- Email: [email protected]
Regulation of Urokinase Receptor Transcription by Ras- and Rho-Family GTPases
Biochemical and Biophysical Research Communications 270, 892– 898 (2000) doi:10.1006/bbrc.2000.2531, available online at http://www.idealibrary.com on
Regulation of Urokinase Receptor Transcription by Ras- and Rho-Family GTPases Silke M. Muller, Emel Okan, and Peter Jones 1 School of Biomedical Sciences, Queen’s Medical Centre, University of Nottingham, Nottingham, NG7 2UH, United Kingdom
Received March 15, 2000
How cell adhesion is coordinated with extracellular proteolysis is a key question in understanding cell migration. Potentially, the small GTP-binding proteins that affect actin organisation and signal transduction may also regulate the expression of genes associated with extracellular proteolysis. We investigated the ability of Ras, Rac-1, Cdc42Hs, and RhoA to regulate transcription from the1.55-kb promoter region of the human urokinase plasminogen activator receptor (uPAR) gene. Constitutively active V12 H-Ras and Rho-A stimulated uPAR transcription while Cdc42Hs and Rac-1 did not. The use of Ras effectorloop mutants indicated that signalling via multiple Ras-effectors is necessary for the maximum activation of transcription. © 2000 Academic Press Key Words: Ras; RhoA; GTP-binding proteins; urokinase receptor.
The urokinase plasminogen activator receptor (uPAR) is a heavily glycosylated, GPI-anchored protein which through binding its ligand, the protease urokinase plasminogen activator (uPA), localises the conversion of plasminogen to plasmin to the surface of a cell. Plasmin is a protease with a broad substrate specificity and is responsible for the activation of the zymogen forms of a number of metalloproteinases and initiates a proteolytic cascade required for cell migration in vivo. Elevated levels of uPAR expression are associated with an increased invasive capacity of a number of cell types. In many cases, the activity of the uPA/uPAR system directly correlates with the extent of cancer cell invasion and metastasis [1, 2]. Further evidence indicating that uPAR plays a key role in metastasis has been demonstrated using antisense techniques and inhibitors of the uPA-uPAR interaction. Both experimental approaches have been shown to decrease the metastatic potential of cells [3– 6]. In addition to promoting 1
To whom all correspondence should be addressed. E-mail: [email protected]. 0006-291X/00 $35.00 Copyright © 2000 by Academic Press All rights of reproduction in any form reserved.
extracellular proteolysis, uPAR affects the migratory capacity of cells by binding directly to vitronectin, [7, 8] and by associating with 2 integrins in haemopoietic cells and 1- or 3-integrins in non-haemopoietic cells. The association of uPAR with integrins modulates the binding affinity of the later for their extracellular matrix ligands [9 –11]. Recent findings also indicate that uPAR is capable of activating the ERK/MAPK [12–14] and JAK/STAT [15, 16] intracellular signalling pathways and is also responsible for the activation of Srcfamily tyrosine kinases and a heterotrimeric G-protein coupled receptor that results in increased cell migration [17]. It therefore appears that uPAR contributes to cell migration in three ways: (1) by affecting extracellular proteolysis; (2) by modulating cell adhesion; and (3) by activating signal transduction pathways. The elevated levels of uPAR expression associated with the increased metastatic potential of transformed cells may reflect a breakdown in the regulatory processes that link cell adhesion with uPAR expression. Identifying signalling pathways that affect uPAR gene expression in response to changes in cell adhesion during cell migration will be important in determining how changes in cell adhesion are coordinated with uPA-mediated extracellular proteolysis. Since the integrins are major sensors of changes in extracellular matrix composition and integrity it is likely that signals transduced by effector molecules that function downstream of integrins are involved in coordinating these events. Integrins make contact with the extracellular matrix at specialised cell junctions, the focal adhesions, that contain greater than twenty different cell signalling molecules [18]. The signal transduction pathways they activate in adherent cells contribute to the suppression of apoptosis and allow cells to progress through the cell cycle [19, 20]. Changes in integrin engagement also affect changes in the organisation of the actin-based cytoskeleton through Ras, Cdc42-, Racand RhoA-dependent signalling pathways [21–25]. In addition to regulating the dynamic reorganisation of the actin-based cytoskeleton, these small GTPases also
892
Vol. 270, No. 3, 2000
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
activate signal transduction pathways that affect gene transcription. Ras is a downstream effector of multiple cell-surface receptors and is involved in integrindependent and growth-factor induced activation of Erk2 [26, 27]. Rho links the LPA receptor to the activation of SRF [28] and Rac-1 and Cdc42 affect gene transcription by regulating the JNK/SAPK and p38/ Mpk1 MAP kinase pathways [29 –31] and indirectly the ERK-MAP kinase pathway by cross-cascade signalling events [32]. Functionally, Ras, Rac-1, Cdc 42 and RhoA are poised to respond to integrin-mediated signals and changes in their activity may serve to coordinate the expression of extracellular protease activity with changes in the organisation of the cytoskeleton and cell migration. Because of its pivotal role in cell migration in affecting both extracellular proteolysis and cell adhesion, we undertook a study to investigate whether Ras or members of the Rho-family of small GTP-binding proteins were able to regulate transcription of the uPAR gene. We cloned the 1.55 kb promoter region of the human uPAR gene from a chromosome 19 cosmid library to study the involvement of small GTPases in regulating transcription of the uPAR gene through luciferase reporter assays. The greatest stimulation of transcription from the uPAR promoter was obtained using a constitutively active H-Ras mutant. This mutant also appeared to increase in the stability of the uPAR mRNA within transfected cells. A constitutively active RhoA mutant produced a moderate increase in transcription from the uPAR promoter while other members of the RhoA family, Cdc42 and Rac, both activators of the JNK pathway, failed to stimulate transcription above basal levels. These data indicate the selective nature of the signalling pathways that operate to regulate uPAR gene transcription. In addition, the use of Ras effector-loop mutants that interact specifically with Raf, PI3K and Ral GDS [33] demonstrated that effector molecules in addition to c-Raf1 are necessary for maximal transcriptional activation of the uPAR gene. MATERIALS AND METHODS Reverse transcription-polymerase chain reaction (RT-PCR). Total RNA was isolated from cultures of approximately 1 ⫻ 10 7 cells adherent cells using the reagent Triazol (Gibco/BRL) as directed by the manufacturer’s instructions. Total RNA was redissolved in 100 l of water and the RNA concentration determined by spectrophotometry. Reverse transcription reactions were carried out in a 20 l volume containing 2– 4 g of RNA, 50 pmol of random hexamer (Pharmacia), 5 nmol of each deoxynucleotide triphosphate (Boehringer), 10 mM Tris-Cl, pH 8.4, 50 mM KCl, 2.5 mM MgCl 2, 10 U RNasin (Promega Biotec) and 200 U of Super Script reverse transcriptase (Gibco-BRL). Two microlitres of each reverse transcription reaction was used for amplification by PCR in a final volume of 100 l. Each reaction contained 0.25 pmol of forward and reverse primers, 200 mol of each dNTP and 2.5 mM Mg 2⫹ ions. The amplification reactions were performed for 30 cycles of 94°C (1 min), 55°C (1 min), 72°C (1 min) followed by a further 10min extension reaction at 72°C for 10 min. The forward and reverse primers used in the amplifica-
tion reactions of murine uPAR cDNA were CAGTGTGAGAGTAACCAG and GGCACTGATTCATTGGTC respectively. The forward and reverse primers used in the amplification of murine glyceraldehyde 3 phosphate dehydrogenase cDNA were CATGTGGGCCATGAGGTCCACCAC and GATGACAAGCTTCCCGTTCTCAGC. Cell culture, transfection and measurement of promoter activity. The murine fibroblast cell line NIH3T3 were maintained in DMEM (Gibco/BRL) supplemented with 10% FCS. The cells were cultured in a humidified atmosphere of 5% CO 2. Cells were transfected when they had obtained approximately 70% confluency. For each transfection, 2– 4 g of luciferase reporter construct or plasmids encoding constitutively-activate or dominant-negative alleles of small GTPbinding-proteins was used. The final amount of DNA used in each transfection of cells in a 90 mm dish was adjusted to a total of 10 g using pBSII (Bluescript) plasmid (Stratagene). Transfected cells were lysed 48 h post-transfection in 250 mM KCl, 50 mM HEPES, pH 7.5, 0.1% NP-40, 10% glycerol. Luciferase activity was determined as described previously (REF). Transfection efficiencies were determined by measuring the  galactosidase activity resulting from co-transfection of 1 g of pCH110 (Amersham Pharmacia Biotec) per plate. The amount of luciferase activity in each transfection experiment was normalised to the relative transfection efficiency of each experimental point. Plasmids. The luciferase reporter construct pGL3-uPAR was constructed by subcloning the region ⫹9 to ⫺1553 relative to the transcription initiation site (Soravia et al., 1995) of the human uPAR gene into the Hind III site of the vector pGL3 (Promega), upstream of the luciferase reporter gene. The promoter fragment was generated by low-cycle PCR amplification from a cosmid clone containing this region isolated from a human chromosome 19 library (clone number 28316) generously provided by Dr. G. Lennon (Human Genome Centre, Livermore, CA). The PCR primers contained HindIII. restriction sites flanking the promoter amplification product to facilitate subcloning of this fragment. The plasmids containing constitutively activated mutants V12HRas, L63RhoA in pCMV5 and L61Cdc42hs L61Rac1 in pcDNA3 have been described previously [32]. The construction and use of V12 H-Ras and the partial effector mutants V12/G37, V12/C40 and V12/ S35 in the vector pSG5 (Stratagene) have also been described [34] and were generously provided by J. Downward, ICRF, London. The activities of the mutants used in the experiments described were verified through their ability to activate or inhibit transcriptional activation of the c-fos promoter in the vector pGL2-Fos wt factor (provided by P. E. Shaw, Nottingham University). This plasmid contains 0.7 kb of the c-fos promoter with an intact binding site for the serum response. Transcription from this promoter is activated in cells supplied with serum or transfected with the small GTP-binding proteins RhoA, Rac Cdc42Hs and Ras. The basal level of transcription of the uPAR promoter used in these experiments is approximately a fifth of the serum-induced fos promoter.
RESULTS Effects of Constitutively Active Ras, RhoA, Rac-1, and Cdc42Hs on Transcription from the 1.5-kb Upstream Region of the uPAR Promoter It has been shown previously that the small GTPbinding proteins Ras, RhoA, Rac-1 and Cdc42Hs affect the organisation of the actin-based cytoskeleton and activate intracellular signal transduction cascades [21–29]. To determine whether the small GTP-binding proteins that cause the most pronounced changes in the organisation of the actin-based cytoskeleton also affect transcription of uPAR gene, NIH 3T3 cells were
893
Vol. 270, No. 3, 2000
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
However, there are no DNA elements that confer sensitivity to Cdc42 Hs or Rac-1 derived signals within the same region of the promoter. The results demonstrate that some degree of specificity exists in the type of signalling events that activate uPAR transcription. Identification of Downstream Effectors of Ras
FIG. 1. Effects of constitutively activate mutants of ras, rhoA, cdc42Hs, and rac1 on the activation of transcription driven from the 1.55-kb upstream promoter region of the human uPAR gene. NIH3T3 cells were mock transfected, transfected with pGL3-uPAR alone, or cotransfected with constitutively activate mutants of ras; rho A, rac1, or cdc42. Luciferase activity is described in terms of relative light units (RLU) as a percentage of the activation by V12 H-Ras. Data points represent the mean of three independent experiments with standard deviations indicated by error bars.
co-transfected with the luciferase reporter construct pGL3-uPAR and constitutively-activate mutants of the GTP-binding proteins (Fig. 1). The vector pGL3-uPAR contains 1.55 kb of 5⬘ DNA proximal to the major transcription start site of the human uPAR gene linked to a luciferase reporter gene. Co-transfection of cells with a constitutively active V12H-ras mutant increased transcription from the uPAR promoter approximately fourfold above the basal level of transcription, indicating that Ras-response elements are contained within this region of the promoter. In order to ensure that H-Ras was not activating transcription from the uPAR promoter by stimulating an autocrine loop, cells were transfected with the reporter construct pGL3uPAR and incubated in conditioned medium from Rastransfected cells. The conditioned media failed to stimulate transcription from the uPAR promoter above basal levels indicating that Ras activates transcription from the uPAR promoter by the direct activation of an intracellular signal transduction pathway (data not shown). To determine if members of the RhoA family of small GTP binding proteins that are reported to be activators of the JNK/stress activated protein kinase (SAPK) pathway and p38 were able to stimulate transcription from the uPAR promoter, NIH3T3 cells were transfected with constitutively active mutants of RhoA (L63RhoA), Cdc42Hs (L61cdc42) or c Rac-1 (L61rac-1) [29]. Constitutively active RhoA increased transcription from the uPAR promoter approximately two-fold but neither Cdc42Hs nor cRac-1 were able to stimulate transcription above the basal level of expression (Fig. 1). These results demonstrate the presence of DNA response elements located within 1.55 kb of the transcription start site of the uPAR gene that confer sensitivity to both Ras- and RhoA-mediated signalling.
Ras is a downstream effector of integrin signalling [25] and, in our assays, was the most potent of the small GTP-binding proteins to stimulate transcription from the 1.55 kb uPAR promoter. We therefore focused on determining how Ras activates uPAR gene transcription. Two of the best characterised pathways downstream of Ras are those that lead to the activation of ERK-1 and-2 through the sequential activation of Raf and MEK1 and a pathway that results in the activation of Cdc42 and cRac-1. In addition to these pathways it is now known that Ras utilises a large number of functionally diverse effector that are capable of transducing signals through multiple pathways [35]. As constitutively active mutants of Cdc42 and Rac-1 failed to stimulate transcription from the 1.55 kb uPAR-promoter fragment (Fig. 1), it seems unlikely that activation of the JNK/SAPK pathways is sufficient to stimulate transcription from the uPAR promoter. It was therefore likely that Ras activates uPAR gene transcription through other effector molecules. A role for cRaf-1 as the Ras effector that leads to increased uPAR gene transcription was investigated by carrying out cotransfections using the uPAR reporter vector pGL3-uPAR with either dominant-negative or constitutively active mutants of cRaf-1 (Fig. 2). In these
FIG. 2. Effects of constitutively activate or dominant-negative raf mutants on transcription from the 1.55 kb promoter-region fragment of the human uPAR gene. NIH 3T3 cells were mock transfected or transfected with pGL3-uPAR alone to determine the basal level of transcription from the uPAR promoter. All other transfections were carried out using pGL3-uPAR cotransfected with either constitutively active V12 H-ras, constitutively active V12 H-ras and V raf1, constitutively active V12 H-ras and dominant negative raf (raf1W375), constitutively active V raf. Luciferase activity is described in terms of relative light units (RLU) as a percentage of the activation by V12 H-Ras. Data points represent the mean of three independent experiments with standard deviations indicated by error bars.
894
Vol. 270, No. 3, 2000
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
experiments, transfection of NIH3T3 cells with constitutively active V12H-ras produced an approximately 6-fold increase in the level of transcription from the uPAR promoter. In comparison, transfection with a constitutively active c-Raf1 mutant only produced a two-fold increase in transcription and cotransfection of cells with constitutively active Ras and Raf mutants together produced a five-fold increase in transcription from the uPAR promoter. The failure to demonstrate any synergy between H-Ras and cRaf-1 in activating uPAR transcription indicates that cRaf-1 is unlikely to be the sole effector molecule involved in the activation of the signalling pathway that stimulates transcription from the uPAR promoter. The failure of a dominantnegative cRaf-1 mutant to inhibit the Ras-stimulated uPAR transcription also supports this finding. These results indicate that the Ras-Raf-MEK-ERK pathway is not sufficient to fully induce uPAR transcription and identifies a requirement for other Ras effectors in this process. Signalling from Multiple Ras Effectors Is Required to Activate Transcription from the uPAR Promoter The linear pathway of signalling from Ras to ERK represents but a minor component of a complex signalling circuit. What has emerged recently is that Ras uses a variety of functionally diverse effectors that transduce signals through multiple pathways [35]. The association between Ras and its effector molecules is complex but for a number of effector molecules the interaction is mediated, at least initially, by interaction between the core Ras effector domain (residues 32– 40 in H-Ras) and the effector molecule. Point mutations in the effector domain of constitutively active Ras generates mutants that are unable to interact with specific effectors thereby preventing the activation of specific downstream signalling pathways [33, 34, 36 – 38]. The Ras effector-domain mutants V12 S35 Ras, V12 G37 Ras and V12 C40 Ras permit the interaction between the Ras effectors Raf, Ral GDS and PI3K respectively and consequently activate signalling pathways that lie downstream of these effector molecules. We co-transfected NIH3T3 cells with the uPAR promoter-reporter construct pGL3-uPAR and either individual or pairwise combinations of the Ras effectorloop mutants in order to identify how these signalling pathways contribute to the activation of uPAR gene transcription by constitutively active Ras (Fig. 3). All Ras effector-loop mutants were able to stimulate uPAR transcription to some extent, however none were as efficient as the constitutively active Ras mutant alone. The inability of the effector-loop mutants to be as effective as the constitutively active Ras mutant is consistent with previous uses of these mutants [34, 36 – 38]. Any pairwise combination of the effector loop mutants was more efficient in activating transcription
FIG. 3. Effects of ras effector-loop mutants on activation of transcription from the uPAR promoter. NIH3T3 cells were transfected with pGL3-uPAR which allows the basal level of transcription to be determined or cotransfected with pGL3-uPAR and constitutively activate V12 H-ras. NIH3T3 cells were also transfected with the combinations of V12 H-Ras effector-loop mutants shown in the figure. Luciferase activity is described in terms of relative light units (RLU) as a percentage of the activation by V12 H-Ras. Data points represent the mean of three independent experiments with standard deviations indicated by error bars.
from the uPAR promoter. Interestingly, the most effective mutant in stimulating uPAR transcription was the V12G37 mutant that utilises RalGDS as its downstream effector. The signalling events that take place after activation of RalGDS are relatively uncharacterised. Overall, it appears that the simultaneous activation of multiple Ras-activated signal transducing pathways are required for efficient transcription from the uPAR promoter. Effects of Signalling by Ras and RhoA Signalling on the Expression of Endogenous uPAR mRNA in NIH 3T3 Cells It has been demonstrated that the levels of uPAR mRNA is subject to regulation at the level of transcription and by changes in mRNA stability in different cell types [39, 40]. To determine if the increase in transcription from the uPAR promoter induced by constitutively active mutants of Ras or RhoA could be further enhanced by stabilisation of the uPAR mRNA, NIH3T3 cells were transfected with the constitutively-active mutants V12-Hras or L63RhoA and the levels of murine uPAR mRNA determined by semi-quantitative RT-PCR analysis (Fig. 4). The amount of PCR product generated in each reaction was quantified by densitometric analysis. Amplification of endogenous glyceraldehyde 3 phosphate dehydrogenase was used to normalise the RT-PCR reactions and PCR amplification reactions using RNA that had not been reverse transcribed into cDNA was used as a control to rule contamination of the RNA samples by DNA (Fig. 4, lane 1). Transfection of cells with V12H-ras increased the
895
Vol. 270, No. 3, 2000
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
that Ras signalling also increases the stability of the endogenous uPAR mRNA. DISCUSSION
FIG. 4. RT-PCR analysis of the effects of constitutively-activate V12 H-ras and rhoA on endogenous uPAR mRNA levels in NIH 3T3 cells. Cells were transfected with 2 g of plasmid encoding constitutively activated V12 H-ras or rhoA and maintained for 48 h in DMEM/0.5% FCS before the isolation of total RNA. Lane M shows the position of HaeIII cut X 174 DNA size markers. Lane 1 shows the amplification products generated from a pool of RNA from all the samples in the absence of a reverse transcription reaction. This was a control to detect the presence of contaminating DNA in the samples. Lane 2 shows the level of endogenous uPAR mRNA in mocktransfected cells. Lanes 3 and 4 show the uPAR amplification products generated after cells were transfected with either constitutively active rhoA or V12 H-ras respectively. Lanes 5–7 show the amplification products of glyceraldehyde 3 phosphate dehydrogenase from the same RNA extracts used to generated the PCR products in lanes 2– 4. These act as controls to ensure that equivalent amounts of RNA were used in each RT-PCR reaction.
amount of uPAR mRNA levels 2.8 fold above that of untransfected cells. This figure is apparently in close agreement with the increase in transcription from the human uPAR promoter (4-fold). However, the actual increase in uPAR mRNA levels within NIH3T3 cells must be greater, approximately 30-fold, since, at best, only 10% of the cells were transfected using the calcium phosphate methodology and as such only represent a small proportion of the cells from which RNA was isolated. The transfection efficiency in these experiments was estimated by counting the percentage of fluorescent NIH3T3 cells within a field of vision in transfections using the GFP expression vector pEGFP-N1 (Clontech) (data not shown). In contrast with the increase in uPAR mRNA in response to transfection with constitutively active Ras, no increase in murine uPAR mRNA levels could be detected after transfection of NIH3T3 cells with constitutively active L63RhoA despite having previously determined that constitutively active RhoA also stimulates transcription from the uPAR promoter. The failure to detect a change mRNA levels may be due to the RT-PCR assay being insufficiently sensitive to detect a two fold change in transcription of the uPAR gene in the small proportion of the cells that were transfected with L63RhoA. Although we can not rule out the possibility that additional sequences in the murine uPAR promoter that are missing from the human uPAR-reporter construct are responsible for the large increase in endogenous uPAR mRNA in response to Ras, it is likely
The small GTP-binding proteins Ras, RhoA, Rac1 and Cdc42Hs act as downstream effectors of integrin signalling to affect the dynamic reorganisation of the actin-based cytoskeleton and activated intracellular signalling cascades [19, 41]. Potentially, changes in the activation state of these small GTP binding proteins could serve to co-ordinate changes in cell adhesion with extracellular proteolysis by affecting the transcription of genes associated with these events. To explore this hypothesis, we focussed on how signalling from small GTP-binding proteins affect transcription of the urokinase receptor gene (uPAR). The urokinase receptor plays a key role in extracellular proteolysis and cell migration [2]. Like many of the genes that encode proteins involved in extracellular proteolysis, including those of metalloproteinases and uPA, the 1.55 kb promoter region of the human uPAR gene contains AP1 and PEA3 DNA response elements located in the promoter elements of their genes [42, 43]. These response elements constitute the prototypical Rasresponsive element and are bound by the ubiquitously expressed polypeptides that comprise the transcription factor AP-1 and by members of the Ets family of transcription factors. Members of the AP1 family of transcription factors are activated by JNK/stress-activated protein kinase (SAPK) and p38 MAP kinases cascades that signal downstream of RhoA GTPases while ETS family transcription factors are subject to regulation by the Ras-MAPK pathway [44]. The 1.55 kb promoter region of the uPAR gene contains consensus DNA response elements for these transcription factors [42] and is therefore potentially subject to regulation by all of these signalling pathways. We found that constitutively activate mutants of H-Ras and RhoA, were able to stimulate transcription from DNA response elements contained within 1.55 kb of the major transcription initiation site of the human uPAR promoter. The ability of the constitutively active Ras mutant to stimulate uPAR transcription is consistent with the observations that transformation of human fibroblasts with oncogenic Ras correlates with increased activity of receptor-bound plasminogen activator [45] and that the targeted disruption of the K-ras oncogene reduces uPAR gene expression and the degradation of extracellular laminin [46]. Cumulatively, these findings indicate that members of the Ras family play a key role in the regulation of uPAR gene expression in vivo and that DNA response element(s) that can be utilised by Ras-mediated signalling are located within 1.55 kb of the major start point of transcription. We further investigated the mechanism of Ras signalling by using constitutively active and dominant neg-
896
Vol. 270, No. 3, 2000
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
ative mutants of c-Raf 1, the best-characterised effector of Ras that leads to the activation of the MAPK pathway. We found that c-Raf 1 was neither necessary nor sufficient for the Ras-mediated activation of uPAR gene transcription indicating that H-Ras utilises alternative effector molecules to activate transcription. Using H-Ras effector-domain mutants that permit Ras to interact selectively with the effector molecules cRaf1, PI3K or RalGDS [33, 34, 36 –38]. We were able to demonstrate that uPAR transcription required the activation of multiple Ras effectors for maximal stimulation. Interestingly the activation of the Ras-effector RalGDS appeared to be the most efficient in activating uPAR transcription. RalGDS is a guanine nucleotide exchange factor for the small GTP-binding proteins RalA and RalB, and two distant relatives Rgl and Rlf. Ras and Ral activate intracellular signalling cascades require various degrees of interdependency. So far little is known about how the activation of these GTPbinding proteins mediate their effects [47]. Of the Rho-family members tested, only RhoA was able to stimulate transcription from the uPAR promoter. Rho-A signalling results in the activation of serum response factor (SRF) dependent transcription and activates the transcription factor NFB [28, 48]. The 1.55 kb uPAR promoter contains only a consensus binding site for NFB and this therefore potentially represents the DNA response element utilised in RhoA-mediated activation of uPAR gene transcription. In our work neither constitutively activate Rac nor Cdc42 mutants stimulated transcription from the uPAR promoter. As Ras is a potent activator of Rac [22, 35] this would suggest that H-Ras does not utilise Rac as an effector in activating uPAR gene transcription. In addition, Rac and Cdc42 have been reported to be activators of the JNK/SAPK and p38 MAP kinase signalling pathways (REF). The failure of constitutively active mutants of Rac and Cdc42 to stimulate transcription from the uPAR promoter would suggest that these signalling pathways do not activate uPAR transcription in NIH3T3 cells. This result contrasts with the earlier findings that the JNK signalling pathway stimulates transcription from a 398 bp uPARpromoter fragment ovarian cancer cell line OVCAR-3 [49]. As this JNK-response element is contained within the promoter fragment used in this work, this may indicate that the importance of a specific signalling pathway in regulating transcription is altered by the activity of endogenous signalling pathways in different cell types. In addition to activating transcription of the uPAR in NIH3T3 cells, constitutively active Ras appeared to increase endogenous uPAR mRNA levels to a greater level than could accounted for by increase in transcription alone. The stabilisation of uPAR mRNA by oncogenic Ras, a frequent occurrence in transformed cells, would serve to augment uPAR expression and is con-
sistent with the elevated levels of uPAR expression often found in transformed cells [2]. The mechanism by which uPAR mRNA is stabilised in response to constitutively active H-Ras remains to be explored but may involve the nonameric destabilising-sequence UUAUUUAUU in the 3⬘ untranslated region of uPAR mRNA [40]. Interestingly, in T-cells, the destabilising effect of this element is overcome by LFA-1 engagement [40]. It is tempting to speculate that Rasmediated signalling functioning down stream of the integrin engagement may be involved in this process. However, this may not be the only stability element involved as the dissociation of a destabilising protein from the coding region of uPAR mRNA that has been reported to increase the stability of uPAR mRNA in response to signals generated by inflammatory mediators [39]. In conclusion it is clear that H-Ras and RhoA can activate transcription from response elements contained within the 1.55 kb promoter fragment while the other RhoA family members that affect the organisation of the actin-based cytoskeleton do not. The requirement for multiple Ras effectors to maximally stimulate uPAR gene expression is intriguing. This may be indicative of the existence of a mechanism whereby fine control can be exerted on uPAR gene expression in response to the large variety of signals that converge on Ras. Physiologically, it is possible that different Ras effectors are utilised at different stages of cell development to regulate uPAR transcription. Elucidation of how these signalling pathways converge at the uPAR will have a significant impact on identifying how extracellular events influence uPAR gene expression. ACKNOWLEDGMENTS The authors thank Professor P. E. Shaw (University of Nottingham) for his helpful discussions regarding mechanisms of intracellular signal transduction. S. M. Muller and E. Okan were supported by a grant from the European Social Fund.
REFERENCES
897
1. Stahl, A., and Muller, B. M. (1994) Cancer Res. 54, 3066 –3071. 2. Andreasen, P. A., Kjøller, L, Christensen, L., and Duffy, M. J. (1997) Int. J. Cancer 72, 1–22. 3. Crowley, C. W., Cohen, R. L., Lucas, B. K., Liu, B. K., Shuman, M. A., and Levinson, A. D. (1993) Proc. Natl. Acad. Sci. USA 90, 5021–5025. 4. Kook, Y. H., Adamski, J., Zelent, A., and Ossowski, L. (1994) EMBO J. 13, 3983–3991. 5. Quattrone, A., Fibbi, G., Anichini, E., Pucci, M., Zamperini, A., Capaccioli, S., and Del Rosso, M. (1995) Cancer Res. 55, 90 –95. 6. Min, H. Y., Doyle, L. V., Vitt, C. R., Zandonella, C. L., StrattonThomas, J. R., Shuman, M. A., and Rosenburg, S. (1996) Cancer Res. 56, 2428 –2433. 7. Wei, Y., Walz, D. A., Rao, N., Drummond, R. J., Rosenburg, S., and Chapman, H. A. (1994) J. Biol. Chem. 269, 32380 –32388.
Vol. 270, No. 3, 2000
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
8. Waltz, D. A., Natkin, L. R., Fijita, R. M., Wei, Y., and Chapman, H. A. (1997) J. Clin Invest 100, 58 – 67. 9. Xue, W., Mizukami, I., Todd, R. F., III, and Petty, H. R. (1997) Cancer Res. 57, 1682–1689. 10. Kindzelskii, A. L., Laska, Z. O., Todd, R. F., III, Petty, H. R. (1996) J. Immunol. 156, 297–309. 11. Kindzelskii, A. L., Eszes, M. M., Todd, R. F., and Petty, H. R. (1997) Biophys. J. 72, 1777–1784) 12. Tang, H., Kerins, D. M., Hao, Q., Inagami, T., and Vaughan, D. E. (1998) J. Biol. Chem. 273, 18268 –18272. 13. Nguyen, D. H., Hussaini, I. M., and Gonias, S. L. (1998) J. Biol. Chem. 273, 8502– 8507. 14. Nguyen, D. H., Catling, A. D., Webb, D. J., Sankovic, M. Walker, L. A., Somylo, A. V., Weber, M. J., and Gonias, S. L (1999) J. Cell Biol. 146, 149 –164. 15. Dumlar, I., Weis, A., Mayboroda, O. A., Maasch, C., Jerke, U., Haller, H., and Gulba, D. C. (1998) J. Biol. Chem. 273, 315–321. 16. Kolshelnick, Y., Ehart, M., Hufnagl, P., Heinrich, P. C., and Binder, B. R. (1997) J. Biol. Chem. 272, 28563–28567. 17. Fazioli, F., Resnati, M., Sidenius, N., Higashimoto, Y., Appella, E., and Blasi, F. (1997) EMBO J. 16, 7279 –7286. 18. Miyamoto, S., Teramoto, H., Coso, O. A., Gutkind, J. S., Burbelo, P. D., Akiyama, S. K., and Yamada, K. M. (1995) J. Cell Biol. 131, 791– 805. 19. Howe, A., Aplin, A. E., Suresh, K. A., and Juliano, R. L. (1998) Curr. Opin. Cell Biol. 10, 220 –231. 20. Assoian, R. K. (1997) J. Cell Biol. 136, 1– 4. 21. Ridley, A. J., and Hall, A. (1992) Cell 70, 389 –399. 22. Ridley, A. J., Paterson, H. F., Johnston, C. L., Diekmann, D., and Hall, A. (1992) Cell 70, 401– 410. 23. Hotchin, N. A., and Hall, A. (1995) J. Cell Biol. 131, 1857–1865. 24. Nobes, C. D., and Hall, A. (1995) Cell 81, 53– 62. 25. Clark, E. A., Warren, G. K., Brugge, J. S,. Symons, M., and Hynes, R. O. (1998) J. Cell Biol. 142, 573–586. 26. Clark, E. A., and Hynes, R. O. (1996) J. Biol. Chem. 271, 14814 – 14818. 27. Schlaepfer, D. D., and Hunter, T. (1997) J. Biol. Chem. 272, 13189 –13195. 28. Hill, C. S., Wynne, J., and Triesman, R. (1995) Cell 81, 1159 –1170. 29. Coso, O. A., Chiariello, M., Yu, J. C., Teramoto, H., Crespo, P., Xu, N., Miki, T., and Gutkind, J. S. (1995) Cell 81, 1137–1146
30. Minden, A., Lin, L., Claret, F X., Abo, A., and Karin, M. (1995) Cell 81, 1147–1157. 31. Bagrodia, S., Derijard, B., Davis, R. J., and Cerione, R. A. (1995) J. Biol. Chem. 270, 27995–27998. 32. Frost, J. A., Steen, H., Shapiro, P., Lewis, T., Ahn, N., Shaw, P. E., and Cobb, M. H. (1997) EMBO J. 16, 6426 – 6438. 33. White, M. A., Nicolette, C., Minden, A., Polverino, A., Van Aelst, L., Karin, M., and Wigler, M. H. (1995) Cell 80, 533–541. 34. Rodriguez-Viciana, P., Warne, P. H., Khwaja, A., Marte, B. M., Pappin, D., Das, P., Waterfield, M. D., Ridley, A., and Downward, J. (1997) Cell 89, 457– 467. 35. Campbell, S. L., Khosravi-Far, R., Rossman, K. L., Clark, G. J., and Channing, J. Der. (1998) Oncogene 17, 1395–1413. 36. Webb, C. P., Van Aelst, L., Wigler, M. H., and Vande Woude, G. F. (1998) Proc. Natl. Acad. Sci. USA 95, 8773– 8778. 37. Kauffman-Zeh, A., Viciana, P. R., Ulrich, E., Gilbert, C., Coffer, P., Downward, J., and Even, G. (1997) Nature 385, 544 –548. 38. Yang, J-J., Kang, J-S., and Krauss, R. S. (1998) Mol. Cell Biol. 18, 2586 –2595. 39. Shetty, E. A., Kumar, A., and Idell, S. (1997) Mol. Cell Biol. 17, 1075–1083. 40. Wang, G. J., Collinge, M., Blasi, F., Pardi, R., and Bender, J. R. (1998) Proc. Natl. Acad. Sci. USA 95, 6296 – 6301. 41. Mackay, D. J. G., and Hall, H. (1998). Rho GTPases. J. Biol. Chem. 273, 20685–20688. 42. Soravia, E., Alexandra, G., De Luca, P., Helin, K., Suh, T. T., Degan, J. L., and Blasi, F. (1995) Blood 86, 624 – 635. 43. Westermark, J., and Kahari, V. M (1999) FASEB J. 8, 781–792. 44. Waslyk, B., Hagman, J., and Gutierrez-Hartmann, A. (1998) Trends Biochem. Sci. 23, 213–216. 45. Jankun, J., Maher, V., and McCormick, J (1991) Cancer Res. 51, 1221–1226. 46. Allagayer, H., Wang, H., Shirasawa, S., Sasazuki, T., and Boyd, D. (1999) Br. J. Cancer 80, 1884 –1891. 47. Bos, J. L. (1998) EMBO J. 17, 6776 – 6782. 48. Sulciner, D. J., Irani, K,. Yu, Z. X., Ferrans, V. J., GoldschmidtClermont, P., and Finkel, T. (1996) Mol. Cell Biol. 16, 7115– 7121. 49. Gum, R., Juarez, J., Allegayer, H., Mazar, A., Wang, Y., and Boyd, D. (1998) Oncogene 17, 213–225.
898
Regulation of Urokinase Receptor Transcription by Ras- and Rho-Family GTPases Silke M. Muller, Emel Okan, and Peter Jones 1 School of Biomedical Sciences, Queen’s Medical Centre, University of Nottingham, Nottingham, NG7 2UH, United Kingdom
Received March 15, 2000
How cell adhesion is coordinated with extracellular proteolysis is a key question in understanding cell migration. Potentially, the small GTP-binding proteins that affect actin organisation and signal transduction may also regulate the expression of genes associated with extracellular proteolysis. We investigated the ability of Ras, Rac-1, Cdc42Hs, and RhoA to regulate transcription from the1.55-kb promoter region of the human urokinase plasminogen activator receptor (uPAR) gene. Constitutively active V12 H-Ras and Rho-A stimulated uPAR transcription while Cdc42Hs and Rac-1 did not. The use of Ras effectorloop mutants indicated that signalling via multiple Ras-effectors is necessary for the maximum activation of transcription. © 2000 Academic Press Key Words: Ras; RhoA; GTP-binding proteins; urokinase receptor.
The urokinase plasminogen activator receptor (uPAR) is a heavily glycosylated, GPI-anchored protein which through binding its ligand, the protease urokinase plasminogen activator (uPA), localises the conversion of plasminogen to plasmin to the surface of a cell. Plasmin is a protease with a broad substrate specificity and is responsible for the activation of the zymogen forms of a number of metalloproteinases and initiates a proteolytic cascade required for cell migration in vivo. Elevated levels of uPAR expression are associated with an increased invasive capacity of a number of cell types. In many cases, the activity of the uPA/uPAR system directly correlates with the extent of cancer cell invasion and metastasis [1, 2]. Further evidence indicating that uPAR plays a key role in metastasis has been demonstrated using antisense techniques and inhibitors of the uPA-uPAR interaction. Both experimental approaches have been shown to decrease the metastatic potential of cells [3– 6]. In addition to promoting 1
To whom all correspondence should be addressed. E-mail: [email protected]. 0006-291X/00 $35.00 Copyright © 2000 by Academic Press All rights of reproduction in any form reserved.
extracellular proteolysis, uPAR affects the migratory capacity of cells by binding directly to vitronectin, [7, 8] and by associating with 2 integrins in haemopoietic cells and 1- or 3-integrins in non-haemopoietic cells. The association of uPAR with integrins modulates the binding affinity of the later for their extracellular matrix ligands [9 –11]. Recent findings also indicate that uPAR is capable of activating the ERK/MAPK [12–14] and JAK/STAT [15, 16] intracellular signalling pathways and is also responsible for the activation of Srcfamily tyrosine kinases and a heterotrimeric G-protein coupled receptor that results in increased cell migration [17]. It therefore appears that uPAR contributes to cell migration in three ways: (1) by affecting extracellular proteolysis; (2) by modulating cell adhesion; and (3) by activating signal transduction pathways. The elevated levels of uPAR expression associated with the increased metastatic potential of transformed cells may reflect a breakdown in the regulatory processes that link cell adhesion with uPAR expression. Identifying signalling pathways that affect uPAR gene expression in response to changes in cell adhesion during cell migration will be important in determining how changes in cell adhesion are coordinated with uPA-mediated extracellular proteolysis. Since the integrins are major sensors of changes in extracellular matrix composition and integrity it is likely that signals transduced by effector molecules that function downstream of integrins are involved in coordinating these events. Integrins make contact with the extracellular matrix at specialised cell junctions, the focal adhesions, that contain greater than twenty different cell signalling molecules [18]. The signal transduction pathways they activate in adherent cells contribute to the suppression of apoptosis and allow cells to progress through the cell cycle [19, 20]. Changes in integrin engagement also affect changes in the organisation of the actin-based cytoskeleton through Ras, Cdc42-, Racand RhoA-dependent signalling pathways [21–25]. In addition to regulating the dynamic reorganisation of the actin-based cytoskeleton, these small GTPases also
892
Vol. 270, No. 3, 2000
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
activate signal transduction pathways that affect gene transcription. Ras is a downstream effector of multiple cell-surface receptors and is involved in integrindependent and growth-factor induced activation of Erk2 [26, 27]. Rho links the LPA receptor to the activation of SRF [28] and Rac-1 and Cdc42 affect gene transcription by regulating the JNK/SAPK and p38/ Mpk1 MAP kinase pathways [29 –31] and indirectly the ERK-MAP kinase pathway by cross-cascade signalling events [32]. Functionally, Ras, Rac-1, Cdc 42 and RhoA are poised to respond to integrin-mediated signals and changes in their activity may serve to coordinate the expression of extracellular protease activity with changes in the organisation of the cytoskeleton and cell migration. Because of its pivotal role in cell migration in affecting both extracellular proteolysis and cell adhesion, we undertook a study to investigate whether Ras or members of the Rho-family of small GTP-binding proteins were able to regulate transcription of the uPAR gene. We cloned the 1.55 kb promoter region of the human uPAR gene from a chromosome 19 cosmid library to study the involvement of small GTPases in regulating transcription of the uPAR gene through luciferase reporter assays. The greatest stimulation of transcription from the uPAR promoter was obtained using a constitutively active H-Ras mutant. This mutant also appeared to increase in the stability of the uPAR mRNA within transfected cells. A constitutively active RhoA mutant produced a moderate increase in transcription from the uPAR promoter while other members of the RhoA family, Cdc42 and Rac, both activators of the JNK pathway, failed to stimulate transcription above basal levels. These data indicate the selective nature of the signalling pathways that operate to regulate uPAR gene transcription. In addition, the use of Ras effector-loop mutants that interact specifically with Raf, PI3K and Ral GDS [33] demonstrated that effector molecules in addition to c-Raf1 are necessary for maximal transcriptional activation of the uPAR gene. MATERIALS AND METHODS Reverse transcription-polymerase chain reaction (RT-PCR). Total RNA was isolated from cultures of approximately 1 ⫻ 10 7 cells adherent cells using the reagent Triazol (Gibco/BRL) as directed by the manufacturer’s instructions. Total RNA was redissolved in 100 l of water and the RNA concentration determined by spectrophotometry. Reverse transcription reactions were carried out in a 20 l volume containing 2– 4 g of RNA, 50 pmol of random hexamer (Pharmacia), 5 nmol of each deoxynucleotide triphosphate (Boehringer), 10 mM Tris-Cl, pH 8.4, 50 mM KCl, 2.5 mM MgCl 2, 10 U RNasin (Promega Biotec) and 200 U of Super Script reverse transcriptase (Gibco-BRL). Two microlitres of each reverse transcription reaction was used for amplification by PCR in a final volume of 100 l. Each reaction contained 0.25 pmol of forward and reverse primers, 200 mol of each dNTP and 2.5 mM Mg 2⫹ ions. The amplification reactions were performed for 30 cycles of 94°C (1 min), 55°C (1 min), 72°C (1 min) followed by a further 10min extension reaction at 72°C for 10 min. The forward and reverse primers used in the amplifica-
tion reactions of murine uPAR cDNA were CAGTGTGAGAGTAACCAG and GGCACTGATTCATTGGTC respectively. The forward and reverse primers used in the amplification of murine glyceraldehyde 3 phosphate dehydrogenase cDNA were CATGTGGGCCATGAGGTCCACCAC and GATGACAAGCTTCCCGTTCTCAGC. Cell culture, transfection and measurement of promoter activity. The murine fibroblast cell line NIH3T3 were maintained in DMEM (Gibco/BRL) supplemented with 10% FCS. The cells were cultured in a humidified atmosphere of 5% CO 2. Cells were transfected when they had obtained approximately 70% confluency. For each transfection, 2– 4 g of luciferase reporter construct or plasmids encoding constitutively-activate or dominant-negative alleles of small GTPbinding-proteins was used. The final amount of DNA used in each transfection of cells in a 90 mm dish was adjusted to a total of 10 g using pBSII (Bluescript) plasmid (Stratagene). Transfected cells were lysed 48 h post-transfection in 250 mM KCl, 50 mM HEPES, pH 7.5, 0.1% NP-40, 10% glycerol. Luciferase activity was determined as described previously (REF). Transfection efficiencies were determined by measuring the  galactosidase activity resulting from co-transfection of 1 g of pCH110 (Amersham Pharmacia Biotec) per plate. The amount of luciferase activity in each transfection experiment was normalised to the relative transfection efficiency of each experimental point. Plasmids. The luciferase reporter construct pGL3-uPAR was constructed by subcloning the region ⫹9 to ⫺1553 relative to the transcription initiation site (Soravia et al., 1995) of the human uPAR gene into the Hind III site of the vector pGL3 (Promega), upstream of the luciferase reporter gene. The promoter fragment was generated by low-cycle PCR amplification from a cosmid clone containing this region isolated from a human chromosome 19 library (clone number 28316) generously provided by Dr. G. Lennon (Human Genome Centre, Livermore, CA). The PCR primers contained HindIII. restriction sites flanking the promoter amplification product to facilitate subcloning of this fragment. The plasmids containing constitutively activated mutants V12HRas, L63RhoA in pCMV5 and L61Cdc42hs L61Rac1 in pcDNA3 have been described previously [32]. The construction and use of V12 H-Ras and the partial effector mutants V12/G37, V12/C40 and V12/ S35 in the vector pSG5 (Stratagene) have also been described [34] and were generously provided by J. Downward, ICRF, London. The activities of the mutants used in the experiments described were verified through their ability to activate or inhibit transcriptional activation of the c-fos promoter in the vector pGL2-Fos wt factor (provided by P. E. Shaw, Nottingham University). This plasmid contains 0.7 kb of the c-fos promoter with an intact binding site for the serum response. Transcription from this promoter is activated in cells supplied with serum or transfected with the small GTP-binding proteins RhoA, Rac Cdc42Hs and Ras. The basal level of transcription of the uPAR promoter used in these experiments is approximately a fifth of the serum-induced fos promoter.
RESULTS Effects of Constitutively Active Ras, RhoA, Rac-1, and Cdc42Hs on Transcription from the 1.5-kb Upstream Region of the uPAR Promoter It has been shown previously that the small GTPbinding proteins Ras, RhoA, Rac-1 and Cdc42Hs affect the organisation of the actin-based cytoskeleton and activate intracellular signal transduction cascades [21–29]. To determine whether the small GTP-binding proteins that cause the most pronounced changes in the organisation of the actin-based cytoskeleton also affect transcription of uPAR gene, NIH 3T3 cells were
893
Vol. 270, No. 3, 2000
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
However, there are no DNA elements that confer sensitivity to Cdc42 Hs or Rac-1 derived signals within the same region of the promoter. The results demonstrate that some degree of specificity exists in the type of signalling events that activate uPAR transcription. Identification of Downstream Effectors of Ras
FIG. 1. Effects of constitutively activate mutants of ras, rhoA, cdc42Hs, and rac1 on the activation of transcription driven from the 1.55-kb upstream promoter region of the human uPAR gene. NIH3T3 cells were mock transfected, transfected with pGL3-uPAR alone, or cotransfected with constitutively activate mutants of ras; rho A, rac1, or cdc42. Luciferase activity is described in terms of relative light units (RLU) as a percentage of the activation by V12 H-Ras. Data points represent the mean of three independent experiments with standard deviations indicated by error bars.
co-transfected with the luciferase reporter construct pGL3-uPAR and constitutively-activate mutants of the GTP-binding proteins (Fig. 1). The vector pGL3-uPAR contains 1.55 kb of 5⬘ DNA proximal to the major transcription start site of the human uPAR gene linked to a luciferase reporter gene. Co-transfection of cells with a constitutively active V12H-ras mutant increased transcription from the uPAR promoter approximately fourfold above the basal level of transcription, indicating that Ras-response elements are contained within this region of the promoter. In order to ensure that H-Ras was not activating transcription from the uPAR promoter by stimulating an autocrine loop, cells were transfected with the reporter construct pGL3uPAR and incubated in conditioned medium from Rastransfected cells. The conditioned media failed to stimulate transcription from the uPAR promoter above basal levels indicating that Ras activates transcription from the uPAR promoter by the direct activation of an intracellular signal transduction pathway (data not shown). To determine if members of the RhoA family of small GTP binding proteins that are reported to be activators of the JNK/stress activated protein kinase (SAPK) pathway and p38 were able to stimulate transcription from the uPAR promoter, NIH3T3 cells were transfected with constitutively active mutants of RhoA (L63RhoA), Cdc42Hs (L61cdc42) or c Rac-1 (L61rac-1) [29]. Constitutively active RhoA increased transcription from the uPAR promoter approximately two-fold but neither Cdc42Hs nor cRac-1 were able to stimulate transcription above the basal level of expression (Fig. 1). These results demonstrate the presence of DNA response elements located within 1.55 kb of the transcription start site of the uPAR gene that confer sensitivity to both Ras- and RhoA-mediated signalling.
Ras is a downstream effector of integrin signalling [25] and, in our assays, was the most potent of the small GTP-binding proteins to stimulate transcription from the 1.55 kb uPAR promoter. We therefore focused on determining how Ras activates uPAR gene transcription. Two of the best characterised pathways downstream of Ras are those that lead to the activation of ERK-1 and-2 through the sequential activation of Raf and MEK1 and a pathway that results in the activation of Cdc42 and cRac-1. In addition to these pathways it is now known that Ras utilises a large number of functionally diverse effector that are capable of transducing signals through multiple pathways [35]. As constitutively active mutants of Cdc42 and Rac-1 failed to stimulate transcription from the 1.55 kb uPAR-promoter fragment (Fig. 1), it seems unlikely that activation of the JNK/SAPK pathways is sufficient to stimulate transcription from the uPAR promoter. It was therefore likely that Ras activates uPAR gene transcription through other effector molecules. A role for cRaf-1 as the Ras effector that leads to increased uPAR gene transcription was investigated by carrying out cotransfections using the uPAR reporter vector pGL3-uPAR with either dominant-negative or constitutively active mutants of cRaf-1 (Fig. 2). In these
FIG. 2. Effects of constitutively activate or dominant-negative raf mutants on transcription from the 1.55 kb promoter-region fragment of the human uPAR gene. NIH 3T3 cells were mock transfected or transfected with pGL3-uPAR alone to determine the basal level of transcription from the uPAR promoter. All other transfections were carried out using pGL3-uPAR cotransfected with either constitutively active V12 H-ras, constitutively active V12 H-ras and V raf1, constitutively active V12 H-ras and dominant negative raf (raf1W375), constitutively active V raf. Luciferase activity is described in terms of relative light units (RLU) as a percentage of the activation by V12 H-Ras. Data points represent the mean of three independent experiments with standard deviations indicated by error bars.
894
Vol. 270, No. 3, 2000
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
experiments, transfection of NIH3T3 cells with constitutively active V12H-ras produced an approximately 6-fold increase in the level of transcription from the uPAR promoter. In comparison, transfection with a constitutively active c-Raf1 mutant only produced a two-fold increase in transcription and cotransfection of cells with constitutively active Ras and Raf mutants together produced a five-fold increase in transcription from the uPAR promoter. The failure to demonstrate any synergy between H-Ras and cRaf-1 in activating uPAR transcription indicates that cRaf-1 is unlikely to be the sole effector molecule involved in the activation of the signalling pathway that stimulates transcription from the uPAR promoter. The failure of a dominantnegative cRaf-1 mutant to inhibit the Ras-stimulated uPAR transcription also supports this finding. These results indicate that the Ras-Raf-MEK-ERK pathway is not sufficient to fully induce uPAR transcription and identifies a requirement for other Ras effectors in this process. Signalling from Multiple Ras Effectors Is Required to Activate Transcription from the uPAR Promoter The linear pathway of signalling from Ras to ERK represents but a minor component of a complex signalling circuit. What has emerged recently is that Ras uses a variety of functionally diverse effectors that transduce signals through multiple pathways [35]. The association between Ras and its effector molecules is complex but for a number of effector molecules the interaction is mediated, at least initially, by interaction between the core Ras effector domain (residues 32– 40 in H-Ras) and the effector molecule. Point mutations in the effector domain of constitutively active Ras generates mutants that are unable to interact with specific effectors thereby preventing the activation of specific downstream signalling pathways [33, 34, 36 – 38]. The Ras effector-domain mutants V12 S35 Ras, V12 G37 Ras and V12 C40 Ras permit the interaction between the Ras effectors Raf, Ral GDS and PI3K respectively and consequently activate signalling pathways that lie downstream of these effector molecules. We co-transfected NIH3T3 cells with the uPAR promoter-reporter construct pGL3-uPAR and either individual or pairwise combinations of the Ras effectorloop mutants in order to identify how these signalling pathways contribute to the activation of uPAR gene transcription by constitutively active Ras (Fig. 3). All Ras effector-loop mutants were able to stimulate uPAR transcription to some extent, however none were as efficient as the constitutively active Ras mutant alone. The inability of the effector-loop mutants to be as effective as the constitutively active Ras mutant is consistent with previous uses of these mutants [34, 36 – 38]. Any pairwise combination of the effector loop mutants was more efficient in activating transcription
FIG. 3. Effects of ras effector-loop mutants on activation of transcription from the uPAR promoter. NIH3T3 cells were transfected with pGL3-uPAR which allows the basal level of transcription to be determined or cotransfected with pGL3-uPAR and constitutively activate V12 H-ras. NIH3T3 cells were also transfected with the combinations of V12 H-Ras effector-loop mutants shown in the figure. Luciferase activity is described in terms of relative light units (RLU) as a percentage of the activation by V12 H-Ras. Data points represent the mean of three independent experiments with standard deviations indicated by error bars.
from the uPAR promoter. Interestingly, the most effective mutant in stimulating uPAR transcription was the V12G37 mutant that utilises RalGDS as its downstream effector. The signalling events that take place after activation of RalGDS are relatively uncharacterised. Overall, it appears that the simultaneous activation of multiple Ras-activated signal transducing pathways are required for efficient transcription from the uPAR promoter. Effects of Signalling by Ras and RhoA Signalling on the Expression of Endogenous uPAR mRNA in NIH 3T3 Cells It has been demonstrated that the levels of uPAR mRNA is subject to regulation at the level of transcription and by changes in mRNA stability in different cell types [39, 40]. To determine if the increase in transcription from the uPAR promoter induced by constitutively active mutants of Ras or RhoA could be further enhanced by stabilisation of the uPAR mRNA, NIH3T3 cells were transfected with the constitutively-active mutants V12-Hras or L63RhoA and the levels of murine uPAR mRNA determined by semi-quantitative RT-PCR analysis (Fig. 4). The amount of PCR product generated in each reaction was quantified by densitometric analysis. Amplification of endogenous glyceraldehyde 3 phosphate dehydrogenase was used to normalise the RT-PCR reactions and PCR amplification reactions using RNA that had not been reverse transcribed into cDNA was used as a control to rule contamination of the RNA samples by DNA (Fig. 4, lane 1). Transfection of cells with V12H-ras increased the
895
Vol. 270, No. 3, 2000
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
that Ras signalling also increases the stability of the endogenous uPAR mRNA. DISCUSSION
FIG. 4. RT-PCR analysis of the effects of constitutively-activate V12 H-ras and rhoA on endogenous uPAR mRNA levels in NIH 3T3 cells. Cells were transfected with 2 g of plasmid encoding constitutively activated V12 H-ras or rhoA and maintained for 48 h in DMEM/0.5% FCS before the isolation of total RNA. Lane M shows the position of HaeIII cut X 174 DNA size markers. Lane 1 shows the amplification products generated from a pool of RNA from all the samples in the absence of a reverse transcription reaction. This was a control to detect the presence of contaminating DNA in the samples. Lane 2 shows the level of endogenous uPAR mRNA in mocktransfected cells. Lanes 3 and 4 show the uPAR amplification products generated after cells were transfected with either constitutively active rhoA or V12 H-ras respectively. Lanes 5–7 show the amplification products of glyceraldehyde 3 phosphate dehydrogenase from the same RNA extracts used to generated the PCR products in lanes 2– 4. These act as controls to ensure that equivalent amounts of RNA were used in each RT-PCR reaction.
amount of uPAR mRNA levels 2.8 fold above that of untransfected cells. This figure is apparently in close agreement with the increase in transcription from the human uPAR promoter (4-fold). However, the actual increase in uPAR mRNA levels within NIH3T3 cells must be greater, approximately 30-fold, since, at best, only 10% of the cells were transfected using the calcium phosphate methodology and as such only represent a small proportion of the cells from which RNA was isolated. The transfection efficiency in these experiments was estimated by counting the percentage of fluorescent NIH3T3 cells within a field of vision in transfections using the GFP expression vector pEGFP-N1 (Clontech) (data not shown). In contrast with the increase in uPAR mRNA in response to transfection with constitutively active Ras, no increase in murine uPAR mRNA levels could be detected after transfection of NIH3T3 cells with constitutively active L63RhoA despite having previously determined that constitutively active RhoA also stimulates transcription from the uPAR promoter. The failure to detect a change mRNA levels may be due to the RT-PCR assay being insufficiently sensitive to detect a two fold change in transcription of the uPAR gene in the small proportion of the cells that were transfected with L63RhoA. Although we can not rule out the possibility that additional sequences in the murine uPAR promoter that are missing from the human uPAR-reporter construct are responsible for the large increase in endogenous uPAR mRNA in response to Ras, it is likely
The small GTP-binding proteins Ras, RhoA, Rac1 and Cdc42Hs act as downstream effectors of integrin signalling to affect the dynamic reorganisation of the actin-based cytoskeleton and activated intracellular signalling cascades [19, 41]. Potentially, changes in the activation state of these small GTP binding proteins could serve to co-ordinate changes in cell adhesion with extracellular proteolysis by affecting the transcription of genes associated with these events. To explore this hypothesis, we focussed on how signalling from small GTP-binding proteins affect transcription of the urokinase receptor gene (uPAR). The urokinase receptor plays a key role in extracellular proteolysis and cell migration [2]. Like many of the genes that encode proteins involved in extracellular proteolysis, including those of metalloproteinases and uPA, the 1.55 kb promoter region of the human uPAR gene contains AP1 and PEA3 DNA response elements located in the promoter elements of their genes [42, 43]. These response elements constitute the prototypical Rasresponsive element and are bound by the ubiquitously expressed polypeptides that comprise the transcription factor AP-1 and by members of the Ets family of transcription factors. Members of the AP1 family of transcription factors are activated by JNK/stress-activated protein kinase (SAPK) and p38 MAP kinases cascades that signal downstream of RhoA GTPases while ETS family transcription factors are subject to regulation by the Ras-MAPK pathway [44]. The 1.55 kb promoter region of the uPAR gene contains consensus DNA response elements for these transcription factors [42] and is therefore potentially subject to regulation by all of these signalling pathways. We found that constitutively activate mutants of H-Ras and RhoA, were able to stimulate transcription from DNA response elements contained within 1.55 kb of the major transcription initiation site of the human uPAR promoter. The ability of the constitutively active Ras mutant to stimulate uPAR transcription is consistent with the observations that transformation of human fibroblasts with oncogenic Ras correlates with increased activity of receptor-bound plasminogen activator [45] and that the targeted disruption of the K-ras oncogene reduces uPAR gene expression and the degradation of extracellular laminin [46]. Cumulatively, these findings indicate that members of the Ras family play a key role in the regulation of uPAR gene expression in vivo and that DNA response element(s) that can be utilised by Ras-mediated signalling are located within 1.55 kb of the major start point of transcription. We further investigated the mechanism of Ras signalling by using constitutively active and dominant neg-
896
Vol. 270, No. 3, 2000
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
ative mutants of c-Raf 1, the best-characterised effector of Ras that leads to the activation of the MAPK pathway. We found that c-Raf 1 was neither necessary nor sufficient for the Ras-mediated activation of uPAR gene transcription indicating that H-Ras utilises alternative effector molecules to activate transcription. Using H-Ras effector-domain mutants that permit Ras to interact selectively with the effector molecules cRaf1, PI3K or RalGDS [33, 34, 36 –38]. We were able to demonstrate that uPAR transcription required the activation of multiple Ras effectors for maximal stimulation. Interestingly the activation of the Ras-effector RalGDS appeared to be the most efficient in activating uPAR transcription. RalGDS is a guanine nucleotide exchange factor for the small GTP-binding proteins RalA and RalB, and two distant relatives Rgl and Rlf. Ras and Ral activate intracellular signalling cascades require various degrees of interdependency. So far little is known about how the activation of these GTPbinding proteins mediate their effects [47]. Of the Rho-family members tested, only RhoA was able to stimulate transcription from the uPAR promoter. Rho-A signalling results in the activation of serum response factor (SRF) dependent transcription and activates the transcription factor NFB [28, 48]. The 1.55 kb uPAR promoter contains only a consensus binding site for NFB and this therefore potentially represents the DNA response element utilised in RhoA-mediated activation of uPAR gene transcription. In our work neither constitutively activate Rac nor Cdc42 mutants stimulated transcription from the uPAR promoter. As Ras is a potent activator of Rac [22, 35] this would suggest that H-Ras does not utilise Rac as an effector in activating uPAR gene transcription. In addition, Rac and Cdc42 have been reported to be activators of the JNK/SAPK and p38 MAP kinase signalling pathways (REF). The failure of constitutively active mutants of Rac and Cdc42 to stimulate transcription from the uPAR promoter would suggest that these signalling pathways do not activate uPAR transcription in NIH3T3 cells. This result contrasts with the earlier findings that the JNK signalling pathway stimulates transcription from a 398 bp uPARpromoter fragment ovarian cancer cell line OVCAR-3 [49]. As this JNK-response element is contained within the promoter fragment used in this work, this may indicate that the importance of a specific signalling pathway in regulating transcription is altered by the activity of endogenous signalling pathways in different cell types. In addition to activating transcription of the uPAR in NIH3T3 cells, constitutively active Ras appeared to increase endogenous uPAR mRNA levels to a greater level than could accounted for by increase in transcription alone. The stabilisation of uPAR mRNA by oncogenic Ras, a frequent occurrence in transformed cells, would serve to augment uPAR expression and is con-
sistent with the elevated levels of uPAR expression often found in transformed cells [2]. The mechanism by which uPAR mRNA is stabilised in response to constitutively active H-Ras remains to be explored but may involve the nonameric destabilising-sequence UUAUUUAUU in the 3⬘ untranslated region of uPAR mRNA [40]. Interestingly, in T-cells, the destabilising effect of this element is overcome by LFA-1 engagement [40]. It is tempting to speculate that Rasmediated signalling functioning down stream of the integrin engagement may be involved in this process. However, this may not be the only stability element involved as the dissociation of a destabilising protein from the coding region of uPAR mRNA that has been reported to increase the stability of uPAR mRNA in response to signals generated by inflammatory mediators [39]. In conclusion it is clear that H-Ras and RhoA can activate transcription from response elements contained within the 1.55 kb promoter fragment while the other RhoA family members that affect the organisation of the actin-based cytoskeleton do not. The requirement for multiple Ras effectors to maximally stimulate uPAR gene expression is intriguing. This may be indicative of the existence of a mechanism whereby fine control can be exerted on uPAR gene expression in response to the large variety of signals that converge on Ras. Physiologically, it is possible that different Ras effectors are utilised at different stages of cell development to regulate uPAR transcription. Elucidation of how these signalling pathways converge at the uPAR will have a significant impact on identifying how extracellular events influence uPAR gene expression. ACKNOWLEDGMENTS The authors thank Professor P. E. Shaw (University of Nottingham) for his helpful discussions regarding mechanisms of intracellular signal transduction. S. M. Muller and E. Okan were supported by a grant from the European Social Fund.
REFERENCES
897
1. Stahl, A., and Muller, B. M. (1994) Cancer Res. 54, 3066 –3071. 2. Andreasen, P. A., Kjøller, L, Christensen, L., and Duffy, M. J. (1997) Int. J. Cancer 72, 1–22. 3. Crowley, C. W., Cohen, R. L., Lucas, B. K., Liu, B. K., Shuman, M. A., and Levinson, A. D. (1993) Proc. Natl. Acad. Sci. USA 90, 5021–5025. 4. Kook, Y. H., Adamski, J., Zelent, A., and Ossowski, L. (1994) EMBO J. 13, 3983–3991. 5. Quattrone, A., Fibbi, G., Anichini, E., Pucci, M., Zamperini, A., Capaccioli, S., and Del Rosso, M. (1995) Cancer Res. 55, 90 –95. 6. Min, H. Y., Doyle, L. V., Vitt, C. R., Zandonella, C. L., StrattonThomas, J. R., Shuman, M. A., and Rosenburg, S. (1996) Cancer Res. 56, 2428 –2433. 7. Wei, Y., Walz, D. A., Rao, N., Drummond, R. J., Rosenburg, S., and Chapman, H. A. (1994) J. Biol. Chem. 269, 32380 –32388.
Vol. 270, No. 3, 2000
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
8. Waltz, D. A., Natkin, L. R., Fijita, R. M., Wei, Y., and Chapman, H. A. (1997) J. Clin Invest 100, 58 – 67. 9. Xue, W., Mizukami, I., Todd, R. F., III, and Petty, H. R. (1997) Cancer Res. 57, 1682–1689. 10. Kindzelskii, A. L., Laska, Z. O., Todd, R. F., III, Petty, H. R. (1996) J. Immunol. 156, 297–309. 11. Kindzelskii, A. L., Eszes, M. M., Todd, R. F., and Petty, H. R. (1997) Biophys. J. 72, 1777–1784) 12. Tang, H., Kerins, D. M., Hao, Q., Inagami, T., and Vaughan, D. E. (1998) J. Biol. Chem. 273, 18268 –18272. 13. Nguyen, D. H., Hussaini, I. M., and Gonias, S. L. (1998) J. Biol. Chem. 273, 8502– 8507. 14. Nguyen, D. H., Catling, A. D., Webb, D. J., Sankovic, M. Walker, L. A., Somylo, A. V., Weber, M. J., and Gonias, S. L (1999) J. Cell Biol. 146, 149 –164. 15. Dumlar, I., Weis, A., Mayboroda, O. A., Maasch, C., Jerke, U., Haller, H., and Gulba, D. C. (1998) J. Biol. Chem. 273, 315–321. 16. Kolshelnick, Y., Ehart, M., Hufnagl, P., Heinrich, P. C., and Binder, B. R. (1997) J. Biol. Chem. 272, 28563–28567. 17. Fazioli, F., Resnati, M., Sidenius, N., Higashimoto, Y., Appella, E., and Blasi, F. (1997) EMBO J. 16, 7279 –7286. 18. Miyamoto, S., Teramoto, H., Coso, O. A., Gutkind, J. S., Burbelo, P. D., Akiyama, S. K., and Yamada, K. M. (1995) J. Cell Biol. 131, 791– 805. 19. Howe, A., Aplin, A. E., Suresh, K. A., and Juliano, R. L. (1998) Curr. Opin. Cell Biol. 10, 220 –231. 20. Assoian, R. K. (1997) J. Cell Biol. 136, 1– 4. 21. Ridley, A. J., and Hall, A. (1992) Cell 70, 389 –399. 22. Ridley, A. J., Paterson, H. F., Johnston, C. L., Diekmann, D., and Hall, A. (1992) Cell 70, 401– 410. 23. Hotchin, N. A., and Hall, A. (1995) J. Cell Biol. 131, 1857–1865. 24. Nobes, C. D., and Hall, A. (1995) Cell 81, 53– 62. 25. Clark, E. A., Warren, G. K., Brugge, J. S,. Symons, M., and Hynes, R. O. (1998) J. Cell Biol. 142, 573–586. 26. Clark, E. A., and Hynes, R. O. (1996) J. Biol. Chem. 271, 14814 – 14818. 27. Schlaepfer, D. D., and Hunter, T. (1997) J. Biol. Chem. 272, 13189 –13195. 28. Hill, C. S., Wynne, J., and Triesman, R. (1995) Cell 81, 1159 –1170. 29. Coso, O. A., Chiariello, M., Yu, J. C., Teramoto, H., Crespo, P., Xu, N., Miki, T., and Gutkind, J. S. (1995) Cell 81, 1137–1146
30. Minden, A., Lin, L., Claret, F X., Abo, A., and Karin, M. (1995) Cell 81, 1147–1157. 31. Bagrodia, S., Derijard, B., Davis, R. J., and Cerione, R. A. (1995) J. Biol. Chem. 270, 27995–27998. 32. Frost, J. A., Steen, H., Shapiro, P., Lewis, T., Ahn, N., Shaw, P. E., and Cobb, M. H. (1997) EMBO J. 16, 6426 – 6438. 33. White, M. A., Nicolette, C., Minden, A., Polverino, A., Van Aelst, L., Karin, M., and Wigler, M. H. (1995) Cell 80, 533–541. 34. Rodriguez-Viciana, P., Warne, P. H., Khwaja, A., Marte, B. M., Pappin, D., Das, P., Waterfield, M. D., Ridley, A., and Downward, J. (1997) Cell 89, 457– 467. 35. Campbell, S. L., Khosravi-Far, R., Rossman, K. L., Clark, G. J., and Channing, J. Der. (1998) Oncogene 17, 1395–1413. 36. Webb, C. P., Van Aelst, L., Wigler, M. H., and Vande Woude, G. F. (1998) Proc. Natl. Acad. Sci. USA 95, 8773– 8778. 37. Kauffman-Zeh, A., Viciana, P. R., Ulrich, E., Gilbert, C., Coffer, P., Downward, J., and Even, G. (1997) Nature 385, 544 –548. 38. Yang, J-J., Kang, J-S., and Krauss, R. S. (1998) Mol. Cell Biol. 18, 2586 –2595. 39. Shetty, E. A., Kumar, A., and Idell, S. (1997) Mol. Cell Biol. 17, 1075–1083. 40. Wang, G. J., Collinge, M., Blasi, F., Pardi, R., and Bender, J. R. (1998) Proc. Natl. Acad. Sci. USA 95, 6296 – 6301. 41. Mackay, D. J. G., and Hall, H. (1998). Rho GTPases. J. Biol. Chem. 273, 20685–20688. 42. Soravia, E., Alexandra, G., De Luca, P., Helin, K., Suh, T. T., Degan, J. L., and Blasi, F. (1995) Blood 86, 624 – 635. 43. Westermark, J., and Kahari, V. M (1999) FASEB J. 8, 781–792. 44. Waslyk, B., Hagman, J., and Gutierrez-Hartmann, A. (1998) Trends Biochem. Sci. 23, 213–216. 45. Jankun, J., Maher, V., and McCormick, J (1991) Cancer Res. 51, 1221–1226. 46. Allagayer, H., Wang, H., Shirasawa, S., Sasazuki, T., and Boyd, D. (1999) Br. J. Cancer 80, 1884 –1891. 47. Bos, J. L. (1998) EMBO J. 17, 6776 – 6782. 48. Sulciner, D. J., Irani, K,. Yu, Z. X., Ferrans, V. J., GoldschmidtClermont, P., and Finkel, T. (1996) Mol. Cell Biol. 16, 7115– 7121. 49. Gum, R., Juarez, J., Allegayer, H., Mazar, A., Wang, Y., and Boyd, D. (1998) Oncogene 17, 213–225.
898