Regulation of prostacyclin synthase expression and prostacyclin content in the pig endometrium

Available online at www.sciencedirect.com

Theriogenology 78 (2012) 2071–2086 www.theriojournal.com

Regulation of prostacyclin synthase expression and prostacyclin content in the pig endometrium E. Morawska, M.M. Kaczmarek, A. Blitek* Institute of Animal Reproduction and Food Research of the Polish Academy of Sciences, Olsztyn, Poland Received 10 May 2012; received in revised form 26 July 2012; accepted 27 July 2012

Abstract Prostaglandins (PGs) are critical regulators of a number of reproductive processes, including embryo development and implantation. In the present study, prostacyclin (PGI2) synthase (PGIS) mRNA and protein expression, as well as 6-keto PGF1␣ (a PGI2 metabolite) concentration, were investigated in the pig uterus. Endometrial tissue and uterine luminal flushings were obtained on Days 4 to 18 of the estrous cycle and pregnancy. Additionally, conceptuses were collected and examined for PGIS mRNA expression and 6-keto PGF1␣ concentration. Regulation of PGI2 synthesis in the porcine endometrium by steroids, conceptus products, and cytokines was studied in vitro and/or in vivo. Endometrial PGIS protein level increased on Days 12 and 16 in pregnant but not in cyclic gilts. Moreover, higher PGIS protein expression on Day 12 of pregnancy was accompanied by a greater content of 6-keto PGF1␣ in the endometrium. The concentration of 6-keto PGF1␣ in uterine luminal flushings increased substantially on Days 16 and 18 in pregnant gilts and was higher than in cyclic animals. Greater PGIS mRNA expression and PGI2 metabolite concentration were detected in Day 12 and 14 conceptuses, respectively. Incubation of endometrial explants with conceptus-conditioned medium resulted in upregulation of PGIS protein expression and increased PGI2 secretion. Moreover, PGIS mRNA and protein expression were upregulated in the endometrium collected from gravid uterine horn on Day 14 of pregnancy. In summary, PGIS is differentially expressed in the endometrium of cyclic and pregnant gilts resulting in higher PGI2 synthesis in pregnant animals. Porcine conceptuses are important regulators of endometrial PGIS expression and PGI2 release during the implantation period. © 2012 Elsevier Inc. All rights reserved. Keywords: Pig; Endometrium; Prostacyclin; Steroids; Cytokines; Conceptus; Pregnancy

1. Introduction Prostaglandins (PGs) produced by the uterus play an important role in various reproductive processes, including ovulation, luteolysis, fertilization, early embryonic development, and implantation [1– 4]. Prostaglandins belong to a group of prostanoids, which are generated from arachidonic acid (AA) that is liberated

* Corresponding author. Tel.: ⫹48 89 5393160; fax: ⫹48 89 5357421. E-mail address: [email protected] (A. Blitek). 0093-691X/$ – see front matter © 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.theriogenology.2012.07.028

from membrane phospholipids by the action of phospholipase A2. Then, prostaglandin endoperoxide synthase (also known as prostaglandin G/H synthase or cyclooxygenase) catalyzes the conversion of AA to PGH2. There are two main prostaglandin endoperoxide synthase isoforms, PTGS1 and PTGS2, encoded by two separate genes. PTGS1 is constitutively expressed in many mammalian cells, while PTGS2 is highly inducible by diverse stimuli, including cytokines, growth factors, and mitogen and tumor promoters [5]. When PGH2 is produced, it forms a substrate for the synthesis of PGE2, PGF2␣, PGD2, PGI2 (prostacyclin), and thrombox-

2072

E. Morawska et al. / Theriogenology 78 (2012) 2071–2086

ane (TXA) via specific enzymes: PGE synthase (PGES), PGF synthase (PGFS), PGD synthase, PGI synthase (PGIS), and TXA synthase, respectively [6]. The importance of PGs during embryo implantation has been demonstrated in Ptgs2-deficient mice, which exhibit implantation defects, including failure of blastocyst implantation and decidualization [7]. In pigs, inhibition of PG synthesis by blocking the activity of PTGS2 causes pregnancy loss [8]. In this species, primary attention has been paid to the role of PTGS2derived opposite-acting PGE2 and PGF2␣ in the regulation of the estrous cycle and early pregnancy. The proper ratio between luteoprotective PGE2 and luteolytic PGF2␣ is essential for successful pregnancy establishment in the pig [9]. Differential mRNA and protein expression profiles were demonstrated for PTGS1, PTGS2, mPGES-1 (microsomal isoform of PGE synthase) and PGFS in the endometrium of cyclic and early pregnant gilts [10,11]. PGE2 of endometrial or conceptus origin acting through its endometrial receptors may increase its own synthesis resulting in a higher PGE2/ PGF2␣ ratio [12]. Moreover, porcine conceptuses increase PTGS2 expression and PGE2 secretion from luminal epithelial cells of the endometrium [13]. Besides PGE2, PGI2 and its receptor signaling are important components of embryo-uterine interactions that are essential for successful implantation, as demonstrated in rodents [14 –16], cattle [17], and sheep [18]. In mice and cattle, PGI2 is the most abundant prostanoid produced by the endometrium, followed by PGE2 [14,17]. PGI2 synthesis occurs via PGIS, a membrane-bound hemoprotein belonging to the cytochrome P450 family. PGIS is widely expressed in different tissues, but is found particularly in endothelial cells (reviewed in [6]). PGI2 is chemically unstable in biological fluids and undergoes spontaneous transformation to 6-keto PGF1␣. The classical signaling pathway of PGI2 uses a G protein-coupled cell surface receptor PTGIR (PGI2 receptor; also known as IP) [19], but PGI2 may also act via peroxisome proliferator activated receptors (PPARs), which belong to a nuclear hormone receptor superfamily [20]. PGI2 is a powerful vasodilator of smooth muscle and an inhibitor of platelet aggregation. In mice, PGI2 is critical to endometrial decidualization and embryo implantation [14]. Moreover, it increases embryonic cell proliferation, reduces apoptosis [21,22], and enhances embryo hatching, and live birth potential of mouse embryos [23,24]. Among domestic species, expression of PGIS as well as PTGIR and PPARs was demonstrated in the endometrium of cyclic and pregnant animals, and also

in conceptuses [17,18]. Recently, changes in the expression of PPARs (␣, ␤, ␥) in the endometrium were reported for cyclic and pregnant gilts [25]. In contrast, there are no data available concerning the profile of PGIS expression and regulation of PGI2 synthesis in the pig uterus. Therefore, the current study was conducted to examine: (1) the concentration of 6-keto PGF1␣ (a PGI2 metabolite) in uterine luminal flushings (ULFs) and in the endometrium of cyclic and early pregnant gilts on Days 4 to 18 after estrus; (2) the profiles of PGIS mRNA and protein expression in the endometrium during Days 4 to 18 of the estrous cycle and early pregnancy; (3) the relative amount of PGIS mRNA and concentration of 6-keto PGF1␣ in porcine conceptuses/ trophoblasts collected on Days 10 to 18 of gestation; (4) the effect of steroids, selected cytokines and conceptus products on PGIS mRNA and protein expression and 6-keto PGF1␣ content in the pig endometrium using in vitro and/or in vivo models. Factors involved in the maternal recognition of pregnancy and conceptus implantation in pigs are not completely defined. Because PGI2 stimulates embryonic development in pigs [26], determination of mechanisms controlling PGI2 synthesis in the endometrium may shed new light on these processes and help to better understand conceptus-maternal interactions. 2. Materials and methods 2.1. Animals and sample collection All procedures involving the use of animals were conducted in accordance with the national guidelines for agricultural animal care and were approved by the Animal Ethics Committee, University of Warmia and Mazury in Olsztyn, Poland. In all the experiments, a total of 93 crossbred gilts (Sus scrofa domesticus) of similar genetic background from one commercial herd were used. To analyze endometrial PGIS mRNA and protein expression and 6-keto PGF1␣ concentration in the endometrium and ULFs of cyclic and pregnant gilts, as well as the profiles of PGIS mRNA expression and 6-keto PGF1␣ concentrations in conceptuses, 59 pubertal gilts of similar age (8 to 8.5 mo) and weight (140 to 150 kg) were used. All gilts were checked daily for estrus behavior with intact males. After exhibiting two estrous cycles of normal length, gilts were randomly divided in two experimental groups: cyclic and pregnant. Animals assigned to the cyclic group were slaughtered on Days 4, 10, 12, and 16 or 18 (n ⫽ 5 per day) of their third estrous cycle. Gilts assigned to the preg-

E. Morawska et al. / Theriogenology 78 (2012) 2071–2086

nant group were bred 12 and 24 h after detection of their third estrus. The day of the second breeding was considered the first day of pregnancy. Gilts were slaughtered on Days 4 (n ⫽ 5), 10 (n ⫽ 6), 12 (n ⫽ 6), 14 (n ⫽ 6), 16 (n ⫽ 5), or 18 (n ⫽ 6) of pregnancy. Each uterine horn was excised then gently flushed with 20 mL of PBS (pH 7.4) to obtain conceptuses and ULFs. The day of pregnancy was confirmed by the size and morphology of conceptuses: Day 10 (spherical conceptuses with a diameter of 3 to 5 mm), Day 12 (all flushed conceptuses filamentous in shape), Days 14 and 16 (elongated forms of conceptuses), and Day 18 (trophoblast tissue and embryos with evident vascularization). On Day 18 of pregnancy, uterine horns were cut open and trophoblast tissue was dissected away from embryos. Uterine luminal flushings were clarified by centrifugation (3000 X g for 5 min), frozen, and stored at ⫺20 °C. Endometrial tissue and conceptuses were snap-frozen in liquid nitrogen and stored at ⫺80 °C until further use. Additionally, 12 gilts were slaughtered on Day 12 of the estrous cycle (n ⫽ 6) and Day 12 of pregnancy (n ⫽ 6) to obtain endometrial tissue for Experiments 1, 2, and 4, and conceptuses for Experiment 2. To examine the effect of conceptus presence on PGIS mRNA and protein expression and 6-keto PGF1␣ concentration in the endometrium, 22 prepubertal gilts were used and subjected to surgical procedure as described below (section 2.4. Experiment 3). 2.2. Experiment 1: effect of steroids on PGIS expression and 6-keto PGF1␣ concentration in the endometrium; in vitro study To study the effect of steroids on PGIS mRNA and protein expression and 6-keto PGF1␣ secretion, endometrial tissue was obtained from Day 12 cyclic gilts (n ⫽ 4) and incubated with estradiol (17␤-estradiol; E2) and progesterone (P4) as previously described [27]. Briefly, endometrial tissue collected from the middle portion of a randomly selected uterine horn was cut into small pieces (20 to 25 mg) and washed in phenol red-free Medium 199 (M3769; Sigma-Aldrich, St. Louis, MO, USA). A total of 100 to 110 mg of tissue was placed into a glass vial containing 2 mL of phenol red-free Medium 199 supplemented with 1% BSA (wt/ vol; ICN Biomedicals, Costa Mesa, CA, USA) and antibiotics (100 IU/mL penicillin and 100 ␮g/mL streptomycin; Sigma-Aldrich) and incubated for 2 h. After this, endometrial slices were treated with fresh Medium 199 containing: no additive (control), or E2 (10 nM; Sigma-Aldrich), P4 (100 nM; Sigma-Aldrich), or 10 nM

2073

E2 plus 100 nM P4, and incubated for 6, 12, or 24 h at 37 °C in a humidified atmosphere of 95% air:5% CO2 with gentle shaking. Additionally, AA (Sigma-Aldrich) at 20 ␮g/mL was used as a positive control for PGI2 secretion. All treatments were performed in quadruplicate (two for mRNA and two for protein analysis for each pig) in four independent experiments (gilts). After incubation, the medium was collected, frozen, and stored at ⫺20 °C for further analysis of 6-keto PGF1␣. Endometrial strips were washed with PBS, snap-frozen in liquid nitrogen, and stored at ⫺80 °C until RNA and protein extraction. 2.3. Experiment 2: effect of conceptus products on PGIS expression and 6-keto PGF1␣ concentration in the endometrium; in vitro study Day 12 conceptuses were collected from uteri by gentle flushing of each uterine horn with sterile phenol red-free Medium 199 containing 5% (v:v) of steroidfree newborn calf serum (NCS) and antibiotics, as described previously [13]. All flushed conceptuses were filamentous in shape. After washing with fresh Medium 199, conceptuses were weighed and placed separately in culture flasks containing an appropriate amount (3 mL medium per 40 mg of conceptus) of phenol red-free Medium 199, supplemented with 5% steroid-free NCS and antibiotics. Three conceptuses from each gilt were used. Incubation was performed for 24 h at 37 °C in a humidified atmosphere of 95% air:5% CO2 with gentle shaking. After incubation, media from all conceptuses obtained from one gilt were pooled together, centrifuged at 500 X g for 5 min and used as conceptusexposed medium (CEM). To study the effect of conceptus products on PGIS expression and 6-keto PGF1␣ secretion, endometrial strips were incubated with CEM. Preparation of the strips was performed as described in Experiment 1. Endometrial slices (100 to 110 mg per vial) were incubated for 2 h in Medium 199 containing 5% steroid-free NCS and antibiotics. Then, the medium was removed and endometrial tissue was treated with control medium (phenol red-free Medium 199 supplemented with 5% steroid-free NCS and antibiotics) or CEM for 6 or 12 h. All treatments were performed in quadruplicate (two for mRNA and two for protein analysis for each pig) in six separate experiments (gilts). After incubation, media was collected, frozen, and stored at ⫺20 °C. Endometrial strips were washed with PBS, snap-frozen in liquid nitrogen, and stored at ⫺80 °C until tissue homogenization and RNA extraction.

2074

E. Morawska et al. / Theriogenology 78 (2012) 2071–2086

2.4. Experiment 3: effect of conceptus presence on PGIS expression and 6-keto PGF1␣ concentration in the endometrium; in vivo study To examine the effect of conceptus presence on PGIS mRNA and protein expression and 6-keto PGF1␣ concentration in the endometrium, 22 prepubertal gilts with an average body weight of 100 kg and 6.0 to 6.5 mo of age were subjected to the surgical procedure described previously [28]. Under general anesthesia, one uterine horn of each gilt was cut transversely and the cut ends were closed with sutures. In this way, the uterus consisted of one intact uterine horn and one horn detached from the uterine corpus. After 10 days, gilts were synchronized with a single dose of 750 IU im pregnant mare’s serum gonadotropin (Folligon; Intervet, Boxmeer, The Nederlands) followed by 500 IU hCG (Chorulon; Intervet) 72 h later. Subsequently, gilts assigned to the pregnant group (n ⫽ 11) were inseminated 24 and 48 h after hCG injection. The day of the second insemination was designated as the first day of pregnancy. Gilts were slaughtered on Days 11 or 14 of pregnancy. The remaining gilts (n ⫽ 11) were not inseminated and used as a control group to exclude the effect of surgery. These gilts were slaughtered on Days 11 or 14 of the estrous cycle. After slaughter, each uterine horn of all gilts was washed with 20 mL of PBS to obtain conceptuses. Pregnancy was confirmed by the morphology of conceptuses, which were flushed only from the connected uterine horn of pregnant animals. Conceptuses collected on Day 11 were spherical (from 3 to 8 mm) or tubular (from 12 to 30 mm) in shape, while those obtained on Day 14 were elongated. Endometrial tissue was dissected from the myometrium, snap-frozen in liquid nitrogen, and stored at ⫺80 °C for further use. 2.5. Experiment 4: effect of cytokines on PGIS expression and 6-keto PGF1␣ concentration in the endometrium; in vitro study To study the effect of cytokines on PGIS expression and 6-keto PGF1␣ secretion, endometrial strips were incubated with interleukin 6 (IL-6) or interleukin 1␤ (IL-1␤). Preparation of the strips was performed as described in Experiment 1. Endometrial slices (100 to 110 mg per vial) collected from Day 12 cyclic gilts were incubated for 2 h in Medium 199 (M2520; SigmaAldrich) containing 0.1% BSA and antibiotics. Then, the medium was removed and the endometrial tissue was treated for 6 h with either medium only (control; Medium 199, supplemented with 0.1% BSA and antibiotics), or medium with IL-6, 10 ng/mL or IL-1␤, 10

ng/mL. The doses of cytokines used were selected according to Franczak and coworkers [29], and time of incubation was selected based on the results of Experiment 2. All treatments were performed in quadruplicate (two for mRNA and two for protein analysis for each pig) in six separate experiments (gilts). After incubation, medium was collected and stored frozen at ⫺20 °C until further assay for 6-keto PGF1␣. Endometrial strips were washed with PBS, snap-frozen in liquid nitrogen, and stored at ⫺80 °C until tissue homogenization and RNA extraction. 2.6. Total RNA isolation and real-time PCR Total RNA was extracted from frozen endometrial tissue and conceptuses using a Total RNA Prep Plus kit (A&A Biotechnology, Gdan´sk, Poland) and treated with DNase I (Deoxyribonuclease I; Invitrogen Life Technologies, Inc., Carlsbad, CA, USA) according to the manufacturer’s instructions. Samples were reverse transcribed using a High Capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster City, CA, USA) as previously described [30]. Briefly, the reverse transcription (RT) reaction mix contained 1 ⫻ RT buffer, 1 mM dNTP mix, 2.5 ␮M RT random primers, 1 U/␮L RNase inhibitor, and 2.5 U/␮L MultiScribe Reverse Transcriptase. At the beginning, the RNA was denatured at 70 °C for 10 min, then the RT reaction was carried out at 25 °C for 10 min, 37 °C for 120 min, and finally 85 °C for 5 min. Diluted cDNA from RT-polymerase chain reaction (PCR) was used to analyze prostacyclin synthase (PGIS), ␤-actin (ACTB), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) quantitative gene expression using an ABI Prism 7300 Sequence Detection System (Life Technologies). Each sample contained cDNA (3 ␮L), forward and reverse primers (0.5 ␮M each), and Power SYBR Green PCR master mix (12.5 ␮L; Life Technologies). To evaluate mRNA levels of PGIS and reference genes (GAPDH and ACTB), specific primers were used (Table 1). For quantification, standard curves consisting of serial dilutions of the appropriate purified cDNA were included. The following real-time PCR conditions were used: initial denaturation for 10 min at 95 °C, followed by 37 cycles of 15 sec of denaturation at 95 °C and 30 sec of annealing at 59 °C (for PGIS and GAPDH) or 60 °C (for ACTB), followed by 45 sec of elongation at 72 °C. After these stages, melting curves were obtained by stepwise increases in temperature from 60 °C to 95 °C to ensure single product amplification. Gel electrophoresis and sequencing were performed to confirm the specificity of

E. Morawska et al. / Theriogenology 78 (2012) 2071–2086

2075

Table 1 Primers used for real-time polymerase chain reaction. Gene

Primer sequences (5= to 3=)

PGIS

Sense: CCAACCTCCGCACTGTCCT Antisense: CTGGGTCAGGTAGCCAGCTCT Sense: CCTTCATTGACCTCCACTACATGGT Antisense: CCACAACATACGTAGCACCACGATC Sense: ACATCAAGGAGAAGCTCTGCTACG Antisense: GAGGGGCGATGATCTTGATCTTCA

GAPDH ACTB

real-time PCR products. All expression data are presented as units of PGIS relative to geometrical averaging of GAPDH and ACTB gene expression according to Vandesompele and coworkers [33]. 2.7. Preparation of tissue homogenates Endometrial tissue of cyclic and pregnant gilts from in vivo experiments was homogenized using an icecold homogenization buffer (50mM Tris-HCl, pH 8.0; 150 mM NaCl, 1% Triton X-100, 1 mM EDTA) containing 10 ␮L/mL Protease inhibitor cocktail (SigmaAldrich). Homogenates were then centrifuged for 10 min at 800 X g at 4 °C. Subsequently, supernatants from endometrial samples obtained from in vivo experiments were collected and centrifuged for an additional 1 h at 100 000 X g at 4 °C, and the resulting supernatants and precipitates were used as the cytosol and microsomal fractions, respectively. The cytosol fraction was used for enzyme immunoassay (EIA) of 6-keto PGF1␣, while the microsomal fraction was used for Western blot analysis of PGIS protein expression. Endometrial strips from in vitro experiments and conceptuses were homogenized using the same ice-cold homogenization buffer as described above and centrifuged for 10 min at 800 X g at 4 °C. The supernatant was collected and used for EIA of 6-keto PGF1␣ (endometrium and conceptuses) and for Western blots of PGIS protein expression (endometrium). Total protein content was determined [34]. 2.8. Western blot analysis Equal amounts of endometrial fractions (40 ␮g for in vivo experiments or 50 ␮g for in vitro experiments) were dissolved in SDS gel-loading buffer (50 mM TrisHCl, pH 6.8; 4% SDS, 20% glycerol, and 2% ␤-mercaptoethanol), heated to 95 °C for 5 min and separated on 10% SDS-polyacrylamide gel electrophoresis. Separated proteins were electroblotted onto 0.45 ␮m pore size polyvinylidene difluoride membranes in transfer buffer (20 mM Tris-HCl, pH 8.2; 150-mM glycine, 20% methanol). After transfer, the nonspecific binding sites were blocked with 5% nonfat dry milk with Tris-buff-

GenBank Accession Number/reference

Product size (base pairs)

BC120087

114

U48832/[31]

183

U07786/[32]

366

ered saline, containing 0.1% Tween 20 for 1.5 h at room temperature. Then, membranes were incubated overnight with polyclonal rabbit anti-PGIS (1:200, Cayman Chemicals, Ann Arbor, MI, USA) or polyclonal anti-ACTB antibodies (1.7 ␮g/mL; Abcam, Cambridge, UK) at 4 °C. Specificity of the PGIS antibodies was previously reported for porcine tissue [35]. After washing in Tris-buffered saline, containing 0.1% Tween 20, membranes were incubated with anti-rabbit alkaline phosphatase-conjugated antibodies (1:20 000; Sigma-Aldrich) for 1.5 h. Immune complexes were visualized using a standard alkaline phosphatase visualization procedure. Western blots were quantitated using Kodak 1D software (Eastman Kodak, Rochester, NY, USA). 2.9. EIA of 6-keto PGF1␣ Concentrations of 6-keto PGF1␣ in ULFs and endometrial tissue homogenates, incubation media, and conceptuses were determined using an EIA kit (Cayman Chemicals), according to the manufacturer’s protocol. The sensitivity of the assay was 1.6 pg/mL, and intraand interassay coefficients of variation were 3.9% and 7.8%, respectively. 2.10. Statistical analysis All statistical analyses were performed using GraphPad PRISM version 5.0 (GraphPad Software, Inc., San Diego, CA, USA). To test the expression of PGIS mRNA and protein in the endometrium and the content of 6-keto PGF1␣ in ULFs and endometrial tissue of cyclic and pregnant animals, statistical analysis was conducted using two-way ANOVA followed by Bonferroni’s post hoc test. This analysis included the effects of day, reproductive status, and day by reproductive status interaction. To examine the effect of CEM on PGIS mRNA and protein expression and 6-keto PGF1␣ concentration in endometrial tissue and incubation medium after 6 and 12 h, two-way ANOVA followed by Bonferroni’s post hoc test was performed. This analysis included the effects of duration of incubation, CEM

2076

E. Morawska et al. / Theriogenology 78 (2012) 2071–2086

treatment, and duration of incubation by CEM treatment interaction. To test the effect of conceptus presence in the uterine horn on PGIS mRNA and protein expression and 6-keto PGF1␣ concentration in the endometrium of gilts, statistical analysis was conducted using two-way ANOVA followed by Bonferroni’s post hoc test. This analysis included the effect of conceptus presence, reproductive status, and conceptus presence by reproductive status interaction. To test the expression of PGIS mRNA and the content of 6-keto PGF1␣ in conceptuses/trophoblasts on Days 10 to 18 of pregnancy, and the effect of steroids and cytokines on PGIS expression and the content of 6-keto PGF1␣ in the endometrium and incubation medium, one-way ANOVA was performed followed by Bonferroni’s post hoc test. To test the level of PGIS mRNA and the concentration of 6-keto PGF1␣ in Day 18 embryos and trophoblasts, a paired t test was performed. All numerical data are expressed as the mean ⫾ SEM, and differences were considered to be statistically different at P ⬍ 0.05. Levels of 6-keto PGF1␣ in endometrial tissue were standardized per total protein content. Because of variability among basal PGIS protein expression in the endometrium, as well as basal 6-keto PGF1␣ concentration in endometrial tissue and incubation media from in vitro experiments, the data were log transformed. 3. Results 3.1. PGIS mRNA and protein expression and 6-keto PGF1␣ content in the endometrium of cyclic and early pregnant gilts PGIS mRNA expression in the porcine endometrium was affected by the day and day by status interaction (P ⬍ 0.0001; Fig. 1A). During the estrous cycle, the highest level of PGIS mRNA was detected on Day 16 compared with Days 4, 10, and 18 (P ⬍ 0.01). Increased PGIS mRNA content was also detected on Day 16 of pregnancy compared with Days 4 and 10 (P ⬍ 0.001) and Day 12 (P ⬍ 0.05). In contrast to the estrous cycle, no differences were observed between Days 16 and 18 of gestation. The effect of reproductive status (cyclic vs. pregnant) on PGIS mRNA expression in the endometrium was apparent on Days 4 (P ⬍ 0.001) and 18 (P ⬍ 0.05) after estrus. PGIS protein expression in the endometrium was affected by day (P ⫽ 0.003; Fig. 1B). PGIS protein content did not change during the studied period of the estrous cycle, but was elevated on Days 12 and 16 of pregnancy in comparison with Days 4 (P ⬍ 0.05), 10 (P ⬍ 0.01), and 18 (P ⬍ 0.05). Moreover, the effect of

reproductive status was detected on Day 12, when PGIS protein expression was higher in the endometrium of pregnant gilts than in cyclic animals (P ⬍ 0.05). The concentration of 6-keto PGF1␣ in the cytosolic fraction of endometrial homogenates was affected by day (P ⬍ 0.0001), reproductive status (P ⫽ 0.003), and day by status interaction (P ⫽ 0.004; Fig. 1C). The content of 6-keto PGF1␣ in the endometrium of cyclic gilts ranged from 309.2 ⫾ 52.8 pg/mg protein on Day 10 to 544.5 ⫾ 104.2 pg/mg protein on Day 18, but no statistical differences were detected. In pregnant gilts, an elevated concentration of PGI2 metabolite was observed on Days 12 to 18 in comparison with Days 4 and 10 (P ⬍ 0.01). The effect of reproductive status on 6-keto PGF1␣ level in the endometrium was detected on Days 12 and 18, when the concentration of PGI2 metabolite was increased in pregnant animals compared with cyclic gilts (686.0 ⫾ 57.6 vs. 401.9 ⫾ 66.4 pg/mg of protein, respectively, on Day 12; P ⬍ 0.05, and 900.0 ⫾ 111.5 vs. 544.5 ⫾ 104.2 pg/mg of protein, respectively, Day 18; P ⬍ 0.01). 3.2. The profile of 6-keto PGF1␣ concentration in ULFs The concentration of 6-keto PGF1␣ in ULFs was affected by day (P ⫽ 0.0002), reproductive status (P ⬍ 0.001), and day by reproductive status interaction (P ⬍ 0.001; Fig. 2). The content of 6-keto PGF1␣ did not change during the studied period of the estrous cycle. During pregnancy, higher levels of PGI2 metabolite in ULFs were detected on Days 16 (9.23 ⫾ 2.9 ng/mL) and 18 (2.95 ⫾ 1.1 ng/mL) compared with Days 10 (0.06 ⫾ 0.02 ng/mL; P ⬍ 0.001) and 12 (0.26 ⫾ 0.02 ng/mL; P ⬍ 0.05). Moreover, an effect of reproductive status was observed on Days 12, 16, and 18 after estrus, when the concentration of 6-keto PGF1␣ was greater in ULFs collected from pregnant gilts compared with cyclic animals (P ⬍ 0.05, P ⬍ 0.0001, and P ⬍ 0.001; respectively). 3.3. Profile of PGIS mRNA expression and 6-keto PGF1␣ concentration in conceptuses As demonstrated in Figure 3A, an increased amount of PGIS mRNA was detected in Day 12 conceptuses compared with conceptuses/trophoblasts obtained on Days 10, 16, and 18 (P ⬍ 0.01). On Day 18, PGIS mRNA expression in embryos was 120-fold higher than in trophoblast tissue (P ⬍ 0.001). Figure 3B shows the profile of 6-keto PGF1␣ concentration in pig conceptuses, with increased levels detected on Day 14 com-

E. Morawska et al. / Theriogenology 78 (2012) 2071–2086

2077

A) PGIS (relative mRNA units)

1.0

cyclic pregnant

C

b

0.8

* CD

0.6

ab BD

*** 0.4 0.2

a

AB

a

a A

0.0

4

10

12

16

18

PGIS (relative protein level)

B)

PGIS (57 kDa)

3

IgG (50 kDa)

ACTB (37 kDa)

B

* 2

B 1

a

a

A

a

a

A

a

A

0

4

10

12

16

18

6-keto PGF1α (pg/mg of protein)

C) 1500

** D

*

1000

BD BC

a 500

A

a

a

a

a

A

0

4

10

12

16

18

days after estrus

Fig. 1. Expression of prostacyclin synthase (PGIS) mRNA (A) and protein (B) and concentration of 6-keto PGF1␣ (PGI2 metabolite; C) in the endometrium of cyclic and early pregnant pigs on Days 4, 10, 12, 16, and 18 after estrus. Values from real-time polymerase chain reaction (PCR) for PGIS were normalized to geometrical averaging of glyceraldehyde-3-phosphate dehydrogenase and ␤-actin (ACTB) gene expression. Values from densitometric analyses of blots were normalized to ACTB. Data are expressed as the mean ⫾ SEM (n ⫽ 5 to 6). Bars with various letters (small letters for cyclic and capital for pregnant) are different among groups of cyclic and pregnant animals. Asterisks indicate differences between groups on particular day after estrus (* P ⬍ 0.05; ** P ⬍ 0.01; *** P ⬍ 0.001). Representative samples of Western blots are presented.

pared with Day 16 (P ⬍ 0.01). In contrast to PGIS mRNA, the concentration of PGI2 metabolite in Day 18 embryos was lower than in trophoblast tissue (2.0 ⫾ 0.6 vs. 4.7 ⫾ 1.1 pg/mg of protein, respectively; P ⬍ 0.05). 3.4. Effect of steroids on PGIS mRNA and protein expression and 6-keto PGF1␣ concentration in the endometrium and in incubation medium Figure 4 demonstrates the effect of E2 and P4 on PGIS expression and 6-keto PGF1␣ accumulation in the endometrium and in incubation medium after 12 h of

incubation. P4 alone stimulated PGIS mRNA expression in the endometrium (P ⬍ 0.05; Fig. 4A), but neither P4 nor E2 affected PGIS protein content (Fig. 4B). Simultaneous treatment of endometrial explants with E2 and P4 resulted in elevated concentrations of 6-keto PGF1␣ in endometrial homogenates when compared with control value (5.7 ⫾ 0.6 vs. 3.2 ⫾ 0.5 ng/mg of protein, respectively; P ⬍ 0.05, Fig. 5C). However, the secretion of 6-keto PGF1␣ from the endometrium was increased in the presence of P4 alone when compared with the control value (34.2 ⫾ 8.2 vs. 14.5 ⫾ 1.5

2078

E. Morawska et al. / Theriogenology 78 (2012) 2071–2086 ****

6-keto PGF1α (ng/ml)

20

***

B 10

B

* 0.4

A

0.3 0.2 0.1

a

a

A

NM

a

a

a

0.0

4

10

12

16

18

days after estrus

Fig. 2. Concentration of 6-keto PGF1␣ (PGI2 metabolite) in uterine luminal flushings (ULFs) of cyclic and early pregnant gilts on Days 10, 12, 16, and 18 after estrus. Values are expressed as the mean ⫾ SEM (n ⫽ 5 to 6). Bars with various letters (small letters for cyclic and capital for pregnant) are different among groups of cyclic and pregnant animals. Asterisks indicate differences between groups on particular day after estrus (* P ⬍ 0.05; *** P ⬍ 0.001; **** P ⬍ 0.0001). NM, not measured.

ng/mL, respectively; P ⬍ 0.05, Fig. 4D). Arachidonic acid, used as a positive control for PGI2 production, resulted in twofold and eightfold increases of 6-keto PGF1␣ concentration in endometrial tissue and in incubation medium, respectively (P ⬍ 0.001; Fig. 4C and D). No effect of steroids on endometrial PGIS mRNA and protein expression and 6-keto PGF1␣ secretion was observed after 6 and 24 h (data not shown). 3.5. Effect of conceptus-exposed medium on PGIS mRNA and protein expression and 6-keto PGF1␣ concentration in endometrial tissue and in incubation medium As demonstrated in Figure 5A, the duration of incubation affected the content of PGIS mRNA in endometrial slices resulting in downregulation of this gene expression observed after 12 h when compared with 6 h of incubation (P ⬍ 0.05). Incubation of endometrial tissue with CEM had no effect on PGIS mRNA expression. In contrast to mRNA, the protein level of PGIS was affected by CEM treatment, but not by the period of incubation. After 6 h, a greater PGIS protein level was detected in endometrial strips treated with CEM (P ⬍ 0.01). The 6-keto PGF1␣ concentration in endometrial tissue was affected by both CEM treatment (P ⬍ 0.01) and duration of incubation (P ⫽ 0.03). The basal content of PGI2 metabolite in endometrial tissue increased from 2.7 ⫾ 0.4 pg/mg of protein after 6 h to 3.9 ⫾ 0.3 pg/mg of protein after 12 h of incubation (P ⬍ 0.05). Addition of CEM resulted in a higher concentration of 6-keto PGF1␣ in the endometrium after 6 h of incubation (P ⬍ 0.01). Moreover, the accumulation of 6-keto

PGF1␣ in the incubation medium was affected by CEM treatment (P ⬍ 0.001) and period of incubation (P ⬍ 0.003). Six hours of incubation resulted in almost threefold higher secretion of PGI2 metabolite from endometrial slices treated with CEM in comparison with nontreated ones (5.8 ⫾ 0.8 vs. 14.2 ⫾ 3.5 ng/mL, respectively; P ⬍ 0.01). 3.6. Effect of conceptus presence on PGIS mRNA and protein expression and 6-keto PGF1␣ concentration in the endometrium Neither the presence of conceptuses, nor reproductive status affected PGIS expression and 6-keto PGF1␣ concentration in the endometrium of gilts with one detached uterine horn that were slaughtered on Day 11 after estrus (Fig. 6). In contrast to Day 11, on Day 14 after estrus PGIS mRNA expression in the endometrium collected from the gravid uterine horn was higher compared with both the contralateral uterine horn (P ⬍ 0.05) and the respective horn of cyclic (control) animals (P ⬍ 0.05). The same correlation was observed for PGIS protein expression. A greater abundance of PGIS was observed in endometrium of the connected uterine horn containing developing conceptuses compared with the detached uterine horn of pregnant gilts (P ⬍ 0.01) and the respective uterine horn of cyclic animals (P ⬍ 0.05; Fig. 6). The concentration of 6-keto PGF1␣ in the cytosolic fraction of endometrial homogenates was affected by reproductive status (P ⫽ 0.003) but not conceptus presence. A greater content of 6-keto PGF1␣ was detected in both uterine horns of pregnant gilts when compared with the respective horns of cyclic animals (P ⬍ 0.05). 3.7. Effect of IL-1␤ and IL-6 on PGIS mRNA and protein expression and 6-keto PGF1␣ concentration in endometrial tissue and in incubation medium None of the cytokines examined affected expression of PGIS mRNA and protein in endometrial tissue (Fig. 7A and B). Treatment of endometrial slices with IL-6 or IL-1␤ had no effect on 6-keto PGF1␣ concentration in the tissue (Fig. 7C). In contrast, the accumulation of 6-keto PGF1␣ in incubation medium (Fig. 7D) was increased in the presence of IL-1␤ (7.9 ⫾ 1.0 vs. 14.7 ⫾ 2.6 ng/mL; P ⬍ 0.05) and IL-6 (7.9 ⫾ 1.0 vs. 17.8 ⫾ 1.6 ng/mL; P ⬍ 0.01). 4. Discussion During the past decade, several studies have been performed to evaluate factors regulating PGF2␣ and

E. Morawska et al. / Theriogenology 78 (2012) 2071–2086

A)

PGIS (relative mRNA units)

1.0

1.0

PGIS (relative mRNA units)

2079

0.8 0.6 0.4 0.06

***

0.8 0.6 0.4 0.02

0.01

0.00 trophoblast

embryo

day 18

b 0.04

ab 0.02

a

a

a

16

18

0.00

10

12

14

6-keto PGF1α (pg/mg of protein)

6-keto PGF1α (pg/mg of protein)

B) 20

15

10 8 6 4

*

2 0 trophoblast

embryo

day 18

10

a

0

ab

ab

5

b NM 10

12

14

16

18

days of pregnancy Fig. 3. Expression of prostacyclin synthase (PGIS) mRNA (A) and concentration of 6-keto PGF1␣ (PGI2 metabolite; B) in pig conceptuses and embryos (insets) collected on Days 10 to 18 of pregnancy. Values from real-time polymerase chain reaction (PCR) for PGIS were normalized to geometrical averaging of glyceraldehyde-3-phosphate dehydrogenase and ␤-actin gene expression. Data are expressed as the mean ⫾ SEM (n ⫽ 4 to 6). Bars with various letters are different (P ⬍ 0.05). Asterisks indicate differences in PGIS mRNA expression in trophoblast and embryonic tissues on Day 18 of pregnancy (* P ⬍ 0.05; *** P ⬍ 0.001).

PGE2 synthesis and release from the pig uterus [29,36 – 39]. Since PGE2 acts as both a luteotrophic and antiluteolytic factor that promotes CL maintenance during early pregnancy in pigs [40,41], its increased production by the uterus is essential for pregnancy establishment [9]. Recently, we demonstrated that products of Day 15 porcine conceptuses increased PTGS2 mRNA expression and PGE2 secretion from endometrial epithelial cells in vitro [13]. Another prostaglandin involved in successful pregnancy establishment seems to be PGI2, because PGIS and PGI2 receptor expression are present both in conceptus and endometrial tissue of mice, rats, sheep, and cows [14 –18], and high concentrations of PGI2 metabolite were found during early pregnancy in the uterine lumen of cattle [17]. In mice, PGI2 is the primary mediator of implantation, whereas PGE2 functions as a supplementary factor for embry-

onic and decidual growth in the presence of PGI2 [14] Moreover, iloprost (an analogue of PGI2) stimulates early embryonic development in pigs [26]. To our knowledge, the present study is the first demonstrating the expression profiles of PGIS mRNA and protein expression and PGI2 concentration in the porcine uterus during the estrous cycle and early pregnancy. The possible regulation of endometrial PGI2 synthesis by steroids, selected cytokines, and conceptus products was also investigated. In the current study, PGIS mRNA content in the endometrium of cyclic animals increased on Day 16 after estrus when compared with Days 4 and 10, and then decreased on Day 18. In pregnant gilts, PGIS mRNA expression increased gradually from Day 4 and was the highest on Day 16, but did not differ from Day 18 of gestation. The effect of reproductive status on

0.6

*

0.2 0.0

E2

P4

E2+P4

1.5 1.2 0.9 0.6 0.3 0.0

control

E2

P4

E2+P4

AA

20

B)

C)

*** 10

* 5 0

E2

P4

E2+P4

control CEM

0.6

a

A

0.4

b

0.0

6

12

AA

2.0

**

1.5 1.0 0.5 0.0

6

12 period of incubation (h)

10 8

*

6

A 4

B

b

a

2 0

6

12 period of incubation (h)

200

100

*

50 0

control

E2

P4

E2+P4

AA

Fig. 4. Effect of estradiol (E2; 10 nM), progesterone (P4; 100 nM), both hormones (10 nM E2 plus 100 nM P4), and arachidonic acid (AA; 20 ␮g/mL) on prostacyclin synthase (PGIS) mRNA (A) and protein (B) expression and 6-keto PGF1␣ (PGI2 metabolite) concentration in endometrial tissue (C) and incubation medium (D). Endometrial slices collected on Day 12 of the estrous cycle were exposed to steroids or AA for 12 h. Values from real-time polymerase chain reaction (PCR) for PGIS were normalized to geometrical averaging of glyceraldehyde-3-phosphate dehydrogenase and ␤-actin (ACTB) gene expression. Values from densitometric analyses of blots were normalized to ACTB. Data are expressed as the mean ⫾ SEM (n ⫽ 4). Asterisks indicate differences in comparison with control value (* P ⬍ 0.05; *** P ⬍ 0.001).

endometrial PGIS mRNA level was evident on Days 4 and 18 after estrus. On Day 4, the amount of PGIS transcripts was threefold lower in pregnant than in

40

6-keto PGF1α (ng/ml)

D)

***

150

MEDIUM

6-keto PGF1α (ng/ml)

B

0.2

period of incubation (h)

15

control

0.8

AA

PGIS (relative protein level)

0.4

ENDOMETRIAL TISSUE

PGIS (relative mRNA units)

C)

PGIS (relative protein level)

B)

D) MEDIUM

A)

0.8

control

6-keto PGF1α (ng/mg of protein)

ENDOMETRIAL TISSUE

A)

PGIS (relative mRNA units)

E. Morawska et al. / Theriogenology 78 (2012) 2071–2086

6-keto PGF1α (pg/mg of protein)

2080

**

30

B

20 10

B b

a

0

6

12 period of incubation (h)

Fig. 5. Effect of conceptus-exposed medium (CEM) on prostacyclin synthase (PGIS) mRNA (A), and protein (B) expression and 6-keto PGF1␣ (PGI2 metabolite) concentration in endometrial tissue (C) and in incubation medium (D). Endometrial slices collected on Day 12 of the estrous cycle were exposed to CEM for 6 and 12 h. Values from real-time polymerase chain reaction (PCR) for PGIS were normalized to geometrical averaging of glyceraldehyde-3-phosphate dehydrogenase and ␤-actin (ACTB) gene expression. Values from densitometric analyses of blots were normalized to ACTB. Data are expressed as the mean ⫾ SEM (n ⫽ 6). Bars with various letters (small letters for untreated endometrium and capital letters for endometrium exposed to CEM) are different. Asterisks indicate differences between control and CEM-treated endometrium on particular periods of incubation (* P ⬍ 0.05; ** P ⬍ 0.01).

E. Morawska et al. / Theriogenology 78 (2012) 2071–2086

PGIS (relative mRNA units)

1.2

Day 14

connected horn detached horn

0.8

0.4

0.0

pregnant

0.06 0.04 0.02 0.00

cyclic

6-keto PGF1α

1000

500

(pg/mg of protein)

6-keto PGF1α

a B

b

B

0.4

0.0

0.08 0.06

cyclic

** a B

0.04

b 0.02

B

0.00

pregnant

cyclic

1500

1500

(pg/mg of protein)

* 0.8

pregnant

0.08

pregnant

1.2

cyclic

PGIS (relative protein level)

PGIS (relative protein level)

PGIS (relative mRNA units)

Day 11

2081

a

A

1000

B

b 500

0

0

pregnant

cyclic

pregnant

cyclic

Fig. 6. Expression of prostacyclin synthase (PGIS) mRNA and protein and 6-keto PGF1␣ (PGI2 metabolite) concentration in the endometrium of gilts subjected to surgical procedure. Gilts were slaughtered on Day 11 or 14 of the estrous cycle and early pregnancy. Values from real-time PCR for PGIS were normalized to geometrical averaging of glyceraldehyde-3-phosphate dehydrogenase and ␤-actin (ACTB) gene expression. Values from densitometric analyses of blots were normalized to ACTB. Data are expressed as the mean ⫾ SEM (n ⫽ 5 to 6). Bars with various letters (small letters for connected uterine horn and capital letters for detached uterine horn) are different between cyclic and pregnant gilts. Asterisks indicate differences between connected and detached uterine horns in cyclic and pregnant gilts (* P ⬍ 0.05; ** P ⬍ 0.01).

cyclic gilts. Such a difference could be due to seminal fluid, which contains cytokines, sex hormones, and PGs, that influence the female reproductive tract (for review see [42]). In pigs, intrauterine infusions of seminal plasma resulted in downregulation of PTGS2 mRNA expression in the endometrium on Day 5 after treatment [43]. However, lower PGIS mRNA expression observed in pregnant compared with cyclic gilts on Day 4 was not accompanied by differences in PGIS protein level or PGI2 (measured as 6-keto PGF1␣) content in endometrial tissue at that time. In contrast to Day 4, greater PGIS mRNA expression in pregnant than in cyclic gilts was detected on Day 18. Because PGIS is expressed with great abundance in endothelial cells and PGI2 is an important vasodilator [6], increased PGIS mRNA accompanied by greater concentration of PGI2 in the endometrium (present data) may be involved in regulation of the function of the vascular system, which is essential for sufficient embryo/fetus nutrition. Our present results are different from those

previously presented for the bovine uterus, where neither day nor reproductive status affected PGIS transcript level [17]. In the ovine endometrium, high PGIS mRNA expression on Days 7 and 9 was followed by a dramatic decrease on Days 12 to 17 [18]. However, the PGIS mRNA profile in cyclic sheep was not examined. Thus, it is difficult to state if the observed decrease in PGIS mRNA in ovine endometrium resulted from the presence of conceptuses. In mice, an abundant accumulation of PGIS mRNA was localized around the implanting blastocyst [14]. In contrast to mRNA, PGIS protein level in the porcine endometrium did not differ during the estrous cycle. In pregnant gilts, endometrial PGIS protein content increased substantially on Days 12 and 16 compared with all other days of pregnancy examined. Moreover, a higher PGIS protein level was detected in the endometrium on Day 12 of pregnancy compared with Day 12 of the estrous cycle. It was accompanied by higher 6-keto PGF1␣ accumulation in the endome-

2082

E. Morawska et al. / Theriogenology 78 (2012) 2071–2086

PGIS (relative mRNA units)

0.8

B)

0.4

0.2

control

IL-1α

IL-6

control

IL-1α

IL-6

control

IL-1α

IL-6

PGIS (relative protein level)

2.0

1.5

1.0

0.5

0.0

C)

6-keto PGF1α (ng/ml)

D) MEDIUM

0.6

0.0

6-keto PGF1α (pg/mg of protein)

ENDOMETRIAL TISSUE

A)

10 8 6 4 2 0

40

30

b

20

10

b

a

0

control

IL-1α

IL-6

Fig. 7. Effect of interleukin-1␤ (IL-1␤) and interleukin-6 (IL-6) on prostacyclin synthase (PGIS) mRNA (A), and protein (B) expression and 6-keto PGF1␣ (PGI2 metabolite) concentration in endometrial tissue (C) and incubation medium (D). Endometrial slices collected on Day 12 of the estrous cycle were exposed to cytokines (10 ng/mL) for 6 h. Values from real-time polymerase chain reaction (PCR) for PGIS were normalized to geometrical averaging of glyceraldehyde3-phosphate dehydrogenase and ␤-actin (ACTB) gene expression. Values from densitometric analyses of blots were normalized to ACTB. Data are expressed as the mean ⫾ SEM (n ⫽ 6). Bars with various letters are different (P ⬍ 0.05).

trium observed beginning from Day 12 of pregnancy. Demonstrated profiles of PGIS protein expression and 6-keto PGF1␣ content in the endometrium indicate a

conceptus-dependent regulation of PGI2 synthesis in pigs. Similar observations were made for the rat uterus, with no differences detected during the estrous cycle versus increased PGIS protein level found at the time of establishment of pregnancy and implantation [15]. In contrast, PGIS protein expression was decreased during the peri-implantation period in ovine endometrium [18]. All these results suggest species-specific regulation of PGIS expression in the endometrium during early pregnancy. As demonstrated for cattle, the concentration of PGI2 measured in uterine flushing was predominant followed by PGF2␣ and PGE2 at all days examined in both cyclic and pregnant animals. Moreover, the concentrations were much higher during pregnancy compared with those of cyclic cows [17]. In the present study, the content of 6-keto PGF1␣ in the porcine endometrium and ULFs did not change significantly on Days 10 to 18 of the estrous cycle. In contrast, PGI2 accumulation in ULFs of pregnant gilts increased substantially on Days 16 and 18 of pregnancy compared with Days 10 and 12 and was much higher than on respective days of the estrous cycle. Increased PGIS protein expression observed in the endometrium resulted in a higher content of PGI2 in the tissue and release into the uterine lumen. These results indicate that increased synthesis and secretion of PGI2 occurs during early pregnancy in pigs. The presence of PPARs, which are nuclear receptors activated by various ligands, including PGs, has been reported in porcine endometrium [25,44]. Thus, PGI2 may influence endometrial functions during implantation. Moreover, paracrine action of PGI2 on conceptus development is possible, because both PTGIR and PPAR transcripts were found in embryo/trophoblast tissue [17,18]. In pigs, blastocysts treated with a PGI2 analogue showed higher numbers of inner cell mass and trophectoderm cells compared with nontreated blastocysts [26]. Searching for reasons for greater 6-keto PGF1␣ concentrations in ULFs turned our attention to conceptuses as a source of PGI2. A threefold higher PGIS mRNA expression was observed in Day 12 filamentous conceptuses than in Day 10 spherical ones. Porcine conceptuses undergo a rapid differentiation and expansion of their trophoblastic membranes between Days 10 to 12 of pregnancy and signal their presence to maternal tissue by increased estrogen synthesis [45,46]. The observed upregulation of PGIS mRNA followed by greater content of 6-keto PGF1␣ indicates that PGI2 may be involved in a local embryo-maternal dialogue. Moreover, increased PGIS mRNA levels in filamentous

E. Morawska et al. / Theriogenology 78 (2012) 2071–2086

conceptuses (present results) is concomitant with abundance of PTGS2 transcripts [47]. However, the concentrations of PGIS mRNA and 6-keto PGF1␣ in endometrial tissue were much greater than in conceptuses. Thus, although the present results clearly show that the conceptus may synthesize PGI2 during the peri-implantation period, the main source of the 6-keto PGF1␣ found in ULFs seems to be endometrial tissue. These results differ partially from those reported for ewes, in which PGIS mRNA and protein expression increased in elongated conceptuses compared with spherical ones and were much higher than in endometrium on the respective days of pregnancy [18]. In the current study, comparison of PGI2 synthesis pathways in Day 18 embryos and trophoblast tissue revealed higher PGIS mRNA expression in embryos than in trophoblast. Moreover, the PGIS mRNA content in embryonic tissue was similar to that observed in the endometrium. This upregulation of PGIS mRNA may be associated with early vascular development, because this enzyme is predominantly expressed in endothelial cells of blood vessels [6]. Among different hormones, E2 and P4 of ovarian origin are crucial regulators of endometrial function and embryo-maternal crosstalk in many species [48 – 51]. Moreover, pig preimplantation conceptuses are an important source of estrogens [46]. E2 of conceptus origin may influence the expression of several genes in the pig endometrium [52] and stimulates the redirection of PGF2␣ secretion into the uterine lumen [53]. E2 alone or in the presence of P4 was previously shown to modulate PGE2 and PGF2␣ production and secretion in the porcine endometrium [13,54,55]. In the present study, the effect of E2 and P4 on PGIS expression and PGI2 secretion was examined using incubation of endometrial explants in vitro. Only P4 increased PGIS mRNA expression in the tissue and 6-keto PGF1␣ concentration in the medium. P4 and E2 added simultaneously stimulated PGI2 accumulation in endometrial slices. Because P4 is absolutely essential to attain uterine receptivity [49,51], increased PGIS mRNA and PGI2 secretion observed in the present study may be related to the preparation of the endometrium for conceptus implantation. However, the regulation of PGI2 synthesis in the uterus by steroids is disputable. As demonstrated for humans, PGIS transcript levels rise after steroid withdrawal at menstruation [56], whereas E2 stimulates PGI2 secretion from cultured endometrial stromal cells [57]. Treatment of ovariectomized ewes with E2 and P4 had no effect on PGIS expression [58], but upregulated PGIS mRNA and PGI2 metabolite con-

2083

tent in ovariectomized rats in a dose-dependent manner [15]. In the present study, the effect of steroids was observed only after 12 h of incubation. We suggest that the effect of steroids on PGIS expression and PGI2 synthesis is more complex and needs some additional regulation (e.g., appropriate blood pressure, permanent blood supply, or other factors). The importance of maternal circulation and blood pressure in the function of the pig uterus has been previously discussed [59]. Therefore, further in vivo experiments should be performed to evaluate E2 and P4 actions on PGI2 production in the pig endometrium. Different profiles of PGIS protein expression and 6-keto PGF1␣ accumulation in the endometrium and ULFs in cyclic and pregnant gilts observed in the current study indicate that the conceptus may affect PGI2 synthesis and/or secretion during early pregnancy. This hypothesis was verified in the present study using in vitro and in vivo models. Incubation of endometrial explants with conceptus-conditioned medium stimulated PGIS protein expression and 6-keto PGF1␣ concentration in endometrial tissue and in incubation medium. Moreover, using an in vivo model we demonstrated increased PGIS mRNA and protein expression in endometrial tissue from the connected uterine horn collected from gilts on Day 14 of gestation. Such a difference was not observed in nonpregnant animals. These data indicate a local effect of conceptus presence on PGIS expression in the endometrium. Although 6-keto PGF1␣ accumulation in the endometrium of the gravid uterine horn did not differ from the nongravid uterine horn of pregnant gilts, it was almost twofold higher than in either uterine horn of cyclic animals. Lack of difference between connected and detached uterine horn in pregnant gilts may be a result of local uterine transfer of PGI2 or its metabolite via blood or lymphatic vessels. These results clearly demonstrate that PGI2 synthesis and secretion is dependent on conceptus products. In contrast to PGIS, mPGES mRNA expression was lower in the gravid uterine horn of pregnant gilts compared with the respective horn of cyclic animals, as previously demonstrated using the same animal model [60]. Moreover, we suggest that only filamentous and elongated conceptuses affect PGI2 synthesis in the porcine endometrium, because neither PGIS expression nor 6-keto PGF1␣ concentration in the tissue changed on Day 11 of pregnancy. Besides E2, porcine conceptuses produce and secrete high amounts of IL-1␤ [61] and IL-6 [62], therefore we examined the effect of both cytokines on PGI2 synthesis. As we demonstrated, neither IL-1␤ nor IL-6 af-

2084

E. Morawska et al. / Theriogenology 78 (2012) 2071–2086

fected the expression of PGIS expression, but both cytokines stimulated the secretion of PGI2 from endometrial tissue. Past studies showed that IL-1␤ increased expression of PTGS2, mPGES, and PGFS mRNAs in endometrial explants collected from gilts on Days 12 to 13 of the estrous cycle [29,63]. Moreover, IL-6 stimulated PGFS mRNA expression and PGF2␣ secretion from the endometrium of cyclic but not pregnant gilts [29]. Results of those studies indicate that both cytokines can influence PTGS2-downstream synthesis pathways in the pig endometrium. The current study showed that IL-1␣ and IL-6 stimulated the secretion of PGI2, but had no effect on PGIS expression. There is a possibility that increased secretion of 6-keto PGF1␣ observed in our study is associated with higher PGIS activity, but not a greater production of this enzyme. This idea is supported by the observation from Experiment 1, that the addition of AA (a substrate for PG production) had no effect on PGIS expression, but resulted in increased concentration of 6-keto PGF1␣ in endometrial tissue and in incubation medium. In summary, this is the first demonstration of pregnancy-dependent PGIS expression and PGI2 release in the pig uterus. Endometrium rather than conceptus tissue, is the main source of increased concentration of 6-keto PGF1␣ in the uterine lumen during early pregnancy. Moreover, we present strong evidence that products of porcine conceptuses stimulate endometrial PGI2 synthesis. However, conceptus-derived factors affecting PGIS expression are not defined yet, because E2, IL-1␤, and IL-6 did not influence PGIS mRNA or protein content. On the other hand, IL-1␤ and IL-6 stimulated 6-keto PGF1␣ release from endometrial explants. Additionally, P4 increased PGIS mRNA expression and PGI2 metabolite secretion from endometrial explants. Further studies should be conducted to evaluate the role of PGI2 during early pregnancy in the pig. Acknowledgments This research was supported by grant 2011/01/B/ NZ9/07069 from National Science Centre and by basic grant of Polish Academy of Sciences in Poland. References [1] Bazer FW, Geisert RD, Thatcher WW, Roberts RM. The establishment and maintenance of pregnancy. In: Control of Pig Reproduction, Cole DJA, Foxcroft GA (Eds.), Butterworth Scientific, 1982, pp. 227–53. [2] Weems CW, Weems YS, Randel RD. Prostaglandins and reproduction in female farm animals. Vet J 2006;171:206 –28.

[3] Kennedy TG, Gillio-Meina C, Phang SH. Prostaglandins and the initiation of blastocyst implantation and decidualization. Reproduction 2007;134:635– 43. [4] Ziecik AJ, Waclawik A, Kaczmarek MM, Blitek A, Jalali BM, Andronowska A. Mechanisms for the establishment of pregnancy in the pig. Reprod Domest Anim 2011;46 Suppl 3:31– 41. [5] Smith WL, Garavito RM, DeWitt DL. Prostaglandin endoperoxide H synthases (cyclooxygenases)-1 and -2. J Biol Chem 1996;271:33157– 60. [6] Helliwell RJ, Adams LF, Mitchell MD. Prostaglandin synthases: recent developments and a novel hypothesis. Prostaglandins Leukot Essent Fatty Acids 2004;70:101–13. [7] Lim H, Paria BC, Das SK, Dinchuk JE, Langenbach R, Trzaskos JM, et al. Multiple female reproductive failures in cyclooxygenase 2-deficient mice. Cell 1997;91:197–208. [8] Kraeling RR, Rampacek GB, Fiorello NA. Inhibition of pregnancy with indomethacin in mature gilts and prepuberal gilts induced to ovulate. Biol Reprod 1985;32:105–10. [9] Davis DL, Blair RM. Studies of uterine secretions and products of primary cultures of endometrial cells in pigs. J Reprod Fertil Suppl 1993;48:143–55. [10] Blitek A, Waclawik A, Kaczmarek MM, Stadejek T, Pejsak Z, Ziecik AJ. Expression of cyclooxygenase-1 and -2 in the porcine endometrium during the oestrous cycle and early pregnancy. Reprod Domest Anim 2006;41:251–7. [11] Waclawik A, Rivero-Muller A, Blitek A, Kaczmarek MM, Brokken LJ, Watanabe K, et al. Molecular cloning and spatiotemporal expression of prostaglandin F synthase and microsomal prostaglandin E synthase-1 in porcine endometrium. Endocrinology 2006;147:210 –21. [12] Waclawik A, Jabbour HN, Blitek A, Ziecik AJ. Estradiol17beta, prostaglandin E2 (PGE2), and the PGE2 receptor are involved in PGE2 positive feedback loop in the porcine endometrium. Endocrinology 2009;150:3823–32. [13] Blitek A, Morawska E, Kiewisz J, Ziecik AJ. Effect of conceptus secretions on HOXA10 and PTGS2 gene expression, and PGE2 release in co-cultured luminal epithelial and stromal cells of the porcine endometrium at the time of early implantation. Theriogenology 2011;76:954 – 66. [14] Lim H, Gupta RA, Ma WG, Paria BC, Moller DE, Morrow JD, et al. Cyclo-oxygenase-2-derived prostacyclin mediates embryo implantation in the mouse via PPARdelta. Genes Dev 1999;13: 1561–74. [15] Kengni JH, St-Louis I, Parent S, Leblanc V, Shooner C, Asselin E. Regulation of prostaglandin D synthase and prostacyclin synthase in the endometrium of cyclic, pregnant, and pseudopregnant rats and their regulation by sex steroids. J Endocrinol 2007;195:301–11. [16] Gillio-Meina C, Phang SH, Mather JP, Knight BS, Kennedy TG. Expression patterns and role of prostaglandin-endoperoxide synthases, prostaglandin E synthases, prostacyclin synthase, prostacyclin receptor, peroxisome proliferator-activated receptor delta and retinoid x receptor alpha in rat endometrium during artificially-induced decidualization. Reproduction 2009;137: 537–52. [17] Ulbrich SE, Schulke K, Groebner AE, Reichenbach HD, Angioni C, Geisslinger G, et al. Quantitative characterization of prostaglandins in the uterus of early pregnant cattle. Reproduction 2009;138:371– 82. [18] Cammas L, Reinaud P, Bordas N, Dubois O, Germain G, Charpigny G. Developmental regulation of prostacyclin synthase and prostacyclin receptors in the ovine uterus and con-

E. Morawska et al. / Theriogenology 78 (2012) 2071–2086

[19]

[20] [21]

[22]

[23]

[24]

[25]

[26]

[27]

[28]

[29]

[30]

[31]

[32]

[33]

[34]

ceptus during the peri-implantation period. Reproduction 2006;131:917–27. Narumiya S, FitzGerald GA. Genetic and pharmacological analysis of prostanoid receptor function. J Clin Invest 2001; 108:25–30. Kota BP, Huang TH, Roufogalis BD. An overview on biological mechanisms of PPARs. Pharmacol Res 2005;51:85–94. Pakrasi PL, Jain AK. Evaluation of cyclooxygenase 2 derived endogenous prostacyclin in mouse preimplantation embryo development in vitro. Life Sci 2007;80:1503–7. Pakrasi PL, Jain AK. Cyclooxygenase-2-derived endogenous prostacyclin reduces apoptosis and enhances embryo viability in mouse. Prostaglandins Leukot Essent Fatty Acids 2008;79:27–33. Huang JC, Wun WS, Goldsby JS, Wun IC, Falconi SM, Wu KK. Prostacyclin enhances embryo hatching but not sperm motility. Hum Reprod 2003;18:2582–9. Huang JC, Goldsby JS, Wun WS. Prostacyclin enhances the implantation and live birth potentials of mouse embryos. Hum Reprod 2004;19:1856 – 60. Bogacka I, Bogacki M. The quantitative expression of peroxisome proliferator activated receptor (PPAR) genes in porcine endometrium through the estrous cycle and early pregnancy. J Physiol Pharmacol 2011;62:559 – 65. Kim JS, Chae JI, Song BS, Lee KS, Choo YK, Chang KT, et al. Iloprost, a prostacyclin analogue, stimulates meiotic maturation and early embryonic development in pigs. Reprod Fertil Dev 2010;22:437– 47. Blitek A, Kiewisz J, Waclawik A, Kaczmarek MM, Ziecik AJ. Effect of steroids on HOXA10 mRNA and protein expression and prostaglandin production in the porcine endometrium. J Reprod Dev 2010;56:643– 8. Kaminska K, Wasielak M, Bogacka I, Blitek M, Bogacki M. Quantitative expression of lysophosphatidic acid receptor 3 gene in porcine endometrium during the periimplantation period and estrus cycle. Prostag Other Lipid M 2008;85:26 –32. Franczak A, Zmijewska A, Kurowicka B, Wojciechowicz B, Petroff BK, Kotwica G. The effect of tumor necrosis factor ␣ (TNF␣), interleukin 1␤ (IL1␤) and interleukin 6 (IL6) on endometrial PGF2␣ synthesis, metabolism and release in earlypregnant pigs. Theriogenology 2012;77:155– 65. Blitek A, Kaczmarek MM, Kiewisz J, Ziecik AJ. Endometrial and conceptus expression of HoxA10, transforming growth factor beta1, leukemia inhibitory factor, and prostaglandin H synthase-2 in early pregnant pigs with gonadotropin-induced estrus. Domest Anim Endocrinol 2010;38:222–34. Bogacka I, Przała J, Siawrys G, Kaminski T, Smolinska N. The expression of short form of leptin receptor gene during early pregnancy in the pig examined by quantitative real time RTPCR. J Physiol Pharmacol 2006;57:479 – 89. Spagnuolo-Weaver M, Fuerst R, Campbell ST, Meehan BM, McNeilly F, Adair B, et al. A fluorimeter-based RT-PCR method for the detection and quantitation of porcine cytokines. J Immunol Methods 1999;230:19 –27. Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, et al. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 2002;3:RESEARCH0034.1-0034.11. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 1976;72:248 –54.

2085

[35] Kaczmarek MM, Krawczynski K, Blitek A, Kiewisz J, Schams D, Ziecik AJ. Seminal plasma affects prostaglandin synthesis in the porcine oviduct. Theriogenology 2010;74:1207–20. [36] Blitek A, Ziecik AJ. Effect of LH on prostaglandin F2␣ and prostaglandin E2 secretion by cultured porcine endometrial cells. Reproduction 2005;130:105–12. [37] Blitek A, Ziecik AJ. Role of tumour necrosis factor alpha in stimulation of prostaglandins F(2alpha) and E(2) release by cultured porcine endometrial cells. Reprod Domest Anim 2006;41: 562–7. [38] Waclawik A, Blitek A, Ziecik AJ. Oxytocin and tumor necrosis factor alpha stimulate expression of prostaglandin E2 synthase and secretion of prostaglandin E2 by luminal epithelial cells of the porcine endometrium during early pregnancy. Reproduction 2010;140:613–22. [39] Franczak A, Kotwica G, Kurowicka B, Oponowicz A, Wocławek-Potocka I, Petroff BK. Expression of enzymes of cyclooxygenase pathway and secretion of prostaglandin E2 and F2alpha by porcine myometrium during luteolysis and early pregnancy. Theriogenology 2006;66:1049 –56. [40] Christenson LK, Farley DB, Anderson LH, Ford SP. Luteal maintenance during early pregnancy in the pig: role for prostaglandin E2. Prostaglandins 1994;47:61–75. [41] Akinlosotu BA, Diehl JR, Gimenez T. Prostaglandin E2 counteracts the effect of PGF2␣ in indomethacin treated gilts. Prostaglandins 1988;365:81–93. [42] Robertson SA. Seminal fluid signaling in the female reproductive tract: lessons from rodents and pigs. J Anim Sci 2007;85:E36 – 44. [43] O’Leary S, Jasper MJ, Warnes GM, Armstrong DT, Robertson SA. Seminal plasma regulates endometrial cytokine expression, leukocyte recruitment and embryo development in the pig. Reproduction 2004;128:237– 47. [44] Lord E, Murphy BD, Desmarais JA, Ledoux S, Beaudry D, Palin MF. Modulation of peroxisome proliferator-activated receptor ␦ and ␥ transcripts in swine endometrial tissue during early gestation. Reproduction 2006;131:929 – 42. [45] Anderson LL. Growth, protein content and distribution of early pig embryos. Anat Rec 1978;190:143–54. [46] Geisert RD, Renegar RH, Thatcher WW, Roberts RM, Bazer FW. Establishment of pregnancy in the pig: I. Interrelationships between preimplantation development of the pig blastocyst and uterine endometrial secretions. Biol Reprod 1982;27:925–39. [47] Wilson ME, Fahrenkrug SC, Smith TP, Rohrer GA, Ford SP. Differential expression of cyclooxygenase-2 around the time of elongation in the pig conceptus. Anim Reprod Sci 2002;71:229 – 37. [48] Paria BC, Song H, Dey SK. Implantation: molecular basis of embryo-uterine dialogue. Int J Dev Biol 2001;45:597– 605. [49] Spencer TE, Johnson GA, Burghardt RC, Bazer FW. Progesterone and placental hormone actions on the uterus: insights from domestic animals. Biol Reprod 2004;71:2–10. [50] Achache H, Revel A. Endometrial receptivity markers, the journey to successful embryo implantation. Hum Reprod Update 2006;12:731– 46. [51] Waclawik A, Blitek A, Kaczmarek MM, Kiewisz J, Ziecik AJ. Antiluteolytic mechanisms and the establishment of pregnancy in the pig. Soc Reprod Fertil Suppl 2009;66:307–20. [52] Johnson GA, Bazer FW, Burghardt RC, Spencer TE, Wu G, Bayless KJ. Conceptus-uterus interactions in pigs: endometrial gene expression in response to estrogens and interferons from conceptuses. Soc Reprod Fertil Suppl 2009;66:321–32.

2086

E. Morawska et al. / Theriogenology 78 (2012) 2071–2086

[53] Bazer FW, Thatcher WW. Theory of maternal recognition of pregnancy in swine based on estrogen controlled endocrine versus exocrine secretion of prostaglandin F2␣ by the uterine endometrium. Prostaglandins 1977;14:397– 401. [54] Blitek A, Mendrzycka AU, Bieganska MK, Waclawik A, Ziecik AJ. Effect of steroids on basal and LH-stimulated prostaglandins F(2alpha) and E(2) release and cyclooxygenase-2 expression in cultured porcine endometrial stromal cells. Reprod Biol 2007;7:73– 88. [55] Hu J, Braileanu GT, Mirando MA. Effect of ovarian steroids on basal and oxytocin-induced prostaglandin F2␣ secretion from pig endometrial cells. Reprod Fertil Dev 2003;15:197– 205. [56] Battersby S, Critchley HO, de Brum-Fernandes AJ, Jabbour HN. Temporal expression and signalling of prostacyclin receptor in the human endometrium across the menstrual cycle. Reproduction 2004;127:79 – 86. [57] Levin JH, Stanczyk FZ, Lobo RA. Estradiol stimulates the secretion of prostacyclin and thromboxane from endometrial stromal cells in culture. Fertil Steril 1992;58:530 – 6. [58] Wu WX, Ma XH, Nathanielsz PW. Changes in prostacyclin synthase in pregnant sheep myometrium, endometrium, and

[59]

[60]

[61]

[62]

[63]

placenta at spontaneous term labor and regulation by estradiol and progesterone. Am J Obstet Gynecol 1999;180: 744 –9. Krzymowski T, Stefan´czyk-Krzymowska S. The oestrous cycle and early pregnancy–a new concept of local endocrine regulation. Vet J 2004;168:285–96. Wasielak M, Kamin´ska K, Bogacki M. Effect of the conceptus on uterine prostaglandin-F2alpha and prostaglandin-E2 release and synthesis during the periimplantation period in the pig. Reprod Fertil Dev 2009;21:709 –17. Ross JW, Malayer JR, Ritchey JW, Geisert RD. Characterization of the interleukin-1beta system during porcine trophoblastic elongation and early placental attachment. Biol Reprod 2003;69:1251–9. Modric T, Kowalski AA, Green ML, Simmen RC, Simmen FA. Pregnancy-dependent expression of leukaemia inhibitory factor (LIF), LIF receptor-␤ and interleukin-6 (IL-6) messenger ribonucleic acids in the porcine female reproductive tract. Placenta 2000;21:345–53. Franczak A, Zmijewska A, Kurowicka B, Wojciechowicz B, Kotwica G. Interleukin 1␤-induced synthesis and secretion of prostaglandin E2 in the porcine uterus during various periods of pregnancy and the estrous cycle. J Physiol Pharmacol 2010;61:733– 42.