- Email: [email protected]
Relation of disease activity during chronic hepatitis C infection to complexity of hypervariable region 1 quasispecies
Relation of Disease Activity During Chronic Hepatitis C Infection to Complexity of Hypervariable Region 1 Quasispecies NOBUKAZU YUKI,1 NORIO HAYASHI,1 TOYOKI MORIBE,2 YOSHIKI MATSUSHITA,3 TSUTOMU TABATA,3 TAKASHI INOUE,3 YOSHIYUKI KANAZAWA,1 KAZUYOSHI OHKAWA,1 AKINORI KASAHARA,1 HIDEYUKI FUSAMOTO,1 AND TAKENOBU KAMADA1
We studied the heterogeneity in the E2/NS1 hypervariable region 1 of the hepatitis C virus (HCV) genome in relation to the natural course after infection. The subjects were composed of 38 chronic hepatitis C carriers who had been followed for 9 to 218 months after the onset of non-A, non-B (type C) hepatitis, being tested monthly for serum alanine aminotransferase levels. The complexity of the sequence heterogeneity was assessed by single-strand conformation polymorphism analysis. The quasispecies complexity had no relation to the route of infection, the time from infection and the duration of aminotransferase elevation after the onset. However, it had a significant relationship with the degree of aminotransferase elevation in the course of the disease. The quasispecies complexity was directly correlated with the first peak of serum aminotransferase at the onset (r Å .48, P õ .01) and the mean aminotransferase levels during the period of persistent aminotransferase elevation (r Å .58, P õ .01). Twenty-three of the 38 patients were further followed for 24 months with biweekly alanine transaminase (ALT) tests. Their aminotransferase levels remained within the normal range during followup, and no significant change was seen in the quasispecies complexity after this asymptomatic period. However among the 23 patients, the quasispecies complexity increased in six cases (26%) and decreased in five (22%). A significant direct relation was seen between changes in the quasispecies complexity and the mean aminotransferase levels during the asymptomatic period (r Å .55, P Å .01). These findings suggest that the development of the HCV quasispecies nature may be related to the severity of the hepatitis in the course of infection. (HEPATOLOGY 1997;25:439-444.) Since the genome of hepatitis C virus (HCV) was cloned,1 many studies have revealed the heterogeneity of the HCV genome. As with other RNA viruses, HCV circulates as a mixture of genetically different but closely related variants, thus forming quasispecies. This quasispecies nature is most prominent in the hypervariable region 1 (HVR1) found at the N-terminus of the E2/NS1 region.2,3 Several studies showed
Abbreviations: HCV, hepatitis C virus; HVR1, hypervariable region 1; SSCP, singlestrand conformation polymorphism; ALT, alanine transaminase; RT-PCR, reverse-transcription polymerase chain reaction; bDNA assay, branched DNA assay; nt, nucleotide position. From the 1First Department of Medicine, Osaka University Medical School, Suita 565; 2 Diagnostic Science Department, Shionogi Biomedical Laboratories, Settsu 566; and 3Department of Medicine, Inoue Hospital, Suita 564, Japan. Received April 13, 1995; accepted September 13, 1996. Supported by a Grant-in-Aid from the Ministry of Education, Science and Culture, Japan. Address reprint requests to: Norio Hayashi, M.D., First Department of Medicine, Osaka University Medical School, Yamadaoka 2-2, Suita 565, Japan. Copyright q 1997 by the American Association for the Study of Liver Diseases. 0270-9139/97/2502-0031$3.00/0
that antibodies to HCV envelope glycoproteins may have a neutralizing effect,4,5 and the genetic drift in HVR1 is thought to provide HCV with a better chance for adaptation to immune pressure.6,7 Very recently, it has been shown that patients with a heterogenous HCV population are less likely to respond to interferon therapy than those with a homogenous HCV population,8-10 indicating that the HVR1 quasispecies nature may be useful for predicting responses to antiviral therapy, as is the case with HCV replicative levels and genotypes.11-15 Thus, the HVR1 quasispecies seem to play an important role in persistent HCV infection. At present, factors affecting the development of the HVR1 quasispecies nature in the natural course of chronic HCV infection remain to be worked out. In this study, the degree of complexity of HVR1 quasispecies was assessed in chronic HCV carriers using single-strand conformation polymorphism (SSCP) analysis.10 The results were correlated with the clinical courses of the patients after infection to study factors affecting the HVR1 quasispecies nature. PATIENTS AND METHODS Patients. Sixty-two patients had undergone detailed follow-up after the onset of non-A, non-B (type C) hepatitis in a hemodialysis unit. Forty of the 62 patients received no blood transfusion after the onset and were subjected to the study. The remaining 22 patients, who received blood products during the follow-up, were excluded because possible superinfection with HCV in contaminated blood products can hamper the analysis of HCV HVR1 derived from initial infection. The HVR1 quasispecies nature at the end of follow-up could be estimated using SSCP analysis in 38 of the 40 cases tested. Thus, these 38 patients were enrolled in the analysis. They were 17 males and 21 females ranging in age from 36 to 75 years (median age, 55 years). The causes of their renal failure were chronic glomerulonephritis (n Å 30), diabetic nephropathy (n Å 4), and polycystic kidney disease (n Å 4). The 38 patients had undergone detailed follow-up for 9 to 218 months (median, 93 months) from the onset of non-A, non-B (type C) hepatitis until 1993. After the diagnosis of renal disease, they received monthly routine laboratory tests including serum alanine transaminase (ALT) activity. Hepatitis B surface antigen was examined every 1 to 3 months. Since serological tests for HCV became available in 1990, HCV antibody was also tested every 3 to 6 months. These 38 patients showed the onset of non-A, non-B (type C) hepatitis 6 to 108 months (median, 15 months) after their entry to the hemodialysis program. They had no preexisting liver disease and had showed repeatedly normal ALT values for more than 3 years. Elevated ALT activity was first noted, and at least two abnormal values were observed in measurements separated by 1 or more weeks. Hepatotropic viruses other than HCV and nonviral causes of hepatocellular injury were excluded by conventional clinical and laboratory studies in all cases. In 16 of the 38 patients, HCV antibody seroconversion was seen after the onset of the disease, and HCV antibody was persistently found during follow-up. The remaining 22 patients contracted non-A, non-B hepatitis before the discovery of HCV, and were shown to have HCV infection in 1990 when serological tests for HCV became available. Thereafter, they remained seropositive for HCV during follow-up. HCV infection was further confirmed in all of the 38 patients by reverse-transcription polymerase chain reaction (RT-PCR) for the detection of serum HCV
439
AID
Hepa 0004
/
5P1C$$$$61
01-10-97 15:27:56
hpta
WBS: Hepatology
440
YUKI ET AL.
HEPATOLOGY February 1997
RNA. During the entire follow-up periods, all of the 38 patients were persistently negative for HBsAg. They had no history of administration of hepatotoxic drugs or alcohol abuse (ú80 g/d) and showed no evidence of autoimmune liver disease. Thus, there was no apparent cause of hepatocellular injury other than HCV during the follow-up. Serum ALT elevation occurred 1 to 7 months after transfusion of two units of packed erythrocytes in 17 cases, and their illness was considered to be posttransfusion non-A, non-B (type C) hepatitis. The other 21 cases had had no apparent risk factors for viral hepatitis, and their illness was considered to be sporadic non-A, non-B (type C) hepatitis. Their first peaks of serum ALT elevation ranged between 1.1 and 23.0 times the upper limit of the normal range (45 U/ L) (median, 4.1). Persistent serum ALT elevation began with low ALT peaks of õ2 times the upper limit of the normal range in nine cases. The duration of serum ALT elevation in the 38 patients ranged between 1 and 206 months (median, 22 months). In 30 patients (79%), serum ALT fluctuation lasted for at least 6 months indicating a strong likelihood of chronicity of the disease. However, after the last episode of serum ALT elevation, 25 (83%) of the 30 patients had a period of serum ALT normalization. Until the end of follow-up, serum ALT normalization was observed for more than 1 year in 16 patients (53%), and eight patients (27%) showed normal serum ALT levels for more than 5 years, thus indicating biochemical remission of the disease. Serum samples obtained from each patient at the end of follow-up in 1993 were subjected to analysis of the HCV quasispecies nature, HCV RNA levels and HCV genotypes. Twenty-three of the 38 patients could be further followed for the subsequent 24 months with biweekly serum ALT tests and then tested for the HCV quasispecies nature and HCV RNA levels again. They remained seropositive for HCV during this period, and HCV viremia was revealed by RT-PCR. However, biweekly ALT levels remained within the normal range in each case. Serological Testing. Serum samples were tested for HBsAg with a radioimmunoassay (Abbott Laboratories, North Chicago, IL). For the diagnosis of non-A, non-B hepatitis, an enzyme immunoassay for immunoglobulin M antibody to hepatitis B core antigen, a radioimmunoassay for IgM antibody to hepatitis A virus (Abbott Laboratories), and indirect immunofluorescence tests for antibodies to cytomegalovirus and Epstein-Barr virus were further performed to exclude other types of viral hepatitis. HCV antibody was tested with a first-generation enzyme-linked immunosorbent assay or a secondgeneration radioimmunoassay (Ortho Diagnostic Systems Co., Ltd., Tokyo, Japan). The assays were performed according to the manufacturer’s instructions and were done in duplicate. Detection, Quantification, and Typing of Serum HCV RNA.
Serum HCV RNA sequences were detected by RT-PCR. HCV RNA was extracted from 100 mL of serum samples, copied into complementary DNA by RT, and amplified by PCR as described elsewhere.13 Primers were derived from the 5*-noncoding region of the published sequence:16 antisense primer 5*ATGGTGCACGGTCTACGAGACCTCC3* and sense primer 5*CACTCCCCTGTGAGGAACTACTGTC3*. The PCR mixtures were amplified in a DNA thermal cycler (Perkin-Elmer Cetus, Norwalk, CT) for 40 cycles (947C for 0.5 minutes; 557C for 1 minute; 727C for 1 minute), followed by a 10-minute final extension at 727C. A portion of the PCR products was fractionated by agarose gel electrophoresis, transferred onto a nylon membrane, hybridized to a 32P-labelled HCV complementary DNA between the two primers, and autoradiographed. Because of the extreme sensitivity of PCR, great care was taken to prevent false-positive PCR results, and the contamination avoidance measures of Kwok and Higuchi17 were strictly applied throughout. Also, we included nine test samples, two negative control sera from healthy individuals without risk factors for HCV infection, and one sample of distilled water to prevent false-positive results. Quantification of serum HCV RNA was performed using a branched DNA (bDNA) assay (Chiron HCV-RNA, Chiron Corporation, Emeryville, CA).12 The assay was performed according to the manufacturer’s instructions. Specimens with quantification values over the cut-off value of the kits (350,000 HCV RNA Eq/mL) were considered positive. All assays were performed in duplicate, and the mean quantification value of the duplicates was calculated. The results were expressed as log10 (HCV RNA equivalent per mL). An arbitrary value of 175,000 Eq/mL was attributed to the serum samples positive by RT-PCR but negative by bDNA assay. HCV RNA–positive serum samples were further subjected to genotype analysis according to a method described previously.18 HCV
AID
Hepa 0004
/
5P1C$$$$62
01-10-97 15:27:56
was classified into four genotypes (1a, 1b, 2a, and 2b) based on variation in nucleotide sequence within restricted regions in the putative HCV core gene. Complexity of the Sequence Heterogeneity in the E2/NS1 HVR1. HVR1 quasispecies was assessed by PCR-SSCP analysis as
described previously.10 In brief, a portion of the HCV E2/NS1 region including HVR1 was amplified by RT-PCR using a sense primer S1 (5*TGGCTTGGGATATGATGATGAAC3*, nucleotide positions [nt] 1277-1299 of HC-J4)19 and antisense primers A1 (5*GGGGTGAAGCAATACACTGGACCACA3*, nt 1831-1856 of HC-J4)/A2 (5*GGGGTGAAGCAGTACACTGGGCCGCA3*, nt 1839-1864 of BK16). A portion of the first-stage PCR products was further amplified by PCR using a nested pair of a sense primer S2 (5*TGGGATATGATGATCAACTGGTC3*, nt 1282-1304 of HC-J4) and antisense primers A3 (5*GTGAAGGAATTCACTGGACCACACAC3*, nt 1828-1853 of HCJ4)/A4 (5*GTGAAGGAATTCACTGGGCCGCACAC3*, nt 1836-1861 of BK). The third-stage PCR was performed using SSCP primers: sense primer HS (5*GCCTTGCCTACTATTCCATG3*, nt 1405-1424 of HC-J4) and antisense primer HA (5*TTGATGTGCCAACTGCCATT3*, nt 1581-1600 of HC-J4). The third-stage PCR products were subjected to electrophoresis, and successful amplification of the predicted length (196 base pairs) was confirmed. For PCR-SSCP analysis, the third-stage PCR amplification was performed using 32P-labelled SSCP primers. A portion of the PCR products were denatured to obtain single-stranded DNA at 957C for 10 minutes in a denaturation solution comprised of 95% formamide, 0.05% bromophenol blue, 0.05% xylene cyanol, and 20 mmol/L ethylene diamine tetraacetic acid. The denatured products were chilled on ice water for 10 minutes and applied to a 5% polyacrylamide gel (acrylamide:N, N*-bisacrylamide Å 49:1). Electrophoresis was performed at 257C for 1 hour at a constant power of 30 W using a Macrophor sequencing system (Pharmacia LKB Biotechnology AB., Uppsala, Sweden). The gel was dried on a glass board and exposed to x-ray film at room temperature for 20 hours. Thus, heterogenous mixtures of mutant genomes were separated into different bands depending on sequence-specific, three-dimensional conformations. In preliminary experiments, SSCP analysis was performed using plasmid DNA clones isolated from serum samples after two-round RT-PCR using S1, S2, A1/A2, and A3/A4 primers. The third-stage PCR products from a single clone were separated into two bands by SSCP analysis. The particularly inseparable clones could be clearly separated into two bands under different SSCP electrophoretic conditions of lower temperature. To detect sequence differences, we also examined the sensitivity. Analysis of a mixture of multiple clones differing in nucleotide sequence by more than 10% usually gave the expected number of SSCP bands. However, in some cases, several bands migrated to the same position, resulting in a smaller number of bands than expected. On the other hand, multiple clones differing by õ10% could not be separated under our electrophoretic conditions and were recognized as the same bands. These findings indicate that our SSCP analysis can evaluate the approximate number of major clones with more than 10% differences in nucleotide sequence. Furthermore, preliminary experiments showed that the degree of complexity of HVR1 quasispecies assessed by SSCP analysis correlated with the degree of diversity assessed by sequence analysis. Statistical Analysis. Statistical analysis for group comparisons was performed by the x2 method and the Wilcoxon nonparametric test. Correlations between the variables were calculated using Spearman rank order correlations. A value of P õ .05 (two-tailed) was considered to indicate significance. RESULTS
All of the 38 patients were followed until 1993, and the clinical course of hepatitis C infection and the results of virological investigation at this point were compared between the posttransfusion and sporadic hepatitis groups (Table 1). Follow-up periods after the onset of non-A, non-B (type C) hepatitis were the same for the 17 patients with posttransfusion hepatitis and the 21 patients with sporadic hepatitis. No significant difference was found in the clinical course of the disease between the two groups. The first ALT peaks at the onset tended to be high in the posttransfusion hepatitis group (median, 6.1; range, 1.6-23.0 times the upper limit of normal) compared with the sporadic hepatitis group (median, 3.9; range, 1.1-21.5 times the upper limit of normal). How-
hpta
WBS: Hepatology
HEPATOLOGY Vol. 25, No. 2, 1997
YUKI ET AL.
441
TABLE 1. Patient Characteristics in Posttransfusion and Sporadic Non-A, Non-B (Type C) Hepatitis Groups Characteristics
Posttransfusion (n Å 17)
Follow-up period after the onset of hepatitis (mo) First ALT peak (1 normal)* Chronicity Period of ALT normalization (mo) Virological tests for HCV HCV quasispecies† Serum HCV RNA titers (Eq/mL) HCV genotype 1b 2a 1b / 2b Unclassified
88 6.1 13/17 41
(14-170) (1.6-23.0) (76%) (0-141)
3 (1-5) 105.9 (RT-PCR//bDNA0 to 107.1) 11 2 1 3
(65%) (12%) (6%) (18%)
Sporadic (n Å 21)
100 3.9 17/21 20
(9-218) (1.1-21.5) (81%) (0-128)
2 (1-6) 106.0 (RT-PCR//bDNA0 to 107.6) 17 (81%) 0 1 (5%) 3 (14%)
P
NS NS NS NS NS NS
NS
NOTE. All patients were followed until 1993 and then subjected to virological tests. Quantitative data expressed as median (range). Abbreviation: NS, not significant. * Values are multiples of the upper limit of normal. † HCV quasispecies are expressed as the number of bands in single-strand conformation polymorphism analysis.
ever, the difference was not significant. The development of chronic hepatitis, defined as persistent serum ALT fluctuation for at least 6 months, was frequently seen in both groups (76% and 81%, respectively), and the periods of ALT normalization after the last episode of serum ALT elevation were also the same for the two groups. In these 38 patients with serum HCV RNA detected by RT-PCR, the degree of complexity of the HVR1 quasispecies assessed by the number of bands in SSCP analysis ranged between one and six (median 3). No difference was found in the complexity of the HVR1 quasispecies nature between the posttransfusion and sporadic hepatitis groups. HCV viremic levels in the 38 patients ranged from RT-PCR//bDNA0 to 107.6 Eq/mL (median 106.0 Eq/mL). HCV genotyping showed that 28 patients (74%) had genotype 1b and two patients (5%) had genotype 2a. Both genotypes 1b and 2b were found in two patients (5%). HCV genotype(s) could not be identified in six cases (16%). No significant difference was also observed in HCV viremic levels and the prevalence of HCV genotypes between the posttransfusion and sporadic hepatitis groups. The virological implications of HVR1 quasispecies nature were further investigated in relation to the clinical course of chronic HCV infection. A relationship between the time from infection and the degree of complexity of HVR1 quasispecies at the end of follow-up in 1993 was not evident. The duration from infection was estimated from the time of blood transfusion for the posttransfusion hepatitis group. For the sporadic hepatitis group, it was estimated from the time when the patients were first noted to have elevated serum ALT levels. No significant relationship was found between the number of bands in SSCP analysis and the time from infection (r Å .13). High complexity of HVR1 quasispecies could be observed in patients with short-term infection. Conversely, in patients with long-term infection, the degree of complexity of HVR1 quasispecies was often low. The degree of complexity of HVR1 quasispecies was further correlated with serum ALT profiles during follow-up after the onset of hepatitis. The number of bands in SSCP analysis had no relation to the duration of serum ALT fluctuation from the onset of hepatitis to the last episode of serum ALT elevation (r Å .05) or the duration of subsequent serum ALT normalization (r Å .15). However, the number of bands in SSCP analysis had relation to the levels of serum ALT elevation during follow-up. It tended to be directly correlated with the first serum ALT peak at the onset (r Å .48, P õ .01) (Fig. 1). Patients with high ALT peaks at the onset tended to show high complexity of HVR1 quasispecies. Disease activity during the entire period of persistent ALT fluctuation until the last episode of ALT elevation was further evaluated for the 30 patients in whom chronic hepatitis
AID
Hepa 0004
/
5P1C$$$$62
01-10-97 15:27:56
developed. A significant direct relation was found between the number of bands in SSCP analysis and the mean value of the monthly ALT tests during the period of ALT fluctuation (r Å .58, P õ .01) (Fig. 2). Thus, patients, who had had higher levels of serum ALT elevation, showed higher complexity of HVR1 quasispecies at the end of follow-up. On the other hand, no significant relationship was seen between the complexity of the HVR1 quasispecies nature and HCV replicative levels assessed by viremic levels at the end of follow-up in 1993 (Fig. 3). The number of bands in SSCP analysis ranged between one and three (median, three) for the 10 patients who had low titers of serum HCV RNA below the bDNA cutoff but were positive according to RT-PCR (RTPCR//bDNA0), and between one and six (median, three) for the remaining 28 patients with serum HCV RNA titers detectable by the bDNA assay. The difference did not reach a statistically significant level. Furthermore, no correlation was found between the number of bands in SSCP analysis and serum HCV RNA titers (r Å .19). In this study, we investigated changes in the HVR1 quasispecies complexity for 23 patients, who underwent further detailed follow-up with biweekly serum ALT tests for 24 months after sera were drawn in 1993. The HVR1 quasispecies nature at the beginning and the end of this period was compared with the same run of SSCP analysis. Their serum ALT levels remained within the normal range during this period although the mean value of the biweekly ALT tests differed considerably (median, 20; range, 8-32 U/L). Twelve
FIG. 1. Relationship between the first peak of serum ALT levels at the onset of hepatitis and complexity of HVR1 quasispecies assessed by SSCP analysis in patients with chronic HCV infection (r Å .48; P õ .01).
hpta
WBS: Hepatology
442
YUKI ET AL.
HEPATOLOGY February 1997
FIG. 2. Relationship between the mean serum ALT levels in the chronic hepatitis period showing persistent ALT fluctuation and complexity of HVR1 quasispecies assessed by SSCP analysis in patients with chronic HCV infection (r Å .58; P õ .01).
cases (52%) showed no change in the number of bands in SSCP analysis although changes in the band pattern were seen in eight (67%) of the 12 cases indicating replacement of HCV populations. The number of bands increased by one to four (median, one) in six cases (26%), whereas it decreased by one in the remaining five cases (22%). Thus, no significant change was seen in the HVR1 quasispecies complexity after the asymptomatic period. In these patients, however, a significant direct relation was observed between changes in the HVR1 quasispecies complexity and the mean value of the
FIG. 4. The mean value of biweekly serum ALT tests during asymptomatic HCV infection had relation to the occurrence of changes in complexity of HVR1 quasispecies (r Å .55; P Å .01). The HVR1 quasispecies complexity was assessed by the number of bands in SSCP analysis.
biweekly ALT tests during follow-up (r Å .55, P Å .01) (Fig. 4). The HVR1 quasispecies complexity tended to increase in association with relatively high ALT levels, whereas patients with low ALT levels tended to show no change or decrease in the HVR1 quasispecies complexity. As for changes in HCV viremic levels, serum HCV RNA titers in the 23 patients ranged from RT-PCR//bDNA0 to 107.1 Eq/mL (median, 106.0 Eq/mL) at the beginning of the asymptomatic period and from RT-PCR//bDNA0 to 106.8 Eq/mL (median, RT-PCR// bDNA0) at the end. A slight but significant reduction in HCV viremic levels was observed (P õ .01). No relationship was seen between the percent changes in HCV viremic levels and changes in the number of bands in SSCP analysis (r Å .18). Then again, we correlated the HVR1 quasispecies complexity at the final end of follow-up (1,993 for the 15 cases without the subsequent follow-up and 1,995 for the remaining 23 cases) with the clinical course after infection. At this point, patients’ clinical and virological characteristics (listed in Table 1) remained the same for the posttransfusion hepatitis group and the sporadic hepatitis group. The HVR1 quasispecies complexity had no relation to the term from infection (r Å .10), the duration of serum ALT fluctuation (r Å .15), or the duration of subsequent serum ALT normalization (r Å 0.02). However, it was still directly correlated with the first serum ALT peak at the onset (r Å .51; P õ .01) and the mean ALT levels during the chronic hepatitis period showing persistent ALT elevation (r Å .39, P õ .05). There was no relationship between the HVR1 quasispecies complexity and HCV viremic levels at the final end of follow-up (r Å .19). DISCUSSION
FIG. 3. Relationship between serum HCV RNA titers and complexity of HVR1 quasispecies assessed by SSCP analysis in patients with chronic HCV infection (r Å .19, not significant).
AID
Hepa 0004
/
5P1C$$$$62
01-10-97 15:27:56
HCV, like other RNA viruses, is thought to mutate rapidly because of the high error rate in RNA replication, leading to the simultaneous coexistence of multiple variants in the same individual (quasispecies). There are hypervariable regions located at the N-terminal part of the envelope 2 region showing high amino acid variability,2,3 which seem to have pervasive clinical implications in that the variability could enable the HCV to escape from the host’s immune system6,7 and also resist antiviral therapy.8-10 However, the development of the quasispecies nature in the hypervariable regions is not fully understood in the natural course of HCV infection. It may be affected by the host immune pressure and also by some viral characteristic associated with mutation frequencies.
hpta
WBS: Hepatology
HEPATOLOGY Vol. 25, No. 2, 1997
YUKI ET AL.
To address the question of which factor has relevance to the development of the HVR1 quasispecies nature in the course of chronic HCV infection, we studied the complexity of the HVR1 quasispecies in relation to various clinical characteristics after HCV infection. For this purpose, we attempted to evaluate the HVR1 quasispecies nature by SSCP analysis. Thus far, the HCV quasispecies nature has been investigated by cloning and sequencing of PCR products. However, such analysis requires much effort to isolate and sequence multiple cDNA clones; only a limited number of clones obtained from a small number of patients can be examined. Another drawback is that a limited number of complementary DNA clones do not necessarily reflect the total spectrum of HCV quasispecies in vivo. On the other hand, SSCP analysis can separate DNA fragments of the same size into different electrophoretic bands depending on their sequence-specific threedimensional conformations.20,21 The number of bands is directly proportional to the degree of sequence complexity. Thus, SSCP analysis has the advantage of enabling rough estimation of the major quasispecies of the total virus population in many samples. The data obtained showed that disease activity in the course of chronic HCV infection showed relevance to the present HVR1 quasispecies nature. The degree of complexity of the HVR1 quasispecies at the end of follow-up was directly related to the levels of serum aminotransferase elevation after infection. On the other hand, the route of infection and the total period from infection had no apparent relation to the complexity of the HVR1 quasispecies. In the present study, we further investigated changes in the HVR1 quasispecies complexity after a period of asymptomatic HCV infection showing normal ALT levels. The HVR1 quasispecies complexity showed no significant change after the asymptomatic period. However, changes in the HVR1 quasispecies complexity were seen in half of the patients examined, which had relevance to serum ALT levels during follow-up. Increase in the HVR1 quasispecies complexity tended to occur in association with relatively high ALT levels. On the other hand, in patients with low ALT levels, decrease in the HVR1 quasispecies complexity could be observed, which may be a reflection of competitive selection of the quasispecies populations in vivo. It has been suggested that hemodialysis patients can show low serum ALT activity and the real upper limit of the normal range may be lower in such patients compared with normal control subjects.22 Taken together, these findings indicate that disease activity in HCV infection may be a factor which contributes to the development of the HVR1 quasispecies nature. Thus far, a few reports suggested that the rate of mutation in the HVR1 correlated with the pattern of ALT profiles in chronic HCV infection and was high in patients with high ALT levels.23,24 Our findings seem to be generally compatible with such studies on the mutation rate. However, controversy remains about the mechanism of the development of the HVR1 quasispecies complexity, and further studies are necessary to address this issue. The marked elevation of serum aminotransferase levels can be associated with the rapid elimination of infected hepatocytes by active host immunological reactions to viral components, and the intensity of such host immune pressure may be relevant to the progression of the quasispecies nature in HCV HVR1, which is considered to bear neutralizing epitopes. It has been shown that the HVR1 sequence remained unchanged in an agammaglobulinemic patient with chronic hepatitis C, thus providing support for the hypothesis that the generation of genetic variation in HVR1 is the result of host immune pressure.25 Human immunodeficiency virus type 1 also has variable domains in the envelope gene, and the third variable domain, V3, includes recognition sites for both humoral and T-cell immune responses. Several reports revealed that greater V3 quasispecies complexity is associ-
AID
Hepa 0004
/
5P1C$$$$63
01-10-97 15:27:56
443
ated with a slow decline of CD4/ cell numbers after infection and the V3 quasispecies evolution is directly related to the duration of the immunocompetent period.26,27 Similarly, intense immune pressure during the period with aminotransferase elevation may play an important role in the development of the HCV HVR1 quasispecies complexity. However, we can’t exclude a possibility that the quasispecies changes in HCV infection conversely enhance host immunological reactivity, resulting in active liver inflammation. Thus, controversy remains about the causal relation between host immune pressure and the development of the HVR1 quasispecies complexity. Alternatively, the marked elevation of aminotransferase levels may be related to the acceleration of HCV replication, which results in an increase in mutation frequencies in HVR1. In the present study, no significant correlation was found between the degree of complexity of the HVR1 quasispecies and HCV replicative levels. Moreover, changes in HCV replicative levels had no relation to those in the HVR1 quasispecies complexity. Thus, it seems that the HVR1 quasispecies nature in chronic HCV infection has distinct virological implications from HCV replicative levels assessed by viremic levels. Nevertheless, we cannot completely exclude a possible interrelationship between the progression of the HVR1 quasispecies nature and viral replicative levels in the course of HCV infection. HCV replicative levels at a few points in time do not always reflect viral replication during the entire follow-up period. Further studies are necessary to address this issue more accurately. Finally, the present study showed that the HVR1 quasispecies nature in chronic HCV carriers had relation to only disease activity during HCV infection. Patients with HCV infection showing higher complexity of the HVR1 quasispecies are more likely to fail to neutralize the virus and resist antiviral therapy. Thus, from the virological point of view, the current study sheds further light on adverse implications of active liver inflammation in the course of HCV infection. REFERENCES 1. Choo Q-L, Kuo G, Weiner AJ, Overby LR, Bradley DW, Houghton M. Isolation of a cDNA clone derived from a blood-borne non-A, non-B viral hepatitis genome. Science 1989;244:359-362. 2. Weiner AJ, Brauer MJ, Rosenblatt J, Richman KH, Tung J, Crawford K, Bonino F, et al. Variable and hypervariable domains are found in the regions of HCV corresponding to the flavivirus envelope and NS1 proteins and the pestivirus envelope glycoproteins. Virology 1991;180:842-848. 3. Hijikata M, Kato N, Ootsuyama Y, Nakagawa M, Ohkoshi S, Shimotohno K. Hypervariable regions in the putative glycoprotein of hepatitis C virus. Biochem Biophys Res Commun 1991;175:220-228. 4. Choo Q-L, Kuo G, Ralston R, Weiner A, Chien D, Van Nest G, Han J, et al. Vaccination of chimpanzees against infection by the hepatitis C virus. Proc Natl Acad Sci U S A 1994;91:1294-1298. 5. Shimizu Y, Hijikata M, Iwamoto A, Alter HJ, Purcell RH, Yoshikura H. Neutralizing antibodies against hepatitis C virus and the emergence of neutralization escape mutant viruses. J Virol 1994;68:1494-1500. 6. Weiner AJ, Geysen HM, Christopherson C, Hall JE, Mason TJ, Saracco G, Bonino F, et al. Evidence for immune selection of hepatitis C virus (HCV) putative envelope glycoprotein variants: potential role in chronic HCV infections. Proc Natl Acad Sci U S A 1992;89:3468-3472. 7. Kato N, Sekiya H, Ootsuyama Y, Nakazawa T, Hijikata M, Ohkoshi S, Shimotohno K. Humoral immune response to hypervariable region 1 of the putative envelope glycoprotein (gp70) of hepatitis C virus. J Virol 1993; 67:3923-3930. 8. Okada S, Akahane Y, Suzuki H, Okamoto H, Mishiro S. The degree of variability in the amino terminal region of the E2/NS1 protein of hepatitis C virus correlates with responsiveness to interferon therapy in viremic patients. HEPATOLOGY 1992;16:619-624. 9. Kanazawa Y, Hayashi N, Mita E, Li T, Hagiwara H, Kasahara A, Fusamoto H, et al. Influence of viral quasispecies on effectiveness of interferon therapy in chronic hepatitis C patients. HEPATOLOGY 1994;20:1121-1130. 10. Moribe T, Hayashi N, Kanazawa Y, Mita E, Fusamoto H, Negi M, Kaneshige T, et al. Hepatitis C viral complexity detected by single-strand conformation polymorphism and response to interferon therapy. Gastroenterology 1995;108:789-795. 11. Takada N, Takase S, Enomoto N, Takada A, Date T. Clinical backgrounds of the patients having different types of hepatitis C virus genomes. J Hepatol 1992;14:35-40.
hpta
WBS: Hepatology
444
YUKI ET AL.
HEPATOLOGY February 1997
12. Lau JYN, Davis GL, Kniffen J, Qian K-P, Urdea MS, Chan CS, Mizokami M, et al. Significance of serum hepatitis C virus RNA levels in chronic hepatitis C. Lancet 1993;341:1501-1504. 13. Hagiwara H, Hayashi N, Mita E, Takehara T, Kasahara A, Fusamoto H, Kamada T. Quantitative analysis of hepatitis C virus RNA in serum during interferon alfa therapy. Gastroenterology 1993;104:877-883. 14. Mita E, Hayashi N, Hagiwara H, Ueda K, Kanazawa Y, Kasahara A, Fusamoto H, et al. Predicting interferon therapy efficacy from hepatitis C virus genotype and RNA titer. Dig Dis Sci 1994;39:977-982. 15. Yuki N, Hayashi N, Kasahara A, Hagiwara H, Takehara T, Oshita M, Katayama K, et al. Pretreatment viral load and response to prolonged interferon-a course for chronic hepatitis C. J Hepatol 1995;22:457-463. 16. Takamizawa A, Mori C, Fuke I, Manabe S, Murakami S, Fujita J, Onishi E, et al. Structure and organization of the hepatitis C virus genome isolated from human carriers. J Virol 1991;65:1105-1113. 17. Kwok S, Higuchi R. Avoiding false positives with PCR. Nature 1989;339: 237-238. 18. Okamoto H, Sugiyama Y, Okada S, Kurai K, Akahane Y, Sugai Y, Tanaka T, et al. Typing hepatitis C virus by polymerase chain reaction with typespecific primers: application to clinical surveys and tracing infectious sources. J Gen Virol 1992;73:673-679. 19. Okamoto H, Okada S, Sugiyama Y, Yotsumoto S, Tanaka T, Yoshizawa H, Tsuda F, et al. The 5*-terminal sequence of the hepatitis C virus genome. Jpn J Exp Med 1990;60:167-177. 20. Orita M, Iwahana H, Kanazawa H, Hayashi K, Sekiya T. Detection of
AID
Hepa 0004
/
5P1C$$$$63
01-10-97 15:27:56
21. 22.
23. 24.
25. 26. 27.
polymorphisms of human DNA by gel electrophoresis as single-strand conformation polymorphisms. Proc Natl Acad Sci U S A 1989;86:2766-2770. Orita M, Suzuki Y, Sekiya T, Hayashi K. Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 1989;5:874-879. Yasuda K, Okuda K, Endo N, Ishiwatari Y, Ikeda R, Hayashi H, Yokozeki K, et al. Hypoaminotransferasemia in patients undergoing long-term hemodialysis: clinical and biochemical appraisal. Gastroenterology 1995;109: 1295-1300. Kurosaki M, Enomoto N, Marumo F, Sato C. Rapid sequence variation of the hypervariable region of hepatitis C virus during the course of chronic infection. HEPATOLOGY 1993;18:1293-1299. Enomoto N, Kurosaki M, Tanaka Y, Marumo F, Sato C. Fluctuation of hepatitis C virus quasispecies in persistent infection and interferon treatment revealed by single-strand conformation polymorphism analysis. J Gen Virol 1994;75:1361-1369. Kumar U, Monjardino J, Thomas HC. Hypervariable region of hepatitis C virus envelope glycoprotein (E2/NS1) in an agammaglobulinemic patient. Gastroenterology 1994;106:1072-1075. Delwart EL, Sheppard HW, Walker BD, Goudsmit J, Mullins JI. Human immunodeficiency virus type 1 evolution in vivo tracked by DNA heteroduplex mobility assays. J Virol 1994;68:6672-6683. Lukashov VV, Kuiken CL, Goudsmit J. Intrahost human immunodeficiency virus type 1 evolution is related to length of the immunocompetent period. J Virol 1995;69:6911-6916.
hpta
WBS: Hepatology
We studied the heterogeneity in the E2/NS1 hypervariable region 1 of the hepatitis C virus (HCV) genome in relation to the natural course after infection. The subjects were composed of 38 chronic hepatitis C carriers who had been followed for 9 to 218 months after the onset of non-A, non-B (type C) hepatitis, being tested monthly for serum alanine aminotransferase levels. The complexity of the sequence heterogeneity was assessed by single-strand conformation polymorphism analysis. The quasispecies complexity had no relation to the route of infection, the time from infection and the duration of aminotransferase elevation after the onset. However, it had a significant relationship with the degree of aminotransferase elevation in the course of the disease. The quasispecies complexity was directly correlated with the first peak of serum aminotransferase at the onset (r Å .48, P õ .01) and the mean aminotransferase levels during the period of persistent aminotransferase elevation (r Å .58, P õ .01). Twenty-three of the 38 patients were further followed for 24 months with biweekly alanine transaminase (ALT) tests. Their aminotransferase levels remained within the normal range during followup, and no significant change was seen in the quasispecies complexity after this asymptomatic period. However among the 23 patients, the quasispecies complexity increased in six cases (26%) and decreased in five (22%). A significant direct relation was seen between changes in the quasispecies complexity and the mean aminotransferase levels during the asymptomatic period (r Å .55, P Å .01). These findings suggest that the development of the HCV quasispecies nature may be related to the severity of the hepatitis in the course of infection. (HEPATOLOGY 1997;25:439-444.) Since the genome of hepatitis C virus (HCV) was cloned,1 many studies have revealed the heterogeneity of the HCV genome. As with other RNA viruses, HCV circulates as a mixture of genetically different but closely related variants, thus forming quasispecies. This quasispecies nature is most prominent in the hypervariable region 1 (HVR1) found at the N-terminus of the E2/NS1 region.2,3 Several studies showed
Abbreviations: HCV, hepatitis C virus; HVR1, hypervariable region 1; SSCP, singlestrand conformation polymorphism; ALT, alanine transaminase; RT-PCR, reverse-transcription polymerase chain reaction; bDNA assay, branched DNA assay; nt, nucleotide position. From the 1First Department of Medicine, Osaka University Medical School, Suita 565; 2 Diagnostic Science Department, Shionogi Biomedical Laboratories, Settsu 566; and 3Department of Medicine, Inoue Hospital, Suita 564, Japan. Received April 13, 1995; accepted September 13, 1996. Supported by a Grant-in-Aid from the Ministry of Education, Science and Culture, Japan. Address reprint requests to: Norio Hayashi, M.D., First Department of Medicine, Osaka University Medical School, Yamadaoka 2-2, Suita 565, Japan. Copyright q 1997 by the American Association for the Study of Liver Diseases. 0270-9139/97/2502-0031$3.00/0
that antibodies to HCV envelope glycoproteins may have a neutralizing effect,4,5 and the genetic drift in HVR1 is thought to provide HCV with a better chance for adaptation to immune pressure.6,7 Very recently, it has been shown that patients with a heterogenous HCV population are less likely to respond to interferon therapy than those with a homogenous HCV population,8-10 indicating that the HVR1 quasispecies nature may be useful for predicting responses to antiviral therapy, as is the case with HCV replicative levels and genotypes.11-15 Thus, the HVR1 quasispecies seem to play an important role in persistent HCV infection. At present, factors affecting the development of the HVR1 quasispecies nature in the natural course of chronic HCV infection remain to be worked out. In this study, the degree of complexity of HVR1 quasispecies was assessed in chronic HCV carriers using single-strand conformation polymorphism (SSCP) analysis.10 The results were correlated with the clinical courses of the patients after infection to study factors affecting the HVR1 quasispecies nature. PATIENTS AND METHODS Patients. Sixty-two patients had undergone detailed follow-up after the onset of non-A, non-B (type C) hepatitis in a hemodialysis unit. Forty of the 62 patients received no blood transfusion after the onset and were subjected to the study. The remaining 22 patients, who received blood products during the follow-up, were excluded because possible superinfection with HCV in contaminated blood products can hamper the analysis of HCV HVR1 derived from initial infection. The HVR1 quasispecies nature at the end of follow-up could be estimated using SSCP analysis in 38 of the 40 cases tested. Thus, these 38 patients were enrolled in the analysis. They were 17 males and 21 females ranging in age from 36 to 75 years (median age, 55 years). The causes of their renal failure were chronic glomerulonephritis (n Å 30), diabetic nephropathy (n Å 4), and polycystic kidney disease (n Å 4). The 38 patients had undergone detailed follow-up for 9 to 218 months (median, 93 months) from the onset of non-A, non-B (type C) hepatitis until 1993. After the diagnosis of renal disease, they received monthly routine laboratory tests including serum alanine transaminase (ALT) activity. Hepatitis B surface antigen was examined every 1 to 3 months. Since serological tests for HCV became available in 1990, HCV antibody was also tested every 3 to 6 months. These 38 patients showed the onset of non-A, non-B (type C) hepatitis 6 to 108 months (median, 15 months) after their entry to the hemodialysis program. They had no preexisting liver disease and had showed repeatedly normal ALT values for more than 3 years. Elevated ALT activity was first noted, and at least two abnormal values were observed in measurements separated by 1 or more weeks. Hepatotropic viruses other than HCV and nonviral causes of hepatocellular injury were excluded by conventional clinical and laboratory studies in all cases. In 16 of the 38 patients, HCV antibody seroconversion was seen after the onset of the disease, and HCV antibody was persistently found during follow-up. The remaining 22 patients contracted non-A, non-B hepatitis before the discovery of HCV, and were shown to have HCV infection in 1990 when serological tests for HCV became available. Thereafter, they remained seropositive for HCV during follow-up. HCV infection was further confirmed in all of the 38 patients by reverse-transcription polymerase chain reaction (RT-PCR) for the detection of serum HCV
439
AID
Hepa 0004
/
5P1C$$$$61
01-10-97 15:27:56
hpta
WBS: Hepatology
440
YUKI ET AL.
HEPATOLOGY February 1997
RNA. During the entire follow-up periods, all of the 38 patients were persistently negative for HBsAg. They had no history of administration of hepatotoxic drugs or alcohol abuse (ú80 g/d) and showed no evidence of autoimmune liver disease. Thus, there was no apparent cause of hepatocellular injury other than HCV during the follow-up. Serum ALT elevation occurred 1 to 7 months after transfusion of two units of packed erythrocytes in 17 cases, and their illness was considered to be posttransfusion non-A, non-B (type C) hepatitis. The other 21 cases had had no apparent risk factors for viral hepatitis, and their illness was considered to be sporadic non-A, non-B (type C) hepatitis. Their first peaks of serum ALT elevation ranged between 1.1 and 23.0 times the upper limit of the normal range (45 U/ L) (median, 4.1). Persistent serum ALT elevation began with low ALT peaks of õ2 times the upper limit of the normal range in nine cases. The duration of serum ALT elevation in the 38 patients ranged between 1 and 206 months (median, 22 months). In 30 patients (79%), serum ALT fluctuation lasted for at least 6 months indicating a strong likelihood of chronicity of the disease. However, after the last episode of serum ALT elevation, 25 (83%) of the 30 patients had a period of serum ALT normalization. Until the end of follow-up, serum ALT normalization was observed for more than 1 year in 16 patients (53%), and eight patients (27%) showed normal serum ALT levels for more than 5 years, thus indicating biochemical remission of the disease. Serum samples obtained from each patient at the end of follow-up in 1993 were subjected to analysis of the HCV quasispecies nature, HCV RNA levels and HCV genotypes. Twenty-three of the 38 patients could be further followed for the subsequent 24 months with biweekly serum ALT tests and then tested for the HCV quasispecies nature and HCV RNA levels again. They remained seropositive for HCV during this period, and HCV viremia was revealed by RT-PCR. However, biweekly ALT levels remained within the normal range in each case. Serological Testing. Serum samples were tested for HBsAg with a radioimmunoassay (Abbott Laboratories, North Chicago, IL). For the diagnosis of non-A, non-B hepatitis, an enzyme immunoassay for immunoglobulin M antibody to hepatitis B core antigen, a radioimmunoassay for IgM antibody to hepatitis A virus (Abbott Laboratories), and indirect immunofluorescence tests for antibodies to cytomegalovirus and Epstein-Barr virus were further performed to exclude other types of viral hepatitis. HCV antibody was tested with a first-generation enzyme-linked immunosorbent assay or a secondgeneration radioimmunoassay (Ortho Diagnostic Systems Co., Ltd., Tokyo, Japan). The assays were performed according to the manufacturer’s instructions and were done in duplicate. Detection, Quantification, and Typing of Serum HCV RNA.
Serum HCV RNA sequences were detected by RT-PCR. HCV RNA was extracted from 100 mL of serum samples, copied into complementary DNA by RT, and amplified by PCR as described elsewhere.13 Primers were derived from the 5*-noncoding region of the published sequence:16 antisense primer 5*ATGGTGCACGGTCTACGAGACCTCC3* and sense primer 5*CACTCCCCTGTGAGGAACTACTGTC3*. The PCR mixtures were amplified in a DNA thermal cycler (Perkin-Elmer Cetus, Norwalk, CT) for 40 cycles (947C for 0.5 minutes; 557C for 1 minute; 727C for 1 minute), followed by a 10-minute final extension at 727C. A portion of the PCR products was fractionated by agarose gel electrophoresis, transferred onto a nylon membrane, hybridized to a 32P-labelled HCV complementary DNA between the two primers, and autoradiographed. Because of the extreme sensitivity of PCR, great care was taken to prevent false-positive PCR results, and the contamination avoidance measures of Kwok and Higuchi17 were strictly applied throughout. Also, we included nine test samples, two negative control sera from healthy individuals without risk factors for HCV infection, and one sample of distilled water to prevent false-positive results. Quantification of serum HCV RNA was performed using a branched DNA (bDNA) assay (Chiron HCV-RNA, Chiron Corporation, Emeryville, CA).12 The assay was performed according to the manufacturer’s instructions. Specimens with quantification values over the cut-off value of the kits (350,000 HCV RNA Eq/mL) were considered positive. All assays were performed in duplicate, and the mean quantification value of the duplicates was calculated. The results were expressed as log10 (HCV RNA equivalent per mL). An arbitrary value of 175,000 Eq/mL was attributed to the serum samples positive by RT-PCR but negative by bDNA assay. HCV RNA–positive serum samples were further subjected to genotype analysis according to a method described previously.18 HCV
AID
Hepa 0004
/
5P1C$$$$62
01-10-97 15:27:56
was classified into four genotypes (1a, 1b, 2a, and 2b) based on variation in nucleotide sequence within restricted regions in the putative HCV core gene. Complexity of the Sequence Heterogeneity in the E2/NS1 HVR1. HVR1 quasispecies was assessed by PCR-SSCP analysis as
described previously.10 In brief, a portion of the HCV E2/NS1 region including HVR1 was amplified by RT-PCR using a sense primer S1 (5*TGGCTTGGGATATGATGATGAAC3*, nucleotide positions [nt] 1277-1299 of HC-J4)19 and antisense primers A1 (5*GGGGTGAAGCAATACACTGGACCACA3*, nt 1831-1856 of HC-J4)/A2 (5*GGGGTGAAGCAGTACACTGGGCCGCA3*, nt 1839-1864 of BK16). A portion of the first-stage PCR products was further amplified by PCR using a nested pair of a sense primer S2 (5*TGGGATATGATGATCAACTGGTC3*, nt 1282-1304 of HC-J4) and antisense primers A3 (5*GTGAAGGAATTCACTGGACCACACAC3*, nt 1828-1853 of HCJ4)/A4 (5*GTGAAGGAATTCACTGGGCCGCACAC3*, nt 1836-1861 of BK). The third-stage PCR was performed using SSCP primers: sense primer HS (5*GCCTTGCCTACTATTCCATG3*, nt 1405-1424 of HC-J4) and antisense primer HA (5*TTGATGTGCCAACTGCCATT3*, nt 1581-1600 of HC-J4). The third-stage PCR products were subjected to electrophoresis, and successful amplification of the predicted length (196 base pairs) was confirmed. For PCR-SSCP analysis, the third-stage PCR amplification was performed using 32P-labelled SSCP primers. A portion of the PCR products were denatured to obtain single-stranded DNA at 957C for 10 minutes in a denaturation solution comprised of 95% formamide, 0.05% bromophenol blue, 0.05% xylene cyanol, and 20 mmol/L ethylene diamine tetraacetic acid. The denatured products were chilled on ice water for 10 minutes and applied to a 5% polyacrylamide gel (acrylamide:N, N*-bisacrylamide Å 49:1). Electrophoresis was performed at 257C for 1 hour at a constant power of 30 W using a Macrophor sequencing system (Pharmacia LKB Biotechnology AB., Uppsala, Sweden). The gel was dried on a glass board and exposed to x-ray film at room temperature for 20 hours. Thus, heterogenous mixtures of mutant genomes were separated into different bands depending on sequence-specific, three-dimensional conformations. In preliminary experiments, SSCP analysis was performed using plasmid DNA clones isolated from serum samples after two-round RT-PCR using S1, S2, A1/A2, and A3/A4 primers. The third-stage PCR products from a single clone were separated into two bands by SSCP analysis. The particularly inseparable clones could be clearly separated into two bands under different SSCP electrophoretic conditions of lower temperature. To detect sequence differences, we also examined the sensitivity. Analysis of a mixture of multiple clones differing in nucleotide sequence by more than 10% usually gave the expected number of SSCP bands. However, in some cases, several bands migrated to the same position, resulting in a smaller number of bands than expected. On the other hand, multiple clones differing by õ10% could not be separated under our electrophoretic conditions and were recognized as the same bands. These findings indicate that our SSCP analysis can evaluate the approximate number of major clones with more than 10% differences in nucleotide sequence. Furthermore, preliminary experiments showed that the degree of complexity of HVR1 quasispecies assessed by SSCP analysis correlated with the degree of diversity assessed by sequence analysis. Statistical Analysis. Statistical analysis for group comparisons was performed by the x2 method and the Wilcoxon nonparametric test. Correlations between the variables were calculated using Spearman rank order correlations. A value of P õ .05 (two-tailed) was considered to indicate significance. RESULTS
All of the 38 patients were followed until 1993, and the clinical course of hepatitis C infection and the results of virological investigation at this point were compared between the posttransfusion and sporadic hepatitis groups (Table 1). Follow-up periods after the onset of non-A, non-B (type C) hepatitis were the same for the 17 patients with posttransfusion hepatitis and the 21 patients with sporadic hepatitis. No significant difference was found in the clinical course of the disease between the two groups. The first ALT peaks at the onset tended to be high in the posttransfusion hepatitis group (median, 6.1; range, 1.6-23.0 times the upper limit of normal) compared with the sporadic hepatitis group (median, 3.9; range, 1.1-21.5 times the upper limit of normal). How-
hpta
WBS: Hepatology
HEPATOLOGY Vol. 25, No. 2, 1997
YUKI ET AL.
441
TABLE 1. Patient Characteristics in Posttransfusion and Sporadic Non-A, Non-B (Type C) Hepatitis Groups Characteristics
Posttransfusion (n Å 17)
Follow-up period after the onset of hepatitis (mo) First ALT peak (1 normal)* Chronicity Period of ALT normalization (mo) Virological tests for HCV HCV quasispecies† Serum HCV RNA titers (Eq/mL) HCV genotype 1b 2a 1b / 2b Unclassified
88 6.1 13/17 41
(14-170) (1.6-23.0) (76%) (0-141)
3 (1-5) 105.9 (RT-PCR//bDNA0 to 107.1) 11 2 1 3
(65%) (12%) (6%) (18%)
Sporadic (n Å 21)
100 3.9 17/21 20
(9-218) (1.1-21.5) (81%) (0-128)
2 (1-6) 106.0 (RT-PCR//bDNA0 to 107.6) 17 (81%) 0 1 (5%) 3 (14%)
P
NS NS NS NS NS NS
NS
NOTE. All patients were followed until 1993 and then subjected to virological tests. Quantitative data expressed as median (range). Abbreviation: NS, not significant. * Values are multiples of the upper limit of normal. † HCV quasispecies are expressed as the number of bands in single-strand conformation polymorphism analysis.
ever, the difference was not significant. The development of chronic hepatitis, defined as persistent serum ALT fluctuation for at least 6 months, was frequently seen in both groups (76% and 81%, respectively), and the periods of ALT normalization after the last episode of serum ALT elevation were also the same for the two groups. In these 38 patients with serum HCV RNA detected by RT-PCR, the degree of complexity of the HVR1 quasispecies assessed by the number of bands in SSCP analysis ranged between one and six (median 3). No difference was found in the complexity of the HVR1 quasispecies nature between the posttransfusion and sporadic hepatitis groups. HCV viremic levels in the 38 patients ranged from RT-PCR//bDNA0 to 107.6 Eq/mL (median 106.0 Eq/mL). HCV genotyping showed that 28 patients (74%) had genotype 1b and two patients (5%) had genotype 2a. Both genotypes 1b and 2b were found in two patients (5%). HCV genotype(s) could not be identified in six cases (16%). No significant difference was also observed in HCV viremic levels and the prevalence of HCV genotypes between the posttransfusion and sporadic hepatitis groups. The virological implications of HVR1 quasispecies nature were further investigated in relation to the clinical course of chronic HCV infection. A relationship between the time from infection and the degree of complexity of HVR1 quasispecies at the end of follow-up in 1993 was not evident. The duration from infection was estimated from the time of blood transfusion for the posttransfusion hepatitis group. For the sporadic hepatitis group, it was estimated from the time when the patients were first noted to have elevated serum ALT levels. No significant relationship was found between the number of bands in SSCP analysis and the time from infection (r Å .13). High complexity of HVR1 quasispecies could be observed in patients with short-term infection. Conversely, in patients with long-term infection, the degree of complexity of HVR1 quasispecies was often low. The degree of complexity of HVR1 quasispecies was further correlated with serum ALT profiles during follow-up after the onset of hepatitis. The number of bands in SSCP analysis had no relation to the duration of serum ALT fluctuation from the onset of hepatitis to the last episode of serum ALT elevation (r Å .05) or the duration of subsequent serum ALT normalization (r Å .15). However, the number of bands in SSCP analysis had relation to the levels of serum ALT elevation during follow-up. It tended to be directly correlated with the first serum ALT peak at the onset (r Å .48, P õ .01) (Fig. 1). Patients with high ALT peaks at the onset tended to show high complexity of HVR1 quasispecies. Disease activity during the entire period of persistent ALT fluctuation until the last episode of ALT elevation was further evaluated for the 30 patients in whom chronic hepatitis
AID
Hepa 0004
/
5P1C$$$$62
01-10-97 15:27:56
developed. A significant direct relation was found between the number of bands in SSCP analysis and the mean value of the monthly ALT tests during the period of ALT fluctuation (r Å .58, P õ .01) (Fig. 2). Thus, patients, who had had higher levels of serum ALT elevation, showed higher complexity of HVR1 quasispecies at the end of follow-up. On the other hand, no significant relationship was seen between the complexity of the HVR1 quasispecies nature and HCV replicative levels assessed by viremic levels at the end of follow-up in 1993 (Fig. 3). The number of bands in SSCP analysis ranged between one and three (median, three) for the 10 patients who had low titers of serum HCV RNA below the bDNA cutoff but were positive according to RT-PCR (RTPCR//bDNA0), and between one and six (median, three) for the remaining 28 patients with serum HCV RNA titers detectable by the bDNA assay. The difference did not reach a statistically significant level. Furthermore, no correlation was found between the number of bands in SSCP analysis and serum HCV RNA titers (r Å .19). In this study, we investigated changes in the HVR1 quasispecies complexity for 23 patients, who underwent further detailed follow-up with biweekly serum ALT tests for 24 months after sera were drawn in 1993. The HVR1 quasispecies nature at the beginning and the end of this period was compared with the same run of SSCP analysis. Their serum ALT levels remained within the normal range during this period although the mean value of the biweekly ALT tests differed considerably (median, 20; range, 8-32 U/L). Twelve
FIG. 1. Relationship between the first peak of serum ALT levels at the onset of hepatitis and complexity of HVR1 quasispecies assessed by SSCP analysis in patients with chronic HCV infection (r Å .48; P õ .01).
hpta
WBS: Hepatology
442
YUKI ET AL.
HEPATOLOGY February 1997
FIG. 2. Relationship between the mean serum ALT levels in the chronic hepatitis period showing persistent ALT fluctuation and complexity of HVR1 quasispecies assessed by SSCP analysis in patients with chronic HCV infection (r Å .58; P õ .01).
cases (52%) showed no change in the number of bands in SSCP analysis although changes in the band pattern were seen in eight (67%) of the 12 cases indicating replacement of HCV populations. The number of bands increased by one to four (median, one) in six cases (26%), whereas it decreased by one in the remaining five cases (22%). Thus, no significant change was seen in the HVR1 quasispecies complexity after the asymptomatic period. In these patients, however, a significant direct relation was observed between changes in the HVR1 quasispecies complexity and the mean value of the
FIG. 4. The mean value of biweekly serum ALT tests during asymptomatic HCV infection had relation to the occurrence of changes in complexity of HVR1 quasispecies (r Å .55; P Å .01). The HVR1 quasispecies complexity was assessed by the number of bands in SSCP analysis.
biweekly ALT tests during follow-up (r Å .55, P Å .01) (Fig. 4). The HVR1 quasispecies complexity tended to increase in association with relatively high ALT levels, whereas patients with low ALT levels tended to show no change or decrease in the HVR1 quasispecies complexity. As for changes in HCV viremic levels, serum HCV RNA titers in the 23 patients ranged from RT-PCR//bDNA0 to 107.1 Eq/mL (median, 106.0 Eq/mL) at the beginning of the asymptomatic period and from RT-PCR//bDNA0 to 106.8 Eq/mL (median, RT-PCR// bDNA0) at the end. A slight but significant reduction in HCV viremic levels was observed (P õ .01). No relationship was seen between the percent changes in HCV viremic levels and changes in the number of bands in SSCP analysis (r Å .18). Then again, we correlated the HVR1 quasispecies complexity at the final end of follow-up (1,993 for the 15 cases without the subsequent follow-up and 1,995 for the remaining 23 cases) with the clinical course after infection. At this point, patients’ clinical and virological characteristics (listed in Table 1) remained the same for the posttransfusion hepatitis group and the sporadic hepatitis group. The HVR1 quasispecies complexity had no relation to the term from infection (r Å .10), the duration of serum ALT fluctuation (r Å .15), or the duration of subsequent serum ALT normalization (r Å 0.02). However, it was still directly correlated with the first serum ALT peak at the onset (r Å .51; P õ .01) and the mean ALT levels during the chronic hepatitis period showing persistent ALT elevation (r Å .39, P õ .05). There was no relationship between the HVR1 quasispecies complexity and HCV viremic levels at the final end of follow-up (r Å .19). DISCUSSION
FIG. 3. Relationship between serum HCV RNA titers and complexity of HVR1 quasispecies assessed by SSCP analysis in patients with chronic HCV infection (r Å .19, not significant).
AID
Hepa 0004
/
5P1C$$$$62
01-10-97 15:27:56
HCV, like other RNA viruses, is thought to mutate rapidly because of the high error rate in RNA replication, leading to the simultaneous coexistence of multiple variants in the same individual (quasispecies). There are hypervariable regions located at the N-terminal part of the envelope 2 region showing high amino acid variability,2,3 which seem to have pervasive clinical implications in that the variability could enable the HCV to escape from the host’s immune system6,7 and also resist antiviral therapy.8-10 However, the development of the quasispecies nature in the hypervariable regions is not fully understood in the natural course of HCV infection. It may be affected by the host immune pressure and also by some viral characteristic associated with mutation frequencies.
hpta
WBS: Hepatology
HEPATOLOGY Vol. 25, No. 2, 1997
YUKI ET AL.
To address the question of which factor has relevance to the development of the HVR1 quasispecies nature in the course of chronic HCV infection, we studied the complexity of the HVR1 quasispecies in relation to various clinical characteristics after HCV infection. For this purpose, we attempted to evaluate the HVR1 quasispecies nature by SSCP analysis. Thus far, the HCV quasispecies nature has been investigated by cloning and sequencing of PCR products. However, such analysis requires much effort to isolate and sequence multiple cDNA clones; only a limited number of clones obtained from a small number of patients can be examined. Another drawback is that a limited number of complementary DNA clones do not necessarily reflect the total spectrum of HCV quasispecies in vivo. On the other hand, SSCP analysis can separate DNA fragments of the same size into different electrophoretic bands depending on their sequence-specific threedimensional conformations.20,21 The number of bands is directly proportional to the degree of sequence complexity. Thus, SSCP analysis has the advantage of enabling rough estimation of the major quasispecies of the total virus population in many samples. The data obtained showed that disease activity in the course of chronic HCV infection showed relevance to the present HVR1 quasispecies nature. The degree of complexity of the HVR1 quasispecies at the end of follow-up was directly related to the levels of serum aminotransferase elevation after infection. On the other hand, the route of infection and the total period from infection had no apparent relation to the complexity of the HVR1 quasispecies. In the present study, we further investigated changes in the HVR1 quasispecies complexity after a period of asymptomatic HCV infection showing normal ALT levels. The HVR1 quasispecies complexity showed no significant change after the asymptomatic period. However, changes in the HVR1 quasispecies complexity were seen in half of the patients examined, which had relevance to serum ALT levels during follow-up. Increase in the HVR1 quasispecies complexity tended to occur in association with relatively high ALT levels. On the other hand, in patients with low ALT levels, decrease in the HVR1 quasispecies complexity could be observed, which may be a reflection of competitive selection of the quasispecies populations in vivo. It has been suggested that hemodialysis patients can show low serum ALT activity and the real upper limit of the normal range may be lower in such patients compared with normal control subjects.22 Taken together, these findings indicate that disease activity in HCV infection may be a factor which contributes to the development of the HVR1 quasispecies nature. Thus far, a few reports suggested that the rate of mutation in the HVR1 correlated with the pattern of ALT profiles in chronic HCV infection and was high in patients with high ALT levels.23,24 Our findings seem to be generally compatible with such studies on the mutation rate. However, controversy remains about the mechanism of the development of the HVR1 quasispecies complexity, and further studies are necessary to address this issue. The marked elevation of serum aminotransferase levels can be associated with the rapid elimination of infected hepatocytes by active host immunological reactions to viral components, and the intensity of such host immune pressure may be relevant to the progression of the quasispecies nature in HCV HVR1, which is considered to bear neutralizing epitopes. It has been shown that the HVR1 sequence remained unchanged in an agammaglobulinemic patient with chronic hepatitis C, thus providing support for the hypothesis that the generation of genetic variation in HVR1 is the result of host immune pressure.25 Human immunodeficiency virus type 1 also has variable domains in the envelope gene, and the third variable domain, V3, includes recognition sites for both humoral and T-cell immune responses. Several reports revealed that greater V3 quasispecies complexity is associ-
AID
Hepa 0004
/
5P1C$$$$63
01-10-97 15:27:56
443
ated with a slow decline of CD4/ cell numbers after infection and the V3 quasispecies evolution is directly related to the duration of the immunocompetent period.26,27 Similarly, intense immune pressure during the period with aminotransferase elevation may play an important role in the development of the HCV HVR1 quasispecies complexity. However, we can’t exclude a possibility that the quasispecies changes in HCV infection conversely enhance host immunological reactivity, resulting in active liver inflammation. Thus, controversy remains about the causal relation between host immune pressure and the development of the HVR1 quasispecies complexity. Alternatively, the marked elevation of aminotransferase levels may be related to the acceleration of HCV replication, which results in an increase in mutation frequencies in HVR1. In the present study, no significant correlation was found between the degree of complexity of the HVR1 quasispecies and HCV replicative levels. Moreover, changes in HCV replicative levels had no relation to those in the HVR1 quasispecies complexity. Thus, it seems that the HVR1 quasispecies nature in chronic HCV infection has distinct virological implications from HCV replicative levels assessed by viremic levels. Nevertheless, we cannot completely exclude a possible interrelationship between the progression of the HVR1 quasispecies nature and viral replicative levels in the course of HCV infection. HCV replicative levels at a few points in time do not always reflect viral replication during the entire follow-up period. Further studies are necessary to address this issue more accurately. Finally, the present study showed that the HVR1 quasispecies nature in chronic HCV carriers had relation to only disease activity during HCV infection. Patients with HCV infection showing higher complexity of the HVR1 quasispecies are more likely to fail to neutralize the virus and resist antiviral therapy. Thus, from the virological point of view, the current study sheds further light on adverse implications of active liver inflammation in the course of HCV infection. REFERENCES 1. Choo Q-L, Kuo G, Weiner AJ, Overby LR, Bradley DW, Houghton M. Isolation of a cDNA clone derived from a blood-borne non-A, non-B viral hepatitis genome. Science 1989;244:359-362. 2. Weiner AJ, Brauer MJ, Rosenblatt J, Richman KH, Tung J, Crawford K, Bonino F, et al. Variable and hypervariable domains are found in the regions of HCV corresponding to the flavivirus envelope and NS1 proteins and the pestivirus envelope glycoproteins. Virology 1991;180:842-848. 3. Hijikata M, Kato N, Ootsuyama Y, Nakagawa M, Ohkoshi S, Shimotohno K. Hypervariable regions in the putative glycoprotein of hepatitis C virus. Biochem Biophys Res Commun 1991;175:220-228. 4. Choo Q-L, Kuo G, Ralston R, Weiner A, Chien D, Van Nest G, Han J, et al. Vaccination of chimpanzees against infection by the hepatitis C virus. Proc Natl Acad Sci U S A 1994;91:1294-1298. 5. Shimizu Y, Hijikata M, Iwamoto A, Alter HJ, Purcell RH, Yoshikura H. Neutralizing antibodies against hepatitis C virus and the emergence of neutralization escape mutant viruses. J Virol 1994;68:1494-1500. 6. Weiner AJ, Geysen HM, Christopherson C, Hall JE, Mason TJ, Saracco G, Bonino F, et al. Evidence for immune selection of hepatitis C virus (HCV) putative envelope glycoprotein variants: potential role in chronic HCV infections. Proc Natl Acad Sci U S A 1992;89:3468-3472. 7. Kato N, Sekiya H, Ootsuyama Y, Nakazawa T, Hijikata M, Ohkoshi S, Shimotohno K. Humoral immune response to hypervariable region 1 of the putative envelope glycoprotein (gp70) of hepatitis C virus. J Virol 1993; 67:3923-3930. 8. Okada S, Akahane Y, Suzuki H, Okamoto H, Mishiro S. The degree of variability in the amino terminal region of the E2/NS1 protein of hepatitis C virus correlates with responsiveness to interferon therapy in viremic patients. HEPATOLOGY 1992;16:619-624. 9. Kanazawa Y, Hayashi N, Mita E, Li T, Hagiwara H, Kasahara A, Fusamoto H, et al. Influence of viral quasispecies on effectiveness of interferon therapy in chronic hepatitis C patients. HEPATOLOGY 1994;20:1121-1130. 10. Moribe T, Hayashi N, Kanazawa Y, Mita E, Fusamoto H, Negi M, Kaneshige T, et al. Hepatitis C viral complexity detected by single-strand conformation polymorphism and response to interferon therapy. Gastroenterology 1995;108:789-795. 11. Takada N, Takase S, Enomoto N, Takada A, Date T. Clinical backgrounds of the patients having different types of hepatitis C virus genomes. J Hepatol 1992;14:35-40.
hpta
WBS: Hepatology
444
YUKI ET AL.
HEPATOLOGY February 1997
12. Lau JYN, Davis GL, Kniffen J, Qian K-P, Urdea MS, Chan CS, Mizokami M, et al. Significance of serum hepatitis C virus RNA levels in chronic hepatitis C. Lancet 1993;341:1501-1504. 13. Hagiwara H, Hayashi N, Mita E, Takehara T, Kasahara A, Fusamoto H, Kamada T. Quantitative analysis of hepatitis C virus RNA in serum during interferon alfa therapy. Gastroenterology 1993;104:877-883. 14. Mita E, Hayashi N, Hagiwara H, Ueda K, Kanazawa Y, Kasahara A, Fusamoto H, et al. Predicting interferon therapy efficacy from hepatitis C virus genotype and RNA titer. Dig Dis Sci 1994;39:977-982. 15. Yuki N, Hayashi N, Kasahara A, Hagiwara H, Takehara T, Oshita M, Katayama K, et al. Pretreatment viral load and response to prolonged interferon-a course for chronic hepatitis C. J Hepatol 1995;22:457-463. 16. Takamizawa A, Mori C, Fuke I, Manabe S, Murakami S, Fujita J, Onishi E, et al. Structure and organization of the hepatitis C virus genome isolated from human carriers. J Virol 1991;65:1105-1113. 17. Kwok S, Higuchi R. Avoiding false positives with PCR. Nature 1989;339: 237-238. 18. Okamoto H, Sugiyama Y, Okada S, Kurai K, Akahane Y, Sugai Y, Tanaka T, et al. Typing hepatitis C virus by polymerase chain reaction with typespecific primers: application to clinical surveys and tracing infectious sources. J Gen Virol 1992;73:673-679. 19. Okamoto H, Okada S, Sugiyama Y, Yotsumoto S, Tanaka T, Yoshizawa H, Tsuda F, et al. The 5*-terminal sequence of the hepatitis C virus genome. Jpn J Exp Med 1990;60:167-177. 20. Orita M, Iwahana H, Kanazawa H, Hayashi K, Sekiya T. Detection of
AID
Hepa 0004
/
5P1C$$$$63
01-10-97 15:27:56
21. 22.
23. 24.
25. 26. 27.
polymorphisms of human DNA by gel electrophoresis as single-strand conformation polymorphisms. Proc Natl Acad Sci U S A 1989;86:2766-2770. Orita M, Suzuki Y, Sekiya T, Hayashi K. Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 1989;5:874-879. Yasuda K, Okuda K, Endo N, Ishiwatari Y, Ikeda R, Hayashi H, Yokozeki K, et al. Hypoaminotransferasemia in patients undergoing long-term hemodialysis: clinical and biochemical appraisal. Gastroenterology 1995;109: 1295-1300. Kurosaki M, Enomoto N, Marumo F, Sato C. Rapid sequence variation of the hypervariable region of hepatitis C virus during the course of chronic infection. HEPATOLOGY 1993;18:1293-1299. Enomoto N, Kurosaki M, Tanaka Y, Marumo F, Sato C. Fluctuation of hepatitis C virus quasispecies in persistent infection and interferon treatment revealed by single-strand conformation polymorphism analysis. J Gen Virol 1994;75:1361-1369. Kumar U, Monjardino J, Thomas HC. Hypervariable region of hepatitis C virus envelope glycoprotein (E2/NS1) in an agammaglobulinemic patient. Gastroenterology 1994;106:1072-1075. Delwart EL, Sheppard HW, Walker BD, Goudsmit J, Mullins JI. Human immunodeficiency virus type 1 evolution in vivo tracked by DNA heteroduplex mobility assays. J Virol 1994;68:6672-6683. Lukashov VV, Kuiken CL, Goudsmit J. Intrahost human immunodeficiency virus type 1 evolution is related to length of the immunocompetent period. J Virol 1995;69:6911-6916.
hpta
WBS: Hepatology