Regulatory roles of nitric oxide during larval development and metamorphosis in Ciona intestinalis

Developmental Biology 306 (2007) 772 – 784 www.elsevier.com/locate/ydbio

Regulatory roles of nitric oxide during larval development and metamorphosis in Ciona intestinalis Stefania Comes a , Annamaria Locascio a , Francesco Silvestre b , Marco d'Ischia c , Gian Luigi Russo d , Elisabetta Tosti b , Margherita Branno a , Anna Palumbo a,⁎ Biochemistry and Molecular Biology Laboratory, Stazione Zoologica “Anton Dohrn”, Villa Comunale, 80121 Naples, Italy b Cell Biology Laboratory, Stazione Zoologica “Anton Dohrn”, Villa Comunale, 80121 Naples, Italy c Department of Organic Chemistry and Biochemistry, University of Naples “Federico II”, Via Cinthia, 80126 Naples, Italy d Institute of Food Sciences, National Research Council, 83100 Avellino, Italy

a

Received for publication 23 October 2006; revised 11 April 2007; accepted 16 April 2007 Available online 21 April 2007

Abstract Metamorphosis in the ascidian Ciona intestinalis is a very complex process which converts a swimming tadpole to an adult. The process involves reorganisation of the body plan and a remarkable regression of the tail, which is controlled by caspase-dependent apoptosis. However, the endogenous signals triggering apoptosis and metamorphosis are little explored. Herein, we report evidence that nitric oxide (NO) regulates tail regression in a dose-dependent manner, acting on caspase-dependent apoptosis. An increase or decrease of NO levels resulted in a delay or acceleration of tail resorption, without affecting subsequent juvenile development. A similar hastening effect was induced by suppression of cGMP-dependent NO signalling. Inhibition of NO production resulted in an increase in caspase-3-like activity with respect to untreated larvae. Detection of endogenously activated caspase-3 and NO revealed the existence of a spatial correlation between the diminution of the NO signal and caspase-3 activation during the last phases of tail regression. Real-time PCR during development, from early larva to early juveniles, showed that during all stages examined, NO synthase (NOS) is always more expressed than arginase and it reaches the maximum value at late larva, the stage immediately preceding tail resorption. The spatial expression pattern of NOS is very dynamic, moving rapidly along the body in very few hours, from the anterior part of the trunk to central nervous system (CNS), tail and new forming juvenile digestive organs. NO detection revealed free diffusion from the production sites to other cellular districts. Overall, the results of this study provide a new important link between NO signalling and apoptosis during metamorphosis in C. intestinalis and hint at novel roles for the NO signalling system in other developmental and metamorphosis-related events preceding and following tail resorption. © 2007 Elsevier Inc. All rights reserved. Keywords: Ciona intestinalis; Nitric oxide; Metamorphosis

Introduction Ciona intestinalis is currently recognised as a valuable model system for understanding chordate evolution and development (Passamaneck and Di Gregorio, 2005). This ascidian and many of its relatives presents a spectacular metamorphosis by which the non-feeding, mobile larva is transformed into a filter feeding, fixed juvenile through a profound reconstruction of the body plan and a remarkable ⁎ Corresponding author. E-mail address: [email protected] (A. Palumbo). 0012-1606/$ - see front matter © 2007 Elsevier Inc. All rights reserved. doi:10.1016/j.ydbio.2007.04.016

resorption/regression of the tail. During the free swimming period, Ciona larva develops passing through different stages: early, middle and late according to Chiba et al. (2004). At late stage, larva becomes competent, it acquires the ability to sense, discriminate and respond to environmental cues that induces settlement and/or metamorphosis. Metamorphosis begins when larva sticks to a suitable substrate by the adhesive papillae, next the tail is retracted and resorbed. Then the larva rotates the body axis and begins tissue remodelling. The process involves numerous coordinated morphogenetic movements and physiological changes by which the larval tissues are destroyed or remodelled and eventually replaced by adult tissues and organs

S. Comes et al. / Developmental Biology 306 (2007) 772–784

(Cloney, 1978, 1982; Jeffery and Swalla, 1997; Swalla, 2004). A detailed description of the development of tissues and organs in larvae and juveniles has been recently carried out (Chiba et al., 2004). A wide variety of environmental stimuli (Jackson et al., 2002) and endogenous signals (Patricolo et al., 1981) have been reported to induce metamorphosis. Recently, considerable interest has been focused to the isolation and characterisation of the genes that are expressed during ascidian metamorphosis. In H. curvata a novel epidermal growth factor-like protein, Hemps, has been found to play a key role in the regulation of metamorphosis (Eri et al., 1999; Woods et al., 2004). Interestingly, no Hemps homologues can be found in Ciona genome (Dehal et al., 2002), thus suggesting significant differences in the genetic networks operating at metamorphosis in different ascidians. In Ciona some genes have been shown to be involved in the initiation of metamorphosis. Among these, six genes Ci-meta1-Cimeta6 have been reported, but none of these is expressed in the tail before and during its resorption (Nakayama et al., 2001, 2002). Moreover, two other genes have been recently identified, Ci-Sccpb and Ci-sushi, which are expressed at the tip of the tail and in tail epithelia, respectively (Chambon et al., 2007). Apoptotic processes play an important role during the sequential events leading from hatching to metamorphosis of Ciona larvae (Chambon et al., 2002; Tarallo and Sordino, 2004; Baghdiguian et al., 2007). In particular, two apoptotic waves occur, at first in the central nervous system and soon after in the tail. The second wave originates at the tail extremity, propagates through cell to cell up to the tail base, promoting caspase-3-dependent apoptosis of tunic, epidermis, striated muscle and notochord cells (Chambon et al., 2002; Baghdiguian et al., 2007). It has been recently reported that the MAP kinases ERK and JNK are both required for the wave of apoptosis and metamorphosis in Ciona (Chambon et al., 2007). Moreover, a model of metamorphosis has been proposed in which JNK activity in the CNS induces apoptosis in several adjacent tail tissues by expression of genes such as Ci-sushi (Chambon et al., 2007). Nitric oxide (NO), a pluripotent physiological messenger produced by oxidation of L-arginine catalysed by the enzyme NO synthase (NOS), is known to be involved at different levels and with different mechanisms in apoptosis (Chung et al., 2001; Brune, 2003). Notably, the NO/cGMP signalling pathway, together with the stress-inducible protein HSP90, have been shown to be involved in the metamorphosis of the ascidians Boltenia villosa and Cnemidocarpa finmarkiensis (Bishop et al., 2001). Treatment of ascidian hatched larvae with NOS and guanylyl cyclase inhibitors, as well as with drugs that inhibit the function of HSP90, increased the frequency of tail resorption (Bishop et al., 2001). NOS is expressed in the tail muscle cells of the ascidian larvae and it has been suggested that the NO/cGMP signalling regulates metamorphosis possibly in combination with HSP90 acting on NOS activity (GarciaCardena et al., 1998; Bender et al., 1999). In C. intestinalis NO has been shown to gate ion channels in the mature oocytes (Grumetto et al., 1997), but no evidence has so far been gained

773

as to its possible involvement in development and metamorphosis of this ascidia. Our current interest in the physiological functions of NO in invertebrates (Palumbo, 2005; Palumbo and d'Ischia, 2007) has prompted us to examine the spatial and temporal expression of NOS as well as the localisation and possible role of NO during larval development and metamorphosis-related events in C. intestinalis. We show for the first time that NO is a critical endogenous regulator of tail regression acting on caspase-mediated apoptosis. Materials and methods Animals, embryos and incubation experiments Adult C. intestinalis were collected in the Bay of Naples and kept in tanks with running sea water until use. Metaphase I-arrested oocytes, obtained from the oviducts, were kept in normal sea water at 18 °C. Spermatozoa were collected with a fine Pasteur pipette from the sperm duct and diluted in seawater immediately before insemination. For fertilisation, spermatozoa were added to the fertilisation bath at a final concentration of 1 × 106/ml. Embryos were cultured at 18 °C in 0.2 μm filtered sea water. Under these conditions, just hatched larvae (early larvae) were obtained about 18–20 h after fertilisation. Development was followed with an Olympus stereomicroscope. Samples at appropriate stages were identified using the morphological criteria reported by Chiba et al. (2004) and were selected on the basis of at least 95% homogeneity. The samples were collected by low speed centrifugation and the pellets were frozen for RNA and protein extraction or fixed for whole-mount in situ hybridisation. When necessary, early larvae were treated in sea water at 18 °C with the following modifiers of NO signalling, at the final concentrations indicated in the text: Nω-nitro-L-arginine (L-NA), Nω-nitro-D-arginine (D-NA), 1H-[1,2,4]oxadiazolo[4,3-a]quinoxalin-1-one (ODQ), Nω-hydroxy-nor-L-arginine (nor-NOHA) and 2-(N,N-diethylamino)-diazenolate-2-oxide (DEA/NO). Each in vivo experiment was performed using more than 1000 larvae and repeated the times as indicated in the figure legends.

RNA extraction and cDNA preparation Total RNA was extracted from each developmental stage using the Promega Kit SV Total RNA Isolation System (Promega), according to instructions of the manufacturer. Total RNA concentration was determined by UV spectrophotometry at A260, its quality was analysed by 2% ethidium bromide agarose gel electrophoresis and its purity was estimated spectrophotometrically from the relative absorbancies A260/A280 and A260/A230. First-strand cDNA was synthesised using 1 μg total RNA, random hexamers and the Taq Man kit (PE Biosystems).

Real-time PCR Real-time PCR was performed using a Chromo 4 sequence detection system and SYBR Green chemistry (PE Biosystems). Specific primer sets for each gene were designed on the basis of the recently sequenced C. intestinalis genome (http://genome.jgi-psf.org; Dehal et al., 2002) using the program Primer3 (http:// frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi). The following primers were used: NOS forward, 5′ AGAGTGAAAGCCTGTCGCATA 3′; NOS reverse, 5′ AACCAATGCGGTGGTTGTAG 3′; ARGINASE forward, 5′ GAAATGGGGTCAAGCCTAAA 3′; ARGINASE reverse, 5′ GTATGCGTATTTGCCCCAGT 3′; RP-S27 forward, 5′ AATCCACCCTTCACCTTGTG 3′; RP-S27 reverse, 5′ GGGAGATCTTGCCATTTTCA 3′. Reactions were carried out at least in triplicates in 96-well optical reaction plates in different runs. The real-time PCR mixture, in the final volume of 25 μl, contained 2 μl of cDNA (dilution 1:2 of starting material), 12.5 μl of SYBR Green PCR master mix (Applied Biosystem) and 10.5 μl of specific primer pairs (7.5 pmol). The following experimental run protocol was used: denaturation program (95 °C for 10 min) and 40 cycles of amplification (15 s at 95 °C and

774

S. Comes et al. / Developmental Biology 306 (2007) 772–784

1 min at 60 °C). Specificity of every amplification reaction was verified by melting curve analysis. PCR efficiencies were calculated for reference and target genes and were found to be 2. For all experiments, raw data output were internally normalised against the ribosomal protein S-27 (RP-S27) mRNA, whose expression levels remain constant during all the developmental stages examined (not shown) according to Olinski et al. (2006). Real-time PCR results are reported as percent of the maximum value. Percent of the maximum indicates the percentage of expression of each sample as compared to the maximum level of expression found, which corresponds to NOS expression in unfertilised eggs. The formula used is 2ΔCt/ΔCtmax, where 2 is the multiplier for amplification per PCR cycle, ΔCt is the cycle threshold difference with RP-S27 found for that sample, ΔCtmax is the cycle threshold difference between RP-S27 and NOS found in the egg sample.

NO detection NO localisation was performed using 4-amino-5-methylamino-2′,7′-difluorofluorescein diacetate (DAF-FM-DA) (Molecular Probes). Larvae and juveniles (about 150–200 each experiment) at different stages were incubated in the dark with 5 μM DAF-FM-DA in sea water for 20 min. Subsequently, they were washed and incubated in sea water for 30 min to allow complete deesterification of intracellular diacetates. When required, early larvae were treated with 1 mM L-NA or 1 mM nor-NOHA at 18 °C for the time necessary to observe a morphological difference in tail retraction respect to the control (about 6–8 h). The larvae were then treated with DAF-FM-DA as reported above. Each experiment was repeated at least 5 times. The fluorescence was visualised with a Zeiss AxioImager.M1 fluorescence microscope equipped with a filter λEXC = 470 ± 40, λEM = 525 ± 50.

In situ hybridisation Poly(A)+RNA was extracted from early larva stage using FastTrack™ 2.0 mRNA isolation kit (Invitrogen) and cDNA synthesis was performed using SuperScript first strand synthesis system kit (Invitrogen), according to manufacturer's instructions. The cDNA was used as template for NOS amplification with the following PCR primer pairs designed on the basis of annotated Ciona NOS genomic sequence (genewise.674.4.1; Dehal et al., 2002): NOS forward, 5′CTGGAGATCATCTAGGTATCTATCC3′; NOS reverse, 5′CGTATGATTCACTTATGCGACAGGC3′. The PCR product corresponding to a fragment of 1192 bp was purified and cloned using Topo TA Cloning kit (Invitrogen). The clone was used to prepare sense and antisense probes by DIG RNA labelling kit (Roche Dignostics). Larvae and juveniles at different stages were fixed with 4% paraformaldehyde in 0.1 M MOPS pH 7.5, 0.5 M NaCl for 90 min at room temperature. Whole-mount in situ hybridisation was performed as previously described (Locascio et al., 1999) with the following modifications: the concentrations of proteinase K (Roche) for early/ middle/late larvae, larvae during metamorphosis and juveniles were 0.8, 0.7 and 0.85 μg/ml, respectively, and the hybridisation was carried out for larvae at 55 °C with 0.4 μg/ml of probe and for juveniles at 48 °C with 0.2 μg/ml of probe.

Caspase-3 detection The localisation of activated caspase-3 was performed using the caspase-3 detection kit (Calbiochem). Larvae (150–200 each experiment) at different stages were incubated in 1 ml of sea water with 8 μl of Red-DEVD-FMK for 1 h at room temperature. Subsequently, they were washed in sea water for 30 min and the fluorescence was visualised using a rhodamine filter. Each experiment was repeated at least 5 times.

Assay for caspase-3-like activity Caspase-3-like activity was determined using as substrate the specific peptide recognised by the human enzyme (Alexis Biochemicals). Briefly, early larvae were treated with 20 μM L-NA in sea water, for the time necessary to observe a morphological difference in tail retraction respect to the control (about 6–8 h). Larvae were then rapidly pelleted, resuspended in lysis buffer (100 mM

HEPES, pH 7.4, 20% glycerol, 0.5 mM EDTA, 5 mM dithiotreitol, 1 mM phenylmethylsulphonylfluoride, 10 μg/ml pepstatin A, 10 μg/ml aprotinin, 20 μg/ml leupeptin) and sonicated twice for 20 s at 20% of the maximum potency with a Sonifier 250 (Branson Ultrasonic Corporation). Samples were centrifuged at 14000 rpm in microfuge for 10 min at 4 °C; protein concentration was determined on supernatants before storage at − 80 °C until caspase-3-like measurement. Extracts were added with caspase-3 reaction buffer and conjugated amino-4-trifluorometyl coumarin (AFC) substrate carbobenzoxyAsp-Glu-Val-Asp-7-amino-4-trifluoromethyl coumarin (Z-DEVD-AFC) and then incubated at 37 °C for 30 min, accordingly to the manufacturer's instructions (Alexis Biochemicals). Upon proteolytic cleavage of the substrate by endogenous caspase-3-like, the free fluorochrome AFC was detected by a spectrofluorimeter (Perkin Elmer LS 50B) with excitation and emission setting of 395 nm and 530 nm, respectively. To quantify enzymatic activities, an AFC standard curve was determined. Caspase specific activities were calculated as nanomoles of AFC produced/min/μg proteins at 37 °C at saturating substrate concentrations (50 μM), as indicated by the manufacturer's instructions.

Results NOS and arginase are differentially expressed during larval and first stages of juvenile development NOS activity in the biological systems is regulated by several factors (Stuehr, 2004) including the availability of the substrate L-arginine. This in turn depends on the activity of other enzymes that utilise the same substrate, including arginase, which converts arginine into ornithine. The role of arginase as key modulator of NO synthesis via regulation of the L-arginine bioavailability is amply documented (Hecker et al., 1995; Li et al., 2001; Berkowitz et al., 2003; Maarsingh et al., 2005). Accordingly, we examined the temporal expression of NOS and arginase mRNAs during larval and first stages of juvenile development. Using NOS and arginase sequences from different sources both genes have been identified in the recently sequenced C. intestinalis genome (http://genome. jgi-psf.org, Dehal et al., 2002). At variance with the mammalian genome, in which three distinct NOS genes are present, for the neuronal, endothelial and inducible isoforms (Alderton et al., 2001; Ghosh and Salerno, 2003), Ciona genome contains only one NOS gene (genewise.674.4.1) which shows an identity of 53% with the human neuronal isoform (Hall et al., 1994), 50% with the human endothelial isoform (Strausberg et al., 2002) and 47% with the human macrophagic isoform (Adams et al., 1998). The actual relationship of Ciona NOS with the mammalian isoforms is currently under investigation and will be reported in due course. Arginase, which is present in mammals as two isoforms encoded by two different genes (Wu and Morris, 1998), occurs in Ciona genome as a unique gene (ci0100135911) with 45% and 49% identity with human I and II isoforms (Strausberg et al., 2002). The expression profiles of NOS and arginase mRNAs were determined by realtime PCR using specific primers designed on the predicted gene sequences. Fig. 1 shows the results obtained for eggs, early, middle, late larvae, larvae during metamorphosis and early/late rotation juveniles. The data were normalised using as endogenous reference the gene which encodes RP-S27, whose expression remains constant in all the stages examined (not shown)

S. Comes et al. / Developmental Biology 306 (2007) 772–784

Fig. 1. Temporal expression of NOS and arginase mRNAs during larval development. mRNA levels were measured by real-time PCR from cDNA templates prepared from eggs, larvae and juveniles at the indicated developmental stages. Data were normalised versus RP-S27 Cts and results were reported as percent of the NOS maximum value found in the eggs, as described in materials and methods. E, eggs; EL, early larva; ML, middle larva; LL, late larva; LM, larva during metamorphosis; JRS, juveniles at early/late rotation stage. Data are expressed as means ± SD.

according to Olinski et al. (2006). Both NOS and arginase are present as maternal transcripts. NOS shows the maximum expression in the eggs. Its expression significantly changes during larval development, it decreases from early to middle larva stage. Then, it increases reaching a value of 94% of the maximum at late larva, the stage that immediately precedes tail resorption. At later stages, NOS mRNA expression decreases reaching the lowest value at early/late rotation juveniles. In the eggs arginase mRNA expression level is 61% with respect to that of NOS. During all stages examined arginase mRNA is always less expressed than NOS and moreover its expression progressively decreases from early swimming larvae to early/ late rotation juveniles (Fig. 1). Spatial expression pattern of NOS during larval and first stages of juvenile development and NO detection The spatial pattern of cellular expression of NOS during larval and early stages of juvenile development was analysed by whole-mount in situ hybridisation experiments. On the basis of genomic sequence (http://genome.jgi-psf.org; Dehal et al., 2002), a cDNA clone of 1192 bp was prepared by PCR amplification and used as a template to prepare DIG-UTPlabelled antisense and sense riboprobes. In Fig. 2, a remarkable dynamic expression of NOS mRNA can be observed at all stages examined. In the early larva (Fig. 2A), the expression of NOS gene is restricted to the anterior portion of the trunk, laterally to future palps, both in the ventral and dorsal epidermis, as shown in the semithin transverse section (Fig. 2B). In the early–middle larva, the signal is still present in the anterior part of the trunk and a new signal appears in the posterior part of the sensory vesicle (Fig. 2C). In the middle larva NOS expression tends to disappear from the anterior trunk and extends in the posterior part of the sensory vesicle where the signal is visible in a series of cells arranged in a circle (Fig. 2D). A new signal appears in the fibres that

775

starting from the sensory vesicle pass through out the neck and arrive to the visceral ganglion. In the late larva, the stage that immediately precedes tail regression, the signal is no more present in the CNS and it is exclusively localised in the central part of the tail (Fig. 2E) at the level of epidermis (Fig. 2F). The signal is absent in the anterior end of the tail as well as in its terminal portion (Fig. 2G). During all stages of tail resorption, NOS continues to be expressed in the tail (Fig. 2H) exclusively in the epidermis, as revealed by transverse sections (data not shown). In particular, a very strong signal is visible in the second half of the tail at the level of its extremity where a ring of expression is visible (Fig. 2H). After complete tail retraction, at late rotation juvenile stage, a new signal localised along the just formed digestive organs (esophagus, stomach and intestine) appears (Fig. 2I). Hybridisation with NOS sense probe at larva and juvenile stages did not produce any specific signal (Figs. 2J and K). Next, the endogenous NO localisation during development was evaluated using DAF-FM-DA, the most sensitive cell permeable and non-fluorescent reagent that combines with NO to form a fluorescent benzotriazole (Kojima et al., 1999). At the late larva stage, NO is present in the posterior part of the sensory vesicle (Fig. 3A) and along the tail at level of muscle cells (Fig. 3C). NO detection in muscle cells is confirmed overlaying fluorescence and bright-field images (Fig. 3D). At this stage of development the NO signal can be also observed in the epidermis, where NO is produced, and in the notochord cells, where the gas rapidly diffuses (Fig. 3E). At the initial tail regression stage, a strong, diffuse NO signal is visible at the tail extremity (Fig. 3F) corresponding to a region where the apoptotic wave starts (Chambon et al., 2002). A strong fluorescence is also present along the tail in the epidermis and in the notochord cells (Fig. 3F). During all phases of tail regression the NO signal seems to decrease and it is more visible at the tail tip, whereas that in the sensory vesicle disappears (Fig. 3G). In the early juvenile, when tail regression is almost completed, NO is detectable in the intestine disc from which the new forming digestive organs, esophagus, stomach and intestine are developing (Fig. 3I). Modulation of NO levels in larvae affects tail resorption To assess the involvement of NO in metamorphosis, different approaches were used that either decrease or increase NO levels. To reduce endogenous NO, early larvae were treated with the NOS inhibitor, L-NA, at different concentrations. After 24 h the control exhibits a 60% of late larvae or larvae during tail resorption and 40% of juveniles at early rotation stage. At 0.1 μM concentration, L-NA induces a significant increase of juveniles (62%) (Fig. 4). The effect increases at higher L-NA concentrations reaching the plateau at 1 μM concentration. Examination of the treated larvae at longer incubation times shows that NOS inhibition accelerates metamorphosis and does not affect subsequent juvenile development. As a control, D-NA, which is inactive on NOS, did not affect the process, indicating that the effects of added L-NA were related to inhibition of NOS. Use of

776

S. Comes et al. / Developmental Biology 306 (2007) 772–784

S. Comes et al. / Developmental Biology 306 (2007) 772–784

777

Fig. 3. Detection of endogenous NO in Ciona larvae and early juveniles using the NO-specific indicator DAF-FM-DA. (A, C, E–G, I) Fluorescence images, (B, H, J) bright-field images of the same larvae (lateral views) and early juveniles. (D) Overlay of fluorescence and bright-field images. (A) High magnification of a late larva trunk showing fluorescence in the posterior part the sensory vesicle. (C) Late larva, the fluorescence is visible in the tail muscle cells, as also evident overlaying the fluorescence and bright-field images (D). (E) Late larva, the fluorescence is visible in the epidermis and notochord cells. (F) Larva at the initial tail regression stage showing a strong, diffuse NO signal at the tail extremity (asterisk), a strong fluorescence along the tail in the epidermis and in the notochord cells. (G) Larva at almost complete tail regression showing the fluorescent signal at the tail tip. (I) Early juvenile at initial rotation stage, a strong fluorescent signal is visible in the new forming digestive organs, the intestine disc. e, epidermis; ind, intestine disc; m, muscles; no, notochord; sv, sensory vesicle.

the NO indicator DAF-FM-DA showed that treatment with 1 mM L-NA resulted in a complete suppression of NO levels, as shown in Fig. 5C, where no fluorescence signal can be detected in larvae

at the initial tail regression stage, with respect to the control (Fig. 5A). Treatment with lower L-NA concentrations, e.g. 100 μM, gave a consistent decrease of the NO signal (data not shown).

Fig. 2. Dynamic expression of NOS mRNA during Ciona development as revealed by whole-mount in situ hybridisation. Ciona larvae and juveniles were hybridised with antisense (A–I) and sense (J, K) probes. (A) Early larva, ventral view, the signal is present in the anterior portion of the trunk, laterally to future palps (arrowheads). Otholite and ocellus can be seen in transparency. (B) Semithin transverse section at the level indicated in panel A showing the signal confined in the ventral and dorsal epidermis. (C) Early– middle larva, lateral view, the signal is still present in the anterior part of the trunk (arrowhead) and a new signal appears in the posterior part of the sensory vesicle (arrow). (D) Middle larva, dorsal view, the signal is visible in the posterior part of the sensory vesicle in a series of cells arranged in a circle (arrowhead) and a new signal appears in the fibres that originate from the sensory vesicle and arrive to the visceral ganglion passing through the neck (arrow). (E) Late larva, lateral view, the signal is no more present in the CNS and appears in the central portion of the tail. (F) Semithin transverse section at the level indicated in panel E showing that the signal is exclusively present in the epidermis. (G) Higher magnification of the tail extremity of a late larva, showing the absence of the signal in the terminal portion. (H) Larva during tail resorption, dorsal view, NOS continues to be expressed in the tail epidermis. The signal is stronger in the second half of the tail at the level of its extremity where a ring of expression is visible. (I) Juvenile at late rotation stage, a new signal appears in the just formed digestive organs, esophagus, stomach and intestine.

778

S. Comes et al. / Developmental Biology 306 (2007) 772–784

Fig. 4. Decreasing NO levels by NOS inhibition results in an acceleration of Ciona metamorphosis. Early larvae were treated with 0.1, 1 and 5 μM L-NA and with 5 μM D-NA as control. After 24 h, the number of late larvae, larvae during tail resorption and juveniles at early rotation stage were counted and reported as percent of the total. Data, expressed as means ± SEM, were assessed by variance analysis (one-way ANOVA after arcsine transformation). Asterisk represents the significance respect to the control (*P b 0.01). Number of experiments = 12. A significant statistical difference (P b 0.01) was also found comparing 0.1 μM L-NA treatment with 1 μM and 5 μM L-NA treatments.

To increase NO levels, two methods were selected. Initially, the NO donor DEA/NO was used as an exogenous NO source (Keefer et al., 1996). After 24 h treatment, DEA/NO significantly slowed down the metamorphosis process. However, the amine DEA, the final decomposition product of DEA/ NO, caused a similar effect as DEA/NO (not shown) which led us to abandon use of NO donors. As an alternative approach to increase endogenous NO production, the bioavailability of L-arginine was increased by treating early larvae with the arginase inhibitor nor-NOHA (Tenu et al., 1999). After 24 h

treatment with nor-NOHA, the percentage of juveniles was dramatically reduced up to 13% with respect to 53% of the control (Fig. 6). Examination of the treated larvae at longer incubation times shows that metamorphosis is not blocked and proceeds slowly but apparently normal. The increase in NO production was demonstrated by the increase in fluorescence with the DAF-FM-DA assay observed in nor-NOHA-treated larvae (Fig. 5E), at the initial tail regression stage, with respect to the control (Fig. 5A). The marked slow down of metamorphosis reported in Fig. 6 is also evident at microscopic level by comparing the morphology of the larvae in the norNOHA experiment and in the control (Figs. 5B, F right insets). In the nor-NOHA-treated larvae a non-complete tubular structure of the notochord can be observed respect to the control where the cavitation of the notochord is complete (Satoh, 1994). These series of experiments demonstrate that NO regulates tail resorption in a dose-dependent manner since any increase or decrease of NO levels resulted in a delay or acceleration of tail resorption. cGMP is involved in modulation of tail resorption To investigate the role of cGMP in the tail resorption process, early larvae were treated in sea water for 24 h with different concentrations of the guanylyl cyclase inhibitor ODQ. At 10 μM concentration, ODQ did not affect the process, but at 50 and 100 μM concentrations it markedly increased the percentages of early rotation stage juveniles, reaching the values of 76% and 94% compared to the control value of 42 % (Fig. 7). Examination of the treated larvae at

Fig. 5. Detection of endogenous NO in Ciona larvae, using the NO-specific indicator DAF-FM-DA, after modulation of NO production. (A, C, E) Fluorescence images, (B, D, F) bright-field images of the same larvae at initial tail regression (lateral views). (A) Larva at the initial tail regression stage showing a strong, diffuse NO signal at the tail extremity, a strong fluorescence along the tail in the epidermis and in the notochord cells. (C) L-NA-treated larvae at the initial tail regression stage showing the absence of the fluorescence respect to the control shown in panel A. (E) nor-NOHA-treated larvae at the initial tail regression stage showing an increased fluorescence respect to the control shown in panel A. (F) Bright-field image of the larva shown in panel E where a non-complete cavitation of notochord can be observed (inset) respect to the control shown in panel B (inset) where a complete tubular structure of the notochord is visible. e, epidermis; no, notochord.

S. Comes et al. / Developmental Biology 306 (2007) 772–784

Fig. 6. Increasing NO levels by arginase inhibition results in a slow down of Ciona metamorphosis. Early larvae were treated with nor-NOHA (300 μM) and after 24 h the number of late larvae, larvae during tail resorption and juveniles at early rotation stage were counted and reported as percent of the total. Data, expressed as means ± SEM, were assessed by variance analysis (one-way ANOVA after arcsine transformation). Asterisk represents the significance respect to the control (*P b 0.01). Number of experiments = 8.

longer incubation times shows that guanylyl cyclase inhibition accelerates metamorphosis and does not affect subsequent juvenile development. These results point to a role of the cGMP signalling pathway as modulator of tail regression during metamorphosis. Detection of activated caspase-3 during tail regression and modulation of its activity by NO Recent studies identified caspase-3 and other executioner caspases as potential NO target in apoptosis (Kim et al., 1997, 1999; Boyd and Cadenas, 2002; Maejima et al., 2005). Considering that in our system a decrease in NO levels, by NOS inhibition with L-NA, resulted in an acceleration of tail regression, which is a caspase-3-dependent apoptosis process (Chambon et al., 2002; Baghdiguian et al., 2007), we investigated if NOS inhibition affected caspase activity. We measured caspase-3-like activity adapting methods and reagents normally employed for the human enzyme. In particular, we used a fluorimetric assay and as substrate the specific peptide recognised by the human enzyme. Noteworthy, this assay was successfully used to detect apoptosis in the sea urchin embryos (Romano et al., 2003). To verify the existence of any functional homology between ascidian and mammalian caspases, we searched in the Ciona genome for sequences homologous to human caspase-3 (GenBank accession no. CAC88866) using BLASTP. We identified at least 17 different Ciona sequences matching our query with an E value ranging between 2e-53 and 2e-08. Fig. 8A shows the alignment between human caspase-3 (HuCASP3) and the Ciona homolog (CiCASP: jgi|Cioin2| 222420|fgenesh3_pg.C_chr_12p000217) with the highest identities (42%) and positivities (60%) respect to the human protein. In addition, we found that residues essential for the catalytic activity, and those involved in substrate binding, are well conserved between human and Ciona (Fig. 8A and Weill et al., 2005). On this basis, it seems reasonable to use for Ciona methods and reagents normally employed to detect the human

779

enzyme. The caspase-3-like activity was then measured in extracts from early larvae reared in sea water, in the absence or presence of 20 μM L-NA, for the time necessary to observe a morphological difference in tail retraction, respect to the control (about 6–8 h). In addition, as a further positive control, hatched Ciona larvae treated with hydrogen peroxide, an agent broadly used to induce apoptosis in both embryos and cell lines (Trimarchi et al., 2000; Kizaki et al., 2006), showed a strong increase in caspase-3 activity (data not shown). In untreated larvae, the specific activity of caspase-3-like was of 0.025 ± 0.011 nmol AFC/min/μg (Fig. 8B). In L-NA-treated samples the activity increased of 2.3-fold compared to control samples, thus suggesting that NO regulates the apoptotic machinery active during C. intestinalis metamorphosis throughout caspase inhibition. Further experiments were performed to detect activated caspase-3 during tail regression. In particular, larvae at equivalent stages of tail regression were analysed for the presence of activated caspase-3, utilising a caspase-3 inhibitor (DEVDFMK) conjugated to sulpho-rhodamine, and for the presence of NO by DAF-FM-DA. At the initial tail regression stage, both caspase-3 and NO are present in the final portion of the tail (Figs. 9A, B). While the caspase-3 signal is present in the external portion of the tail extremity (Fig. 9A), NO is more diffused (Fig. 9B). At 2/3 of tail regression no detectable activated caspase-3 is present at the tail extremity (Fig. 9C) where a diffuse NO signal is more clearly visible (Fig. 9D). The caspase-3 active form signal is diffused in the remaining portion of the tail with a more evident accumulation in the epidermis of the central part of the tail (Fig. 9C). When tail regression proceeds, activated caspase-3 is present along all the residual tail where NO signal is barely detectable (Figs. 9E, F). Moreover, at this stage high NO levels are visible in the intestinal disk (Fig. 9F). At early juveniles, activated caspase-3 signal is very strong in the tail residue and NO is almost exclusively present in the

Fig. 7. Effect of guanylyl cyclase inhibition on Ciona metamorphosis. Early larvae were treated with ODQ at 10, 50 and 100 μM and after 24 h the number of late larvae, larvae during tail resorption and juveniles at early rotation stage were counted and reported as percent of the total. Data, expressed as means ± SEM, were assessed by variance analysis (one-way ANOVA after arcsine transformation). Asterisk represents the significance respect to the control (*P b 0.01). Number of experiments = 10. Treatment with 10 μM ODQ is not significantly different from the control. A significant statistical difference (P b 0.01) was also found between 50 μM and 100 μM ODQ treatments.

780

S. Comes et al. / Developmental Biology 306 (2007) 772–784

Fig. 8. Amino acid comparison and caspase-3 like activity in Ciona. (A) Ciona sequences homologous to human caspase-3 were searched using BLASTP from JGI web site. CiCASP represents the Ciona caspase-like protein with the highest homology to human caspase-3 (HuCASP3). Red boxes indicate conserved residues involved in the catalytic activity. Black dots indicate residues involved in substrate binding. (B) Early larvae were treated with 20 μM L-NA for the time necessary to observe a morphological difference in tail retraction respect to the control (about 6–8 h). At the end of the incubation, samples were collected, lysed and caspase-3 enzymatic activity determined as reported in materials and methods section. Ten micrograms of total cell lysates were assayed for each experimental point (untreated versus L-NA-treated larvae). Statistical significance of the data, expressed as means ± SEM, was determined by the paired, two-tailed Student's t-test. Asterisk represents the significance respect to the control (*P b 0.05). Number of experiments = 4.

newly forming digestive organs (Figs. 9G, H). It is interesting that, in addition to the tail, activated caspase-3 appears in the sensory vesicle (Figs. 9C, E, G), starting from the 2/3 tail regression stage and it continues to be present until the end of the process. Discussion Biological functions of NO in invertebrates encompass diverse roles such as defense, learning, development, fertilisation, feeding, symbiosis, chemiluminescence (Palumbo, 2005; Palumbo and d'Ischia, 2007). The results of this study provide evidence that NO is a critical endogenous regulator of tail

regression in C. intestinalis, controlling the initiation of caudal regression by a mechanism that represses caspase-3 activation. Furthermore, NO may be also involved in other developmental and metamorphosis-related events preceding and following tail resorption. The ascidian C. intestinalis proved to be a suitable system for manipulating the endogenous production of NO and determining its effects. By this approach, we were able to demonstrate that a decreased NO production causes an increase of the percentage of juveniles, whereas stimulating NO production results in an opposite trend. The marked slow down of metamorphosis observed when NO production is increased is also confirmed by images at microscopic level in which an

S. Comes et al. / Developmental Biology 306 (2007) 772–784

781

Fig. 9. Detection of endogenous activated caspase-3 and NO in Ciona larvae at different tail regression stages and early juveniles. Each image represents the overlay of bright-field image and the corresponding fluorescence image using Red-DEVD-FMK for caspase-3 (A, C, E, G) and DAF-FM-DA for NO (B, D, F, H). (A, B) Larvae at the initial tail regression stage showing the caspase-3 signal in the external portion of the tail extremity (A) and a strong, diffuse NO signal at the tail extremity (B). (C, D) Larvae at 2/3 of tail regression stage showing a quite diffuse caspase-3 signal particularly strong in the epidermis of the central part of the tail (arrow) and the appearance of a new signal in the sensory vesicle (C) and a diffuse NO signal in the posterior half of the tail (D). (E, F) Larvae at almost completed tail regression showing the caspase-3 signal in the sensory vesicle and diffused along the residual tail (E) and NO signal barely detectable in the residual tail and mostly evident in the intestinal disk (F). (G, H) Early juveniles showing a strong caspase-3 signal in the tail residue (G) and high NO levels in the intestinal disk (H). ind, intestine disc; tr, tail residue; sv, sensory vesicle.

incomplete cavitation of the notochord is evident, relative to the control (see Figs. 5B, F, insets). The finding that blocking guanylyl cyclase activity had similar effect as NOS inhibition on tail resorption points to cGMP as the chief mediator of NO signalling during metamorphosis. The interesting outcome of the present study is the demonstration that NO regulates C. intestinalis metamorphosis in a dose-dependent manner since any increase or decrease of NO levels resulted in a delay or acceleration of tail resorption. In previous papers NO was reported to repress metamorphosis in organisms such as the gastropod Ilyanassa obsoleta (Froggett and Leise, 1999), the sea urchin Lytechinus pictus (Bishop and Brandhorst, 2001) and the ascidians B. villosa and C. finmarkiensis (Bishop et al., 2001), based on the increased frequency of metamorphosis after reduction of NO levels. The inhibitory role of NO on metamorphosis was also suggested to be operative in the gastropod Crepidula fornicata (Pechenik et al., 2002). Considering that these animals are characterised by a biphasic life cycle with planktonic larvae and benthic adults, it has been recently proposed that NO is an ancient and widely used regulator of biphasic life histories and

plays a role in the origin and evolution of biphasy in the bilateria (Bishop and Brandhorst, 2003). The expression of both NOS and arginase in the unfertilised eggs suggests a general role of these genes during embryogenesis, which will be the focus of further studies. Moreover, the two genes are already expressed in early and middle swimming larvae which are not yet competent to metamorphosis, suggesting a role for these genes during larval development not only strictly related to metamorphosis. Indeed, NOS is expressed in the anterior part of the trunk at early–middle larva stage and in the posterior part of the sensory vesicle at middle larva stage. The transitory expression of NOS in these structures may be related to the involvement of NO in other functions possibly related to neural processes. It is also of interest that during larval development the expression of arginase progressively decreases while that of NOS rapidly changes and reaches the maximum level at the late larva stage. It is tempting to argue that a decrease in arginase is instrumental to increase the availability of the L-arginine pool to form NO. The findings that NOS mRNA level is high at the late larva stage, when larvae have acquired competence to metamorphosis, and that the

782

S. Comes et al. / Developmental Biology 306 (2007) 772–784

transcript is localised in the tail epidermal cells during all the phases of the tail resorption suggest a key role of NO during this process. Another noteworthy observation is that the NOS gene is the first gene found to be expressed in the tail just before and during all the resorption phases. The Ci-sushi gene is expressed in the tail epithelia at late larva and no data are available on its expression during tail regression (Chambon et al., 2007). Regarding the Ci-meta genes, only Ci-meta 3 is expressed in the retractile tail region of early juveniles, when tail regression has been almost completed (Nakayama et al., 2002). NOS is also expressed in the digestive organs of early juveniles suggesting that NO is not only involved during the early phases of metamorphosis but also in the later ones, when new adult organs are forming. From the in situ hybridisation panel, it emerges that NOS is expressed in different cellular regions and that the expression patterns are extremely dynamic, moving rapidly from one region to another within very few hours. This finding points to the possible involvement of NO in the developmental processes preceding metamorphosis and in metamorphosis, including tail regression and first stages of juvenile development. Detection of endogenous NO by the sensitive and NOspecific DAF-FM-DA fluorescence assay revealed that NO at late larva stage is present as a diffuse signal mainly localised in the posterior part of the sensory vesicle and in the tail. The presence of NO in the sensory vesicle may be related, in addition to neural functions, to the first apoptotic wave described by Tarallo and Sordino (2004), consistent with the reported role of NO in apoptotic processes (Chung et al., 2001; Brune, 2003). This wave originates in the dorsal cells of the posterior sensory vesicle neighbouring the ocellus, then diffuses posteriorly to affect visceral ganglion and neural tube, in the same region where NOS is expressed. The freely diffusible character of NO which rapidly crosses cell membranes and reaches cellular districts different from the production sites is well apparent from the fluorescence images of endogenous NO. In the tail NO is produced in the epidermis but readily diffuses in other cellular layers of the tail, passing throughout the muscle cells and reaching the notochord cells. These data are in line with the current knowledge about spatial selectivity of NO actions and the underlying diffusion dynamics (O'Shea et al., 1998). Model studies of NO diffusion from tubular structures like those commonly found in invertebrate CNS have shown that this gaseous messenger, when generated, e.g. by a 0.5-s pulse of synthesis from such structures, can attain far higher concentrations within the centre of the structure than at similar distances outside the walls. Hence, NO can mediate communication with distal targets through distinct channels tracked by the tubular organisation. In the present case, this entails that the unusually dynamic patterns of NOS expression can result in spatially and temporally localised bursts of NO that can diffuse along the fibres and organised structures of the larvae at the various stages of development and can persist for several seconds to elicit its effects in a relatively compartmentalised fashion. Thus, DAF-detectable patterns of NO localisation may in some instances differ from those of NOS expression as a

result of such peculiar dynamics of NO diffusion. Of particular interest is the presence of a strong and diffuse NO-related fluorescence at the tail extremity of larvae at the beginning of the resorption process (Fig. 3F) where the apoptotic wave originates (Chambon et al., 2002) and activated caspase-3 has been found to be present by red-DEVD-FMK. The fluorimetric caspase-3-like activity assays show that larvae under conditions of low NO levels exhibit an increase of enzymatic activity with respect to the control, suggesting that, at high concentration, NO may inhibit caspase-3-like activity thus modulating apoptosis. The low basal levels of caspase-3-like activity, approaching detection limits, prevented observation of the expected inhibitory effects upon increasing NO production. The in vivo detection of NO and activated caspase-3 in larvae at equivalent stage of tail regression confirmed the spatial correlation between the diminution of the NO signal and caspase-3 activation during the last phases of tail regression. In the first stages of the process an overlapping of the two signals seems to occur to some extent revealing a dynamic condition in which NO affects only in part caspase-3 activity. This suggests that during the first phases of tail regression a fine regulation of these two molecules is necessary to start and carry on the process. The finding that NO inhibits apoptosis in Ciona is in line with several studies showing that NO is an antiapoptotic modulator in many cell types (Chung et al., 2001). Furthermore, NO has been also shown to be an inducer of apoptosis in other cells (Chung et al., 2001; Brune, 2003). The dichotomous regulatory role of NO on apoptosis depends on a variety of factors, including the cell type, the redox state and the rate of NO production. Inactivation of caspases may occur by S-nitrosylation of the cysteine residue in the active site (Boyd and Cadenas, 2002), or by a cGMP-dependent pathway with the involvement of a protein kinase G (Kim et al., 1999). In the case of caspase-3, the two mechanisms may coexist in the same biological system as in rat hepatocytes (Kim et al., 1997). Alternatively, there may be prevalence of S-nitrosylation, as in cardiomyocytes (Maejima et al., 2005) or of cGMP-dependent processes, as in PC12 cells (Kim et al., 1999). Which of these mechanisms is operative in our system is under investigation. An interesting outcome of this study is the presence in the sensory vesicle of a third apoptotic process, caspase-3 dependent, which starts at 2/3 tail regression stage, after the previously described apoptotic waves in the central nervous system and in the tail (Chambon et al., 2002; Tarallo and Sordino, 2004; Baghdiguian et al., 2007), and continues until the end of tail regression. This apoptotic process is probably related to the disintegration of the vesicle, occurring during metamorphosis that contributes to the development of the adult nervous system. In conclusion, we disclosed the crucial role of NO as an endogenous regulator of tail regression in C. intestinalis. This is the first report on the involvement of NO in Ciona development and metamorphosis, and it is tempting to speculate that NO plays a variety of roles during the entire reorganisation of the body plan, as suggested by the rapid localisation changes observed before, during and after the tail resorption process has been completed. Induction of apoptosis occurs whenever the

S. Comes et al. / Developmental Biology 306 (2007) 772–784

balance between anti- and pro-apoptotic factors is tipped in favour of the latter, and we can now include NO and cGMP among the factors contributing to this balance. The close association of NO and NOS expression with apoptosis reported in this study offers new important clues to unravel the nature of the inductive signal that triggers apoptosis at the tip of the tail and of the secondary signals transmitting cell death throughout the tail. Acknowledgments We thank Ina Arnone for helpful discussions regarding realtime PCR experiments. We thank Elio Biffali, Marco Borra and the Molecular Biology Service of the Stazione Zoologica for real-time PCR analyses, sequences and oligonucleotides, Rita Marino and Rita Graziano of the Service Technology for the Study of Gene Expression for in situ hybridisation and the Service Marine Resourches for Research for assistance with living organisms, Gennaro Iamunno for preparation of the semithin sections. References Adams, V., Krabbes, S., Jiang, H., Yu, J., Rahmel, A., Gielen, S., Schuler, G., Hambrecht, R., 1998. Complete coding sequence of inducible nitric oxide synthase from human heart and skeletal muscle of patients with chronic heart failure. Nitric Oxide 2, 242–249. Alderton, W.K., Cooper, C.E., Knowles, R.G., 2001. Nitric oxide synthases: structure, function and inhibition. Biochem. J. 357, 593–615. Baghdiguian, S., Martinand-Mari, C., Mangeat, P., 2007. Using Ciona to study developmental programmed cell death. Semin. Cancer Biol. 17, 147–153. Bender, A.T., Silverstein, A.M., Demady, D.R., Kanelakis, K.C., Noguchi, S., Pratt, W.C., Osawa, Y., 1999. Neuronal nitric-oxide synthase is regulated by the Hsp90-based chaperone system in vivo. J. Biol. Chem. 274, 1472–1478. Berkowitz, D.E., White, R., Li, D., Minhas, K.M., Cernetich, A., Kim, S., Burke, S., Shoukas, A.A., Nyhan, D., Champion, H.C., Hare, J.M., 2003. Arginase reciprocally regulates nitric oxide synthase activity and contributes to endothelial dysfunction in aging blood vessels. Circulation 108, 2000–2006. Bishop, C.D., Brandhorst, B.P., 2001. NO/cGMP signaling and HSP90 activity represses metamorphosis in the sea urchin Lytechinus pictus. Biol. Bull. 201, 394–404. Bishop, C.D., Brandhorst, B.P., 2003. On nitric oxide signaling, metamorphosis, and the evolution of biphasic life cycles. Evol. Dev. 5, 542–550. Bishop, C.D., Bates, W.R., Brandhorst, B.P., 2001. Regulation of metamorphosis in ascidians involves NO/cGMP signaling and HSP90. J. Exp. Zool. 289, 374–384. Boyd, C.S., Cadenas, E., 2002. Nitric oxide and cell signaling pathways in mitochondrial-dependent apoptosis. Biol. Chem. 383, 411–423. Brune, B., 2003. Nitric oxide: NO apoptosis or turning it ON? Cell Death Differ. 10, 864–869. Chambon, J.P., Soule, J., Pomies, P., Fort, P., Sahuquet, A., Alexandre, D., PaulHenri Mangeat, P.H., Baghdiguian, S., 2002. Tail regression in Ciona intestinalis (Prochordate) involves a caspase-dependent apoptosis event associated with ERK activation. Development 129, 3105–3114. Chambon, J.P., Nakayama, A., Takamura, K., McDougall, A., Satoh, N., 2007. ERK- and JNK-signalling regulate gene networks that stimulate metamorphosis and apoptosis in tail tissues of ascidian tadpoles. Development 134, 1203–1219. Chiba, S., Sasaki, A., Nakayama, A., Takamura, K., Satoh, N., 2004. Development of Ciona intestinalis juveniles (through 2nd ascidian stage). Zool. Sci. 21, 285–298.

783

Chung, H.T., Pae, H.O., Choi, B.M., Billiar, T.R., Kim, Y.M., 2001. Nitric oxide as a bioregulator of apoptosis. Biochem. Biophys. Res. Commun. 282, 1075–1079. Cloney, R.A., 1978. Ascidian metamorphosis review and analysis. In: Chia, F.S., Rice, M.E. (Eds.), Settlement and Metamorphosis of Marine Invertebrate Larvae. Elsevier North Holland Biomedical Press, New York, pp. 255–282. Cloney, R.A., 1982. Ascidian larvae and the events of metamorphosis. Am. Zool. 22, 817–826. Dehal, P., Satou, Y., Campbell, R.K., Chapman, J., Degnan, B., De Tomaso, A., Davidson, B., Di Gregorio, A., Gelpke, M., Goodstein, D.M., et al., 2002. The draft genome of Ciona intestinalis: insights into chordate and vertebrate origins. Science 298, 2157–2167. Eri, R., Arnold, J.M., Hinman, V.F., Green, K.M., Jones, M.K., Degnan, B.M., Lavin, M.F., 1999. Hemps, a novel EGF-like protein, plays a central role in ascidian metamorphosis. Development 126, 5809–5818. Froggett, S.J., Leise, E.M., 1999. Metamorphosis in the marine snail Ilyanassa obsoleta, yes or no? Biol. Bull. 196, 57–62. Garcia-Cardena, G., Fan, R., Shah, V., Sorrentino, R., Cirino, G., Papapetropoulos, A., Sessa, W.C., 1998. Dynamic activation of endothelial nitric oxide synthase by Hsp90. Nature 392, 821–824. Ghosh, D.K., Salerno, J.C., 2003. Nitric oxide synthases: domain structure and alignment in enzyme function and control. Front. Biosci. 8, d193–d209. Grumetto, L., Wilding, M., De Simone, M.L., Tosti, E., Galione, A., Dale, B., 1997. Nitric oxide gates fertilization channels in ascidian oocytes through nicotinamide nucleotide metabolism. Biochem. Biophys. Res. Commun. 239, 723–728. Hall, A.V., Antoniou, H., Wang, Y., Cheung, A.H., Arbus, A.M., Olson, S.L., Lu, W.C., Kau, C.L., Marsden, P.A., 1994. Structural organization of the human neuronal nitric oxide synthase gene (NOS1). J. Biol. Chem. 269, 33082–33090. Hecker, M., Nematollahi, H., Hey, C., Busse, R., Racke, K., 1995. Inhibition of arginase by NG-hydroxy-L-arginine in alveolar macrophages: implications for the utilization of L-arginine for nitric oxide synthesis. FEBS Lett. 359, 251–254. Jackson, D., Leys, S.P., Hinman, V.F., Woods, R., Lavin, M.F., Degnan, B.M., 2002. Ecological regulation of development: induction of marine invertebrate metamorphosis. Int. J. Dev. Biol. 46, 679–686. Jeffery, W.R., Swalla, B.J., 1997. Embryology of the tunicates. In: Gilbert, S. (Ed.), Embryology: Constructing the Organism. Sinauer, Sunderland, MA, pp. 331–364. Keefer, L.K., Nims, R.W., Davies, K.M., Wink, D.A., 1996. “NONOates” (1-substituted diazen-1-ium-1,2-diolates) as nitric oxide donors: convenient nitric oxide dosage forms. Methods Enzymol. 268, 281–293. Kim, Y.M., Talanian, R.V., Billiar, T.R., 1997. Nitric oxide inhibits apoptosis by preventing increases in caspase-3-like activity via two distinct mechanisms. J. Biol. Chem. 272, 31138–31148. Kim, Y.M., Chung, H.T., Kim, S.S., Han, J.A., Yoo, Y.M., Kim, K.M., Lee, G.H., Yun, H.Y., Green, A., Li, J., Simmons, R.L., Billiar, T.R., 1999. Nitric oxide protects PC12 cells from serum deprivation-induced apoptosis by cGMP-dependent inhibition of caspase signaling. J. Neurosci. 19, 6740–6747. Kizaki, M., Xian, M., Sagawa, M., Ikeda, Y., 2006. Induction of apoptosis via the modulation of reactive oxygen species (ROS) production in the treatment of myeloid leukemia. Curr. Pharm. Biotechnol. 7, 323–329. Kojima, H., Urano, Y., Kikuchi, K., Higuchi, T., Hirata, Y., Nagano, T., 1999. Fluorescent indicators for imaging nitric oxide production. Angew. Chem., Int. Ed. Engl. 38, 3209–3212. Li, H., Meininger, C.J., Hawker Jr., J.R., Haynes, T.E., Kepka-Lenhart, D., Mistry, S.K., Morris Jr., S.M., Wu, G., 2001. Regulatory role of arginase I and II in nitric oxide, polyamine, and proline syntheses in endothelial cells. Am. J. Physiol.: Endocrinol. Metab. 280, E75–E82. Locascio, A., Aniello, F., Amoroso, A., Manzanares, M., Krumlauf, R., Branno, M., 1999. Patterning the ascidian nervous system: structure, expression and transgenic analysis of the CiHox3 gene. Development 126, 4737–4748. Maarsingh, H., Tio, M.A., Zaagsma, J., Meurs, H., 2005. Arginase attenuates inhibitory nonadrenergic noncholinergic nerve-induced nitric oxide generation and airway smooth muscle relaxation. Respir. Res. 6, 23–29.

784

S. Comes et al. / Developmental Biology 306 (2007) 772–784

Maejima, Y., Adachi, S., Morikawa, K., Ito, H., Isobe, M., 2005. Nitric oxide inhibits myocardial apoptosis by preventing caspase-3 activity via S-nitrosylation. J. Mol. Cell. Cardiol. 38, 163–174. Nakayama, A., Satou, Y., Satoh, N., 2001. Isolation and characterization of genes that are expressed during Ciona intestinalis metamorphosis. Dev. Genes Evol. 211, 184–189. Nakayama, A., Satou, Y., Satoh, N., 2002. Further characterization of genes expressed during Ciona intestinalis metamorphosis. Differentiation 70, 429–437. Olinski, R.P., Dahlberg, C., Thorndyke, M., Hallbook, F., 2006. Three insulinrelaxin-like genes in Ciona intestinalis. Peptides 27, 2535–2546. O'Shea, M., Colbert, R., Williams, L., Dunn, S., 1998. Nitric oxide compartments in the mushroom bodies of the locust brain. NeuroReport 9, 333–336. Palumbo, A., 2005. Nitric oxide in marine invertebrates: a comparative perspective. Comp. Biochem. Physiol., Part A: Mol. Integr. Physiol. 142, 241–248. Palumbo, A., d'Ischia, M., 2007. Nitric oxide biogenesis, signalling and roles in molluscs: the Sepia officinalis paradigm. In: Trimmer, B., Tota, B. (Eds.), Advances in Experimental Biology on Nitric Oxide. Elsevier, London, pp. 45–64. Passamaneck, A.J., Di Gregorio, A., 2005. Ciona intestinalis: chordate development made simple. Dev. Dyn. 233, 1–19. Patricolo, E., Ortolani, G., Casico, A., 1981. The effect of L-thyroxine on the metamorphosis of Ascidia malaca. Cell Tissue Res. 214, 289–301. Pechenik, J.A., Li, W., Cochrane, D.E., 2002. Timing is everything: the effects of putative dopamine antagonists on metamorphosis vary with larval age and experimental duration in the prosobranch gastropod Crepidula fornicata. Biol. Bull. 202, 137–147. Romano, G., Russo, G.L., Buttino, I., Ianora, A., Miralto, A., 2003. A marine

diatom-derived aldehyde induces apoptosis in copepod and sea urchin embryos. J. Exp. Biol. 206, 3487–3494. Satoh, N., 1994. Embryogenesis. Developmental Biology of Ascidians. Cambridge Univ. Press, pp. 59–61. Strausberg, R.L., Feingold, E.A., Grouse, L.H., Derge, J.G., Klausner, R.D., Collins, F.S., Wagner, L., Shenmen, C.M., Schuler, G.D., Altschul, S.F., et al., 2002. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc. Natl. Acad. Sci. U. S. A. 99, 16899–16903. Stuehr, D.J., 2004. Enzymes of the L-arginine to nitric oxide pathway. J. Nutr. 134, 2748S–2751S. Swalla, B.J., 2004. Procurement and culture of ascidian embryos. Methods Cell Biol. 74, 115–141. Tarallo, R., Sordino, P., 2004. Time course of programmed cell death in Ciona intestinalis in relation to mitotic activity and MAPK signaling. Dev. Dyn. 230, 251–262. Tenu, J.P., Lepoivre, M., Moali, C., Brollo, M., Mansuy, D., Boucher, J.L., 1999. Effects of the new arginase inhibitor N(omega)-hydroxy-nor-L-arginine on NO synthase activity in murine macrophages. Nitric Oxide 3, 427–438. Trimarchi, J.R., Liu, L., Smith, P.J., Keefe, D.L., 2000. Noninvasive measurement of potassium efflux as an early indicator of cell death in mouse embryos. Biol. Reprod. 63, 851–857. Weill, M., Philips, A., Chourrout, D., Fort, P., 2005. The caspase family in urochordates: distinct evolutionary fates in ascidians and larvaceans. Biol. Cell 97, 857–866. Woods, R.G., Roper, K.E., Gauthier, M., Bebell, L.M., Sung, K., Degnan, B.M., Lavin, M.F., 2004. Gene expression during early ascidian metamorphosis requires signalling by Hemps, an EGF-like protein. Development 131, 2921–2933. Wu, G., Morris, S.M., 1998. Arginine metabolism: nitric oxide and beyond. Biochem. J. 336, 1–17.