Regulation of pluripotent cell differentiation by a small molecule, staurosporine

Differentiation ∎ (∎∎∎∎) ∎∎∎–∎∎∎

Contents lists available at ScienceDirect

Differentiation journal homepage: www.elsevier.com/locate/diff

Regulation of pluripotent cell differentiation by a small molecule, staurosporine James Nicholas Hughes c,1, Chong Kum Edwin Wong a,b,1,2, Kevin Xiuwen Lau a, Peter David Rathjen a,d, Joy Rathjen a,d,n a

Department of Zoology, University of Melbourne, Parkville, Victoria 3010 Australia Australian Stem Cell Centre, Monash University, Clayton, 3800 Victoria, Australia c School of Molecular and Biomedical Science, University of Adelaide, Adelaide, South Australia 5005, Australia d The Menzies Research Institute Tasmania, University of Tasmania, 17 Liverpool Street, Hobart, Tasmania 7000, Australia b

art ic l e i nf o

a b s t r a c t

Article history: Received 31 May 2013 Received in revised form 16 December 2013 Accepted 7 January 2014

Research in the embryo and in culture has resulted in a sophisticated understanding of many regulators of pluripotent cell differentiation. As a consequence, protocols for the differentiation of pluripotent cells generally rely on a combination of exogenous growth factors and endogenous signalling. Little consideration has been given to manipulating other pathways to achieve pluripotent cell differentiation. The integrity of cell:cell contacts has been shown to influence lineage choice during pluripotent cell differentiation, with disruption of cell:cell contacts promoting mesendoderm formation and maintenance of cell:cell contacts resulting in the preferential formation of neurectoderm. Staurosporine is a broad spectrum inhibitor of serine/threonine kinases which has several effects on cell function, including interruption of cell:cell contacts, decreasing focal contact size, inducing epithelial to mesenchyme transition (EMT) and promoting cell differentiation. The possibility that staurosporine could influence lineage choice from pluripotent cells in culture was investigated. The addition of staurosporine to differentiating mouse EPL resulted in preferential formation of mesendoderm and mesoderm populations, and inhibited the formation of neurectoderm. Addition of staurosporine to human ES cells similarly induced primitive streak marker gene expression. These data demonstrate the ability of staurosporine to influence lineage choice during pluripotent cell differentiation and to mimic the effect of disrupting cell: cell contacts. Staurosporine induced mesendoderm in the absence of known inducers of formation, such as serum and BMP4. Staurosporine induced the expression of mesendoderm markers, including markers that were not induced by BMP4, suggesting it acted as a broad spectrum inducer of molecular gastrulation. This approach has identified a small molecule regulator of lineage choice with potential applications in the commercial development of ES cell derivatives, specifically as a method for forming mesendoderm progenitors or as a culture adjunct to prevent the formation of ectoderm progenitors during pluripotent cell differentiation. Crown Copyright & 2014 Published by Elsevier B.V. on behalf of International Society of Differentiation All rights reserved.

Keywords: Staurosporine Embryonic stem cell Differentiation Primitive streak Mesoderm Neural ectoderm

1. Introduction Directing the differentiation of pluripotent cells in culture into specific cell populations has been a long-term challenge. The ability to impose a single, predetermined cellular outcome during differentiation at the expense of other outcomes is predicted to n Corresponding author at: The Menzies Research Institute, University of Tasmania, 17 Liverpool Street, Hobart, Tasmania 7000, Australia. Tel.: þ 61 36 226 2856. E-mail addresses: [email protected] (P.D. Rathjen), [email protected] (J. Rathjen). 1 These authors contributed equally to this work. 2 Present address: Australian Prostate Cancer Research Centre @ Epworth Level 2, 185 Hoddle St, Richmond, Victoria 3121, Australia.

have many applications; it will provide specific cell populations for research, populations of cells that can be developed for commercial applications, such as for drug screening or cell-based devices, and ultimately cells for clinical use. Moreover, understanding the processes regulating directed differentiation in culture will give unique insights into the molecular regulation of these processes during embryogenesis. In culture mouse ES cells can be directed to form a second pluripotent cell population, early primitive ectoderm-like (EPL) cells, in response to a medium conditioned by the human hepatocellular cell line, HepG2, and more specifically by the amino acid L-proline (Casalino et al., 2011; Lake et al., 2000; Rathjen et al., 1999; Tan et al., 2011). EPL cells share many properties with the

0301-4681/$ - see front matter Crown Copyright & 2014 Published by Elsevier B.V. on behalf of International Society of Differentiation All rights reserved. Join the International Society for Differentiation (www.isdifferentiation.org) http://dx.doi.org/10.1016/j.diff.2014.01.001

Please cite this article as: Hughes, J.N., et al., Regulation of pluripotent cell differentiation by a small molecule, staurosporine. Differentiation (2014), http://dx.doi.org/10.1016/j.diff.2014.01.001i

2

J.N. Hughes et al. / Differentiation ∎ (∎∎∎∎) ∎∎∎–∎∎∎

embryonic primitive ectoderm, including morphology, gene expression, differentiation potential and cytokine responses (Lake et al., 2000; Pelton et al., 2002; Rathjen et al., 2002, 1999). In culture, EPL cell differentiation within embryoid bodies (EPLEBs) recapitulates molecular gastrulation and provides a sensitive model for identifying and understanding the regulatory pathways that determine lineage choice during differentiation (Hughes et al., 2009a, 2009b; Lake et al., 2000; Rathjen et al., 2002). We have shown previously a critical role for cell:cell contacts in lineage choice during EPL cell differentiation (Hughes et al., 2009b), with disruption of cell:cell contacts resulting in the preferential formation of primitive streak-like intermediates, or mesendoderm, while maintenance of cell:cell contacts promoted the establishment of ectoderm. Maintaining E-cadherin integrity during differentiation, through suppression of γ-secretase activity with DAPT, prevented formation of primitive streak-like intermediates and results in the preferential formation of ectoderm (Hughes et al., 2009a). This outcome can be reversed by destabilising E-cadherin through addition of a neutralising E-cadherin antibody (Hughes et al., 2009a). A chemical screen looking for compounds able to promote pluripotency has identified a role for E-cadherin stability in hES cell survival and self-renewal (Xu et al., 2010), and in mouse ES cells E-cadherin has been linked to the maintenance of pluripotency (Hawkins et al., 2012). These data support a role for E-cadherin integrity, and cell:cell junction integrity, in pluripotent cell maintenance and pluripotent cell differentiation in culture and raise the possibility that chemicals which modulate junction integrity may be able to modulate differentiation and/or lineage choice from pluripotent cells. Staurosporine is a broad spectrum serine/threonine kinase inhibitor (Tamaoki et al., 1986), which can affect the activity of a

range of kinases including PKC, PKA, PKG and CaM (Ruegg and Burgess, 1989; Tamaoki et al., 1986; Yanagihara et al., 1991). At high concentrations staurosporine induces apoptosis in a large number of cell populations (Bertrand et al., 1994; Falcieri et al., 1993; Koh et al., 1995; Weil et al., 1996), including differentiating ES cells (Buschke et al., 2012). At lower concentrations, typically between 20 and 25 nM, staurosporine interrupts the formation of, or destabilises established, cell:cell contacts (Denisenko et al., 1994; Ratcliffe et al., 1997), decreases focal contact size (Hugo et al., 2009), induces epithelial to mesenchymal transition (EMT) (Newgreen and Minichiello, 1995, 1996) and has been shown to induce cell differentiation (Thompson and Levin, 2010; Zhang et al., 2005; Schumacher et al., 2003). Treatment of cells with lower concentrations of staurosporine has been suggested to target atypical PKCs in the cellular adherens junction and disrupt the association between the actin cytoskeleton and junction (Minichiello et al., 1999; Newgreen and Minichiello, 1996). It has also been shown to result in hyperphosphorylation of p100/p120, cellular adherens junction-associated proteins; this has similarly been postulated to modulate intracellular junction function (Ratcliffe et al., 1997). Here, we examine the effect on lineage choice of adding low concentrations of staurosporine during EPL cell differentiation. The addition of staurosporine resulted in the preferential formation of mesendoderm and mesoderm, with a reduction in the formation of neurectoderm and neurons. Addition of staurosporine to human ES cells similarly promoted differentiation and induced the expression of primitive streak markers. Staurosporine affected lineage choice in conditions that have been shown to suppress primitive streak formation, including in the presence of the BMP4 antagonist noggin, and in serum-free medium conditions, suggesting that activity was independent of known

Fig. 1. Staurosporine treated EPL cell colonies retain E-cadherin, β-catenin and F-actin at cell borders. ES cells, grown in 50% MEDII for 3 days to form EPL cells, were transferred to 50% MEDII supplemented with staurosporine (lower panel) or DMSO (upper panel) and cultured for a further 24 h. Immunofluorescence shows the position of β-Catenin and E-Cadherin within the cell; rhodamine conjugated phalloidin was included to detect F-actin. DAPI was used to visualize cellular DNA. The distribution of β-catenin, E-Cadherin and F-actin was analysed by Laser Scanning Confocal microscopy. Size bar represents 50 mm.

Please cite this article as: Hughes, J.N., et al., Regulation of pluripotent cell differentiation by a small molecule, staurosporine. Differentiation (2014), http://dx.doi.org/10.1016/j.diff.2014.01.001i

J.N. Hughes et al. / Differentiation ∎ (∎∎∎∎) ∎∎∎–∎∎∎

3

inductive agents. Gene expression analysis of mesendoderm formed in response to staurosporine revealed the formation of a broad spectrum of mesoderm subtypes distinct from those formed in response to BMP4. Considered with previous data on the role of cell:cell contacts (Hughes et al., 2009b) and γ-secretase (Hughes et al., 2009a) in lineage choice from differentiating EPL cells, we suggest that staurosporine is inducing primitive streak formation through destabilisation of cell to cell contacts.

2. Results 2.1. Addition of staurosporine alters the morphology of EPL cells in culture EPL cells were cultured in the presence of staurosporine (25 nM) or DMSO (0.1%) for 24 h. Colonies in DMSO maintained EPL cell colony morphology, consisting of a continuous epithelial sheet with tight cell:cell junctions between individual cells (Fig. 1). Consistent with the morphology E-cadherin, β-Catenin and F-actin were localised to the cell:cell borders in these colonies. The addition of staurosporine to EPL cells resulted in an altered colony morphology; the colonies became irregular with cells extending away from the centre in chains and spaces appearing (Fig. 1). Cells within these colonies retained cell:cell junctions and peripheral staining for E-cadherin, β-Catenin and F-actin, suggesting that the integrity of the cell adherens junctions was maintained (Fig. 1). 2.2. Staurosporine favours the formation of mesoderm lineages from EPL cells The possibility that the addition of staurosporine to EPL cells affected differentiation outcomes was analysed using differentiation assays. EPL cells were cultured in suspension in 50% MEDII or differentiation medium and with or without staurosporine for 4 days before they were assayed for differentiation outcomes. In differentiation medium, EPL cells formed neural extensions and mesoderm derivatives (visible red blood cells and beating cardiocytes); this is consistent with previous reports (Hughes et al., 2009b). The addition of staurosporine to the differentiating aggregate changed the frequency of differentiation outcomes, resulting in a complete loss of neural extensions accompanied by an increase in visible red blood cell formation and decrease in beating cardiocytes (Fig. 2A). In 50% MEDII, EPL cells differentiate to form neurectoderm and neurons, with effectively no mesoderm formation (Rathjen et al., 2002). When staurosporine was added there was a significant decrease in the number of aggregates forming neural extensions, with a concomitant increase in mesoderm outcomes (Fig. 2B). These data suggest that the addition of staurosporine to differentiating EPL cells altered differentiation and favoured the formation of subsets of mesoderm. The addition of staurosporine resulted in shedding of cells from the EPL cell aggregates. Staurosporine can induce apoptosis at concentrations higher than those used here (Bertrand et al., 1994; Falcieri et al., 1993; Koh et al., 1995; Schumacher et al., 2003; Weil et al., 1996) and exposure over 96 h could induce cell death. Work in the neural tube has shown exposure to staurosporine for as little as 4 h is sufficient to induce an epithelial to mesenchymal transition (Newgreen and Minichiello, 1995), raising the possibility that a shorter exposure maybe effective. EPL cells carrying GFP under the control of the Mixl1, T or Sox1 promoters (Fehling et al., 2003; Li et al., 1998; Ng et al., 2005) were cultured in 50% MEDII with staurosporine for 4, 24, 48 or 96 h and outcomes were measured by flow cytometry (Fig. 3). Mixl1 and T expression marks mesendoderm (Robb et al., 2000; Wilkinson et al., 1990) while Sox1 expression marks neurectoderm (Pevny et al., 1998). Dead

Fig. 2. Addition of staurosporine during EPL cell differentiation results in the preferential formation of mesoderm and a reduction in neural differentiation. EPL cells were formed from D3 ES cells and transferred to differentiation medium (A) or 50% MEDII (B) supplemented with staurosporine or DMSO for a further 4 days. Aggregates were individually seeded and the percentage forming visible red blood cells, beating cardiocytes or neural projections were manually scored by morphology (n¼ 3, error bars represent SEM). The graph shows the maximum recorded score for each condition. When compared to aggregates cultured in medium supplemented with DMSO, the percentage of aggregates cultured in staurosporine forming neural projections was found be significantly reduced in both medium conditions (p o 0.05). In differentiation medium (A) staurosporine addition resulted in decreased beating cardiocyte formation (*p o 0.05) and increased visible red blood (*p o 0.05). In MEDII supplemented medium (B) staurosporine addition resulted in significant increases in beating cardiocytes and blood (*p o0.05).

cells, as determined by PI uptake, were excluded from the analysis. As expected from the differentiation assays, when Mixl1:GFP or GFP-Bry EPL cells were differentiated in 50% MEDII with DMSO few cells expressing GFP were formed. In contrast, differentiation of Sox1:GFP cells in 50% MEDII produced a peak of approximately 50% GFP-expressing cells. EPL cells cultured for 48 or 96 h in 50% MEDII and staurosporine showed robust formation of GFPexpressing cells from the Mixl1:GFP or GFP-Bry cell lines and poor formation of GFP-expressing cells from the Sox1:GFP line,

Please cite this article as: Hughes, J.N., et al., Regulation of pluripotent cell differentiation by a small molecule, staurosporine. Differentiation (2014), http://dx.doi.org/10.1016/j.diff.2014.01.001i

4

J.N. Hughes et al. / Differentiation ∎ (∎∎∎∎) ∎∎∎–∎∎∎

Fig. 3. Staurosporine induces the expression of primitive streak markers after 24 h of treatment. EPL cell aggregates were formed from Mixl1-GFP (A), GFP-Bry (B) and Sox1-GFP (C) ES cell lines. On day 3 aggregates were transferred into 50% MEDII containing staurosporine for 4, 24, 48 or 96 h or DMSO for 48 or 96 h. After removal of staurosporine or DMSO aggregates were maintained in 50% MEDII. Aggregates were analysed by flow cytometry and the percentage of GFP þ cells for each condition is shown.

consistent with the formation of mesoderm but not neural extensions in the differentiation assays. Addition of staurosporine for the first 24 h of differentiation resulted in a strong up-regulation of mesoderm markers but was less effective at reducing GFP positive cells from the Sox1:GFP line. Addition of staurosporine for the first 4 h of differentiation gave a variable result with GFPexpressing cells formed from the Mixl1:GFP cell line but not the GFP-Bry cell line; these are likely to arise from cell-line specific differences. For all further experimental approaches reported here, staurosporine was added for the initial 24 h of differentiation only. 2.3. Staurosporine induces the formation of primitive streak-like intermediates from EPL cells EPL cells were differentiated in 50% MEDII for 4 days, with or without staurosporine for the initial 24 h of differentiation, and analysed for the expression of a number of genes expressed by

Fig. 4. Staurosporine induces the formation of primitive streak-like intermediates and inhibits the formation of ectoderm during EPL cell differentiation. (A) EPL cells, formed in aggregates, were transferred to 50% MEDII supplemented with staurosporine. After 24 h staurosporine was removed. Aggregates were collected on day 4 and analysed for the expression of primitive streak markers (T, Mixl1, Wnt3, Tgfβ1 and Snail1) and neurectoderm markers (Sox1, Ptn) by real-time PCR. Gene expression has been normalised to β-actin and is shown relative to expression in EPL cells differentiated in medium containing DMSO. n ¼3, error bars represent SEM; * po 0.05. (B) Aggregates, cultured as for A, were transferred to adherent culture and chemically defined medium and maintained for a further 4 days. Seeded cell populations were analysed for the presence of β-Tubulin III (green), which detects the presence of neurons, and DNA (DAPI, blue). Cells treated with DMSO formed abundant neurons (B i, iii); cells treated with staurosporine formed few neurons (B ii). A minor population of β-Tubulin III þ cells was detected in staurosporine treated populations but these cells did not show a neuronal phenotype (B iv). Size bars represent 500 mm (i, ii) and 50 mm (iii, iv).

mesendoderm, nascent mesoderm and neural ectoderm (T, Mixl1, Wnt3, Tgfβ1, Sna1, Sox1 and Ptn) by real-time PCR. Consistent with the formation of mesendoderm and mesoderm cell populations the addition of staurosporine resulted in a significant increase in the expression of multiple mesendoderm and nascent mesoderm

Please cite this article as: Hughes, J.N., et al., Regulation of pluripotent cell differentiation by a small molecule, staurosporine. Differentiation (2014), http://dx.doi.org/10.1016/j.diff.2014.01.001i

J.N. Hughes et al. / Differentiation ∎ (∎∎∎∎) ∎∎∎–∎∎∎

5

Fig. 5. Staurosporine induces primitive streak-like intermediates, representative of anterior and posterior primitive streak, in the absence of serum. (A) EPL cells, formed in aggregates, were transferred to differentiation medium (FCS) or KOSR-containing medium supplemented with staurosporine or BMP4. After 24 h staurosporine or BMP4 was removed. Aggregates were collected on days 1–5 after the addition of treatments and analysed by RT-PCR for the expression of primitive streak markers (T, Mixl1,Wnt3, Fgf8 and Eomes), anterior and posterior streak markers (Mesp1, Cer1, Chrd2) and endoderm markers (Sox17, FoxA2). GAPDH expression was used as a positive control. n¼ 3, a representative result is shown. (B–D) EPL cells were treated with BMP4 (24 h, B), KOSR-containing medium supplemented with DMSO (48 h; C), or KOSR-containing medium supplemented with staurosporine (24 h, D). Cells were analysed by immunofluorescence for the expression of T (red) to show the presence of the primitive streak-like intermediate. Nuclei were visualized using DAPI (blue). Size bar represents 50 mm. (E) EPL cells were transferred to KOSR-containing medium supplemented with staurosporine or BMP4, with or without Noggin. After 24 h staurosporine was removed; BMP4 and Noggin were continued throughout. Aggregates were collected 2–4 days after the addition of treatments and analysed by RT-PCR for the expression of primitive streak markers (T, Mixl1, BMP4 and Tgfβ1). GAPDH expression was used as a positive control. n¼ 3, a representative result is shown. (E) EPL cells were exposed to BMP4, noggin and/or staurosporine, as denoted in the figure, and analysed for the presence of phosphorylated Smad1/5/8. The presence of protein in each lane is demonstrated with β-tubulin I.

markers and a significant decrease in the expression of neurectoderm markers (Fig. 4). Cells exposed to staurosporine during the initial 24 h of differentiation were seeded on day 4, cultured for a further 5 days in chemically defined medium and analysed for the formation of

neurons using β-Tubulin III. As expected, cells differentiated in 50% MEDII and the absence of staurosporine formed abundant neurons; in contrast cells exposed to staurosporine formed few neurons with almost no aggregates giving rise to any β-Tubulin III þ cells of the correct morphology (Fig. 4B; data not shown).

Please cite this article as: Hughes, J.N., et al., Regulation of pluripotent cell differentiation by a small molecule, staurosporine. Differentiation (2014), http://dx.doi.org/10.1016/j.diff.2014.01.001i

6

J.N. Hughes et al. / Differentiation ∎ (∎∎∎∎) ∎∎∎–∎∎∎

2.4. Staurosporine induces cell populations independently of BMP signalling activity EPL cells were transferred to KOSR-containing medium, a medium supplement devoid of activities that can induce molecular gastrulation in this assay (K.L. unpublished). BMP4 or staurosporine were added for the initial 24 h of culture in KOSR-containing medium and the expression of markers of mesendoderm, posterior and anterior mesoderm and definitive endoderm were compared on days 1–5. Cells differentiated in FCS were used as a positive control for differentiation (Fig. 5A). Twenty-four hour in the presence of BMP4 or staurosporine was sufficient to induce the expression of primitive streak markers T, Mixl1, Wnt3 and Fgf8. By immunofluorescence, cells expressing T were readily detectable in cell populations differentiated in KOSR-containing medium supplemented with BMP4 or staurosporine (Fig. 5B–D). Brief exposure of cells to BMP4 induced the expression of anterior markers Cer1 and Chrd2 (Gadue et al., 2006), but not the posterior marker Mesp1 (Lindsley et al., 2008) or the mesendoderm/endoderm marker Eomes (Ciruna and Rossant, 1999). The endoderm marker Sox17 (Kanai-Azuma et al., 2002) was not induced by BMP4. The expression of FoxA2, a marker of anterior primitive streak and derivatives (Shawlot et al., 1999), was detected. In contrast, 24 h exposure to staurosporine induced not

only mesendoderm and anterior mesoderm markers but also Mesp1 and Sox17, suggesting that the outcomes of differentiation in response to staurosporine were broader than those outcomes generated in response to BMP4. The possibility that staurosporine was acting via the induction of endogenous BMP4, which subsequently induced the formation of mesendoderm, was investigated (Fig. 5E). EPL cells were cultured in KOSR-containing medium supplemented with staurosporine for 24 h with or without Noggin, a well characterised inhibitor of BMP4 activity (Krause et al., 2011); Noggin was maintained on the cells for the duration of the experiment. Cells were collected on days 2–4 and analysed for the expression of T, Mixl1, BMP4 and TGFβ1. Cells cultured in BMP4 expressed BMP4 from day 3 of differentiation; in contrast, staurosporine treated cells did not express BMP4 until day 4, 48 h after the induction of T. Cells cultured in BMP4 and Noggin failed to up regulate mesendoderm markers. The addition of Noggin with staurosporine delayed but did not prevent the expression of mesendoderm markers, suggesting that the action of staurosporine did not require initial induction of BMP4. Moreover, the addition of staurosporine did not induce the phosphorylation of Smad1, 5 or 8 in treated ES cells, suggesting that staurosporine did not activate the BMP signalling pathway Fig. 5F). 2.5. Staurosporine induces the formation of primitive streak-like intermediates from human ES cells Several reports have aligned human ES cells in culture with cells of the primitive ectoderm (Hughes et al., 2009b; Vallier et al., 2009; Ware et al., 2009). The ability of staurosporine to induce differentiation from human ES cells, specifically to induce the formation of mesendoderm, was tested Fig. 6. Human ES cells were cultured in mTeSR1 on Matrigel™ for 6 days before the addition of staurosporine (25 nM). Cells were collected after a further 24 h of culture; this was sufficient time for the cells to undergo a distinct morphological change Fig 6A, B. The altered morphology of hES cells in response to staurosporine was more reminiscent of mouse EPL cells cultured in staurosporine than human ES cells cultured in BMP4 (Hughes et al., 2009a). It was also noted that the addition of staurosporine caused some cells to die and be shed from the colony over the 24 h of exposure; continued culture after exposure to staurosporine resulted in a further loss of cells from the wells. Human ES cells cultured in staurosporine were analysed for the expression of the pluripotent cells markers OCT4 and GDF3, primitive streak markers T, MIXL1 and WNT3 and the mesoderm inducing activity BMP4 Fig. 6C. The addition of staurosporine resulted in a significant reduction in OCT4 and GDF3 transcript levels, suggesting differentiation. Consistent with this, transcript levels of both MIXL1 and WNT3, but surprisingly not T, were significantly increased. These data suggest that staurosporine was able to induce the differentiation of human ES cells and the resulting population expressed markers of the primitive streak. The expression of BMP4 was not elevated suggesting that endogenous expression of BMP4 was not triggering primitive streak intermediate formation within the timeframe of this experiment.

3. Discussion

Fig. 6. Staurosporine induces differentiation of human ES cells. (A, B) Human ES cells were cultured for 6 days in mTeSR1 before the addition of staurosporine (B) for 24 h. Cells in (A) received no treatment. Size bars represent 200 μm. (C) Staurosporine treated cells were analysed by real-time PCR for the expression of pluripotent (OCT4, GDF3) and primitive streak markers (T, MIXL1, WNT3, BMP4). Error bars represent SEM. * p o 0.05.

The differentiation of EPL cells in culture is a tractable system for characterising the processes controlling lineage choice in vitro (Hughes et al., 2009a, 2009b). The determination of lineage from EPL cells is influenced by growth factor signalling (such as BMP4, components within foetal calf serum or activities within MEDII (Hughes et al., 2009a; Johansson and Wiles, 1995; Rathjen et al.,

Please cite this article as: Hughes, J.N., et al., Regulation of pluripotent cell differentiation by a small molecule, staurosporine. Differentiation (2014), http://dx.doi.org/10.1016/j.diff.2014.01.001i

J.N. Hughes et al. / Differentiation ∎ (∎∎∎∎) ∎∎∎–∎∎∎

2002)), and by the physical configuration of the cells, particularly the integrity of cell:cell interactions (Hughes et al., 2009b). Lineage choice can be manipulated through the use of chemical antagonists of signalling, such as the γ-secretase inhibitor, DAPT and the nodal pathway inhibitors SB431542 or PD169316 (Hughes et al., 2009a). These approaches have provided information on the signalling pathways regulating lineage choice and processes that can be modulated to regulate lineage choice, as well as identifying small molecule regulators of these processes. This information provides valuable targets that can inform the development of protocols capable of directing pluripotent cell differentiation and the production of commercially and clinically relevant pluripotent cell derivatives. In the embryo, primitive ectoderm that differentiates within the primitive streak gives rise to mesoderm and endoderm, whereas cells that remain within the epithelial structure of the ectoderm differentiate to definitive ectoderm. Cells that enter the primitive streak up regulate the expression of a markers of differentiation, acquire a restricted developmental potential that includes mesoderm and endoderm but not ectoderm (Tam and Beddington, 1992), and undergo an EMT characterised by the loss of E-cadherin at the cell:cell junctions (Ciruna and Rossant, 2001; Williams et al., 2012). These hallmarks of differentiation can be detected when pluripotent cells undergo molecular gastrulation in culture (Lake et al., 2000; Ng et al., 2005; Spencer et al., 2007; Vassilieva et al., 2012). In cells treated with staurosporine up regulation of markers of differentiation and the restriction of developmental potential were observed, suggesting that staurosporine is inducing molecular gastrulation in EPL cells. Down regulation of E-cadherin at cell:cell contacts was not seen after 24 h of treatment. Loss of E-cadherin has been shown to occur late in gastrulation, with junctional integrity maintained in cells as they enter and traverse the primitive streak (Williams et al., 2012). The maintenance of cell:cell contacts is proposed to functionally pull cells through the streak (Williams et al., 2012). Staurosporine has been shown to induce an EMT from quail neural progenitors; these cells undergo EMT within the embryo as they differentiate to form the neural crest (Newgreen and Minichiello, 1996). It is probable, therefore, that staurosporine is inducing an EMT, and one that is characteristic of molecular gastrulation, such that cell movements are seen early in the process but alterations in Ecadherin localisation does not occur until later in the process and have not occurred within the 24 h of observation used here. Up regulation of the key EMT regulator, Snail1, on day 4 of differentiation supports the occurrence of an EMT in cells treated with staurosporine. Others have shown a role for staurosporine in the induction of ectoderm derivatives, specifically neural and glial precursors, and not mesendoderm, during the differentiation of ES cells within EBs (Schumacher et al., 2003). In contrast, when added to cells differentiating in chemically defined medium, conditions that promote ectoderm formation, specifically neural precursors and lineages, staurosporine inhibited neural formation. The opposing results presented in the previous report and here are difficult to reconcile, but may result from the action of staurosporine on cell lineages formed during early EB differentiation that are not present during EPL cell formation and differentiation, such as the extraembryonic endoderm (Vassilieva et al., 2012). Selective loss of extraembryonic endoderm from EBs, or changes in cell function, would likely impact the inductive environment, the formation of primitive ectoderm and the ability to form mesendoderm. Molecular gastrulation was induced when EPL cells were exposed to staurosporine in serum-containing or serum-free medium, suggesting that the ability of staurosporine to affect lineage choice was independent of serum-associated factors. Staurosporine activity was independent BMP4 signalling and was

7

not inhibited by MEDII, which contains a mesoderm suppressing activity (Hughes et al., 2009c). Moreover, the activity of staurosporine is unlikely to be mediated through GSK3β inhibition and activation of the canonical Wnt signalling pathway (Bhat et al., 2000; D0 Alimonte et al., 2007; Koivisto et al., 2003; Leclerc et al., 2001), a pathway that has been implicated in the induction of gastrulation from pluripotent cells in culture (Jackson et al., 2010). The activity of staurosporine on the cell, therefore, appeared sufficient to influence lineage choice. Staurosporine has been reported to induce F-actin de-bundling and disruption of cell:cell adhesion through the inhibition of a protein kinase C, providing a potential mode of action for the chemical in EPL cell differentiation (Hugo et al., 2009). Alternatively, destabilization of E-cadherin in response to p38 MAPK signalling (Guo et al., 2007) has been shown to regulate E-cadherin during gastrulation and may act as a target for staurosporine. Unlike, stauprimide, another small molecule regulators of differentiation that has been identified (Zhu et al., 2009), which predispose ES cells to differentiation without preference to lineage; staurosporine appears to specifically induce molecular gastrulation from EPL cells. The formation of neurectoderm and neurectoderm derivatives was inhibited effectively by the presence of staurosporine during the early phases of EPL cell differentiation. These data suggest a novel approach to directing the differentiation of pluripotent cells to primitive streak-like intermediates in culture. The formation of mesendoderm and mesoderm is concomitant with the acquisition of positional information by the cells. Positional information is thought to be impacted by the combination of growth factors and signalling molecules present within the streak as differentiation occurs. Positional specification can be recapitulated in culture through the use of alternate growth factors and culture conditions (Gadue et al., 2006; Tanaka et al., 2009). In KOSR-containing medium supplemented with staurosporine the formation of mesendoderm from EPL cells occurs in an environment devoid of exogenous growth factors and results in the expression of gene expression markers characteristic of posterior mesoderm, anterior mesoderm and endoderm. In contrast, cells formed in response to a 24 h exposure to BMP4 preferentially expressed Cer1 and Chrd2, markers of anterior mesoderm. These data suggest that the alternate inductive protocols enrich for mesendoderm with distinct but overlapping positional identities, and that staurosporine induced a broad range of outcomes, similar to those detected from cells treated with FCS. The ability to understand and regulate lineage choice during pluripotent cell differentiation in culture is critical to the development of technologies that direct differentiation and enrich for specific cell outcomes. In addition to the key role played by growth factors, the integrity of cell:cell contact has been shown to influence lineage choice during early primitive ectoderm-like (EPL) cell differentiation. Here we have shown that staurosporine, a previously reported regulator of cell adherens junction integrity, can mimic the effect of disrupting cell:cell contacts. This work demonstrates the importance of cell:cell contacts in regulating pluripotent cell differentiation and identifies a target that can be manipulated by small molecules or antibodies as a method for enriching mesoderm or endoderm progenitors or as a culture adjunct that can be used to prevent the formation of ectoderm progenitors.

4. Materials and methods 4.1. Cell culture 4.1.1. Mouse ES cells D3 ES cells (Doetschman et al., 1985), GFP-Bry ES cells (Fehling et al., 2003) (kindly provided by Prof. Gordon Keller, McEwen

Please cite this article as: Hughes, J.N., et al., Regulation of pluripotent cell differentiation by a small molecule, staurosporine. Differentiation (2014), http://dx.doi.org/10.1016/j.diff.2014.01.001i

J.N. Hughes et al. / Differentiation ∎ (∎∎∎∎) ∎∎∎–∎∎∎

8

Centre for Regenerative Medicine, University Health Network, Toronto), Mixl1:GFP ES cells (Hart et al., 2002) (kindly provided by Dr. A. Elefanty, Monash University, Australia) and Sox1-GFP ES cells (Ying et al., 2003) (kindly provided by Prof. Austin Smith, Centre for Stem Cell Research, Cambridge) were used in this study. D3 ES cells and Sox1-GFP ES cells were maintained in feeder-free culture conditions as previously described (Rathjen and Rathjen, 2003). GFP-Bry and Mixl1-GFP ES cells were maintained on feeder layers of irradiated mouse embryonic fibroblasts (MEFs). MEFs were generated and used as described in (Abbondanzo et al., 1993). Media and routine culture conditions used were the same as those used for feeder-free culture (Rathjen and Rathjen, 2003). Before use, MEFs were depleted from GFP-Bry and Mixl1-GFP ES cells by incubating single cell suspensions with gelatinised tissue culture plates for 30 min to selectively remove MEFs or by culturing overnight on gelatinised tissue culture at a density of 3.8  104 cm2. The formation of EPL cells and the production of MEDII conditioned medium were as described previously (Rathjen et al., 2002, 1999; Rathjen and Rathjen, 2003). Staurosporine (staurosporine; Alexis) was added to culture medium as described at a concentration of 25 nM, controls contained an equivalent volume of dimethyl sulfoxide (DMSO; Sigma Aldrich). Cells were differentiated in 50% MEDII (Rathjen and Rathjen, 2003), differentiation medium (Rathjen and Rathjen, 2003) or KOSR containing medium (45% Dulbecco0 s Modified Eagle0 s Medium (DMEM; Invitrogen # 11995-065), 45% Ham0 s F12 (Invitrogen # 11765-054), 10% Knockout™ Serum Replacement (Invitrogen), 1  insulin-transferrinsodium selenite (ITSS, Roche), 0.1 mM β-mercaptoethanol (Sigma Aldrich), Penicillin-Streptomycin (Chemicon) as described in the text. BMP4 and noggin (R&D systems) were added at 10 ng/ml and 90 ng/ ml respectively. 4.1.2. Human ES cells MEL2 ES cells (Australian Stem Cell Centre) were maintained in 6 well cluster dishes (BIOFIL) on BD Matrigel™ (BD Biosciences) in mTeSR1 medium (Stem Cell Technologies) according to the manufacturer0 s instructions. For treatment with staurosporine human ES cells were cultured as described in 6 well cluster dishes. On day 6 the medium was replenished with mTeSR supplemented with 25 nM staurosporine. Cells were collected after 24 h for analysis. 4.1.3. Differentiation assays ES cells were aggregated in 50% MEDII (Rathjen and Rathjen, 2003) and cultured for 3 days to form EPL cells. EPL cell aggregates were transferred to differentiation medium (Rathjen and Rathjen, 2003) or 50% MEDII and cultured with staurosporine or DMSO, as specified in the text. Four days after addition of treatments aggregates were transferred to individual, gelatin-treated, tissue culture grade plastic wells (Falcon or BIOFIL) for approximately 12 h before the medium was replaced with chemically defined medium (Rathjen and Rathjen, 2003). Outgrowths were examined microscopically 2, 4 and 6 days after seeding and scored for the presence of neural projections, visible red blood cells and beating cardiocytes, which were identified by extension of cell processes from the centre of the aggregate, colour and pulsatile motion, respectively. Cells with neural projections have been shown previously to express Tubulin-βIII and NeuN (Rathjen et al., 2002; Washington et al., 2010). Generally, for each experimental condition 48 individual wells were seeded with randomly selected cellular aggregates and experiments were repeated three times. Data was analysed statistically using a two-tailed student0 s t-test. 4.2. Immunofluorescence and light microscopy Cells to be stained were grown on gelatin treated glass coverslips in chemically defined medium (Rathjen and Rathjen, 2003) or

96 well tissue culture treated imaging plates (BD Falcon) in KOSRcontaining medium, washed with PBS and fixed with 4% PFA. Fixed cells were permeabilised with PBS/0.25% TritonX and blocked with 1% BSA or 10% FCS. Antibodies directed against β-Catenin (BD Biosciences, 1:1000), E-Cadherin (BD Biosciences, 1:1000), βTubulin III (Sigma Aldrich, 1:1000), T (R&D Systems, 1:400) and FGF8 (R&D Systems, 1:400) were applied as denoted in the text. Secondary antibodies were used at 1:1000. Rhodamine conjugated phalloidin (Molecular Probes, 1:1000) was included with the secondary antibodies to detect F-actin. Cells were mounted in Prolong-gold Antifade with DAPI to visualize the nucleus. Images were taken on a Laser Scanning Confocal Microscope (Leica SP5) or an Olympus BX50 with an F-view II digital camera (Figs. 4 and 5). 4.3. Flow cytometry Cells and aggregates to be analysed by flow cytometry were reduced to single cell suspensions using Trypsin-EDTA and passed through a 70 μm sieve (BD Falcon). Cell suspensions were analysed using a Becton Dickinson FACScan and data collected using CellQuest Pro software (Becton Dickinson) and manipulated using either CellQuest Pro or FCS Express (Microsoft). Live cells were gated by propidium iodide (PI) exclusion and forward and side scatter characteristics; D3 ES cell-derived populations were used to determine background fluorescence at each time point. 4.4. Gene expression analysis Total RNA was isolated using Trizol reagent (mouse cells; Invitrogen) or RNAqueous-4PCR kit (human cells; Ambion) according to the manufacturer0 s instructions. cDNA was synthesised from total RNA with the Omniscript RT kit (Qiagen) and oligo dT primers (Invitrogen) or using Promega reagents. 4.4.1. Realtime PCR Reactions were performed with the Platinum SYBR Green qPCR Supermix-UDG (Invitrogen) or Absolute blue QPCR SYBR Green Mix (Thermo Scientific) on an MJ research thermocycler with a Chromo4 Continuous Fluorescence Detection system (MJ Research). Data was analysed using the Q-Gene software package (Muller et al., 2002; Simon, 2003) and, unless otherwise indicated, primers were designed using Primer3 software (Rozen and Skaletsky, 2000). Primers for the detection of genes in mouse ES cells and derivatives were tested on EBs that had been differentiated in culture for 9 days and the PCR product sequenced. Primers for the detection of human transcripts were tested on human ES cell RNA and/or genomic DNA. The sequences and length of amplified products can be found in Table 1. Data was analysed statistically using a two-tailed student0 s t-test. 4.4.2. RT-PCR PCR reactions, containing 1  concentration of GoTaqs Green Master Mix (Promega), were set up according to the manufacturer0 s recommendations. Cycles were 95 1C for 30 s, 60 1C for 30 s and 72 1C for 30 s before a 5 min final extension step at 72 1C on an MJ Research thermocycler. A list of primer sequences, and expected amplicon size, can be found in Table 1.

5. Western blot analysis EPL cells were serum-starved for an hour in serum free medium (50% DMEM, 50% Ham0 s F12, 1  ITSS, 0.1 mM βmercaptoethanol (Sigma Aldrich) and Penicillin-Streptomycin (Chemicon)) with or without noggin. BMP4 or staurosporine were added to the cells for a further hour. Total protein was analysed by

Please cite this article as: Hughes, J.N., et al., Regulation of pluripotent cell differentiation by a small molecule, staurosporine. Differentiation (2014), http://dx.doi.org/10.1016/j.diff.2014.01.001i

J.N. Hughes et al. / Differentiation ∎ (∎∎∎∎) ∎∎∎–∎∎∎

9

Table 1 PCR primers. Gene Mouse genes Actin Brachyurya BMP4 Cerberus Chordin Eomesb FoxA2 Fgf8 GAPDH Lmx1a Mixl1 Mesp1 Ptn Snail1 Sox1 Sox17 Tgfβ1 Wnt3 Human genes ACTIN BRACHYURY BMP4 GDF3 MIXL1 OCT4 WNT3 a b

Product (bp)

Forward primer 50 -30

Reverse primer 50 –30

89 143 118 229 155 228 150 143 236 150 145

CTGCCTGACGGCCAGG TGCTGCCTGTGAGTCATAAC AGGAGGAGGAGGAAGAGCAG AGAGGTTCTGGCATCGGTTC AGACCAAGCCTCAGCGGAAG GCAGGGCAATAAGATGTACG CCGGGACTTAACTGTAACGG TCCGGACCTACCAGCTCTAC CTTCACCACCATGGAGAAGGC GGCATGGACTGTGGTCATGAG CTTCCGACAGACCATGTACCC TCGTTCCAGTACGCAGAAACAGC TGGAGCTGAGTGCAAGTACC GCCGGAAGCCCAACTATAGC GACTTGCAGGCTATGTACAACATC CTTTATGGTGTGGGCCAAAG TGAGTGGCTGTCTTTTGACG TCCACTGGTGCTGCTATGTC

GATTCCATACCCAAGAAGGAAGG GCCTCGAAAGAACTGAGCTC CCTGGGATGTTCTCCAGATG GAGCAGAAGCTGTGGGCATC GGTACCAACATTCAGGAACAGC CTGAGTCTTGGAAGGGTTCA TGTTGCTCACGGAAGAGTAG TCGGACTCTGCTTCCAAAAG GGCATGGACTGTGGTCATGAG CCTTGAATGCTCTCCTCTGC GATAAGGGCTGAAATGACTTCCC TCAGACAGGGTGACAATCATCCG CTGCCAGTTCTGGTCTTCAA TAGGGCTGCTGGAAGGTGAA CCTCTCAGACGGTGGAGTTATATT TTGTAGTTGGGGTGGTCCTG AGTGAGCGCTGAATCGAAAG CCTGCTTCTCATGGGACTTC

CGCACCACTGGCATTGTC GTGCTGTCCCAGGTGGCTTACAGATG AGCACTGGTCTTGAGTATCC AAATGTTTGTGTTGCGGTCA GCTTTCAGTTACCCTCCCAGATAAC AGCGAACCAGTATCGAGAAC CGTGTTAGTGTCCAGGGAG

TCCTCCTTGATGTCACGCAC CCTTAACAGCTCAACTCTAACTACTTG TGCTGCTGAGGTTAAAGAG TCTGGCACAGGTGTCTTCAG GCACAGGAAGTACAATAACAAGTGC TTACAGAACCACACTCGCAC CTTGAGGAAGTCACCGATG

78 64 171 186 89 138

249 179 142

Elefanty and Robb et al. (1997). Eomesodermin (McConnell and Petrie et al., 2005).

Western blot. Membranes were developed with ECL substrate (Amersham Pharmacia Biotech), scanned with a Molecular Imagers ChemiDoc™ XRS Imaging System (BioRad) and analysed by Quantity One™. Antibodies used: pSmad1/5/8 (Cell Signalling Technologies) and β-tubulin I (Sigma). Acknowledgements We thank Natasha Dodge for technical support and Jennifer Washington and Dr. Rebecca Keough for insightful discussions of the data, Prof. Andrew Elefanty (Monash Immunology and Stem Cell Laboratories, Clayton, Victoria, Australia), Prof. Gordon Keller (McEwen Centre for Regenerative Medicine, University Health Network, Toronto) and Prof. Austin Smith (Centre for Stem Cell Research, Cambridge) for providing the GFP-tagged ES cell lines. This work and E.W. were supported by the Australian Stem Cell Centre (previously of Ground Floor, Building 75, STRIP, Monash University, Wellington Road, Clayton, Victoria 3800, Australia) and the University of Melbourne (Parkville, Victoria 3010, Australia). J.H. was supported on a University of Adelaide scholarship, K.L. is supported by an Australian Postgraduate Award. References Abbondanzo, S.J., Gadi, I., Stewart, C.L., 1993. Derivation of embryonic stem cell lines. Methods Enzymol. 225, 803–823. Bertrand, R., Solary, E., O0 Connor, P., Kohn, K.W., Pommier, Y., 1994. Induction of a common pathway of apoptosis by staurosporine. Exp. Cell Res. 211, 314–321. Bhat, R.V., Shanley, J., Correll, M.P., Fieles, W.E., Keith, R.A., Scott, C.W., Lee, C.M., 2000. Regulation and localization of tyrosine216 phosphorylation of glycogen synthase kinase-3beta in cellular and animal models of neuronal degeneration. Proc. Natl. Acad. Sci. U. S. A. 97, 11074–11079. Buschke, D.G., et al., 2012. Cell death, non-invasively assessed by intrinsic fluorescence intensity of NADH, is a predictive indicator of functional differentiation of embryonic stem cells. Biol. Cell. 104 (6), 352–364. Casalino, L., Comes, S., Lambazzi, G., De Stefano, B., Filosa, S., De Falco, S., De Cesare, D., Minchiotti, G., Patriarca, EJ., 2011. Control of embryonic stem cell metastability by L-proline catabolism. J. Mol. Cell. Biol. 3 (2), 108–122.

Ciruna, B., Rossant, J., 2001. FGF signaling regulates mesoderm cell fate specification and morphogenetic movement at the primitive streak. Dev. Cell 1, 37–49. Ciruna, B.G., Rossant, J., 1999. Expression of the T-box gene Eomesodermin during early mouse development. Mech. Dev. 81, 199–203. D0 Alimonte, I., Ballerini, P., Nargi, E., Buccella, S., Giuliani, P., Di Iorio, P., Caciagli, F., Ciccarelli, R., 2007. Staurosporine-induced apoptosis in astrocytes is prevented by A1 adenosine receptor activation. Neurosci. Lett. 418, 66–71. Denisenko, N., Burighel, P., Citi, S., 1994. Different effects of protein kinase inhibitors on the localization of junctional proteins at cell-cell contact sites. J. Cell Sci. 107 (Pt 4), 969–981. Doetschman, T.C., Eistetter, H., Katz, M., Schmidt, W., Kemler, R., 1985. The in vitro development of blastocyst-derived embryonic stem cell lines: formation of visceral yolk sac, blood islands and myocardium. J. Embryol. Exp. Morphol. 87, 27–45. Elefanty, A.G., Robb, L., et al., 1997. Hematopoietic-specific genes are not induced during in vitro differentiation of scl-null embryonic stem cells. Blood 90 (4), 1435–1447. Falcieri, E., Martelli, A.M., Bareggi, R., Cataldi, A., Cocco, L., 1993. The protein kinase inhibitor staurosporine induces morphological changes typical of apoptosis in MOLT-4 cells without concomitant DNA fragmentation. Biochem. Biophys. Res. Commun. 193, 19–25. Fehling, H.J., Lacaud, G., Kubo, A., Kennedy, M., Robertson, S., Keller, G., Kouskoff, V., 2003. Tracking mesoderm induction and its specification to the hemangioblast during embryonic stem cell differentiation. Development 130, 4217–4227. Gadue, P., Huber, T.L., Paddison, P.J., Keller, G.M., 2006. Wnt and TGF-beta signaling are required for the induction of an in vitro model of primitive streak formation using embryonic stem cells. Proc. Natl. Acad. Sci. U. S. A. 103, 16806–16811. Guo, Y.L., Ye, J., Huang, F., 2007. p38alpha MAP kinase-deficient mouse embryonic stem cells can differentiate to endothelial cells, smooth muscle cells, and neurons. Dev. Dyn. 236, 3383–3392. Hart, A.H., Hartley, L., Sourris, K., Stadler, E.S., Li, R., Stanley, E.G., Tam, P.P., Elefanty, A.G., Robb, L., 2002. Mixl1 is required for axial mesendoderm morphogenesis and patterning in the murine embryo. Development 129, 3597–3608. Hawkins, K., Mohamet, L., Ritson, S., Merry, C.L., Ward, C.M., 2012. E-cadherin and, in its absence, N-cadherin promotes Nanog expression in mouse embryonic stem cells via STAT3 phosphorylation. Stem Cells 30, 1842–1851. Hughes, J.N., Dodge, N., Rathjen, P.D., Rathjen, J., 2009a. A novel role for gammasecretase in the formation of primitive streak-like intermediates from ES cells in culture. Stem Cells 27, 2941–2951. Hughes, J.N., Washington, J.M., Zheng, Z., Lau, X.K., Yap, C., Rathjen, P.D., Rathjen, J., 2009b. Manipulation of cell:cell contacts and mesoderm suppressing activity direct lineage choice from pluripotent primitive ectoderm-like cells in culture. PLoS One 4, e5579. Hugo, H.J., Wafai, R., Blick, T., Thompson, E.W., Newgreen, D.F., 2009. Staurosporine augments EGF-mediated EMT in PMC42-LA cells through actin

Please cite this article as: Hughes, J.N., et al., Regulation of pluripotent cell differentiation by a small molecule, staurosporine. Differentiation (2014), http://dx.doi.org/10.1016/j.diff.2014.01.001i

10

J.N. Hughes et al. / Differentiation ∎ (∎∎∎∎) ∎∎∎–∎∎∎

depolymerisation, focal contact size reduction and Snail1 induction - a model for cross-modulation. BMC Cancer 9, 235. Jackson, S.A., Schiesser, J., Stanley, E.G., Elefanty, A.G., 2010. Differentiating embryonic stem cells pass through ‘temporal windows’ that mark responsiveness to exogenous and paracrine mesendoderm inducing signals. PLoS One 5, e10706. Johansson, B.M., Wiles, M.V., 1995. Evidence for involvement of activin A and bone morphogenetic protein 4 in mammalian mesoderm and hematopoietic development. Mol. Cell Biol. 15, 141–151. Kanai-Azuma, M., Kanai, Y., Gad, J.M., Tajima, Y., Taya, C., Kurohmaru, M., Sanai, Y., Yonekawa, H., Yazaki, K., Tam, P.P., Hayashi, Y., 2002. Depletion of definitive gut endoderm in Sox17-null mutant mice. Development 129, 2367–2379. Koh, J.Y., Wie, M.B., Gwag, B.J., Sensi, S.L., Canzoniero, L.M., Demaro, J., Csernansky, C., Choi, D.W., 1995. Staurosporine-induced neuronal apoptosis. Exp. Neurol. 135, 153–159. Koivisto, L., Alavian, K., Hakkinen, L., Pelech, S., McCulloch, C.A., Larjava, H., 2003. Glycogen synthase kinase-3 regulates formation of long lamellipodia in human keratinocytes. J. Cell Sci. 116, 3749–3760. Krause, C., Guzman, A., Knaus, P., 2011. Noggin. Int. J. Biochem. Cell Biol. 43, 478–481. Lake, J., Rathjen, J., Remiszewski, J., Rathjen, P.D., 2000. Reversible programming of pluripotent cell differentiation. J. Cell Sci. 113 (Pt 3), 555–566. Leclerc, S., Garnier, M., Hoessel, R., Marko, D., Bibb, J.A., Snyder, G.L., Greengard, P., Biernat, J., Wu, Y.Z., Mandelkow, E.M., Eisenbrand, G., Meijer, L., 2001. Indirubins inhibit glycogen synthase kinase-3 beta and CDK5/p25, two protein kinases involved in abnormal tau phosphorylation in Alzheimer0 s disease. A property common to most cyclin-dependent kinase inhibitors? J. Biol. Chem. 276, 251–260. Li, M., Pevny, L., Lovell-Badge, R., Smith, A., 1998. Generation of purified neural precursors from embryonic stem cells by lineage selection. Curr. Biol. 8, 971–974. Lindsley, R.C., Gill, J.G., Murphy, T.L., Langer, E.M., Cai, M., Mashayekhi, M., Wang, W., Niwa, N., Nerbonne, J.M., Kyba, M., Murphy, K.M., 2008. Mesp1 coordinately regulates cardiovascular fate restriction and epithelial-mesenchymal transition in differentiating ESCs. Cell Stem Cell 3, 55–68. McConnell, J., Petrie, L., et al., 2005. Eomesodermin is expressed in mouse oocytes and pre-implantation embryos. Mol. Reprod. Dev. 71 (4), 399–404. Minichiello, J., Ben-Ya0 acov, A., Hearn, C.J., Needham, B., Newgreen, D.F., 1999. Induction of epithelio-mesenchymal transformation of quail embryonic neural cells by inhibition of atypical protein kinase-C. Cell Tissue Res. 295, 195–206. Muller, P.Y., Janovjak, H., Miserez, A.R., Dobbie, Z., 2002. Processing of gene expression data generated by quantitative real-time RT-PCR. Biotechniques 32, 1372–1374, 1376, 1378–1379. Newgreen, D.F., Minichiello, J., 1995. Control of epitheliomesenchymal transformation. I. Events in the onset of neural crest cell migration are separable and inducible by protein kinase inhibitors. Dev. Biol. 170, 91–101. Newgreen, D.F., Minichiello, J., 1996. Control of epitheliomesenchymal transformation. II. Cross-modulation of cell adhesion and cytoskeletal systems in embryonic neural cells. Dev. Biol. 176, 300–312. Ng, E.S., Azzola, L., Sourris, K., Robb, L., Stanley, E.G., Elefanty, A.G., 2005. The primitive streak gene Mixl1 is required for efficient haematopoiesis and BMP4induced ventral mesoderm patterning in differentiating ES cells. Development 132, 873–884. Pelton, T.A., Sharma, S., Schulz, T.C., Rathjen, J., Rathjen, P.D., 2002. Transient pluripotent cell populations during primitive ectoderm formation: correlation of in vivo and in vitro pluripotent cell development. J. Cell Sci. 115, 329–339. Pevny, L.H., Sockanathan, S., Placzek, M., Lovell-Badge, R., 1998. A role for SOX1 in neural determination. Development 125, 1967–1978. Ratcliffe, M.J., Rubin, L.L., Staddon, J.M., 1997. Dephosphorylation of the cadherinassociated p100/p120 proteins in response to activation of protein kinase C in epithelial cells. J. Biol. Chem. 272, 31894–31901. Rathjen, J., Rathjen, P.D., 2003. Lineage specific differentiation of mouse ES cells: formation and differentiation of early primitive ectoderm-like (EPL) cells. Methods Enzymol. 365, 3–25. Rathjen, J., Lake, J.A., Bettess, M.D., Washington, J.M., Chapman, G., Rathjen, P.D., 1999. Formation of a primitive ectoderm like cell population, EPL cells, from ES cells in response to biologically derived factors. J. Cell Sci. 112 (Pt 5), 601–612. Rathjen, J., Haines, B.P., Hudson, K.M., Nesci, A., Dunn, S., Rathjen, P.D., 2002. Directed differentiation of pluripotent cells to neural lineages: homogeneous formation and differentiation of a neurectoderm population. Development 129, 2649–2661. Robb, L., Hartley, L., Begley, C.G., Brodnicki, T.C., Copeland, N.G., Gilbert, D.J., Jenkins, N.A., Elefanty, A.G., 2000. Cloning, expression analysis, and chromosomal

localization of murine and human homologues of a Xenopus mix gene. Dev. Dyn. 219, 497–504. Rozen, S., Skaletsky, H., 2000. Primer3 on the WWW for general users and for biologist programmers. Methods Mol. Biol. 132, 365–386. Ruegg, U.T., Burgess, G.M., 1989. Staurosporine, K-252 and UCN-01: potent but nonspecific inhibitors of protein kinases. Trends Pharmacol. Sci. 10, 218–220. Schumacher, A., Arnhold, S., Addicks, K., Doerfler, W., 2003. Staurosporine is a potent activator of neuronal, glial, and “CNS stem cell-like” neurosphere differentiation in murine embryonic stem cells. Mol. Cell Neurosci. 23, 669–680. Shawlot, W., Wakamiya, M., Kwan, K.M., Kania, A., Jessell, T.M., Behringer, R.R., 1999. Lim1 is required in both primitive streak-derived tissues and visceral endoderm for head formation in the mouse. Development 126, 4925–4932. Simon, P., 2003. Q-Gene: processing quantitative real-time RT-PCR data. Bioinformatics 19, 1439–1440. Spencer, H.L., Eastham, A.M., Merry, C.L., Southgate, T.D., Perez-Campo, F., Soncin, F., Ritson, S., Kemler, R., Stern, P.L., Ward, C.M., 2007. E-cadherin inhibits cell surface localization of the pro-migratory 5T4 oncofetal antigen in mouse embryonic stem cells. Mol. Biol. Cell 18, 2838–2851. Tan, B.S., Lonic, A., Morris, M.B., Rathjen, P.D., Rathjen, J., 2011. The amino acid transporter SNAT2 mediates L-proline-induced differentiation of ES cells. Am. J. Cell. Physiol. 300 (6), C1270–1279. Tam, P.P., Beddington, R.S., 1992. Establishment and organization of germ layers in the gastrulating mouse embryo. Ciba Found Symp. 165, 27–41 (discussion 4229). Tamaoki, T., Nomoto, H., Takahashi, I., Kato, Y., Morimoto, M., Tomita, F., 1986. Staurosporine, a potent inhibitor of phospholipid/Ca þ þdependent protein kinase. Biochem. Biophys. Res. Commun. 135, 397–402. Tanaka, M., Jokubaitis, V., Wood, C., Wang, Y., Brouard, N., Pera, M., Hearn, M., Simmons, P., Nakayama, N., 2009. BMP inhibition stimulates WNT-dependent generation of chondrogenic mesoderm from embryonic stem cells. Stem Cell Res. 3, 126–141. Thompson, A.F., Levin, L.A., 2010. Neuronal differentiation by analogs of staurosporine. Neurochem. Int. 56, 554–560. Vallier, L., Mendjan, S., Brown, S., Chng, Z., Teo, A., Smithers, L.E., Trotter, M.W., Cho, C.H., Martinez, A., Rugg-Gunn, P., Brons, G., Pedersen, R.A., 2009. Activin/Nodal signalling maintains pluripotency by controlling Nanog expression. Development 136, 1339–1349. Vassilieva, S., Goh, H.N., Lau, K.X., Hughes, J.N., Familari, M., Rathjen, P.D., Rathjen, J., 2012. A system to enrich for primitive streak-derivatives, definitive endoderm and mesoderm, from pluripotent cells in culture. PLoS One 7, e38645. Ware, C.B., Wang, L., Mecham, B.H., Shen, L., Nelson, A.M., Bar, M., Lamba, D.A., Dauphin, D.S., Buckingham, B., Askari, B., Lim, R., Tewari, M., Gartler, S.M., Issa, J. P., Pavlidis, P., Duan, Z., Blau, C.A., 2009. Histone deacetylase inhibition elicits an evolutionarily conserved self-renewal program in embryonic stem cells. Cell Stem Cell 4, 359–369. Washington, J.M., Rathjen, J., Felquer, F., Lonic, A., Bettess, M.D., Hamra, N., Semendric, L., Tan, B.S., Lake, J.A., Keough, R.A., et al., 2010. L-Proline induces differentiation of ES cells: a novel role for an amino acid in the regulation of pluripotent cellsin culture. Am. J. Physiol. Cell. Physiol. 298 (5), C982–992. Xu, Y., et al., 2010. Revealing a core signaling regulatory mechanism for pluripotent stem cell survival and self-renewal by small molecules. Proc. Natl. Acad. Sci. U S A, 107 (18), 8129–8134. Weil, M., Jacobson, M.D., Coles, H.S., Davies, T.J., Gardner, R.L., Raff, K.D., Raff, M.C., 1996. Constitutive expression of the machinery for programmed cell death. J. Cell Biol. 133, 1053–1059. Wilkinson, D.G., Bhatt, S., Herrmann, B.G., 1990. Expression pattern of the mouse T gene and its role in mesoderm formation. Nature 343, 657–659. Williams, M., Burdsal, C., Periasamy, A., Lewandoski, M., Sutherland, A., 2012. Mouse primitive streak forms in situ by initiation of epithelial to mesenchymal transition without migration of a cell population. Dev. Dyn. 241, 270–283. Yanagihara, N., Tachikawa, E., Izumi, F., Yasugawa, S., Yamamoto, H., Miyamoto, E., 1991. Staurosporine: an effective inhibitor for Ca2 þ /calmodulin-dependent protein kinase II. J. Neurochem. 56, 294–298. Ying, Q.L., Stavridis, M., Griffiths, D., Li, M., Smith, A., 2003. Conversion of embryonic stem cells into neuroectodermal precursors in adherent monoculture. Nat. Biotechnol. 21, 183–186. Zhang, H., Vollmer, M., De Geyter, M., Durrenberger, M., De Geyter, C., 2005. Apoptosis and differentiation induced by staurosporine in granulosa tumor cells is coupled with activation of JNK and suppression of p38 MAPK. Int. J. Oncol. 26, 1575–1580. Zhu, S., Wurdak, H., Wang, J., Lyssiotis, C.A., Peters, E.C., Cho, C.Y., Wu, X., Schultz, P. G., 2009. A small molecule primes embryonic stem cells for differentiation. Cell Stem Cell 4, 416–426.

Please cite this article as: Hughes, J.N., et al., Regulation of pluripotent cell differentiation by a small molecule, staurosporine. Differentiation (2014), http://dx.doi.org/10.1016/j.diff.2014.01.001i