽAssociation pour la Recherche sur la Sclerose En Plaques.. P.T.T. is a ´ recipient of a PhD fellowship from the French Government.

References w1x E. Abdel Basset, S. Fedoroff, Effect of bacterial wall lipopolysaccharide ŽLPS. on morphology, motility and cytoskeletal organization of microglia in cultures, J. Neurosci. Res. 41 Ž1995. 222–237. w2x M.E. Abood, Q. Tao, Characterization of a delta opioid receptor in rat pheochromocytoma cells, J. Pharmacol. Exp. Ther. 274 Ž1995. 1566–1573. w3x T. Avidor-Reiss, M. Bayewitch, R. Levy, N. Matusleibovitch, I. Nevo, Z. Vogel, Adenylylcyclase supersensitization in mu-opioid receptor-transfected Chinese hamster ovary cells following chronic opioid treatment, J. Biol. Chem. 270 Ž1995. 29732–29738. w4x F. Besnard, F. Perraud, M. Sensenbrenner, G. Labourdette, Effects of acidic and basic fibroblast growth factors on proliferation and maturation of cultured rat oligodendrocytes, Int. J. Dev. Neurosci. 7 Ž1989. 401–409. w5x F. Besnard, F. Perraud, M. Sensenbrenner, G. Labourdette, Plateletderived growth factor is a mitogen for glial but not for neuronal rat brain cells in vitro, Neurosci. Lett. 73 Ž1987. 287–292. w6x M. Caldani, B. Rolland, C. Fages, M. Tardy, Glutamine synthetase activity during mouse brain development, Experientia 38 Ž1982. 1199–1202.

149

w7x C.C. Chao, G. Gekker, S.X. Hu, W.S. Sheng, K.B. Shark, D.F. Bu, S. Archer, J.M. Bidlack, P.K. Peterson, Kappa opioid receptors in human microglia downregulate human immunodeficiency virus 1 expression, Proc. Natl. Acad. Sci. U.S.A. 93 Ž1996. 8051–8056. w8x Y. Chen, A. Mestek, J. Liu, L. Yu, Molecular cloning of a rat kappa opioid receptor reveals sequence similarities to the mu and delta opioid receptors, Biochem. J. 295 Ž1993. 625–628. w9x P. Chomczynski, N. Sacchi, Single step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction, Anal. Biochem. 162 Ž1987. 156–159. w10x T. Dipucchio, M.G. Ennas, M. Presta, G.M. Lauro, Basic fibroblast growth factor modulates in vitro differentiation of human fetal microglia, NeuroReport 7 Ž1996. 2813–2817. w11x F. Eclancher, F. Perraud, J. Faltin, G. Labourdette, M. Sensenbrenner, Reactive astrogliosis after basic fibroblast growth factor ŽbFGF. injection in injured neonatal rat brain, Glia 3 Ž1990. 502–509. w12x P.S. Eriksson, E. Hansson, L. Ronnback, Delta and kappa opiate receptors in primary astroglial cultures: Part II. Receptor sets in cultures from various brain regions and interactions with beta-receptor activated cyclic AMP, Neurochem. Res. 17 Ž1992. 545–551. w13x P.S. Eriksson, E. Hansson, L. Ronnback, Mu and delta opiate receptors in neuronal and astroglial primary cultures from various regions of the brain—coupling with adenylate cyclase, localisation on the same neurones and association with dopamine ŽD1. receptor adenylate cyclase, Neuropharmacology 30 Ž1991. 1233–1239. w14x N. Ferrara, F. Ousley, D. Gospodarowicz, Bovine brain astrocytes express basic fibroblast growth factor, a neurotrophic and angiogenic mitogen, Brain Res. 462 Ž1988. 223–232. w15x S.A. Frautschy, P.A. Walicke, A. Baird, Localization of basic fibroblast growth factor and its mRNA after CNS injury, Brain Res. 553 Ž1991. 291–299. w16x K. Fuxe, B. Tinner, M. Zoli, R.F. Pettersson, A. Baird, G. Biagini, G. Chadi, L.F. Agnati, Computer-assisted mapping of basic fibroblast growth factor immunoreactive nerve cell populations in the rat brain, J. Chem. Neuroanat. 11 Ž1996. 13–35. w17x C. Gaveriaux, J. Peluso, F. Simonin, J. Laforet, B. Kieffer, Identification of kappa- and delta-opioid receptor transcripts in immune cells, FEBS Lett. 369 Ž1995. 272–276. w18x M. Guizzetti, P. Costa, J. Peters, L.G. Costa, Acetylcholine as a mitogen—muscarinic receptor-mediated proliferation of rat astrocytes and human astrocytoma cells, Eur. J. Pharmacol. 297 Ž1996. 265–273. w19x K.F. Hauser, J.A. Gurwell, N.R. Bhat, Endogenous opioid systems and the growth of oligodendrocyte progenitors: paradoxical increases in oligodendrogenesis as an indirect mechanism of opioid action, Glia 9 Ž1993. 157–162. w20x K.F. Hauser, A. Stiene-Martin, M.P. Mattson, R.P. Elde, S.E. Ryan, C.C. Godleske, Mu-opioid receptor-induced Ca2q mobilization and astroglial development—morphine inhibits DNA synthesis and stimulates cellular hypertrophy through a Ca2q-dependent mechanism, Brain Res. 720 Ž1996. 191–203. w21x H.K. Kimelberg, Receptors on astrocytes—what possible functions, Neurochem. Int. 26 Ž1995. 27–40. w22x F. Kirchhoff, C. Mulhardt, A. Pastor, C.M. Becker, H. Kettenmann, Expression of glycine receptor subunits in glial cells of the rat spinal cord, J. Neurochem. 66 Ž1996. 1383–1390. w23x P.E. Knapp, K.F. Hauser, Mu-opioid receptor activation enhances DNA synthesis in immature oligodendrocytes, Brain Res. 743 Ž1996. 341–345. w24x G. Labourdette, G. Roussel, M.S. Ghandour, J.L. Nussbaum, Cultures from rat brain hemispheres enriched in oligodendrocytes-like cells, Brain Res. 179 Ž1979. 199–203. w25x G. Labourdette, M. Sensenbrenner, Growth factors and their receptors in the central nervous system, in: H. Kettenman, B.R. Ransom ŽEds.., Neuroglia, Oxford Univ. Press, New York, 1995, pp. 441– 459. w26x P. Laeng, D. Decimo, B. Pettmann, T. Janet, G. Labourdette,

150

w27x

w28x

w29x

w30x

w31x

w32x

w33x w34x

w35x

w36x

w37x

w38x w39x

w40x

w41x

w42x

P. Tryoen-Toth et al.r Molecular Brain Research 55 (1998) 141–150 Retinoic acid regulates the development of oligodendrocyte precursor cells in vitro, J. Neurosci. Res. 39 Ž1994. 613–633. C. Loret, M. Sensenbrenner, G. Labourdette, Maturation-related gene expression of rat astroblasts in vitro studied by two-dimensional polyacrylamide gel electrophoresis, Cell Differ. Dev. 25 Ž1988. 37–45. K.G. Low, R.G. Allen, M.H. Melner, Differential regulation of proenkephalin expression in astrocytes by cytokines, Endocrinology 131 Ž1992. 1908–1914. K. Maderspach, R. Solomonia, Glial and neuronal opioid receptors: apparent positive cooperativity observed in intact cultured cells, Brain Res. 441 Ž1988. 41–47. A. Mansour, C.A. Fox, S. Burke, F. Meng, R.C. Thompson, H. Akil, S.J. Watson, Mu, delta and kappa opioid receptor mRNA expression in the rat CNS: an in situ hybridization study, J. Comp. Neurol. 350 Ž1994. 412–438. M. Mayer, K. Bhakoo, M. Noble, Ciliary neurotrophic factor and leukemia inhibitory factor promote the generation, maturation and survival of oligodendrocytes in vitro, Development 120 Ž1994. 143–153. M.H. Melner, K.G. Low, R.G. Allen, C.P. Nielsen, S.L. Young, R.P. Saneto, The regulation of proenkephalin expression in a distinct population of glial cells, EMBO J. 9 Ž1990. 791–796. H.W. Muller, U. Junghans, J. Kappler, Astroglial neurotrophic and neurite-promoting factors, Pharmacol. Ther. 65 Ž1995. 1–18. G.M.J. Murphy, Y. Song, E. Ong, Y.L. Lee, K.G. Schmidt, V. Bocchini, L.F. Eng, Leukemia inhibitory factor mRNA is expressed in cortical astrocyte cultures but not in an immortalized microglial cell line, Neurosci. Lett. 184 Ž1995. 48–51. H. Nagao, I. Matsuoka, K. Kurihara, Effects of adenylyl cyclase-linked neuropeptides on the expression of ciliary neurotrophic factormRNA in cultured astrocytes, FEBS Lett. 362 Ž1995. 75–79. Y. Nakagaito, T. Yoshida, M. Satoh, M. Takeuchi, Effects of leukemia inhibitory factor on the differentiation of astrocyte progenitor cells from embryonic mouse cerebral hemispheres, Dev. Brain Res. 87 Ž1995. 220–223. M. Noble, K. Murray, P. Stroobant, M.D. Waterfield, P. Riddle, Platelet-derived growth factor promotes division and motility and inhibits premature differentiation of the oligodendrocytertype-2 astrocyte progenitor cell, Nature 333 Ž1988. 560–562. G.C. Otero, J.E. Merrill, Cytokine receptors on glial cells, Glia 11 Ž1994. 117–128. K. Ozawa, T. Urono, K. Miyakawa, M. Seo, T. Imamura, Expression of the fibroblast growth factor family and their receptor family genes during mouse brain development, Mol. Brain Res. 41 Ž1996. 279–288. B. Pearce, M. Cambray Deakin, S. Murphy, Astrocyte opioid receptors: activation modifies the noradrenaline-evoked increase in 2w 14 Cxdeoxyglucose incorporation into glycogen, Neurosci. Lett. 55 Ž1985. 157–160. F. Perraud, F. Besnard, G. Labourdette, M. Sensenbrenner, Proliferation of rat astrocytes, but not of oligodendrocytes, is stimulated in vitro by protease inhibitors, Int. J. Dev. Neurosci. 6 Ž1988. 261–266. B. Pettmann, M. Weibel, M. Sensenbrenner, G. Labourdette, Purifi-

w43x

w44x

w45x

w46x

w47x

w48x

w49x

w50x

w51x

w52x

w53x

w54x

w55x

w56x

w57x

cation of two astroglial growth factors from bovine brain, FEBS Lett. 189 Ž1985. 102–108. P.S. Puttfarcken, B.M. Cox, Morphine-induced desensitization and down-regulation at mu-receptors in 7315C pituitary tumor cells, Life Sci. 45 Ž1989. 1937–1942. D.W. Raible, F.A. McMorris, Induction of oligodendrocyte differentiation by activators of adenylate cyclase, J. Neurosci. Res. 27 Ž1990. 43–46. M. Righi, Modulation of cytokine expression by cAMP analogs in myc-immortalized microglial cell lines, Funct. Neurol. 8 Ž1993. 359–363. G. Rougon, M.R. Hirsch, M. Hirn, J.L. Guenet, C. Goridis, Monoclonal antibody to neural cell surface protein: identification of a glycoprotein family of restricted cellular localization, Neuroscience 10 Ž1983. 511–520. B.B. Ruzicka, C.A. Fox, R.C. Thompson, F. Meng, S.J. Watson, H. Akil, Primary astroglial cultures derived from several rat brain regions differentially express mu, delta and kappa opioid receptor mRNA, Mol. Brain Res. 34 Ž1995. 209–220. B.B. Ruzicka, R.C. Thompson, S.J. Watson, H. Akil, Interleukin-1beta-mediated regulation of mu-opioid receptor mRNA in primary astrocyte-enriched cultures, J. Neurochem. 66 Ž1996. 425–428. S.K. Sharma, M. Nirenberg, W.A. Klee, Morphine receptors as regulators of adenylate cyclase activity, Proc. Natl. Acad. Sci. U.S.A. 72 Ž1975. 590–594. M. Shimojo, K. Nakajima, N. Takei, M. Hamanoue, S. Kohsaka, Production of basic fibroblast growth factor in cultured rat brain microglia, Neurosci. Lett. 123 Ž1991. 229–231. A. Stiene-Martin, K.F. Hauser, Opioid-dependent growth of glial cultures: suppression of astrocyte DNA synthesis by met-enkephalin, Life Sci. 46 Ž1990. 91–98. A. Stiene-Martin, M.P. Mattson, K.F. Hauser, Opiates selectively increase intracellular calcium in developing type-1 astrocytes: role of calcium in morphine-induced morphologic differentiation, Brain Res. Dev. 76 Ž1993. 189–196. E.J. Van Bockstaele, P. Branchereau, V.M. Pickel, Morphologically heterogeneous met-enkephalin terminals form synapses with tyrosine hydroxylase-containing dendrites in the rat nucleus locus coeruleus, J. Comp. Neurol. 363 Ž1995. 423–438. D. van Calker, F. Loffler, B. Hamprecht, Corticotropin peptides and X X melanotropins elevate the level of adenosine 3 :5 -cyclic monophosphate in cultured murine brain cells, J. Neurochem. 40 Ž1983. 418–427. M.H. Vilijn, P.J. Vaysse, R.S. Zukin, J.A. Kessler, Expression of preproenkephalin mRNA by cultured astrocytes and neurons, Proc. Natl. Acad. Sci. U.S.A. 85 Ž1988. 6551–6555. A.G. Yakovlev, K.E. Krueger, A.I. Faden, Structure and expression of a rat kappa opioid receptor gene, J. Biol. Chem. 270 Ž1995. 6421–6424. K. Yasuda, K. Raynor, H. Kong, C.D. Breder, J. Takeda, T. Reisine, G.I. Bell, Cloning and functional comparison of kappa and delta opioid receptors from mouse brain, Proc. Natl. Acad. Sci. U.S.A. 90 Ž1993. 6736–6740.