- Email: [email protected]
Relationship between methanogenic archaea and subgingival microbial complexes in human periodontitis
Anaerobe xxx (2015) 1e3
Contents lists available at ScienceDirect
Anaerobe journal homepage: www.elsevier.com/locate/anaerobe
Clinical microbiology
Relationship between methanogenic archaea and subgingival microbial complexes in human periodontitis H.P. Horz a, *, N. Robertz b, M.E. Vianna c, K. Henne b, G. Conrads b a
Division of Virology, Institute of Medical Microbiology, RWTH Aachen University Hospital, Pauwelsstrasse 30, 52057 Aachen, Germany Division of Oral Microbiology and Immunology, Department for Operative Dentistry, Periodontology and Preventive Dentistry, RWTH Aachen University Hospital, Pauwelsstrasse 30, 52057 Aachen, Germany c Unit of Endodontology, UCL-Eastman Dental Institute, University College London, London, United Kingdom b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 1 September 2014 Received in revised form 28 January 2015 Accepted 2 February 2015 Available online xxx
We compared the amounts of methanogenic archaea with ten of the most important periodontal pathogens in 125 clinical samples. Correlation analysis suggests that the support of the periodontitisassociated bacterial consortium by methanogenic archaea may be driven through direct or indirect interactions with Prevotella intermedia. © 2015 Published by Elsevier Ltd.
Keywords: Periodontal disease Archaea Methanobrevibacter oralis Tannerella forsythia Prevotella intermedia Porphyromonas gingivalis
In recent years a high number of studies have reported the occurrence of methanogenic archaea at sites of oral infection, particularly periodontal disease [1e3]. Virtually all studies are consistent in that Methanobrevibacter oralis and a closely related phylotype are the predominant representatives of the domain Archaea in the oral cavity [4,5], which we will address hereafter simply as “methanogens”. The positive correlation with severity of periodontal disease, the almost entire absence at healthy oral sites along with the detection of methanogens inside of infected dental root canals, suggests that methanogens play a role in the etiology or at least progression of oral infections [6,7]. Conversely, clear experimental proof that establishes a direct link between methanogens and disease does still not exist and no virulence factors (known or novel) have been identified in methanogens so far. However, owing to their unique metabolism, namely the consumption of molecular hydrogen with subsequent formation of methane, it is possible that methanogens drive periodontal disease through the support of the anaerobic oral pathogenic bacteria. This assumption is warranted given that syntrophic interactions of
* Corresponding author. E-mail address: [email protected] (H.P. Horz).
methanogens with fermenting bacteria (the so-called interspecies hydrogen transfer) are widespread in anaerobic natural environments [8,9]. If analogous interactions occur in the oral cavity and if they do have implications for oral diseases, the knowledge of the precise syntrophic partners of methanogens would be highly valuable for an advanced understanding of the microbial oral ecology. In the case of periodontitis it is self-evident that one would first want to look for possible relationships with those bacteria intimately associated with periodontitis, (i.e. bacteria of the socalled red and orange complex [10,11]) as the possible prime candidate syntrophic partners. In our study we therefore compared the amount of methanogens with the occurrence and abundance of ten bacterial species, namely Tannerella forsythia, Porphyromonas gingivalis, Treponema denticola (together forming the “red complex”), plus Campylobacter rectus, Fusobacterium nucleatum, Parvimonas micra, Prevotella intermedia (which among others are members of the “orange complex”) and Aggregatibacter actinomycetemcomitans, Eikenella corrodens and Actinomyces viscosus. Our study encompassed subgingival plaque samples from 125 patients (48 males and 81 female patients, age range from 31 to 84 years, median: 51) at various stages of severity of chronic periodontal disease along with 25 analogous samples from agematched healthy control individuals. Inclusion of patients and
http://dx.doi.org/10.1016/j.anaerobe.2015.02.008 1075-9964/© 2015 Published by Elsevier Ltd.
Please cite this article in press as: H.P. Horz, et al., Relationship between methanogenic archaea and subgingival microbial complexes in human periodontitis, Anaerobe (2015), http://dx.doi.org/10.1016/j.anaerobe.2015.02.008
2
H.P. Horz et al. / Anaerobe xxx (2015) 1e3
Table 1 Primer description and thermal profiles for PCR. Primer pair
Sequences (50 / 30 )
Target DNA (approx. size, bp)
Temperature profile
Molecular analysis
Reference
A109F A934R Mbb279F Mbb709R
ACKGCTCAGTAACACGT GTGCTCCCCCGCCAATTCCT TGATCGGTACGGGTTGTG CAACAGGCGGTCCTCCCA
16S rRNA gene (798) 16S rRNA gene (405)
Initial 95 C (2 min); 22 cycles of 95 C (30 s), 52 C (30 s) and 72 C (90 s); final 72 C (20 min) Initial 95 C (10 min); 35 cycles of 95 C (10 s), 58 C (10 s) and 72 C (25 s); fluorescence measurement at 78 C
Conventional PCR
[21]
RTQ-PCR
This study
data was in accordance with the guidelines of the Ethics Committee of the RWTH University Hospital, Aachen, Germany. The periodontal status was evaluated by assessment of the probing depths (PD) and clinical attachment level (CAL) recorded at six sites per tooth. The CAL (the distance between the cementoeenamel junction and bottom of the pocket) was obtained by adding the PD values to gingival recession values (the distance between the gingival margin and cementoeenamel junction). The measurements were performed using a millimetre-graded, pressure-sensitive probe (Hawe ClickProbe, Kerr Hawe, Bioggio, Switzerland) set to a probing force of 0.25 N. The ten bacterial species were detected by DNA hybridization on a microarray-chip (Parocheck®; Greiner Bio-One GmbH, Frickenhausen, Germany [12]). Hybridization intensity was measured by a fluorescence signal and the calculated signal to noise ratio (SNR) was used as an indication of species abundance. Sample collection and DNA-extraction was done as described in detail previously [13]. Universal bacterial PCR and microarray analysis followed in principle the instructions of the manufacturer, with slight modifications as specified in detail previously [14]. Results were automatically generated using a scanner (Axon 4100 A, Axon Instruments Inc., Union City, CA) and the pParorReport software (supplied with the ParoCheck® Kit, based on GenePix®, Axon Instruments). Although our knowledge about archaeal diversity in the oral cavity is still increasing [13,15] we focused here on the by far predominant human-associated methanogens, namely M. oralis, and a closely related as yet uncultivated methanogenic phylotype [4]. For quantification of methanogens, we developed a real-time quantitative PCR assay targeting a partial stretch of the 16S rRNA gene. Because of the frequently observed cross-reactivity of 16S rRNA gene primers with human DNA [16] we performed a preamplification step with universal archaeal primers followed by a nested PCR with primers specific to M. oralis and close relatives using PCR conditions as specified in Table 1. The first round of PCR (22 cycles) was performed in a 50 ml volume and each reaction mixture contained 0.5 U of Taq DNA polymerase supplied with PCR buffer, 0.2 mM dNTPs (both Roche Applied Science, Penzberg, Germany), 0.5 mM of each primer, and 1 ml of template DNA (approximately 25 ng). The second round of PCR (35 cycles) was performed on a Roche light cycler (LightCycler 2.0) using LightCycler FastStart DNA MasterPLUS SYBR Green I in a total volume of 20 ml. Final reaction mixtures contained 0.5 mM of each primer and 1 ml of template DNA from the first round of PCR. Quantification (i.e. determination of crossing points and conversion to initial gene target molecule numbers based on calibration standards) as well as correction for the enrichment during preamplification in the first round was performed as described previously [1]. PCR-product specificity was determined by melting curve analysis and in addition by electrophosis on a 1.5% agarose-gel (Merck KGaA, Darmstadt, Germany). Furthermore, identity of PCR-products was verified by sequence analysis of randomly selected samples. Abundance data were analyzed with non-parametric tests, such as the Spearman's rank correlation coefficient and the WilcoxoneManneWhitneyeTest. Correlation tests based on ranks rather
than the real measured values made it possible to compare abundance data obtained by microarray analysis (i.e. SNR values) with those obtained by real-time quantitative PCR. Of 125 patient samples, 56 (45%) were found to be positive for methanogens, while all control samples were tested negative. Sequence analysis of PCR products confirmed the predominant presence of M. oralis and with fewer prevalence Methanobrevibacter “phylotype 3” [4]. The mean amount of methanogens per sample was found to be 106 target molecule numbers (standard error: 4 105). Both, prevalence and quantity were in rough accordance to previous studies [1,2,17]. There was no discernable relationship of methanogenic prevalence or abundance with gender. However, there was a significant positive correlation between the abundance of methanogens and pocket depth (r ¼ 0.435, p ¼ 0.004) as well as methanogens and age (r ¼ 0.514, p < 0.001). Mean abundance of methanogens was 5.1 105 target molecule numbers in patients with periodontal pocket depths less than 5 mm and at least ten times higher in patients with more severe periodontal conditions (p < 0.001, Fig. 1), which is also in line with the previous studies [1,2]. As can be anticipated for chronic periodontitis, periodontal pocket depth is naturally positively correlated with age, which explains the positive co-correlation between methanogen abundance, pocket depth, and age. However, interestingly no significant correlation with age was observed in the study by Lepp et al. [2]. Lack of a significant correlation in their study could be due to a lower number of enrolled patients, namely 50 individuals of which 18 individuals (36%) were tested positive for methanogens [2], as opposed to our study in which 56 patients (45%) were found to harbour methanogens. We next tested for any positive or negative relationship of methanogens with the ten prominent periodontal bacteria listed above. While no significant correlation could be discerned for nine bacterial species we found a significant positive correlation between methanogen abundance and the amount of P. intermedia
Fig. 1. Mean amount of methanogens in subgingival plaque samples from periodontal pockets with a pocket depth of 5 mm and less or greater than 5 mm. Error bars indicate standard error.
Please cite this article in press as: H.P. Horz, et al., Relationship between methanogenic archaea and subgingival microbial complexes in human periodontitis, Anaerobe (2015), http://dx.doi.org/10.1016/j.anaerobe.2015.02.008
H.P. Horz et al. / Anaerobe xxx (2015) 1e3
3
kinetics (compared with growth of mono-cultures) could be monitored in future studies in order to verify this assumption. References
Fig. 2. Mean amount of methanogens in subgingival plaque samples from periodontal pockets with presence or absence of Prevotella intermedia (P.i.). Error bars indicate standard error.
(r ¼ 0.345, p ¼ 0.009) in the fraction of methanogen-positive samples. The amount of M. oralis was at least ten times higher in patients that harboured also P. intermedia (p ¼ 0.008, Fig. 2). Likewise the amount of P. intermedia was higher in methanogenpositive samples, although this was not significant at the 5%-significance level. Since the amplitudes of methanogen abundance resemble each other in the diagrams of Figs. 1 and 2, one is tempted to conclude that the positive relationship between methanogens and P. intermedia simply mirrors the positive correlation already observed between methanogens and pocket depth. However, this is unlikely as P. intermedia did not correlate with pocket depth and the patient groups who are represented by the diagrams in Figs. 1 and 2 are only partially congruent (left bars 50%, right bars 32% congruency, respectively). Hence, the positive correlation between methanogens and P. intermedia is not solely due to the fact that both organisms thrive on more favourable conditions coming along with increasing pocket depths (e.g. the degree of oxygen reduction). Instead, other factors not directly linked with pocket depth may connect both species. A key feature of members of the genus Prevotella, incl. P. intermedia, is the broader substrate range for fermentation (i.e. growth on carbohydrates and proteins), which distinguishes this group of organisms from the other two genera of the domain Bacteroidetes, namely Porphyromonas and Tannerella, who are asacharolytic [18e20]. Enlarged metabolic versatility may lead to the production of a broader range of short chain fatty acids required for interspecies hydrogen transfer thereby providing more opportunities for P. intermedia to engage in syntrophic interactions with methanogens (compared to P. gingivalis and T. forsythia). This may be the underlying reason for the correlation observed in our study. In conclusion, if the metabolic activity of methanogens fosters the bacterial community from the red and orange complex in human periodontitis, this role is likely mediated through direct or indirect interactions with P. intermedia. Defined mixtures of cocultures with methanogens in combination with either P. intermedia, T. forsythia or P. gingivalis and resulting growth
[1] M.E. Vianna, S. Holtgraewe, I. Seyfarth, G. Conrads, H.P. Horz, Quantitative analysis of three hydrogenotrophic microbial groups, methanogenic archaea, sulfate-reducing bacteria, and acetogenic bacteria, within plaque biofilms associated with human periodontal disease, J. Bacteriol. 190 (2008) 3779e3785. [2] P.W. Lepp, M.M. Brinig, C.C. Ouverney, K. Palm, G.C. Armitage, D.A. Relman, Methanogenic archaea and human periodontal disease, Proc. Natl. Acad. Sci. USA 101 (2004) 6176e6181. [3] E.A. Lira, F.S. Ramiro, F.M. Chiarelli, R.R. Dias, M. Feres, L.C. Figueiredo, M. Faveri, Reduction in prevalence of archaea after periodontal therapy in subjects with generalized aggressive periodontitis, Aust. Dent. J. 58 (2013) 442e447. [4] M.E. Vianna, G. Conrads, B.P. Gomes, H.P. Horz, T-RFLP-based mcrA gene analysis of methanogenic archaea in association with oral infections and evidence of a novel methanobrevibacter phylotype, Oral Microbiol. Immunol. 24 (2009) 417e422. [5] E. Conway de Macario, A.J. Macario, Methanogenic archaea in health and disease: a novel paradigm of microbial pathogenesis, Int. J. Med. Microbiol. 299 (2009) 99e108. [6] M.E. Vianna, G. Conrads, B.P. Gomes, H.P. Horz, Identification and quantification of archaea involved in primary endodontic infections, J. Clin. Microbiol. 44 (2006) 1274e1282. [7] H.P. Horz, G. Conrads, The discussion goes on: what is the role of euryarchaeota in humans? Archaea (2010) 967271. [8] R.K. Thauer, A.K. Kaster, H. Seedorf, W. Buckel, R. Hedderich, Methanogenic archaea: ecologically relevant differences in energy conservation, Nat. Rev. Microbiol. 6 (2008) 579e591. [9] B. Schink, Energetics of syntrophic cooperation in methanogenic degradation, Microbiol. Mol. Biol. Rev. 61 (1997) 262e280. [10] S.S. Socransky, A.D. Haffajee, M.A. Cugini, C. Smith, R.L. Kent Jr., Microbial complexes in subgingival plaque, J. Clin. Periodontol. 25 (1998) 134e144. [11] S.S. Socransky, A.D. Haffajee, Periodontal microbial ecology, Periodontol. 2000 38 (2005) 135e187. [12] J. Eberhard, N. Menzel, H. Dommisch, J. Winter, S. Jepsen, R. Mutters, The stage of native biofilm formation determines the gene expression of human betadefensin-2, psoriasin, ribonuclease 7 and inflammatory mediators: a novel approach for stimulation of keratinocytes with in situ formed biofilms, Oral Microbiol. Immunol. 23 (2008) 21e28. [13] H.P. Horz, I. Seyfarth, G. Conrads, McrA and 16S rRNA gene analysis suggests a novel lineage of Archaea phylogenetically affiliated with thermoplasmatales in human subgingival plaque, Anaerobe 18 (2012) 373e377. [14] M.E. Vianna, H.P. Horz, B.P. Gomes, G. Conrads, Microarrays complement culture methods for identification of bacteria in endodontic infections, Oral Microbiol. Immunol. 20 (2005) 253e258. [15] C.L. Li, Y.T. Jiang, L. Liu da, J. Qian, J.P. Liang, R. Shu, Prevalence and quantification of the uncommon Archaea phylotype thermoplasmata in chronic periodontitis, Arch. Oral Biol. 59 (2014) 822e828. [16] H.P. Horz, S. Scheer, F. Huenger, M.E. Vianna, G. Conrads, Selective isolation of bacterial DNA from human clinical specimens, J. Microbiol. Methods 72 (2008) 98e102. [17] A. Bringuier, S. Khelaifia, H. Richet, G. Aboudharam, M. Drancourt, Real-time PCR quantification of Methanobrevibacter oralis in periodontitis, J. Clin. Microbiol. 51 (2013) 993e994. [18] H.N. Shah, D.M. Collins, Prevotella, a new genus to include Bacteroides melaninogenicus and related species formerly classified in the genus Bacteroides, Int. J. Syst. Bacteriol. 40 (1990) 205e208. [19] M. Sakamoto, M. Suzuki, M. Umeda, I. Ishikawa, Y. Benno, Reclassification of Bacteroides forsythus (Tanner et al. 1986) as Tannerella forsythensis corrig., gen. nov., comb. nov, Int. J. Syst. Evol. Microbiol. 52 (2002) 841e849. [20] H.N. Shah, S.E. Gharbia, Biochemical and chemical studies on strains designated Prevotella intermedia and proposal of a new pigmented species, Prevotella nigrescens sp. nov, Int. J. Syst. Bacteriol. 42 (1992) 542e546. [21] R. Grosskopf, P.H. Janssen, W. Liesack, Diversity and structure of the methanogenic community in anoxic rice paddy soil microcosms as examined by cultivation and direct 16S rRNA gene sequence retrieval, Appl. Environ. Microbiol. 64 (1998) 960e969.
Please cite this article in press as: H.P. Horz, et al., Relationship between methanogenic archaea and subgingival microbial complexes in human periodontitis, Anaerobe (2015), http://dx.doi.org/10.1016/j.anaerobe.2015.02.008
Contents lists available at ScienceDirect
Anaerobe journal homepage: www.elsevier.com/locate/anaerobe
Clinical microbiology
Relationship between methanogenic archaea and subgingival microbial complexes in human periodontitis H.P. Horz a, *, N. Robertz b, M.E. Vianna c, K. Henne b, G. Conrads b a
Division of Virology, Institute of Medical Microbiology, RWTH Aachen University Hospital, Pauwelsstrasse 30, 52057 Aachen, Germany Division of Oral Microbiology and Immunology, Department for Operative Dentistry, Periodontology and Preventive Dentistry, RWTH Aachen University Hospital, Pauwelsstrasse 30, 52057 Aachen, Germany c Unit of Endodontology, UCL-Eastman Dental Institute, University College London, London, United Kingdom b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 1 September 2014 Received in revised form 28 January 2015 Accepted 2 February 2015 Available online xxx
We compared the amounts of methanogenic archaea with ten of the most important periodontal pathogens in 125 clinical samples. Correlation analysis suggests that the support of the periodontitisassociated bacterial consortium by methanogenic archaea may be driven through direct or indirect interactions with Prevotella intermedia. © 2015 Published by Elsevier Ltd.
Keywords: Periodontal disease Archaea Methanobrevibacter oralis Tannerella forsythia Prevotella intermedia Porphyromonas gingivalis
In recent years a high number of studies have reported the occurrence of methanogenic archaea at sites of oral infection, particularly periodontal disease [1e3]. Virtually all studies are consistent in that Methanobrevibacter oralis and a closely related phylotype are the predominant representatives of the domain Archaea in the oral cavity [4,5], which we will address hereafter simply as “methanogens”. The positive correlation with severity of periodontal disease, the almost entire absence at healthy oral sites along with the detection of methanogens inside of infected dental root canals, suggests that methanogens play a role in the etiology or at least progression of oral infections [6,7]. Conversely, clear experimental proof that establishes a direct link between methanogens and disease does still not exist and no virulence factors (known or novel) have been identified in methanogens so far. However, owing to their unique metabolism, namely the consumption of molecular hydrogen with subsequent formation of methane, it is possible that methanogens drive periodontal disease through the support of the anaerobic oral pathogenic bacteria. This assumption is warranted given that syntrophic interactions of
* Corresponding author. E-mail address: [email protected] (H.P. Horz).
methanogens with fermenting bacteria (the so-called interspecies hydrogen transfer) are widespread in anaerobic natural environments [8,9]. If analogous interactions occur in the oral cavity and if they do have implications for oral diseases, the knowledge of the precise syntrophic partners of methanogens would be highly valuable for an advanced understanding of the microbial oral ecology. In the case of periodontitis it is self-evident that one would first want to look for possible relationships with those bacteria intimately associated with periodontitis, (i.e. bacteria of the socalled red and orange complex [10,11]) as the possible prime candidate syntrophic partners. In our study we therefore compared the amount of methanogens with the occurrence and abundance of ten bacterial species, namely Tannerella forsythia, Porphyromonas gingivalis, Treponema denticola (together forming the “red complex”), plus Campylobacter rectus, Fusobacterium nucleatum, Parvimonas micra, Prevotella intermedia (which among others are members of the “orange complex”) and Aggregatibacter actinomycetemcomitans, Eikenella corrodens and Actinomyces viscosus. Our study encompassed subgingival plaque samples from 125 patients (48 males and 81 female patients, age range from 31 to 84 years, median: 51) at various stages of severity of chronic periodontal disease along with 25 analogous samples from agematched healthy control individuals. Inclusion of patients and
http://dx.doi.org/10.1016/j.anaerobe.2015.02.008 1075-9964/© 2015 Published by Elsevier Ltd.
Please cite this article in press as: H.P. Horz, et al., Relationship between methanogenic archaea and subgingival microbial complexes in human periodontitis, Anaerobe (2015), http://dx.doi.org/10.1016/j.anaerobe.2015.02.008
2
H.P. Horz et al. / Anaerobe xxx (2015) 1e3
Table 1 Primer description and thermal profiles for PCR. Primer pair
Sequences (50 / 30 )
Target DNA (approx. size, bp)
Temperature profile
Molecular analysis
Reference
A109F A934R Mbb279F Mbb709R
ACKGCTCAGTAACACGT GTGCTCCCCCGCCAATTCCT TGATCGGTACGGGTTGTG CAACAGGCGGTCCTCCCA
16S rRNA gene (798) 16S rRNA gene (405)
Initial 95 C (2 min); 22 cycles of 95 C (30 s), 52 C (30 s) and 72 C (90 s); final 72 C (20 min) Initial 95 C (10 min); 35 cycles of 95 C (10 s), 58 C (10 s) and 72 C (25 s); fluorescence measurement at 78 C
Conventional PCR
[21]
RTQ-PCR
This study
data was in accordance with the guidelines of the Ethics Committee of the RWTH University Hospital, Aachen, Germany. The periodontal status was evaluated by assessment of the probing depths (PD) and clinical attachment level (CAL) recorded at six sites per tooth. The CAL (the distance between the cementoeenamel junction and bottom of the pocket) was obtained by adding the PD values to gingival recession values (the distance between the gingival margin and cementoeenamel junction). The measurements were performed using a millimetre-graded, pressure-sensitive probe (Hawe ClickProbe, Kerr Hawe, Bioggio, Switzerland) set to a probing force of 0.25 N. The ten bacterial species were detected by DNA hybridization on a microarray-chip (Parocheck®; Greiner Bio-One GmbH, Frickenhausen, Germany [12]). Hybridization intensity was measured by a fluorescence signal and the calculated signal to noise ratio (SNR) was used as an indication of species abundance. Sample collection and DNA-extraction was done as described in detail previously [13]. Universal bacterial PCR and microarray analysis followed in principle the instructions of the manufacturer, with slight modifications as specified in detail previously [14]. Results were automatically generated using a scanner (Axon 4100 A, Axon Instruments Inc., Union City, CA) and the pParorReport software (supplied with the ParoCheck® Kit, based on GenePix®, Axon Instruments). Although our knowledge about archaeal diversity in the oral cavity is still increasing [13,15] we focused here on the by far predominant human-associated methanogens, namely M. oralis, and a closely related as yet uncultivated methanogenic phylotype [4]. For quantification of methanogens, we developed a real-time quantitative PCR assay targeting a partial stretch of the 16S rRNA gene. Because of the frequently observed cross-reactivity of 16S rRNA gene primers with human DNA [16] we performed a preamplification step with universal archaeal primers followed by a nested PCR with primers specific to M. oralis and close relatives using PCR conditions as specified in Table 1. The first round of PCR (22 cycles) was performed in a 50 ml volume and each reaction mixture contained 0.5 U of Taq DNA polymerase supplied with PCR buffer, 0.2 mM dNTPs (both Roche Applied Science, Penzberg, Germany), 0.5 mM of each primer, and 1 ml of template DNA (approximately 25 ng). The second round of PCR (35 cycles) was performed on a Roche light cycler (LightCycler 2.0) using LightCycler FastStart DNA MasterPLUS SYBR Green I in a total volume of 20 ml. Final reaction mixtures contained 0.5 mM of each primer and 1 ml of template DNA from the first round of PCR. Quantification (i.e. determination of crossing points and conversion to initial gene target molecule numbers based on calibration standards) as well as correction for the enrichment during preamplification in the first round was performed as described previously [1]. PCR-product specificity was determined by melting curve analysis and in addition by electrophosis on a 1.5% agarose-gel (Merck KGaA, Darmstadt, Germany). Furthermore, identity of PCR-products was verified by sequence analysis of randomly selected samples. Abundance data were analyzed with non-parametric tests, such as the Spearman's rank correlation coefficient and the WilcoxoneManneWhitneyeTest. Correlation tests based on ranks rather
than the real measured values made it possible to compare abundance data obtained by microarray analysis (i.e. SNR values) with those obtained by real-time quantitative PCR. Of 125 patient samples, 56 (45%) were found to be positive for methanogens, while all control samples were tested negative. Sequence analysis of PCR products confirmed the predominant presence of M. oralis and with fewer prevalence Methanobrevibacter “phylotype 3” [4]. The mean amount of methanogens per sample was found to be 106 target molecule numbers (standard error: 4 105). Both, prevalence and quantity were in rough accordance to previous studies [1,2,17]. There was no discernable relationship of methanogenic prevalence or abundance with gender. However, there was a significant positive correlation between the abundance of methanogens and pocket depth (r ¼ 0.435, p ¼ 0.004) as well as methanogens and age (r ¼ 0.514, p < 0.001). Mean abundance of methanogens was 5.1 105 target molecule numbers in patients with periodontal pocket depths less than 5 mm and at least ten times higher in patients with more severe periodontal conditions (p < 0.001, Fig. 1), which is also in line with the previous studies [1,2]. As can be anticipated for chronic periodontitis, periodontal pocket depth is naturally positively correlated with age, which explains the positive co-correlation between methanogen abundance, pocket depth, and age. However, interestingly no significant correlation with age was observed in the study by Lepp et al. [2]. Lack of a significant correlation in their study could be due to a lower number of enrolled patients, namely 50 individuals of which 18 individuals (36%) were tested positive for methanogens [2], as opposed to our study in which 56 patients (45%) were found to harbour methanogens. We next tested for any positive or negative relationship of methanogens with the ten prominent periodontal bacteria listed above. While no significant correlation could be discerned for nine bacterial species we found a significant positive correlation between methanogen abundance and the amount of P. intermedia
Fig. 1. Mean amount of methanogens in subgingival plaque samples from periodontal pockets with a pocket depth of 5 mm and less or greater than 5 mm. Error bars indicate standard error.
Please cite this article in press as: H.P. Horz, et al., Relationship between methanogenic archaea and subgingival microbial complexes in human periodontitis, Anaerobe (2015), http://dx.doi.org/10.1016/j.anaerobe.2015.02.008
H.P. Horz et al. / Anaerobe xxx (2015) 1e3
3
kinetics (compared with growth of mono-cultures) could be monitored in future studies in order to verify this assumption. References
Fig. 2. Mean amount of methanogens in subgingival plaque samples from periodontal pockets with presence or absence of Prevotella intermedia (P.i.). Error bars indicate standard error.
(r ¼ 0.345, p ¼ 0.009) in the fraction of methanogen-positive samples. The amount of M. oralis was at least ten times higher in patients that harboured also P. intermedia (p ¼ 0.008, Fig. 2). Likewise the amount of P. intermedia was higher in methanogenpositive samples, although this was not significant at the 5%-significance level. Since the amplitudes of methanogen abundance resemble each other in the diagrams of Figs. 1 and 2, one is tempted to conclude that the positive relationship between methanogens and P. intermedia simply mirrors the positive correlation already observed between methanogens and pocket depth. However, this is unlikely as P. intermedia did not correlate with pocket depth and the patient groups who are represented by the diagrams in Figs. 1 and 2 are only partially congruent (left bars 50%, right bars 32% congruency, respectively). Hence, the positive correlation between methanogens and P. intermedia is not solely due to the fact that both organisms thrive on more favourable conditions coming along with increasing pocket depths (e.g. the degree of oxygen reduction). Instead, other factors not directly linked with pocket depth may connect both species. A key feature of members of the genus Prevotella, incl. P. intermedia, is the broader substrate range for fermentation (i.e. growth on carbohydrates and proteins), which distinguishes this group of organisms from the other two genera of the domain Bacteroidetes, namely Porphyromonas and Tannerella, who are asacharolytic [18e20]. Enlarged metabolic versatility may lead to the production of a broader range of short chain fatty acids required for interspecies hydrogen transfer thereby providing more opportunities for P. intermedia to engage in syntrophic interactions with methanogens (compared to P. gingivalis and T. forsythia). This may be the underlying reason for the correlation observed in our study. In conclusion, if the metabolic activity of methanogens fosters the bacterial community from the red and orange complex in human periodontitis, this role is likely mediated through direct or indirect interactions with P. intermedia. Defined mixtures of cocultures with methanogens in combination with either P. intermedia, T. forsythia or P. gingivalis and resulting growth
[1] M.E. Vianna, S. Holtgraewe, I. Seyfarth, G. Conrads, H.P. Horz, Quantitative analysis of three hydrogenotrophic microbial groups, methanogenic archaea, sulfate-reducing bacteria, and acetogenic bacteria, within plaque biofilms associated with human periodontal disease, J. Bacteriol. 190 (2008) 3779e3785. [2] P.W. Lepp, M.M. Brinig, C.C. Ouverney, K. Palm, G.C. Armitage, D.A. Relman, Methanogenic archaea and human periodontal disease, Proc. Natl. Acad. Sci. USA 101 (2004) 6176e6181. [3] E.A. Lira, F.S. Ramiro, F.M. Chiarelli, R.R. Dias, M. Feres, L.C. Figueiredo, M. Faveri, Reduction in prevalence of archaea after periodontal therapy in subjects with generalized aggressive periodontitis, Aust. Dent. J. 58 (2013) 442e447. [4] M.E. Vianna, G. Conrads, B.P. Gomes, H.P. Horz, T-RFLP-based mcrA gene analysis of methanogenic archaea in association with oral infections and evidence of a novel methanobrevibacter phylotype, Oral Microbiol. Immunol. 24 (2009) 417e422. [5] E. Conway de Macario, A.J. Macario, Methanogenic archaea in health and disease: a novel paradigm of microbial pathogenesis, Int. J. Med. Microbiol. 299 (2009) 99e108. [6] M.E. Vianna, G. Conrads, B.P. Gomes, H.P. Horz, Identification and quantification of archaea involved in primary endodontic infections, J. Clin. Microbiol. 44 (2006) 1274e1282. [7] H.P. Horz, G. Conrads, The discussion goes on: what is the role of euryarchaeota in humans? Archaea (2010) 967271. [8] R.K. Thauer, A.K. Kaster, H. Seedorf, W. Buckel, R. Hedderich, Methanogenic archaea: ecologically relevant differences in energy conservation, Nat. Rev. Microbiol. 6 (2008) 579e591. [9] B. Schink, Energetics of syntrophic cooperation in methanogenic degradation, Microbiol. Mol. Biol. Rev. 61 (1997) 262e280. [10] S.S. Socransky, A.D. Haffajee, M.A. Cugini, C. Smith, R.L. Kent Jr., Microbial complexes in subgingival plaque, J. Clin. Periodontol. 25 (1998) 134e144. [11] S.S. Socransky, A.D. Haffajee, Periodontal microbial ecology, Periodontol. 2000 38 (2005) 135e187. [12] J. Eberhard, N. Menzel, H. Dommisch, J. Winter, S. Jepsen, R. Mutters, The stage of native biofilm formation determines the gene expression of human betadefensin-2, psoriasin, ribonuclease 7 and inflammatory mediators: a novel approach for stimulation of keratinocytes with in situ formed biofilms, Oral Microbiol. Immunol. 23 (2008) 21e28. [13] H.P. Horz, I. Seyfarth, G. Conrads, McrA and 16S rRNA gene analysis suggests a novel lineage of Archaea phylogenetically affiliated with thermoplasmatales in human subgingival plaque, Anaerobe 18 (2012) 373e377. [14] M.E. Vianna, H.P. Horz, B.P. Gomes, G. Conrads, Microarrays complement culture methods for identification of bacteria in endodontic infections, Oral Microbiol. Immunol. 20 (2005) 253e258. [15] C.L. Li, Y.T. Jiang, L. Liu da, J. Qian, J.P. Liang, R. Shu, Prevalence and quantification of the uncommon Archaea phylotype thermoplasmata in chronic periodontitis, Arch. Oral Biol. 59 (2014) 822e828. [16] H.P. Horz, S. Scheer, F. Huenger, M.E. Vianna, G. Conrads, Selective isolation of bacterial DNA from human clinical specimens, J. Microbiol. Methods 72 (2008) 98e102. [17] A. Bringuier, S. Khelaifia, H. Richet, G. Aboudharam, M. Drancourt, Real-time PCR quantification of Methanobrevibacter oralis in periodontitis, J. Clin. Microbiol. 51 (2013) 993e994. [18] H.N. Shah, D.M. Collins, Prevotella, a new genus to include Bacteroides melaninogenicus and related species formerly classified in the genus Bacteroides, Int. J. Syst. Bacteriol. 40 (1990) 205e208. [19] M. Sakamoto, M. Suzuki, M. Umeda, I. Ishikawa, Y. Benno, Reclassification of Bacteroides forsythus (Tanner et al. 1986) as Tannerella forsythensis corrig., gen. nov., comb. nov, Int. J. Syst. Evol. Microbiol. 52 (2002) 841e849. [20] H.N. Shah, S.E. Gharbia, Biochemical and chemical studies on strains designated Prevotella intermedia and proposal of a new pigmented species, Prevotella nigrescens sp. nov, Int. J. Syst. Bacteriol. 42 (1992) 542e546. [21] R. Grosskopf, P.H. Janssen, W. Liesack, Diversity and structure of the methanogenic community in anoxic rice paddy soil microcosms as examined by cultivation and direct 16S rRNA gene sequence retrieval, Appl. Environ. Microbiol. 64 (1998) 960e969.
Please cite this article in press as: H.P. Horz, et al., Relationship between methanogenic archaea and subgingival microbial complexes in human periodontitis, Anaerobe (2015), http://dx.doi.org/10.1016/j.anaerobe.2015.02.008