Relationship Between Heterosis and Parental Genetic Distance Based on Molecular Markers for Functional Genes Related to Yield Traits in Rice

Rice Science, 2010, 17(4): 288−295 Copyright © 2010, China National Rice Research Institute. Published by Elsevier BV. All rights reserved DOI: 10.1016/S1672-6308(09)60029-9

Relationship Between Heterosis and Parental Genetic Distance Based on Molecular Markers for Functional Genes Related to Yield Traits in Rice ZHANG Tao1, 2, NI Xian-lin1, 3, JIANG Kai-feng1, 2, DENG Hua-feng4, HE Qing4, YANG Qian-hua1, YANG Li1, 2, WAN Xian-Qi1, CAO Ying-jiang1, ZHENG Jia-kui1, 2, 3 (1Rice and Sorghum Research Institute, Sichuan Academy of Agricultural Sciences, Deyang 618000, China; 2Luzhou Branch of Chinese National Center for Rice Improvement, Luzhou 646000, China; 3College of Bioengineering, Chongqing University, Chongqing 400044, 4 China; China National Hybrid Rice R & D Center, Changsha 410125, China)

Abstract: The genetic distances among 18 cytoplasmic male sterile lines and 11 restorer lines were analyzed with molecular markers derived from yield-related functional genes. The correlation between parental genetic distance and heterosis was investigated by analyzing the performance of 47 combinations. The results showed that the genetic distance was significantly correlated with yield heterosis (r=0.29*), but not significantly correlated with heterosis for other traits, such as number of effective panicles per plant, seed setting rate, 1000-grain weight, number of grains per panicle and theoretical yield. However, the correlation coefficient was so small that the parental genetic distance could not to be used to predict heterosis. Key words: rice; yield related traits; simple sequence repeats; genetic distance; heterosis; correlation

How to efficiently screen for suitable parents and correctly predict the heterosis of certain parental combinations has been of great interest for breeders who are actively involved in the application of this phenomenon in crop breeding. Genetic differences between parents are the primary cause of heterosis. Breeders have extensively investigated the genetic diversities between parents and their relationship with heterosis for predicting heterosis. However, limitations in traditional methods based on genetic relationship, geographic origin, morphological markers and isozymes (Zhu et al, 1987; Hinze et al, 2003) made the prediction of heterosis difficult. The development of molecular marker techniques provides a new way for heterosis prediction, which effectively improves the efficiency of hybrid breeding. Sun et al (2000) showed that the over-parent heterosis was obviously correlated with indica-japonica differentiation of parents. Furthermore, the over-parent heterosis is more correlated with the differences of two parents at DNA level than at morphological level, suggesting that DNA sequence is a better predictor of heterosis than phenotypic characteristics. Using molecular markers to reveal genetic differences among parents and then to predict heterosis Received: 8 December 2009; Accepted: 18 June 2010 Corresponding author: ZHENG Jia-kui ([email protected])

have been reported with inconsistent results. Cai et al (2005), Zhao et al (2008) and other researchers suggested that genetic distances revealed by molecular markers were highly and positively correlated with heterosis in rice. Zhang et al (2000) suggested that the mid-parent heterosis and competitive heterosis for whole growth duration, plant height, and panicle length were significantly correlated with parental genetic distance calculated based on random amplified polymorphic DNA (RAPD) markers. The greater the parental genetic distance are, the more the possibility to obtain strong heterosis in hybrid. However, Liao et al (1998) and Zhang et al (2006) showed that there was no obvious correlation between genetic distance detected by molecular markers and F1 heterosis, suggesting that genetic distance could not be used to predict heterosis. Zhang et al (1994, 1995) showed that genetic distance might be used to predict heterosis when the specific heterozygosity between parents was highly correlated with hybrid performance. But this relationship would be affected by parental genetic diversity and complexity of the genetic mechanisms of heterosis. Xiao et al (1996b) also obtained similar results in hybrid rice by using PCR-based molecular markers. The correlation between genetic distance and heterosis depends on the types of materials. The genetic differences between

ZHANG Tao, et al. Correlation between Heterosis and Parental Genetic Distance in Rice

parents were analyzed with non-specific molecular markers randomly distributed in rice genome in previous studies. These genetic differences calculated based on markers at random loci might cause inconsistent results when analyzing the correlation between parental genetic distance and heterosis. Given the fact that the heterosis of hybrid rice is mainly determined by yield related traits, we speculate that it may not be proper to analyze the correlation between the genetic difference in the parents and yield heterosis using the genetic distance revealed by whole-genome analysis. It may be more reliable to analyze the parental differences based on molecular markers derived from yield-related genes to predict yield heterosis. At present, many genes related to rice yield traits have been cloned or fine-mapped (Huang et al, 2008; Jiang et al, 2008). It may be more valuable if we use the markers for these cloned or fine-mapped genes to analyze parental genetic distance and to predict heterosis. In this study, 29 rice lines and 47 corresponding hybrid combinations were used. Rice yield-related gene markers were adopted to detect genetic differences between parents in order to exam the correlation of parental genetic distance and heterosis.

MATERIALS AND METHODS Plant materials Twenty-nine parental lines of three-line system hybrid rice, including 18 cytoplasmic male sterile (CMS) lines (2832A, 5206A, Gang 46A, 8680A, II-32A, Chuanxiang 29A, Dexiang 074A, 9168A, 5220A, DF17A, DF1A, DF24A, DF13A, DF22A, Jing 077A, 6248A, 4248A and Luxiang 618A) and 11 restorer lines (R188, R7254, R7182, R8258, HR57, H103, R527, R494, R157, Luhui 0738 and H82), and a control hybrid rice combination Gangyou 725, as well as 47 hybrid rice combinations derived from above parental lines, were used in the experiment. Field trials The experiment under a randomized block design with three replications was conducted at the Deyang base of Sorghum and Rice Research Institute, Sichuan Academy of Agricultural Sciences, China in the summer of 2008. Seedlings of a parental line or combination

289

were transplanted to a 6-row plot with a plant spacing of 16.7 cm × 33.3 cm, 40 hills per row and two seedlings per hill. The number of grains per panicle, number of effective panicles per plant, seed setting rate, 1000-grain weight, yield and other agronomic traits were surveyed. SSR analysis An improved SDS method (McCouch et al, 2002; Zhang, 2007) was adopted to extract DNA. Forty-one markers for functional genes related to yield traits located on 10 rice chromosomes were selected to analyze 29 parental lines for polymorphism (Table 1). Primers were synthesized by the Invitrogen Ltd, China. The 25 µL PCR reaction system contained 50 mmol/L KCl, 10 mmol/L Tris-HCl (pH 9.0), 1.5 mmol/L MgCl2, 200 μmol/L dNTPs, 50–100 ng of genomic DNA, 1 U of Taq polymerase and 0.1 μmol/L primers. The PCR was performed under the following conditions: 94ºC for 5 min followed by 35 cycles at 94ºC for 1 min, 55ºC for 1 min and 72ºC for 1 min, and a final extension at 72ºC for 10 min. Statistical analysis Each detected polymorphic band was regarded as an allele. According to the results of PCR amplification, the assignments were ‘1’ when there was a band in the same migration location, ‘0’ for no band and ‘9’ for a missing band. The genetic distance (GD) between parental lines was calculated according to the method of Nei et al (1979): GD=1–2Nij/(Ni+Nj), where Ni is the number of appeared bands for i line, Nj is the number of appeared bands for j line, and Nij is the number of shared bands for i and j lines. Polymorphism index content (PIC)=1–Σ(pi)2, where pi is the gene frequency on the ith-polymorphic locus. Standard heterosis = (F1–CK)/CK×100%; Average heterosis = (F1– X )/ X ×100%. Where F1 is the average value for each hybrid combination, CK is the value of the control, and X is the average value for all combinations. The percentage parameters were calculated after arcsine transformation. The EXCEL 2003 and NTSYS-pc2.1 software were applied for data processing and statistical analysis. Cluster analysis for the 29 parental lines was conducted with the NTSYS-pc2.1 software, and the relationships between parents were

Rice Science, Vol. 17, No. 4, 2010

290

Table 1. Markers for yield-related functional genes in rice. Primer RM1 RM5 RM212 RM246 RM302 RM472 RM145 RM208 RM213 RM262 RM263 RM2634 RM5897 RM6318 RM130 RM411 RM520 RM571 RM3646 RM6881 RM252 RM273 RM303 RM16 RM17 RM18 RM26 RM289 RM3 RM70 RM2256 RM5436 RM5499 RM201 RM205 RM228 RM4 RM20 RM202 RM206 RM209

Chromosome 1 1 1 1 1 1 2 2 2 2 2 2 2 2 3 3 3 3 3 3 4 4 4 5 5 5 5 5 6 7 7 7 7 9 9 10 11 11 11 11 11

Forward primer gcgaaaacacaatgcaaaaa tgcaacttctagctgctcga ccactttcagctactaccag gagctccatcagccattcag tcatgtcatctaccatcacac ccatggcctgagagagagag ccggtaggcgccctgcagtttc tctgcaagccttgtctgatg atctgtttgcaggggacaag cattccgtctcggctcaact cccaggctagctcatgaacc gattgaaaattagagtttgcac ggcatcttcccctctctctc tgctgcttctgtccagtgag tgttgcttgccctcacgcgaag acaccaactcttgcctgcat aggagcaagaaaagttcccc ggaggtgaaagcgaatcatg actagagcaccctcgctgag aaggcacctcctcctcctac ttcgctgacgtgataggttg gaagccgtcgtgaagttacc gcatggccaaatattaaagg cgctagggcagcatctaaa tgccctgttattttcttctctc ttccctctcatgagctccat gagtcgacgagcggcaga ttccatggcacacaagcc acactgtagcggccactg gtggacttcatttcaactcg gtgcttgcatataacctata caaagggggtgtcctctatg tggagtacgacgtgatcgtg ctcgtttattacctacagtacc ctggttctgtatgggagcag ctggccattagtccttgg ttgacgaggtcagcactgac atcttgtccctgcaggtcat cagattggagatgaagtcctcc cccatgcgtttaactattct atatgagttgctgtcgtgcg

Reverse primer

Functional gene

gcgttggttggacctgac gcatccgatcttgatggg cacccatttgtctctcattatg ctgagtgctgctgcgact atggagaagatggaatacttgc agctaaatggccatacggtg caaggaccccatcctcggcgtc taagtcgatcattgtgtggacc aggtctagacgatgtcgtga cagagcaaggtggcttgc gctacgtttgagctaccacg tgccgagatttagtcaacta ccaacccaaaccagtctacc ggatcataacaagtgcctcg ggtcgcgtgcttggtttggttc tgaagcaaaaacatggctagg gccaatgtgtgacgcaatag cctgctgctctttcatcagc ctcagccaccccatcaac aagcagaggaagacgacgac atgacttgatcccgagaacg gtttcctacctgatcgcgac ggttggaaatagaagttcggt aacacagcaggtacgcgc ggtgatcctttcccatttca gagtgcctggcgctgtac ctgcgagcgacggtaaca ctgtgcacgaacttccaaag cctccactgctccacatctt gatgtataagatagtccc agatcaaccttcttattcag gttgctcgtcctacatgtgc cagaaacgggaggggatc ctacctcctttctagaccgata ctggcccttcacgtttcagtg gcttgcggctctgcttac agggtgtatccgactcatcg gaaacagaggcacatttcattg ccagcaagcatgtcaatgta cgttccatcgatccgtatgg caacttgcatcctcccctcc

qGW-1 yld1.1 gw1.1 pss1.1 gw1.1 gpl1.1 GW2 gw2.1 gpl2.1 np2.1 Ftg-1 GW2 GW2 GW2 gw3.2 Gs3 gw3.1 gw3.2 Gs3 Gs3 qpn4.4 qpn4.4 pss4.1 qSW5 qSW5 qSW5 qGW-5 qGW5 Moc1 Ghd7 Ghd7 Ghd7 Ghd7 gw9 gw9.2 gw10b gw11 gw11.1 ppl11.1 qGW-11-1 gw11

represented graphically in the form of dendrogram.

RESULTS Analysis of functional gene markers A total of 41 loci and 105 alleles in the 29 rice parental lines were detected using the 41 functional gene markers, showing the polymorphic frequency of 100%. The allele number per locus ranged from 2 to 4 with an average of 2.56, and the PIC ranged from 0.12 (RM262) to 0.66 (RM252) with an average of 0.40, indicating a rich genetic diversity among the parental lines. The genetic distance among 18 CMS and 11 restorer lines ranged from 0.49 to 0.87, with an average of 0.70 (Table 2). The genetic distance was maximum

Reference Cho et al, 2003 Xiao et al, 1996a; Xiao et al, 1998 Moncada et al, 2001 Thomson et al, 2003 Moncada et al, 2001 Xiao et al, 1996a; Septiningsih et al, 2003 Lin et al, 2007 Marri et al, 2005 Moncada et al, 2001; Septiningsi et al, 2003 Marri et al, 2005 Deng, 2005

Thomson et al, 2003 Zhang et al, 2006 Septiningsih et al, 2003

Thomson et al, 2003 Ayahiko et al, 2008

Cho et al, 2003 Sun et al, 2005 Li et al, 2003 Zhang et al, 2008

Hua et al, 2003 Hua et al, 2003 Li et al, 2000 Moncada et al, 2001 Moncada et al, 2001; Septiningsi et al, 2003 Cho et al, 2003

(0.87) between 5206A and R7254 or R527, and minimum (0.49) between DF24A and R494. For the CMS lines, 5206A showed a maximal average genetic distance of 0.80, and DF24A showed a minimal average genetic distance of 0.64 from the restorer lines. For the restorer lines, R157 had a maximal average genetic distance of 0.75, and R8258 had a minimal average genetic distance of 0.66 from the CMS lines. The relatively large genetic distance between the CMS lines and the restorer lines indicated that the used parental lines were genetically and highly different, and were good for matching a combination with strong heterosis. The 29 parental lines were clearly clustered into two major categories (CMS line group and restorer line group) (Fig. 1) at the genetic distance

ZHANG Tao, et al. Correlation between Heterosis and Parental Genetic Distance in Rice

291

Table 2. Genetic distance among 18 cytoplasmic male sterile lines and 11 restorer lines. Male sterile line 2832A 5206A Gang 46A 8680A II-32A Chuanxiang 29A Dexiang 074A 9168A 5220A DF17A DF1A DF24A DF13A DF22A Jiing 077A 6248A 4248A Luxiang 618A

R188 0.68 0.80 0.68 0.68 0.64 0.63 0.77 0.63 0.70 0.75 0.68 0.66 0.76 0.67 0.72 0.73 0.80 0.69

R7254 0.74 0.87 0.74 0.70 0.74 0.74 0.81 0.70 0.68 0.77 0.72 0.70 0.79 0.71 0.76 0.75 0.82 0.76

R7182 0.68 0.80 0.70 0.68 0.70 0.72 0.79 0.68 0.66 0.75 0.66 0.63 0.79 0.63 0.72 0.75 0.77 0.80

R8258 0.66 0.77 0.67 0.69 0.60 0.60 0.70 0.64 0.63 0.68 0.65 0.62 0.65 0.64 0.67 0.68 0.74 0.62

of 0.60, which was consistent with their pedigree. These results suggest that the functional gene markers could be effectively adopted in germplasm identification and genetic diversity research, which is in accordance with the results in other studies (Zhao et al, 2002; Zhang, 2007). Heterosis of hybrid rice combinations The average heterosis and standard heterosis for the six yield-related traits in the 47 hybrid rice

Fig. 1. Dendrogram by cluster analysis for 29 rice lines.

Restorer line HR57 H103 0.67 0.68 0.76 0.80 0.68 0.64 0.70 0.64 0.63 0.62 0.65 0.61 0.71 0.72 0.65 0.70 0.66 0.73 0.71 0.70 0.66 0.70 0.67 0.63 0.66 0.66 0.58 0.65 0.70 0.72 0.69 0.73 0.78 0.75 0.67 0.61

R527 0.74 0.87 0.74 0.76 0.70 0.74 0.79 0.75 0.73 0.79 0.76 0.70 0.72 0.71 0.76 0.75 0.73 0.73

R494 0.57 0.75 0.62 0.60 0.57 0.59 0.70 0.57 0.66 0.61 0.57 0.49 0.66 0.61 0.62 0.61 0.65 0.63

R157 0.72 0.85 0.72 0.77 0.68 0.72 0.81 0.74 0.75 0.79 0.79 0.74 0.68 0.73 0.79 0.75 0.80 0.69

Luhui 0738 0.68 0.75 0.70 0.68 0.62 0.61 0.66 0.61 0.68 0.74 0.66 0.63 0.62 0.65 0.76 0.71 0.71 0.65

H82 0.68 0.75 0.66 0.74 0.66 0.68 0.72 0.66 0.73 0.72 0.68 0.61 0.66 0.65 0.72 0.71 0.71 0.65

combinations are shown in Table 3. Average heterosis The average heterosis for the number of grains per panicle varied the greatest (-32.08%–31.59%), whereas that for yield varied the smallest (-9.10%– 9.67%) among the average heteroses for the six traits. The number of hybrid combinations with positive average heterosis was the most for the seed-setting rate among all the six traits, with 28 (59.57%) combinations showing

Rice Science, Vol. 17, No. 4, 2010

292

Table 3. Average heterosis and standard heterosis for six yield-related traits. Average heterosis Trait

Range (%)

No. of effective panicles per plant -23.64–20.27 Seed setting rate -20.49–18.33 1000-grain weight -14.17–13.18 No. of grains per panicle -32.08–31.59 Theoretical yield -18.94–22.26 Actual yield -9.10–9.67

No. of combinations with positive (negative)heterosis

Range (%)

25 (22) 28 (19) 21 (26) 19 (28) 26 (21) 23 (24)

-15.79–32.63 -24.35–12.58 -3.73–26.95 -44.91–6.74 -19.72–21.08 -8.31–10.62

positive heterosis. Standard heterosis In the 47 hybrid rice combinations, the standard heterosis for the number of effective panicles per plant ranged from -15.79% to 32.63% with an average of 10.28%, and 33 combinations (70.21%) had more number of effective panicles than the control Gangyou 725; the standard heterosis for the 1000-grain weight ranged from -3.73% to 26.95% with an average of 12.16%, and 44 combinations (93.62%) had higher grain weight than Gangyou 725. Some of the hybrid rice combinations performed well in both theoretical and actual yields, and about half of the combinations showed a positive heterosis, suggesting that these combinations may be of great value in use. Most of the combinations showed a negative heterosis for the number of grains per panicle and seed setting rate, which might be related with the control selected. Correlation between parental genetic distance and hybrid heterosis Correlation analysis between parental genetic distance and hybrid heterosis showed that parental genetic distance was equally correlated with either the standard heterosis or the average heterosis for each of the six yield-related traits (Table 4). The correlations between the genetic distance and the heterosis for number of effective panicles per plant, number of grains Table 4. Coefficients of correlation between parental genetic distance and heterosis. Trait No. of effective panicles per plant Seed-setting rate 1000-grain weight No. of grains per panicle Theoretical yield Actual yield *, P<0.05.

Average heterosis Standard heterosis 0.13 -0.07 -0.24 0.13 0.17 0.29*

Standard heterosis

0.13 -0.07 -0.24 0.13 0.17 0.29*

Average (%)

No. of combinations with positive (negative) heterosis

10.28 -4.85 12.16 -18.88 -0.96 0.87

33 (14) 15 (32) 44 (3) 2 (45) 23 (24) 25(22)

per panicle, theoretical yield or actual yield were positive, whereas those between the genetic distance and the heterosis for seed-setting rate or 1000-grain weight were negative. Moreover, none of these correlations were significant except the heterosis for actual yield of hybrid was significantly correlated with the parental genetic distance (r=0.29*). This suggests that the parental genetic distance was only reflected in the heterosis for actual yield but not other traits in this experiment. Therefore, it is possible to predict heterosis by using yield-related functional gene markers.

DISCUSSION The heterosis depends on a certain degree of genetic differences and complementary traits of parents. In general, the bigger the genetic difference is, the greater the heterosis is. Owing to its simplicity in use, DNA molecular markers have been widely used in the study of heterosis prediction. However, the researchers have different views on molecular marker based prediction. Some suggested that the molecular markers of genetic distance based on molecular markers were of great value in predicting heterosis (Lee et al, 1989; Smith et al, 1990), which was confirmed in maize heterosis prediction, and great success had been achieved. In addition, some researchers obtained the same results in the prediction of heterosis in rice (Wang et al, 1994; Li et al, 2000; Zhang et al, 2000; Cai et al, 2005). But some researchers believed that the genetic distance based on molecular markers could not be reliable to predict heterosis (Li et al, 1998; Liao et al, 1998; Liu et al, 2001; Zhu et al, 2001; Zhang et al, 2006; Zhao et al, 2009), which was supported by hybrid rice breeding. Some studies suggested that it was difficult to use molecular markers to predict the heterosis of hybrid rice (Zhang et al, 1994, 1995; Xiao et al, 1996b; Zhang et al, 1996; Zhao et al, 1999).

ZHANG Tao, et al. Correlation between Heterosis and Parental Genetic Distance in Rice

The different views are attributed to different results in the relationship between molecular marker-detected heterozygosity and heterosis, which were associated with the genetic backgrounds of rice germplasms and the complex genetic mechanisms of heterosis, and so on. Furthermore, the differences in experimental materials, designs and molecular markers also brought different results. The genetic differences between parents have many aspects, involving many traits and loci, but not all traits or loci are related to yield. Thus, it was impossible that the difference in an individual trait or locus between parents caused heterosis, or all the polymorphic loci were associated with heterosis (Liao et al, 1998). The utilization of heterosis of hybrid rice mainly depends on yield heterosis, so we believe that it may be more reliable to use yield-related loci to analyze genetic differences and investigate the correlation between parental genetic distance and hybrid yield heterosis. In this study, we selected 41 yield-related functional gene markers which have been fine-mapped or cloned to analyze the genetic differences between parents and to determine the correlation between parental genetic distance and heterosis. The results showed that the genetic distance and the actual yield was significantly and positively correlated, which was consistent with our speculation. We consider that it is feasible to use yield-related gene markers to predict yield heterosis of hybrid rice. However, the heterosis for the other yield-related traits had no significant correlation with the genetic distance. We believe that the genetic distance analyzed in this study was based on all used yieldrelated loci, and not all the genetic differences detected by the markers were related to the yield heterosis. Our study confirmed the feasibility of yield-related gene markers to study yield heterosis. Based on the above findings, we suggest that yield-related gene markers could be used to predict yield heterosis. However, the coefficients of correlation were too small in our study, so that the genetic distance based on yield-related gene markers may not be reliable in the heterosis prediction, and similar results were documented in other publications. Regarding using functional gene molecular markers to predict hybrid performance, the selection of DNA molecular markers and the methodology of heterosis prediction need to be improved. The further development

293

of functional genomics and the establishment of rice saturated genetic maps and physical maps are vital for the research in this area.

ACKNOWLEDGEMENTS This work was supported by the National High Technology Research and Development of China (Grant No. 2009AA101101); the China National Jumping Plan of Agricultural Technology and Science; the Tackling Key Subject of Rice Breeding in Sichuan Province, China (Grant No. YZGG2006-1); and the Youth Foundation of Sichuan Academy of Agricultural Sciences, China (Grant No. 2008QNJJ).

REFERENCES Ayahiko S, Takeshi I, Kaworu E, Takeshi E, Hiromi K, Saeko K, Masahiro Y. 2008. Deletion in a gene associated with grain size increased yields during rice domestication. Nat Genet, 40(8): 1023–1028. Cai J, Lan W. 2005. Using of AFLP marker to predict the hybrid yield and yield heterosis in rice. Chin Agric Sci Bull, 21(4): 39–43. (in Chinese with English abstract). Cho Y C, Suh J P, Choi I S. 2003. QTLs analysis of yield and its related traits in wild rice relative Oryza rufipogon. Treat Crop Res, 4: 19–29. Deng Q M. 2005. Mapping and cloning of rice few-tillering candidate gene and rice bacterial blight resistance breeding by molecular marker-assisted [PhD Dissertation]. Chengdu: Sichuan Agricultural University. (in Chinese with English abstract) Fan C C, Xing Y Z, Mao H L, Lu T T, Han B, Xu C G, Li X H, Zhang Q F. 2006. GS3, a major QTL for grain length and weight and minor QTL for grain width and thickness in rice, encodes a putative transmembrane protein. Theor Appl Genet, 112(6): 1164– 1171. Hinze L L, Lamkey K R. 2003. Absence of epistasis for grain yield in elite maize hybrids. Crop Sci, 43(1): 46–56. Hua J P, Xing Y Z, Wu W R, Xu C G, Sun X L, Yu S B, Zhang Q F. 2003. Single-locus heterotic effects and dominance by dominance interactions can adequately explain the genetic basis of heterosis in an elite rice hybrid. Proc Natl Acad Sci USA, 100: 2574–2579. Huang X B, Tian Z H, Deng Z Q, Zheng J T, Lin C B, Tang J X. 2008. Preliminary identification of a novel Sanming dominant male sterile gene in rice (Oryza sativa L.). Acta Agron Sin, 34(10): 1865–1868. (in Chinese with English abstract). Jiang L, Guo L B, Jiang H, Zeng D L, Hu J, Wu L W, Liu J, Gao Z Y, Qian Q. 2008. Genetic analysis and fine-mapping of a dwarfing with withered leaf-tip mutant in rice. J Genet Genom, 35(12): 715–721.

Rice Science, Vol. 17, No. 4, 2010

294 Lee M, Godshalk K, Lamkey K R, Woodman W W. 1989. Association

RING-type E3 ubiquitin ligase. Nat Genet, 39(5): 623–630.

of restriction fragment length polymorphisms among maize

Sun C Q, Jiang Y B, Chen L, Wu C M, Li Z C, Wang X K. 2000.

inbreds with agronomic performance of their crosses. Crop Sci,

Studies on the relationship between heterosis and genetic

29(4): 1067–1071.

differentiation in hybrid rice (Oryza sativa L.). Acta Agron Sin,

Li R H, Xu C G, He Y Q, Yuan L P, Wang X K. 1998. Relationship

26(6): 641–649. (in Chinese with English abstract)

between the extent of genetic differentiantion in parental lines

Thomson M J, Tai T H, McClung A M, Lai X H, Hinga M E,

and heterosis of indica-japonica hybrid rice. Acta Agron Sin,

Lobos K B, Xu Y, Martinez C P, McCouch S R. 2003. Mapping

24(5): 564–576. (in Chinese with English abstract)

quantitative trait loci for yield, yield components and

Li X Y, Qian Q, Fu Z M, Wang Y H, Xiong G S, Zeng D L, Wang

morphological traits in an advanced backcross population

X Q, Liu X F, Teng S, Fujimoto H, Yuan M, Luo D, Han B, Li J

between Oryza rufipogon and the Oryza sativa cultivar Jefferson.

Y. 2003. Control of tilling in rice. Nature, 422: 618–621.

Theor Appl Genet, 107: 479–493.

Li Y H, Qian Q, Zeng D L, Sun Z X. 2000. Identification by RAPD

Tian F, Li D J, Fu Q, Zhu Z F, Fu Y C, Wang X K, Sun C Q. 2006.

analysis and studies on genetic relationship of main parents of

Construction of introgression lines carrying wild rice (Oryza

hybrid rice in China. Acta Agron Sin, 26(2): 171–176. (in Chinese

rufipogon Griff.) segments in cultivated rice (Oryza sativa L.)

with English abstract)

background and characterization of introgressed segments

Liao F M, Zhou K L, Yang H H, Xu Q S. 1998. Genetic difference of parents and its relation to heterosis in hybrid rice. Chin J Rice Sci, 12(4): 193–199. (in Chinese with English abstract) Lin J X, Yu S B, Xu C G, Tan Y F, Gao Y J, Li X H, Zhang Q F.

associated with yield-related traits. Theor Appl Genet, 112(3): 570–580. Wang G J, Castiglione S, Zhang J, Fu R, Ma J, Li W, Sun Y, Sala F. 1994. Hybrid rice (Oryza sativa L.): Identification and parentage

2000. Analyzing quantitative trait loci for yield using a

determination by RAPD fingerprinting. Plant Cell Rep, 14:

vegetatively replicated F2 population from a cross between the

112–115.

parents of an elite rice hybrid. Theor Appl Genet, 101: 248–254. Liu D C, Zhang A M. 2001. Progress in basic research of heterosis in crops. Bull Chin Acad Sci, 5: 334–338. (in Chinese with English abstract)

Xiao J H, Grandillo S, Ahn S N, McCouch S R, Tanksley S D, Li J M, Yuan L P. 1996a. Genes from wild rice improve yield. Nature, 384: 223–224. Xiao J H, Li J M, Yuan L P, McCouch S R, Tanksley S D. 1996b.

Marri P R, Sarla N, Reddy L V, Siddiq E A. 2005. Identification

Genetic diversity and its relationship to hybrid performance and

and mapping of yield and yield related QTLs from an Indian

heterosis in rice as revealed by PCR-based markers. Theor Appl

accession of Oryza rufipogon. BMC Genet, 6(33): 1–14.

Genet, 92(6): 637–643.

McCouch S R, Leonid T, Xu Y B, Katarzyna B L, Karen C, Mark

Xiao J H, Li J M, Silvana G, Ahn S N, Yuan L P, Tanksley S D,

W, Fu B Y, Reycel M, Li Z K, Xing Y Z, Zhang Q F, Izumi K,

McCouch S R. 1998. Identification of trait-improving quantitative

Masahiro Y, Robert F, Genevieve D, David S, Samuel C, Doreen

trait loci alleles from a wild rice relative, Oryza rufipogon.

W, Lincoln S. 2002. Development and mapping of 2240 new SSR markers for rice (Oryza sativa L.). DNA Res, 9(6): 199–207.

Genetics, 150: 899–909. Xue W Y, Xing Y Z, Weng X Y, Zhao Y, Tang W J, Wang L, Zhou

Moncada P, Martinez C P, Borrero J, Châtel M, Gauch H,

H J, Yu S B, Xu C G, Li X H, Zhang Q F. 2008. Natural variation

Guimaraes E P, Tohmé J, McCouch S R. 2001. Quantitative trait

in Ghd7 is an important regulator of heading date and yield

loci for yield and yield components in an Oryza sativa × Oryza rufipogon BC2F2 population evaluated in an upland environment. Theor Appl Genet, 102(1): 41–42. Nei M, Li W. 1979. Mathematical model for studying genetic variation in terms of restriction endonucleases. Proc Natl Acad Sci USA, 76(10): 5269–5273. Septiningsih E M, Prasetiyono J, Lubis E, Tai T H, Tjubaryat T, Moeljopawiro S, McCouch S R. 2003. Identification of

potential in rice. Nat Genet, 40(6): 761–767. Zhang P J, Cai H W, Li H C, Yang L S, Bai Y S, Hu X M, Xu C W. 2000. RAPD molecular markers of rice genetic distance and its relationship with heterosis. J Anhui Agric Univ, 28(6): 697–700, 704. (in Chinese with English abstract) Zhang Q F, Gao Y J, Saghai Maroof M A, Yang H S, Li X J. 1995. Molecular divergence and hybrid performance in rice. Mol Breeding, 1(2): 133–142.

quantitative trait loci for yield and yield components in an

Zhang Q F, Gao Y J, Yang S H, Ragab R A, Saghai Maroof M A, Li

advanced backcross population derived from the Oryza sativa

Z B. 1994. A diallel analysis of heterosis in elite hybrid rice based

variety IR64 and the wild relative O. rufipogon. Theor Appl Genet, 107: 1419–1432. Smith O S, Smith J S C, Bowen S L, Tenborg K A, Wall S J. 1990.

on RFLPs and microsatellites. Theor Appl Genet, 9(2): 185–192. Zhang Q F, Zhou Z Q, Yang G P, Xu C G, Liu K D, Saghai Maroof M A. 1996. Molecular marker heterozygosity and hybrid performance

Similarities among a group of elite maize inbreds as measured

in indica and japonica rice. Theor Appl Genet, 93(8): 1218–1224.

by pedigree, F1 grain yield, grain yield, heterosis and RFLPs.

Zhang T. 2007. QTL mapping of brown rice protein content in a

Theor Appl Genet, 80(6): 833–840. Song X J, Huang W, Shi M, Zhu M Z, Lin H X. 2007. A QTL for rice grain width and weight encodes a previously unknown

RIL population of rice and analysis of genetic diversity of aromatic rice varieties [PhD Dissertation]. Chengdu: Sichuan Agricultural University. (in Chinese with English abstract)

ZHANG Tao, et al. Correlation between Heterosis and Parental Genetic Distance in Rice Zhang T, Han L, Xu J D, Jiang K F, Wu X J, Wang X D, Zheng J K.

295

abstract)

2006. Correlation between genetic distance and yield heterosis

Zhao Y, Yang K, Cheema A A, Weng Y J. 2002. Evaluation of rice

of hybrid aromatic rice. Sci Agric Sin, 39(4): 831–835. (in

germplsam using SSR markers of functional gene in rice. Sci

Chinese with English abstract) Zhao M F, Li X H, Yang J B. 1999. Relationship between molecular

Agric Sin, 35(4): 349–353. (in Chinese with English abstract) Zhu Y G, Zhang W G. 1987. Study on the relationship of hybrid

marker heterozygosis and hybrid performance in intra- and

rice seedling isozymes and heterosis. Acta Agron Sin, 13(2):

inter-subspecific crosses of rice. Plant Breeding, 18(2): 139–144.

89–96. (in Chinese with English abstract)

Zhao Q Y, Zhu Z, Zhang Y D, Zhao L, Chen T, Zhang Q F, Wang C

Zhu Z F, Sun C Q, Jiang T B, Fu Q, Wang X K. 2001. The comparison

L. 2009. Analysis on correlation between heterosis and genetic

of genetic divergences and its relationships to heterosis revealed

distance based on simple sequence repeat markers in japonica

by SSR and RFLP markers in rice (Oryza sativa L.). Acta Genet

rice. Chin J Rice Sci, 23(2): 141–147. (in Chinese with English

Sin, 28(8): 738–745. (in Chinese with English abstract)