Remote ischemic preconditioning attenuates EGR-1 expression following myocardial ischemia reperfusion injury through activation of the JAK-STAT pathway

International Journal of Cardiology 228 (2017) 729–741

Contents lists available at ScienceDirect

International Journal of Cardiology journal homepage: www.elsevier.com/locate/ijcard

Remote ischemic preconditioning attenuates EGR-1 expression following myocardial ischemia reperfusion injury through activation of the JAK-STAT pathway☆ H Mudaliar ⁎, B Rayner, M Billah, N Kapoor, W Lay, A Dona, R Bhindi North Shore Heart Research Foundation, Kolling Institute of Medical Research, University of Sydney, Royal North Shore Hospital, St Leonards, NSW 2065, Australia

a r t i c l e

i n f o

Article history: Received 29 August 2016 Accepted 6 November 2016 Available online 10 November 2016 Keywords: Early growth response-1 Myocardial I/R injury Remote ischemic preconditioning JAK-STAT Cardioprotection

a b s t r a c t Background/objectives: Remote ischemic preconditioning (RIPC) protects the myocardium from ischemia/ reperfusion (I/R) injury however the molecular pathways involved in cardioprotection are yet to be fully delineated. Transcription factor Early growth response-1 (Egr-1) is a key upstream activator in a variety of cardiovascular diseases. In this study, we elucidated the role of RIPC in modulating the regulation of Egr-1. Methods: This study subjected rats to transient blockade of the left anterior descending (LAD) coronary artery with or without prior RIPC of the hind-limb muscle and thereafter excised the heart 24 h following surgical intervention. In vitro, rat cardiac myoblast H9c2 cells were exposed to ischemic preconditioning by subjecting them to 3 cycles of alternating nitrogen-flushed hypoxia and normoxia. These preconditioned media were added to recipient H9c2 cells which were then subjected to 30 min of hypoxia followed by 30 min of normoxia to simulate myocardial I/R injury. Thereafter, the effects of RIPC on cell viability, apoptosis and inflammatory markers were assessed. Results: We showed reduced infarct size and suppressed Egr-1 in the heart of rats when RIPC was administered to the hind leg. In vitro, we showed that RIPC improved cell viability, reduced apoptosis and attenuated Egr-1 in recipient cells. Conclusions: Selective inhibition of intracellular signaling pathways confirmed that RIPC increased production of intracellular nitric oxide (NO) and reactive oxygen species (ROS) via activation of the JAK-STAT pathway which then inactivated I/R-induced ERK 1/2 signaling pathways, ultimately leading to the suppression of Egr-1. © 2016 Elsevier Ireland Ltd. All rights reserved.

1. Introduction Acute myocardial infarction (AMI) is a major cause of death and disability worldwide with a mortality rate of approximately 10% [1,39]. The mainstay of treatment for patients with AMI is early myocardial reperfusion with the use of either primary percutaneous coronary intervention or thrombolytic therapy [35,61]. Although early reperfusion is the current optimal way to rescue the heart, paradoxically, the process of reperfusion has been shown to induce cardiomyocyte death, contribute to the final myocardial infarct size and activate cellular damage by the activation of deleterious signaling cascades [15,17,22,46].

☆ New & noteworthy: In this study, we demonstrate that administration of RIPC prior to myocardial I/R injury abrogated Egr-1 expression in in vitro and in vivo models through regulation of the JAK-STAT signaling pathway. Attenuation of Egr-1 results in enhanced cardioprotection through reduced infarct size, suppressed apoptosis and increased cell viability. ⁎ Corresponding author at: Kolling Institute of Medical Research, University of Sydney, NSW 2065, Australia. E-mail address: [email protected] (H. Mudaliar).

http://dx.doi.org/10.1016/j.ijcard.2016.11.198 0167-5273/© 2016 Elsevier Ireland Ltd. All rights reserved.

Novel strategies to manage myocardial reperfusion injury are required and ischemic preconditioning has emerged as a promising therapy against lethal reperfusion injury. It is thought to provide this protection by increasing the tissue's tolerance to ischemia through the attenuation of oxidative stress, inflammation and apoptosis in the preconditioned tissue [26,36,37]. Remote ischemic preconditioning (RIPC) a non-invasive approach whereby brief cycles of ischemia and reperfusion are applied to a more accessible tissue such as a limb or organ remote from the heart has also emerged as a convenient model rendering protection to myocardial tissue in ischemic reperfusion (I/R) injury [16,28,43,44]. Progress has been made in translating the concept of RIPC from experimental models to clinical practice in which prior administration of RIPC has been shown to ameliorate myocardial injury in patients undergoing elective abdominal aortic aneurysm repair, elective percutaneous coronary intervention, angioplasty and coronary artery bypass surgery [2,9,19,58,66]. Although the actual trigger through which RIPC confers cardioprotection is unknown, increasing numbers of experimental studies have suggested potential underlying mechanistic pathways and signal transduction cascades within the remote organ, which may contribute

730

H. Mudaliar et al. / International Journal of Cardiology 228 (2017) 729–741

(A)

(B) 60

*

2.5 Fold change in Egr-1 mRNA (relative to GAPDH)

Infarct size/AAR (%)

50 **

40 30

20 10 0

2 1.5

1 0.5 0

I/R

Sham

RIPC + I/R

I/R

RIPC + I/R

(C) EGR-1

82 kDa

Actin

42 kDa

Expression of EGR-1/actin as % ctrl

150

**

100

50

0 Sham

I/R

RIPC + I/R

Fig. 1. The effect of remote ischemic preconditioning (RIPC) on myocardial infarct size and Egr-1 expression following ischemia-reperfusion (I/R) injury in a rat model. (A) Evan's blue dye and triphenyltetrazolium chloride (TTC) staining of rat hearts at 24 h post-myocardial infarction demonstrated a reduction in infarct size following RIPC. (B) RIPC attenuated I/R-induced Egr-1 transcription in rats. (C) Egr-1 protein expression was induced in rats exposed to I/R and suppressed with prior administration of RIPC to the hind leg. Data represents mean ± s.e.m. from n = 7 rats per treatment group. ⁎P b 0.05 vs sham (control group). ⁎⁎P b 0.01 vs sham (control group). ǂP b 0.05 vs I/R group. ǂǂP b 0.05 vs I/R group.

to RIPC-induced cardioprotection. The activation of signal transducer and activator of transcription (STAT) proteins which are part of the Janus kinase (JAK)-STAT pathway, pro-survival kinases such as mitogen activated protein kinases (MAPK) and extracellular signal-related kinase 1/2 (ERK 1/2) pathways (also termed reperfusion injury salvage kinase or RISK pathway), mitochondrial ATP-sensitive potassium (KATP) channels and the uncoupling of mitochondria have been implicated in the complex signal transduction cascade of ischemic preconditioning [34,47,59,62]. Moreover, small amounts of reactive oxygen species (ROS) produced in part by uncoupling of oxidative phosphorylation or by the activation of NADPH-oxidase have been shown to further contribute to cardioprotection by activating p38 MAP kinases [37]. However, the signal transduction of RIPC, notably the mechanisms which exert cardioprotective effects on the heart remains yet to be fully elucidated. Transcriptional factor Early growth response 1 (Egr-1), a key immediate master regulator gene, plays an integral role in the injury response to the pathophysiology of multiple cardiovascular diseases [24]. We have previously shown that upregulation of Egr-1 in the heart following ischemia reperfusion (I/R) injury initiates inflammation [6] and the subsequent use of Egr-1 targeting DNAzymes attenuated myocardial infarct size and inflammatory markers in a rodent and porcine model [5,45]. As a master switch controlling developmental processes, transcription

factors such as Egr-1 are attractive candidates as potential therapeutic targets. However, the role of Egr-1 in the protective effect of RIPC following myocardial I/R injury is yet to be delineated. Therefore, in this study we sought to elucidate the cardioprotective role of RIPC modulated by Egr-1 through the regulation of JAK-STAT pathway, pro-survival kinases (MAPK and RISK pathways) and oxidative stressors in myocardial I/R injury. 2. Material and methods 2.1. Ethics statement Experiments in this study were approved by the Animal Care and Ethics Committee of Royal North Shore Hospital and were performed according to the recommendations of the Australian Council for Animal Care.

2.2. In vivo experiments Sprague–Dawley rats (weight 250 to 300 g) were acclimatized for a period of 1 week before surgery. Myocardial I/R was induced as previously described using an open-chest approach [6]. Ischemia was induced for 30 min by transient suture ligation of the left anterior coronary artery approximately 2 to 3 mm distal to the junction of the pulmonary artery and left atrial appendage. After 24 h, the left anterior coronary artery was reoccluded, 5 mL of 3% Evan's blue was infused via the tail vein. Following culling, the heart was then excised, sectioned into 2-mm short-axis slices, and placed in TTC 1% in

H. Mudaliar et al. / International Journal of Cardiology 228 (2017) 729–741

731

(A)

Cell viability (%)

150

100

**

50

0 Normoxia

H/R

RIPC + H/R

(B) H/R

Normoxia

RIPC+ H/R 4.12%

0.87%

1.62%

% of apoptotic cells

6 *

5 4 3 2 1

0 Normoxia

H/R

RIPC + H/R

Fig. 2. The effect of hypoxia-reperfusion (H/R) injury and remote ischemic preconditioning (RIPC) prior to inducing H/R injury on cell death in H9c2 cells. (A) Cell viability was markedly reduced with H/R injury however was rescued with prior administration of RIPC. (B) H/R injury increased apoptosis and administration of RIPC prior to H/R injury attenuated the rate of apoptosis in H9c2 cells. Data represents mean ± s.e.m. from n = 4 per H9c2 cell treatment group. ⁎P b 0.05 vs normoxia (control group). ⁎⁎P b 0.01 vs normoxia (control group) ǂP b 0.05 vs H/R group.

phosphate-buffered saline for 20 min at 37 °C [7]. Slices were photographed and then fixed in 10% normal buffered formalin. 2.3. Cell culture and manipulation Rat cardiac derived H9c2 cells (ATCC CRL 1446) were grown in DMEM (GIBCO/BRL) supplemented with 10% fetal bovine serum (Hyclone, Logan, Utah), 4 mM glutamine and 100 U/mL penicillin/streptomycin (Sigma-Aldrich, St. Louis, MO, USA). Cells were kept in the incubator at 37 °C equilibrated with 5% CO2. The Egr-1 expression vector utilized in our experiments was designated as “pCDNA3.1_Egr-1”. 2.4. Experimental protocol The H9c2 rat cardiac myoblast cell line was grown to 70–80% confluence and serumstarved overnight and thereafter exposed to 3 different experimental conditions: 1) normoxic control where cells were exposed to serum-free media (8.3 g/L DMEM,

10 mM glucose and 10 mM HEPES; pH 7.4) for 1 h under normoxic conditions (20% O2) 2) hypoxia-reperfusion (H/R) where cells were subjected to 30 min of nitrogen-flushed hypoxia (b2% O2) in hypoxic media (8.3 g/L DMEM and 10 mM HEPES; pH 6.5) followed by 30 min of normoxia and 3) RIPC where donor cells were first subjected to 3 cycles of 5 min duration alternating between nitrogen-flushed hypoxia and normoxia. Then, these preconditioned media were added to recipient H9c2 cells which were further subjected to 30 min of hypoxia followed by 30 min of normoxia in the preconditioned media to simulate myocardial I/R injury. To delineate the different molecular pathways which modulate Egr-1 regulation, several pharmacological drugs including SB239063, U0126 monoethanolate, SP600125, Tyrphostin AG 490, Glibenclamide, N-nitro-L-arginine methyl ester hydrochloride (L-NAME), and superoxide dismutase (PEG-SOD) were used. All the pharmacological inhibitors used in this study were purchased from Sigma. Several inhibitors were dissolved in dimethyl sulfoxide (DMSO). The final concentration of DMSO was 0.1% and this concentration of DMSO was found to have no effect on H9c2 cell viability. H9c2 cells were pre-treated with inhibitors 30 min prior to the induction of hypoxia.

732

H. Mudaliar et al. / International Journal of Cardiology 228 (2017) 729–741

(A)

(B)

**

2.5

3.5

**

Fold change in Egr-1 mRNA (relative to GAPDH)

Fold change in Egr-1 mRNA (relative to GAPDH)

3

2

*

1.5 1 0.5

3 2.5 2 1.5

1 0.5

0 Control

0.5

1

2

3

**

0

24

Normoxia

H/R

RIPC + H/R

Reperfusion time (h)

(C) (D) EGR-1

82 kDa

Actin

42 kDa

200

Egr-1 luciferase activity

Expression of EGR-1/actin as % ctrl

200

* 150

100

50

** 150 **

100

50

0

0

Normoxia

H/R

Normoxia

RIPC + H/R

H/R

RIPC + H/R

Fig. 3. The effect of hypoxia-reperfusion (H/R) injury and the administration of remote ischemic preconditioning (RIPC) prior to H/R injury on Egr-1 expression and reporter activity in H9c2 cells. (A) Subjecting H9c2 cells to H/R injury induced Egr-1 transcription maximally at 30 min. (B) Egr-1 transcription was upregulated with H/R injury and was significantly attenuated with RIPC. (C) Similarly, Egr-1 protein expression was induced with H/R injury and administration of RIPC prior to H/R suppressed Egr-1 protein expression. (D) H/R injury activated the transcriptional activity of Egr-1 whereas RIPC suppressed H/R-induced transactivation as demonstrated with luciferase assay. Data represents mean ± s.e.m. from n = 5. ⁎P b 0.05 vs control (normoxia). ⁎⁎P b 0.01 vs control. ǂP b 0.05 vs H/R limb.

2.5. Trypan blue exclusion assay The percentage of viable cells was determined by recording the number of cells that excluded 0.4% solution trypan blue dye (Sigma-Aldrich, USA). The cells were photographed using an Olympus SC35 camera attached to an Olympus CK40 microscope.

2.6. Western blot Cells were scraped from petri dishes when 95% confluent and were resuspended in cell lysis buffer containing 50 mM Tris-HCl, 5 mM EDTA (pH 7.4), 150 mM NaCl, 0.5% TritonX-100 and protease inhibitors (Roche Diagnostics, Germany). The cell lysate was spun at 13,000 rpm at 4 °C for 5 min and protein quantification was performed with Bradford Protein Assay (Bio-Rad, CA, USA). The cell lysate was then stored in −20 °C. Total cell protein (50 μg) was mixed with 3 × Laemmli sample buffer containing β-mercaptoethanol and heated at 95 °C for 10 min. Samples were then analyzed by sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) and electroblotted to Hybond Nitrocellulose membranes (Amersham Pharmacia Biotech, Bucks, UK). Membranes were blocked in Tris-buffered saline containing 0.2% Tween-20 (TBST) in 5% skim milk for 2 h and then incubated overnight at 4 °C with the following antibodies – EGR-1 1:500 (Santa Cruz, CA, USA), phosphorylated p38 1:500 (Abcam), total p38 1:500 (Abcam), STAT1 1:500 (Life Technologies, CA, USA), phosphorylated STAT1 1:1000 (Cell Signalling, MA, USA), STAT3 1:500 (Life Technologies), phosphorylated STAT3 1:1000 (Life Technologies) and β-actin 1:1000 (Santa Cruz). Membranes were washed with TBST and incubated with horseradish peroxidase conjugated secondary antibody. Proteins were visualised using the enhanced chemiluminescence (ECL) detection system (Amersham Pharmacia Biotech, Bucks, UK). All membranes were corrected for

actin as a loading control and analysed using ImageJ software (Java based software program, NIH). 2.7. Real-time PCR Total RNA was isolated with the use of Genelute Mammalian Total RNA Miniprep kit (Sigma, St Louis, MO, USA). 1 μg of RNA was reverse transcribed with iScript™ cDNA Synthesis-Kit (Bio-Rad). cDNA was analyzed using quantitative real-time PCR in triplicate using SensiFAST™ SYBR® HI-ROX kit (Bioline, Taunton, MA, USA) in an ABI Prism 7900 HT Sequence Detection System (Applied Biosystems, Foster City, CA). Reactions performed in at least triplicate were analyzed by relative quantitation using RQ Manager software, version 1.2 (Applied Biosystems). The following primers were used for mRNA detection: Egr-1: Forward 5′-CTTACTCCTCTCCGGGCTCCTCTAC-3′ Reverse 5′-CCCTCCCTTTGCTCTC TTTCATTC, Cardiotrophin: Forward 5′-AGCCTTCCTGATTTCTGCAGGCT Reverse 5′-AATT TCTGTGTTGGCGCAGTGTGG, Leukemia Inhibitory Factor (LIF): Forward 5′-TGTGGTAGC AGCCGAGTCATAAT Reverse 5′-CGTGGCTTGTGTGTTCGGTTTCAT, Interleukin (IL)-6: Forward 5′-GCTCGTCGTCGACAACGGCCTC Reverse 5′-CAAACATGATCTGGGTCATCTTCTC, IL-11: Forward 5′-CGTGAAGCTGTGTTGTCCTG Reverse 5′-GCTCCTAGGACTGTCTTCTTC, GAPDH: Forward 5′-ATGGGAAGCTGGTCATCAAC-3′ Reverse 5′ GTGGTTCACACCCATC ACAA-3′. All data are presented as fold-change compared with control after normalization to housekeeping gene GAPDH. 2.8. Flow cytometry After exposure to the experimental conditions, H9c2 cells were collected and resuspended in 1× binding buffer. Then, these cells were stained with antibody to Annexin V-FITC and propidium iodide (BD Biosciences, Franklin Lakes, NJ) according to the

H. Mudaliar et al. / International Journal of Cardiology 228 (2017) 729–741

733

(A) 82 kDa

Actin

42 kDa

Expression of EGR-1/actin as % ctrl

EGR-1

250 ** 200

150 100 50 0 pCDNA 3.1 pCDNA 3.1 + EGR-1

(B) Normoxia

H/R

RIPC + H/R 0.88%

1.22%

0.38%

Control vector

Normoxia

RIPC + H/R

H/R

0.53%

2.52%

1.92%

Egr-1 expression vector

% of apoptotic cells

2

1.5

# **

1

Control vector Egr-1 expression vector

## 0.5

0 Normoxia

H/R

RIPC + H/R

Fig. 4. The role of Egr-1 in modulating remote ischemic preconditioning (RIPC) in H/R injury in H9c2 cells. (A) Egr-1 protein is overexpressed in cells transfected with the Egr-1 expression vector. (B) H9c2 cells in which Egr-1 protein was overexpressed induced a significantly greater rate of apoptosis in the normoxic and RIPC limbs. Data represents mean ± s.e.m. from n = 4. ⁎⁎P b 0.01 vs control (normoxia). ǂP b 0.05 vs H/R limb. #P b 0.05 vs corresponding control vector. ##P b 0.01 vs corresponding control vector.

734

H. Mudaliar et al. / International Journal of Cardiology 228 (2017) 729–741

(A)

(B) 150

*

7 6 5 4 3 2

1

**

**

**

LIF

cardiotrophin

IL-11

IL-6 prot ein secret ion in med ia

Fold change in mRN A of cyt okines (relative to GAPDH)

8

**

100

50

0

0 Control

IL-6

Normoxia

IPC

Fig. 5. The effect of ischemic preconditioning (IPC) in donor cells. (A) Donor H9c2 cells exposed to IPC demonstrated maximal transcription of IL-6 when assessed for cytokines involved in myocardial I/R injury. (B) Concomitantly, IL-6 protein secretion was increased in the supernatants of donor cells exposed to IPC. Data represents mean ± s.e.m. from n = 4 per H9c2 cell treatment group. ⁎P b 0.05 vs normoxia (control). ⁎⁎P b 0.01 vs normoxia.

manufacturer's instructions. The percentage of apoptotic cells was quantified by flow cytometry (BD, USA).

2.9. Luciferase assay H9c2 cells were plated into 6-well plates (1 × 104/well) until 70–80% confluence was observed. Just prior to transfection, complete full-serum medium was replaced with serum-free Opti-MEM media (Gibco) to enhance transfection efficiency. For each well, a 1:3 ratio of plasmid DNA to lipid reagent (ViaFect, Promega) was used. 1 μg of reporter construct (Cignal Egr-1 Reporter Assay kit; SABiosciences) was used per well. Cells were transfected with Viafect and 1 μg of pcDNA3.1 or pcDNA 3.1_Egr-1 in H9c2 cells overnight, after which the transfection medium was replaced with full-serum medium. Cells were grown for 24 h then serum deprived in 0.1% fetal calf serum overnight, before exposure to normoxia, H/R and RIPC. Cell lysates were harvested using PLB lysis buffer (Promega, Madison, WI, USA) and analyzed for Firefly and Renilla luciferase activities in a 96-well plate luminometer by the Promega Dual-Glo luciferase assay system and the Promega Glo-Max luminometer. Firefly luciferase activity was normalized for Renilla luciferase activity, as recommended by the manufacturer (Promega).

2.10. Phospho-ERK 1/2 ELISA H9c2 cells were plated in 6-well plates and exposed to experimental conditions as defined above in triplicate. Following treatment, the supernatant was centrifuged at 13,000 rpm for 5 min. Protein concentrations of secreted phospho-ERK 1/2 were determined using commercially available ELISA kits (R&D system). A microplate reader was used to read optical density (OD) at 450 nm. Cell lysate protein concentration from corresponding wells was determined by protein assay (Bio-Rad). Phosphorylated ERK 1/2 protein levels were corrected for protein content per well.

2.11. Measurement of ROS generation The ROS-Glo™ Assay (Promega Inc. Madison, WI) was used to measure the level of hydrogen peroxide (H2O2), directly in cell culture according to the manufacturer's recommendations. Cells were plated at a density of 100,000 cells/well in a 96 well plate and incubated overnight for attachment. Cells were subjected to the respective experimental limbs – normoxia, H/R and RIPC + H/R. H2O2 substrate solution was added to the plates before the plates were placed in normoxic chamber for the final 30 min stimulating “reperfusion injury”. The detection solution was then added to the plates and incubated at room temperature for 20 min. Relative luminescence was recorded using Promega Glo-Max Multi-detection system.

2.12. Statistical analyses Normalized results are expressed as a percentage of the mean ± standard error of the mean of control values or as stated. Experiments were performed at least in triplicate or as detailed in text. Statistical comparisons between groups were made by using unpaired Student t-tests or Mann-Whitney test. Analyses were performed using the PRISM software package (version 3; GraphPad Inc., San Diego, CA, USA), with significance highlighted where P values b0.05 were observed.

3. Results 3.1. The effect of remote ischemic preconditioning (RIPC) on infarct size reduction in myocardial ischemic-reperfusion (I/R) injury Administration of RIPC immediately prior to myocardial I/R injury resulted in a significant reduction in infarct size in Sprague Dawley rats. After 24 h from the induction of myocardial I/R injury, rats demonstrated an infarct size of 51.5 ± 2.55%, which was ameliorated to 30.2 ± 5.16% (P b 0.01) when administered with prior RIPC (Fig. 1A). Concurrently, myocardial I/R injury upregulated Egr-1 mRNA and protein expression in vivo to 2.09 ± 0.251-fold (P b 0.05) and 119.6 ± 3.18% (P b 0.01) of sham controls respectively. The mRNA and protein expression was significantly attenuated in rats which underwent RIPC prior to I/R. Transcription of Egr-1 mRNA was reduced by 0.522 ± 0.103-fold (P b 0.01) and protein expression to 72.3 ± 11.2% (P b 0.05) of hearts exposed to myocardial I/R without RIPC (Fig. 1B and C). 3.2. The effect of hypoxia-reperfusion (H/R) and remote ischemic preconditioning (RIPC) on cell viability and apoptosis in H9c2 cells We determined the effects of H/R and RIPC + H/R on cell viability with trypan blue exclusion. There was a significant reduction in cell viability to 44.5 ± 4.95% (P b 0.01) of control levels when H9c2 cells were exposed to H/R. However, exposing cells to RIPC prior to H/R injury in vitro rescued cell viability to 65.9 ± 6.04% (P b 0.05) of control levels compared to exposure to H/R alone (Fig. 2A). Flow cytometry revealed a greater percentage in cardiomyocyte apoptosis with H/R injury at 4.12 ± 0.78% (P b 0.05) compared to the normoxia control. Exposure to RIPC + H/R significantly reduced the degree of apoptosis to 1.62 ± 0.25% (P b 0.05) compared to H9c2 cells subjected to H/R alone (Fig. 2B). 3.3. The effect of hypoxia-reperfusion (H/R) and remote ischemic preconditioning (RIPC) on Egr-1 expression and reporter activity in H9c2 cells We subjected H9c2 cells to increasing reperfusion time following H/R injury and observed that the earliest time point of 30 min induced maximal Egr-1 transcription at 2.33 ± 0.22-fold (P b 0.01) of control levels (Fig. 3A). Subjecting H9c2 cells to H/R increased Egr-1 transcription to 2.95 ± 0.36-fold (P b 0.01) of control values. However, exposure to RIPC prior to H/R injury significantly attenuated Egr-1 transcription to

H. Mudaliar et al. / International Journal of Cardiology 228 (2017) 729–741

(A)

3.4. The role of Egr-1 in modulating RIPC in H/R injury in H9c2 cells #

3.5 Fold change in Egr-1 mRNA (relative to GAPDH)

735

*

3 2.5 2

-AG-490 1.5

+ AG-490

1 0.5 0 Normoxia

H/R

We transiently transfected H9c2 cells with Egr-1 expression plasmid (pCMV-Egr-1) and observed an increase in EGR-1 protein expression to 183.8 ± 14.4% (P b 0.01) of control values (Fig. 4A). To further delineate the direct relationship between RIPC and the expression of EGR-1, we subjected EGR-1 overexpressed cells to H/R with or without RIPC and assessed for cell death. EGR-1 overexpressed cells exhibited increased percentage of apoptotic cells at 0.53 ± 0.079% (P b 0.01) compared to wildtype H9c2 cells when exposed to normoxia. Exposure to RIPC + H/R failed to suppress apoptosis in EGR-1 overexpressed cells, significantly inducing the percentage of apoptotic cells to 2.52 ± 0.18% (P b 0.05).

RIPC + H/R

3.5. The effect of ischemic preconditioning on donor cells

(B) Normoxia

H/R

RIPC + H/R 91 kDa

p-STAT1 STAT1

81/92 kDa 92 kDa

p-STAT3 STAT3

92 kDa

Actin

p-STAT/STAT expression as % ctrl

3.6. The role of the Janus kinase and signal transducer and activator of transcription (JAK-STAT) pathway in modulating Egr-1 regulation in RIPC

42 kDa

300

**

250 200 ** 150

pSTAT1/STAT1 pSTAT3/STAT3

100 50 0 Normoxia

H/R

H9c2 cells exposed to ischemic preconditioning (3 cycles of alternating hypoxia and normoxia) showed a 5.39 ± 1.56-fold (P b 0.05) increase in interleukin (IL)-6 transcription compared to cells exposed to normoxia alone. Ischemic preconditioning did not significantly upregulate the expression of other cytokines critical in cardiovascular pathology such as leukemia inhibitory factor (LIF), cardiotrophin and IL-11 (Fig. 5A). With respect to protein levels, IL-6 secretion was increased to 126.6 ± 1.68% (P b 0.01) when H9c2 donor cells were subjected to remote ischemic preconditioning compared to cells exposed to normoxia alone (Fig. 5B).

RIPC + H/R

Fig. 6. The role of JAK-STAT signaling pathway in modulating Egr-1 regulation in RIPC. (A) Inhibition with AG-490, a specific JAK-STAT inhibitor, Egr-1 suppression was reversed in the RIPC limb. (B) The phosphorylation of STAT1 was induced with H/R injury however exposure to RIPC prior to H/R did not suppress STAT1 phosphorylation. H/R injury did not induce the phosphorylation of STAT3 however exposure to RIPC prior to H/R significantly upregulated STAT3 phosphorylation. Data represents mean ± s.e.m. from n = 4 individual experiments per treatment group. ⁎P b 0.05 vs normoxia. ⁎⁎P b 0.01 vs normoxia. ǂP b 0.05 vs H/R limb. #P b 0.05 compared to control limb without drug treatment.

We investigated the role of JAK-STAT pathway on Egr-1 modulation when exposed to H/R injury and RIPC respectively. Pretreatment of H9c2 cells with Tyrphostin AG-490, a JAK-STAT inhibitor reversed RIPC-mediated Egr-1 attenuation and induced a significant increase in Egr-1 transcription to 2.49 ± 0.740-fold (P b 0.05) of control values in the limb exposed to RIPC + H/R. However, Egr-1 transcription in the presence of the JAK-STAT inhibitor was not significantly different in the other experimental limbs (Fig. 6A). We further assessed for the role of STAT activation when exposed to H/R injury with or without RIPC. Exposure to H/R injury significantly increased the phosphorylation of STAT1 at Tyr-701 residue to 237.3 ± 29.9% (P b 0.01) of control values but administration of RIPC prior to H/R injury did not induce a significant change in the phosphorylation of STAT1. STAT3, known to be activated by IL-6 in the heart [33,64], was markedly phosphorylated at its Tyr-705 residue with prior exposure to RIPC to 120.9 ± 4.68% (P b 0.01) of control compared to the limb exposed to H/R injury alone. In addition, STAT3 was significantly phosphorylated compared to the normoxia control. However, exposure to H/R injury did not induce STAT3 phosphorylation (Fig. 6B). 3.7. The role of nitric oxide (NO) signaling and oxidative stress on Egr-1 regulation

1.60 ± 0.19-fold (P b 0.05) of control values (Fig. 3B). Similarly, we observed a significant increase in EGR-1 protein expression when H9c2 cells were exposed to H/R to 143.1 ± 9.27% (P b 0.05) of control levels and RIPC prior to H/R attenuated EGR-1 cellular expression to 58.7 ± 21.8% (P b 0.05) of control levels (Fig. 3C). We also determined the reporter activity of Egr-1 with exposure to H/R and RIPC with luciferase assay. Our results showed that H/R induced the promoter activity of Egr-1 to 143.8 ± 4.78% (P b 0.01) of control values and administering RIPC prior to H/R abrogated Egr-1 reporter activity to 113.4 ± 7.13% (P b 0.01) of control values (Fig. 3D).

To further elucidate the role of NO signaling on Egr-1 regulation, we pretreated H9c2 cells with 20 μM nitric oxide synthase (NOS) inhibitor, nitro-L-arginine methyl ester (L-NAME). There was significant upregulation in Egr-1 transcription in the limb exposed to normoxia to 3.39 ± 0.743-fold (P b 0.01) in the presence of the drug compared to control values. There was a further upregulation in Egr-1 mRNA in the limb exposed to RIPC + H/R to 7.48 ± 2.69fold (P b 0.01) in the presence of L-NAME compared to control (Fig. 7A). Oxidative stress has been shown to play a pivotal role in the pathophysiology of myocardial I/R injury. We measured the levels

736

H. Mudaliar et al. / International Journal of Cardiology 228 (2017) 729–741

(A)

(B) ##

200

**

10 8

6

- L-NAME

##

+ L-NAME

4

*

2

Average Luminescence (RLU) as % ctrl

Fold change in Egr-1 mRNA (relative to GAPDH)

12

150

100

50

0

0

Normoxia

H/R

RIPC + H/R

Normoxia

H/R

RIPC + H/R

(C) Fold change in Egr-1 mRNA (relative to GAPDH)

9 #

8 #

7

6

Control

5

#

PEG-SOD Glybenclamide

4

*

3 2

1 0 Normoxia

H/R

RIPC + H/R

Fig. 7. The role of nitric oxide (NO) signaling and oxidative stress on Egr-1 regulation. (A) Pretreatment with L-NAME, a nitric oxide synthase (NOS) inhibitor increased Egr-1 transcription in the limbs exposed to normoxia and RIPC prior to H/R injury. (B) H/R injury induced the secretion of reactive oxygen species (ROS) in the supernatant of H9c2 cells however RIPC abrogated the production of ROS. (C) Significant increase in Egr-1 transcription in the limbs exposed to H/R and RIPC prior to H/R when pretreated with polyethylene glycolconjugated superoxide dismutase (PEG-SOD), a superoxide scavenger. However, pretreatment with Glibenclamide, a KATP channel blocker, suppressed Egr-1 transcription only in the limb exposed to RIPC. Data represents mean ± s.e.m. from n = 4 individual experiments per treatment group. ⁎P b 0.05 vs normoxia. ⁎⁎P b 0.01 vs normoxia. ǂP b 0.05 vs H/R limb. ǂǂ P b 0.01 vs H/R limb. #P b 0.05 compared to control limb without drug treatment. ##P b 0.01 compared to control limb without drug treatment.

of reactive oxygen species (ROS) generated by each experimental condition through the release of H 2 O 2 into the supernatant. The amount of H2O 2 levels generated in H/R injury was 177.9 ± 2.46%

(A)

(B)

Phospho-p38

38 kDa 38 kDa

Actin

42 kDa

**

250 *

200 150 100 50

20

Fold change in Egr-1 mRNA (relative to GAPDH)

Total p38

300

Phospho-p38/total p38 expression as % ctrl

(P b 0.01) of control values. However, exposure to RIPC + H/R attenuated the release of H2O2 to 118.6 ± 2.03% (P b 0.01) compared to exposure to H/R alone (Fig. 7B).

##

18 16

14 12 10

- SB239063

8

+ SB239063

6

*

4 2

0

0 Normoxia

H/R

RIPC + H/R

Normoxia

H/R

RIPC + H/R

Fig. 8. The role of p38 mitogen activated protein kinases (MAPK) in H/R injury in H9c2 cells. (A) p38 MAPK activation was augmented in cells with H/R injury and further increased in cells with RIPC. (B) Pharmacological inhibition of the p38 MAPK pathway through the use of SB239063 reversed RIPC-mediated Egr-1 attenuation in the limb treated with RIPC prior to H/R injury. Data represents mean ± s.e.m. from n = 5. ⁎P b 0.05 vs normoxia. ⁎⁎P b 0.01 vs normoxia. ǂP b 0.05 vs H/R limb. ##P b 0.01 compared to control limb without drug treatment.

H. Mudaliar et al. / International Journal of Cardiology 228 (2017) 729–741

(A)

(B)

12

*

3

10

*

8 Control 6

L-NAME FeTTPs

4

2 0

Fold change in Egr-1 mRNA (relative to GAPDH)

Phospho-ERK 1/2

737

2.5 2 - U0126

1.5 ##

1

+ U0126

##

0.5 0

Normoxia

H/R

RIPC+ H/R

Normoxia

H/R

RIPC + H/R

Fig. 9. The role of Extracellular-Signal Regulated Kinases (ERK) in the regulation of Egr-1 in H/R injury. (A) H/R injury induced the phosphorylation of ERK 1/2 which was suppressed with prior administration of RIPC. Pretreatment with NOS inhibitor, L-NAME reversed RIPC-mediated suppression of ERK 1/2 phosphorylation but no change in Egr-1 transcription was observed in the other limbs. Pretreatment with FeTTPs, a peroxynitrate inhibitor demonstrated no change in phosphorylated ERK 1/2 levels in all limbs. (B) Pretreatment of cells with ERK 1/2 inhibitor, U0126 reduced Egr-1 transcription in both limbs exposed to H/R injury and prior RIPC compared to corresponding controls without the inhibitor. Data represents mean ± s.e.m. from n = 5. ⁎P b 0.05 vs normoxia. ǂP b 0.05 vs H/R limb. ǂǂP b 0.01 vs H/R limb. ##P b 0.01 compared to control limb without drug treatment.

To address the relationship between oxidative stress and Egr-1, we pretreated H9c2 cells with 100 units/mL of polyethylene-glycoladsorbed-superoxide dismutase (PEG-SOD), a specific superoxide scavenger. The use of PEG-SOD markedly increased Egr-1 transcription to 5.82 ± 0.92-fold (P b 0.05) of control values in the H/R limb and reversed RIPC mediated Egr-1 attenuation by increasing it to 3.56 ± 0.708-fold of control values (P b 0.05) The involvement of the mitochondrial KATP channel has been previously implicated in the mechanism of ischemic preconditioning-mediated cardiac protection. To elucidate the role of mitochondrial KATP channel activation and the regulation of Egr-1 in our experimental model, we pretreated H9c2 cells with 25 μM Glibenclamide, a KATP channel blocker. The inhibition of KATP channels markedly unregulated Egr-1 transcription in the limbs exposed to RIPC prior to H/R injury to 5.69 ± 1.95–fold (P b 0.05) of control values. However, Glibenclamide mediated no significant change in Egr-1 transcription with H/R injury (Fig. 7C). 3.8. The activation of p38 mitogen activated protein kinase (MAPK) in H/R injury in H9c2 cells Subjecting H9c2 cells to H/R injury increased p38 phosphorylation to 160.5 ± 14.5% (P b 0.05) of control levels. Administering RIPC prior to H/R injury resulted in a further increase in the activation of p38 as evidenced by the increase in phosphorylation of p38 to 243.4 ± 21.4% (P b 0.01) of control levels (Fig. 8A). Inhibition of the p38 MAPK pathway through pre-incubation with 50 μM SB239063 led to a significant upregulation of Egr-1 mRNA within cells exposed to RIPC prior to H/R injury to 13.9 ± 3.73-fold (P b 0.01) of control values. However, there was no significant difference in Egr-1 mRNA regulation in cells subjected to H/R injury with SB239063 (Fig. 8B). 3.9. The role of Extracellular-Signal Regulated Kinases (ERK) pathway in regulating H/R injury in H9c2 cells ERK 1/2 has been shown to be potentially upregulated in myocardial I/R injuries [3]. We confirmed this upregulation by assaying phosphorylated ERK 1/2 levels in our experimental limbs with ELISA. H/R injury induced an increase in phosphorylated ERK 1/2 protein levels to 7.32 ± 1.09 ng/mL (P b 0.05) however exposure to RIPC prior to H/R attenuated phosphorylated ERK 1/2 protein levels to 3.98 ± 0.96 ng/mL (P b 0.05). Pretreatment with L-NAME reversed RIPC-suppressed levels of phosphorylated ERK 1/2 levels and instead increased its levels to 8.2 ± 0.85 ng/mL (P b 0.01) in the RIPC limb. However, pretreatment with 20 μM FeTTPs, a peroxynitrate

decomposition catalyst induced no change in ERK 1/2 phosphorylation in all experimental limbs (Fig. 9A). We utilized U0126 monoethanolate, a highly selective inhibitor of MAPK kinases known to repress downstream ERK 1/2 activation, to determine Egr-1 modulation by ERK 1/2. Pretreatment of H9c2 cells with 500 nM U0126 monoethanolate attenuated the expression of Egr-1 mRNA to 0.817 ± 0.147-fold (P b 0.01) and 0.230 ± 0.0361-fold (P b 0.01) of control levels in the H/R and RIPC + H/R limbs respectively (Fig. 9B). 3.10. The role of JAK-STAT signaling through the activation of nitric oxide (NO) and NADPH oxidase (Nox) in modulating Egr-1 transcription in RIPC in rats NADPH oxidases (Nox) are known to contribute to the major production of reactive oxygen species in cardiovascular cells [67]. We showed that myocardial I/R injury induced NADPH oxidase (Nox2) and inducible nitric oxide synthase (iNOS) transcription in rat hearts to 6.78 ± 0.983–fold (P b 0.01) and 3.27 ± 0.71-fold (P b 0.05) of sham (control) rats. Administering RIPC to the hind limb of the rat prior to myocardial I/R injury markedly upregulated Nox2 and iNOS transcription to 30.4 ± 7.11-fold (P b 0.01) and 7.10 ± 1.15-fold (P b 0.05) of control levels respectively. No significant change in Nox1 and eNOS levels was observed (Fig. 10A). We assessed for the activation of STAT proteins in rat tissues exposed to I/R injury with or without prior administration of RIPC to the hind leg. We demonstrated an increase in phosphorylated STAT1 to 307.9 ± 29.7% (P b 0.01) of control (sham) rats with I/R injury. In contrary to our in vitro data, we observed a reduction in phosphorylated STAT1 levels (P b 0.05) in rats exposed to RIPC + I/R compared to I/R alone although its expression levels remained significantly elevated at 204.3 ± 40.6% (P b 0.05) of control. Our results also showed RIPC induced phosphorylation of STAT3 to 208.2 ± 14.7% (P b 0.01) of control compared to rat hearts exposed to I/R alone. However, myocardial I/R injury failed to induce STAT3 phosphorylation (Fig. 10B). 4. Discussion In this study, we have shown novel data that RIPC suppressed H/R injury-mediated Egr-1 expression in cardiomyocytes which may be in part governed by the release of cytokine IL-6 in the remotely preconditioned organ. We have uniquely demonstrated with the selective inhibition of intracellular signaling pathways in RIPC, the involvement of pro-survival kinase p38 MAPK and further delineated the induction of RIPC prior to H/R injury increased the production of

738

H. Mudaliar et al. / International Journal of Cardiology 228 (2017) 729–741

(A) Fold change in mRN A expression (relative to GAPDH)

40

35 30 25

Nox1

20

Nox2

iNOS

15

eNOS

**

10

*

5 0 Sham

I/R

RIPC + I/R

(B) Normoxia

H/R

RIPC + H/R

p-STAT1

91 kDa

STAT1

81/92 kDa 92 kDa

STAT3

92 kDa

Actin

42 kDa

pSTAT/STAT expression as % ctrl

p-STAT3

400

*

350 300

* **

250 200

pSTAT1/STAT1

150

pSTAT3/STAT3

100 50 0 Normoxia

H/R

RIPC + H/R

Fig. 10. The role of NO, NADPH oxidase (Nox) and JAK-STAT signaling in rats. (A) I/R injury induced transcription of Nox2 and iNOS in rat hearts. Administration of RIPC prior to I/R injury further increased the transcription of Nox2 and iNOS in rat hearts compared to exposure to I/R alone. However, there was no increase in Nox1 and eNOS transcription in rat hearts exposed to I/R injury with or without RIPC. (B) STAT1 phosphorylation was augmented in rats exposed to I/R injury and RIPC prior to I/R injury respectively. However, STAT3 phosphorylation was only induced in rats exposed to RIPC prior to I/R injury. Data represents mean ± s.e.m. from n = 4 individual experiments per treatment group. ⁎P b 0.05 vs normoxia. ⁎⁎P b 0.01 vs normoxia. ǂP b 0.05 vs H/R limb.

intracellular nitric oxide and NADPH-generated superoxide through activation of the JAK-STAT pathway which most likely contributes to cardioprotection in remote preconditioning. Furthermore, our findings have also implicated KATP channels in cardiomyocytes to be important regulators of RIPC-mediated Egr-1 suppression. The results also confirm that H/R injury induced myocardial upregulation of the ERK 1/2 pathway and demonstrated a further RIPC suppression in Egr-1 expression with the additional blockade of the ERK 1/2 pathway in RIPC. Taken together, our data supports that the cardioprotective role exerted by RIPC mechanistically abrogates Egr-1 expression in myocardial I/R injury through the regulation of the JAK-STAT pathway, prosurvival kinases and oxidative stressors (Scheme 1). Transcription factor Egr-1 is recognized as a “master regulator” that plays a key role in triggering inflammation-induced tissue injury after ischemia and reperfusion [5]. Our findings demonstrated a reduction in infarct size with a concomitant reduction in Egr-1 expression with the administration of RIPC in Sprague Dawley rats. Similarly, in vitro

we showed augmented Egr-1 expression with the induction of H/R injury and abrogated Egr-1 expression with exposure to RIPC prior to H/R injury. Although RIPC has been shown by recent experimental and clinical studies to exert cardioprotective effects by reducing infarct size and improving endothelial function [12,14,25,32], the molecular mechanisms regarding the identities of the triggers and cardiac signaling components are yet to be fully elucidated. In our study, we have confirmed that the administration of RIPC prior to the induction of H/R injury rescued cell viability and attenuated apoptosis in H9c2 cells. Importantly, we have demonstrated a key role for Egr-1 regulation in the protective effect of RIPC. We showed that RIPC lost its ability to rescue cell death in Egr-1 overexpressed cells, demonstrating that RIPC mediated Egr-1 suppression is key in ameliorating I/R induced cardiomyocyte apoptosis. We further delineated that RIPC inhibited the functional activation of Egr-1 by inhibiting its promoter activity thereby preventing the transcription of downstream Egr-1-dependent genes. We investigated the upstream mediators in RIPC and their causal modulation of Egr-1 through the selective inhibition of signaling pathways. Myocardial I/R injury has been shown to activate protein kinases notably MAPK kinases such as p38 MAPK and ERK 1/2 [63,65]. The role of p38 MAPK in exerting a protective effect in ischemic preconditioning has been controversial. However, the phosphorylation of p38 MAPK during ischemia has been well-documented and its inhibition has been shown to contribute to the protection of ischemic preconditioning in murine and porcine models [34,48]. Consistent with prior studies, our results support the activation of p38 MAPK with the induction of H/R injury in cardiomyocytes and further upregulation in p38 MAPK activation with exposure to RIPC. Furthermore, for the first time we showed that the use of a p38 MAPK inhibitor reversed RIPC-mediated Egr-1 suppression indicating a pivotal role for the p38 MAPK pathway in the regulation of Egr-1 in response to ischemic preconditioning in the remote organ. Our findings also demonstrated no significant regulation of Egr-1 by the p38 MAPK pathway with exposure to H/R injury. The activation of the RISK pathway by pro-survival kinase ERK 1/2 has been demonstrated to confer powerful cardioprotection against myocardial ischemia reperfusion injury [20,21,42]. We showed the activation of mitogen-activated protein kinase ERK 1/2 with H/R injury which is consistent with a plethora of studies demonstrating an increase in ERK 1/2 with myocardial I/R injury [27,30,65]. Our results also showed that nitric oxide increased in RIPC may be responsible in part for the inhibition of ERK 1/2 activation thereby supporting the suppression of Egr-1 expression in RIPC. Moreover, with the use of a NOS inhibitor, we showed Egr1-mediated increase in ERK 1/2 in H/R injury. We showed further attenuation in Egr-1 expression with dual exposure to RIPC and ERK 1/2 inhibitor indicating that the suppression of ERK 1/2 plays a key role in attenuating Egr-1 expression in RIPC. Dawn et al., has shown the activation of JAK-STAT pathway in late preconditioning with the release of IL-6 [13]. In the present study, we showed an increase in IL-6 in the donor cells subjected to cycles of hypoxia and reperfusion (ischemic preconditioning) with the concurrent activation of the JAK-STAT pathway in the recipient cells (cells exposed to the supernatant of donor cells) ultimately suppressing Egr-1 activation. To further support the involvement of the JAK-STAT pathway, we also demonstrated an increase in the activation of STAT1 in H9c2 cells exposed to H/R injury and conversely observed an increase in the activation of STAT3 in the limb exposed to RIPC prior to H/R injury. In vivo, we showed similar results with an upregulation of phosphorylated STAT3 in rat hearts exposed to prior RIPC. However, with respect to STAT1, although prior induction of RIPC moderately suppressed STAT1 phosphorylation, phosphorylated STAT1 remained significantly elevated in rat hearts exposed to both myocardial I/R injury with or without RIPC. Our findings are in keeping with previous studies which establish the key role of STAT1 in the induction of apoptosis through the activation of effectors such as caspases and Fas ligands whereas STAT3 has been shown to protect cardiomyocytes following I/R injury by TNF-α mediated activation of Survivor Activating Factor Enhancement (SAFE)

H. Mudaliar et al. / International Journal of Cardiology 228 (2017) 729–741

739

Scheme 1. Possible mechanism of Egr-1 attenuation following myocardial ischemic reperfusion (I/R) injury and remote ischemic preconditioning (RIPC).

pathway, the activation of several STAT3 target genes such as Bcl-2, FLIP, and survivin and the inhibition of caspases [18,29,50,52,53]. Further support for the role of STAT1 as a pro-apoptotic factor in the myocardium comes from studies which show that inhibition of STAT1 activity during I/R results in significant cardioprotection [51,56]. In addition, the proapoptotic effects of STAT1 have been shown to be blocked by p38 MAPK inhibition, suggesting cross-talk between the JAK-STAT pathway and the MAP kinase pathway during I/R injury [55]. On the other hand, STAT3 overexpression has been shown to protect mice from doxorubicin-induced cardiomyopathy and transfection of STAT3 into cardiac myocytes abrogated the proapoptotic effects of STAT1 following I/R injury [38,54]. Furthermore, increased expression of STAT3 has been shown to inhibit the proapoptotic effects of STAT1 in fibroblasts [49]. Since STAT1 and 3 can act antagonistically to one another to control apoptosis, our data therefore suggests that the activation of p38 and STAT3 in RIPC may be limiting STAT1-mediated apoptosis. Therefore, we postulate that IL-6 released by the donor organ potentially plays a proximal and essential role in the activation of the downstream JAK-STAT pathway, in particular through the tyrosine phosphorylation of STAT3 by overriding the apoptotic effects of STAT1 in the remotely preconditioned organ ultimately suppressing Egr-1 expression. It has been previously shown that myocardial IL-6 signaling activated JAK-STAT3 pathway leading to the generation of nitric oxide in the heart in patients with donor heart dysfunction [10]. To further delineate the molecular mechanisms of nitric oxide regulation in RIPC, we used a nitric oxide synthase inhibitor and have clearly shown a reversal in RIPC-mediated Egr-1 suppression indicating that nitric oxide plays a key role in ameliorating Egr-1 expression in the remotely preconditioned heart. Additionally, we have also observed an increase in Egr-1 expression with the use of a nitric oxide synthase inhibitor in the normoxic limb indicating that basal levels of nitric oxide required for normal cardiac physiology may also be suppressing Egr-1 expression. In support of our in vitro data, we have demonstrated iNOS

activation in rat hearts exposed to I/R injury and a further induction with RIPC. This is consistent with studies supporting the essential role of enhanced nitric oxide production by iNOS in mediating antistunning and anti-infarct actions of ischemic preconditioning independent of eNOS regulation [8,23,31]. There is increasing evidence which advocates the necessity for reactive oxygen species (ROS) in cellular homeostasis however when produced in excess have been shown to contribute to the development and progression of cardiovascular diseases [57]. The sudden reperfusion in I/R injury has been shown to produce augmented oxidative stress which in turn contributes to myocardial injury and cardiomyocyte death [11,60]. In our study, we measured the levels of hydrogen peroxide, a ROS, as a marker for oxidative stress and demonstrated consistent data with an increase in oxidative stress with H/R injury and showed attenuated oxidative stress with prior administration of RIPC. With a superoxide scavenger, we demonstrated that the modulation of Egr-1 expression is regulated by ROS by both H/R and RIPC. Given that ROSdependent preconditioning has been previously shown to rely on Nox2-containing NADPH oxidase in a Langendorff perfused isolated mouse heart model of I/R injury [4], we show consistent data in rats demonstrating a superinduction of Nox2-containing NADPH oxidase with RIPC, further alluding to the pivotal role of ROS mediated cardioprotection in preconditioning. Our results suggest that moderate increases in ROS trigger cardioprotection through the suppression of Egr-1 expression whereas greater increases in ROS when subjected to H/R injury induce Egr-1 expression consequently resulting in cardiomyocyte death. The role of KATP channels in myocardial protection and preservation of cardiac function following an ischemic insult has been extensively studied. In particular, cardiac mitochondrial KATP, implicated in the generation of ROS in preconditioning in myocardial I/R injury, has been identified as the key effector in cardioprotection during ischemic preconditioning although the precise mechanisms of protection are yet to be defined [40,41]. In this study, we have demonstrated

740

H. Mudaliar et al. / International Journal of Cardiology 228 (2017) 729–741

novel results that the suppression of Egr-1 expression with RIPC is a KATP-dependent mechanism further illustrating a loss of remote preconditioning benefits in the absence of ROS. Collectively, our data suggests that RIPC administered prior to H/R injury rescues cell viability and is protective against H/R-induced late stage apoptosis with the concurrent attenuation of Egr-1 expression. Moreover, with the selective inhibition of intracellular signaling pathways, we have delineated that RIPC suppressed Egr-1 expression through MAPK activated pathways such as p38 and the JAK-STAT pathway which may have proximally increased the production of intracellular nitric oxide and ROS resulting in the suppression of Egr-1 transcription. We also provided evidence of the involvement of ERK 1/ 2 pathway in upregulating Egr-1 in H/R injury which in RIPC is suppressed by nitric oxide generated by JAK-STAT signaling. Rapid ischemia-activated Egr-1 plays a central role in inducing the pivotal regulators of inflammation, coagulation and vascular hyperpermeability leading to tissue damage. Therefore, a better understanding of the underlying cellular mechanisms which regulate Egr-1 expression in myocardial I/R injury and RIPC would facilitate the development of better clinical treatment options and an improved prognosis following myocardial I/R injury.

[16]

[17]

[18]

[19]

[20]

[21] [22] [23]

[24]

Conflict of interest

[25]

The authors report no relationships that could be construed as a conflict of interest.

[26]

References [1] The Heart Foundation, National Goal for Acute Coronary Syndromes-Australian Safety and Quality Goals Melbourne, The National Heart Foundation of Australia, 2012. [2] R.M. Ahmed, H.A. Mohamed el, M. Ashraf, S. Maithili, F. Nabil, R. Rami, T.I. Mohamed, Effect of remote ischemic preconditioning on serum troponin T level following elective percutaneous coronary intervention. Catheterization and cardiovascular interventions, Catheter. Cardiovasc. Interv. 82 (2013) E647–E653. [3] S.C. Armstrong, Protein kinase activation and myocardial ischemia/reperfusion injury, Cardiovasc. Res. 61 (2004) 427–436. [4] R.M. Bell, A.C. Cave, S. Johar, D.J. Hearse, A.M. Shah, M.J. Shattock, Pivotal role of NOX-2-containing NADPH oxidase in early ischemic preconditioning, FASEB J. 19 (2005) 2037–2039. [5] R. Bhindi, R.G. Fahmy, A.C. McMahon, L.M. Khachigian, H.C. Lowe, Intracoronary delivery of DNAzymes targeting human EGR-1 reduces infarct size following myocardial ischaemia reperfusion, J. Pathol. 227 (2012) 157–164. [6] R. Bhindi, L.M. Khachigian, H.C. Lowe, DNAzymes targeting the transcription factor Egr-1 reduce myocardial infarct size following ischemia–reperfusion in rats, J. Thromb. Haemost. 4 (2006) 1479–1483. [7] R. Bhindi, P.K. Witting, A.C. McMahon, L.M. Khachigian, H.C. Lowe, Rat models of myocardial infarction. Pathogenetic insights and clinical relevance, Thromb. Haemost. 96 (2006) 602–610. [8] R. Bolli, Cardioprotective function of inducible nitric oxide synthase and role of nitric oxide in myocardial ischemia and preconditioning: an overview of a decade of research, J. Mol. Cell. Cardiol. 33 (2001) 1897–1918. [9] H.E. Botker, R. Kharbanda, M.R. Schmidt, M. Bottcher, A.K. Kaltoft, C.J. Terkelsen, K. Munk, N.H. Andersen, T.M. Hansen, S. Trautner, J.F. Lassen, E.H. Christiansen, L.R. Krusell, S.D. Kristensen, L. Thuesen, S.S. Nielsen, M. Rehling, H.T. Sorensen, A.N. Redington, T.T. Nielsen, Remote ischaemic conditioning before hospital admission, as a complement to angioplasty, and effect on myocardial salvage in patients with acute myocardial infarction: a randomised trial, Lancet 375 (2010) 727–734. [10] C.F. Bulcao, K.M. D'Souza, R. Malhotra, M. Staron, J.Y. Duffy, P.K. Pandalai, V. Jeevanandam, S.A. Akhter, Activation of JAK-STAT and nitric oxide signaling as a mechanism for donor heart dysfunction, J. Heart Lung Transplant. 29 (2010) 346–351. [11] S.J. Clarke, I. Khaliulin, M. Das, J.E. Parker, K.J. Heesom, A.P. Halestrap, Inhibition of mitochondrial permeability transition pore opening by ischemic preconditioning is probably mediated by reduction of oxidative stress rather than mitochondrial protein phosphorylation, Circ. Res. 102 (2008) 1082–1090. [12] F. D'Ascenzo, C. Moretti, P. Omede, E. Cerrato, E. Cavallero, F. Er, D.G. Presutti, F. Colombo, G. Crimi, F. Conrotto, J.J. Dinicolantonio, S. Chen, A. Prasad, G. Biondi Zoccai, F. Gaita, Cardiac remote ischaemic preconditioning reduces periprocedural myocardial infarction for patients undergoing percutaneous coronary interventions: a meta-analysis of randomised clinical trials, EuroIntervention 9 (2014) 1463–1471. [13] B. Dawn, Y. Xuan, A. Rezazadeh, A. Stein, G. Hunt, W. Wu, W. Tan, R. Bolli, IL-6 plays an obligatory role in late preconditioning via JAK-STAT signaling and upregulation of iNOS and COX-2, Cardiovasc. Res. 64 (2004) 61–71. [14] J.H. Dong, Y.X. Liu, E.S. Ji, R.R. He, Limb ischemic preconditioning reduces infarct size following myocardial ischemia-reperfusion in rats, Sheng li xue bao: Acta Phys. Sin. 56 (2004) 41–46. [15] E.A. Dumont, L. Hofstra, W.L. van Heerde, S. van den Eijnde, P.A. Doevendans, E. DeMuinck, M.A. Daemen, J.F. Smits, P. Frederik, H.J. Wellens, M.J. Daemen, C.P.

[27]

[28]

[29]

[30]

[31]

[32]

[33]

[34]

[35]

[36]

[37]

[38]

[39] [40] [41] [42]

[43]

Reutelingsperger, Cardiomyocyte death induced by myocardial ischemia and reperfusion: measurement with recombinant human annexin-V in a mouse model, Circulation 102 (2000) 1564–1568. B.C. Gho, R.G. Schoemaker, M.A. van den Doel, D.J. Duncker, P.D. Verdouw, Myocardial protection by brief ischemia in noncardiac tissue, Circulation 94 (1996) 2193–2200. A. Guerchicoff, S.J. Brener, A. Maehara, B. Witzenbichler, M. Fahy, K. Xu, B.J. Gersh, R. Mehran, C.M. Gibson, G.W. Stone, Impact of delay to reperfusion on reperfusion success, infarct size, and clinical outcomes in patients with ST-segment elevation myocardial infarction: the INFUSE-AMI trial (INFUSE-Anterior Myocardial Infarction), JACC Cardiovasc. Interv. 7 (2014) 733–740. R. Hattori, N. Maulik, H. Otani, L. Zhu, G. Cordis, R.M. Engelman, M.A. Siddiqui, D.K. Das, Role of STAT3 in ischemic preconditioning, J. Mol. Cell. Cardiol. 33 (2001) 1929–1936. D.J. Hausenloy, P.K. Mwamure, V. Venugopal, J. Harris, M. Barnard, E. Grundy, E. Ashley, S. Vichare, C. Di Salvo, S. Kolvekar, M. Hayward, B. Keogh, R.J. MacAllister, D.M. Yellon, Effect of remote ischaemic preconditioning on myocardial injury in patients undergoing coronary artery bypass graft surgery: a randomised controlled trial, Lancet 370 (2007) 575–579. D.J. Hausenloy, A. Tsang, D.M. Yellon, The reperfusion injury salvage kinase pathway: a common target for both ischemic preconditioning and postconditioning, Trends Cardiovasc. Med. 15 (2005) 69–75. D.J. Hausenloy, D.M. Yellon, Reperfusion injury salvage kinase signalling: taking a RISK for cardioprotection, Heart Fail. Rev. 12 (2007) 217–234. T. Kalogeris, C.P. Baines, M. Krenz, R.J. Korthuis, Cell biology of ischemia/reperfusion injury, Int. Rev. Cell Mol. Biol. 298 (2012) 229–317. S. Kanno, P.C. Lee, Y. Zhang, C. Ho, B.P. Griffith, L.L. Shears, T.R. Billiar, Attenuation of myocardial ischemia/reperfusion injury by superinduction of inducible nitric oxide synthase, Circulation 101 (2000) 2742–2748. L.M. Khachigian, Early growth response-1 in cardiovascular pathobiology, Circ. Res. 98 (2006) 186–191. R.K. Kharbanda, U.M. Mortensen, P.A. White, S.B. Kristiansen, M.R. Schmidt, J.A. Hoschtitzky, M. Vogel, K. Sorensen, A.N. Redington, R. MacAllister, Transient limb ischemia induces remote ischemic preconditioning in vivo, Circulation 106 (2002) 2881–2883. R.K. Kharbanda, M. Peters, B. Walton, M. Kattenhorn, M. Mullen, N. Klein, P. Vallance, J. Deanfield, R. MacAllister, Ischemic preconditioning prevents endothelial injury and systemic neutrophil activation during ischemia-reperfusion in humans in vivo, Circulation 103 (2001) 1624–1630. V.K. Kutala, M. Khan, R. Mandal, L.P. Ganesan, S. Tridandapani, T. Kalai, K. Hideg, P. Kuppusamy, Attenuation of myocardial ischemia-reperfusion injury by trimetazidine derivatives functionalized with antioxidant properties, J. Pharmacol. Exp. Ther. 317 (2006) 921–928. S.C. Lang, A. Elsässer, C. Scheler, S. Vetter, C.P. Tiefenbacher, W. Kübler, H.A. Katus, P.D.D.A. Vogt, Myocardial preconditioning and remote renal preconditioning, Basic Res. Cardiol. 101 (2006) 149–158. S. Lecour, Activation of the protective Survivor Activating Factor Enhancement (SAFE) pathway against reperfusion injury: does it go beyond the RISK pathway? J. Mol. Cell. Cardiol. 47 (2009) 32–40. T. Luo, B. Chen, Z. Zhao, N. He, Z. Zeng, B. Wu, Y. Fukushima, M. Dai, Q. Huang, D. Xu, J. Bin, M. Kitakaze, Y. Liao, Histamine H2 receptor activation exacerbates myocardial ischemia/reperfusion injury by disturbing mitochondrial and endothelial function, Basic Res. Cardiol. 108 (2013) 342. L. Ma, F. Kong, H. Ge, J. Liu, F. Gong, L. Xu, B. Hu, R. Sun, Ventricular hypertrophy blocked delayed anesthetic cardioprotection in rats by alteration of iNOS/COX-2 signaling, Sci. Rep. 4 (2014) 7071. V. Manchurov, N. Ryazankina, T. Khmara, D. Skrypnik, R. Reztsov, E. Vasilieva, A. Shpektor, Remote ischemic preconditioning and endothelial function in patients with acute myocardial infarction and primary PCI, Am. J. Med. 127 (2014) 670–673. R. Matsuo, H. Morihara, T. Mohri, S. Murasawa, K. Takewaki, H. Nakayama, M. Maeda, Y. Fujio, The inhibition of N-glycosylation of glycoprotein 130 molecule abolishes STAT3 activation by IL-6 family cytokines in cultured cardiac myocytes, PLoS One 9 (2014), e111097. M.M. Mocanu, G.F. Baxter, Y. Yue, S.D. Critz, D.M. Yellon, The p38 MAPK inhibitor, SB203580, abrogates ischaemic preconditioning in rat heart but timing of administration is critical, Basic Res. Cardiol. 95 (2000) 472–478. G. Montalescot, H.R. Andersen, D. Antoniucci, A. Betriu, M.J. de Boer, L. Grip, F.J. Neumann, M.T. Rothman, Recommendations on percutaneous coronary intervention for the reperfusion of acute ST elevation myocardial infarction, Heart 90 (2004) e37. J.A. Moolman, S. Hartley, J. Van Wyk, E. Marais, A. Lochner, Inhibition of myocardial apoptosis by ischaemic and beta-adrenergic preconditioning is dependent on p38 MAPK, Cardiovasc. Drugs Ther. 20 (2006) 13–25. B.A.L. Müller, N.S. Dhalla, Mechanisms of the beneficial actions of ischemic preconditioning on subcellular remodeling in ischemic-reperfused heart, Curr. Cardiol. Rev. 6 (2010) 255–264. S. Negoro, K. Kunisada, E. Tone, M. Funamoto, H. Oh, T. Kishimoto, K. YamauchiTakihara, Activation of JAK/STAT pathway transduces cytoprotective signal in rat acute myocardial infarction, Cardiovasc. Res. 47 (2000) 797–805. M. Nichols, K. Peterson, L. Alston, S. Allender, Australian Heart Disease Statistics 2014, National Heart Foundation of Australia, Melbourne, 2014. B. O'Rourke, Evidence for mitochondrial K+ channels and their role in cardioprotection, Circ. Res. 94 (2004) 420–432. B. O'Rourke, Myocardial KATP channels in preconditioning, Circ. Res. 87 (2000) 845–855. A. Prasad, G.W. Stone, D.R. Holmes, B. Gersh, Reperfusion injury, microvascular dysfunction, and cardioprotection: the “dark side” of reperfusion, Circulation 120 (2009) 2105–2112. K. Przyklenk, B. Bauer, M. Ovize, R.A. Kloner, P. Whittaker, Regional ischemic ‘preconditioning’ protects remote virgin myocardium from subsequent sustained coronary occlusion, Circulation 87 (1993) 893–899.

H. Mudaliar et al. / International Journal of Cardiology 228 (2017) 729–741 [44] K. Przyklenk, P. Whittaker, Remote ischemic preconditioning: current knowledge, unresolved questions, and future priorities, J. Cardiovasc. Pharmacol. Ther. 16 (2011) 255–259. [45] B.S. Rayner, G.A. Figtree, T. Sabaretnam, P. Shang, J. Mazhar, J.C. Weaver, W.N. Lay, P.K. Witting, S.N. Hunyor, S.M. Grieve, L.M. Khachigian, R. Bhindi, Selective inhibition of the master regulator transcription factor Egr-1 with catalytic oligonucleotides reduces myocardial injury and improves left ventricular systolic function in a preclinical model of myocardial infarction, J. Am. Heart Assoc. 2 (2013), e000023. [46] A. Redel, V. Jazbutyte, T.M. Smul, M. Lange, T. Eckle, H. Eltzschig, N. Roewer, F. Kehl, Impact of ischemia and reperfusion times on myocardial infarct size in mice in vivo, Exp. Biol. Med. (Maywood) 233 (2008) 84–93. [47] M.N. Sack, Mitochondrial depolarization and the role of uncoupling proteins in ischemia tolerance, Cardiovasc. Res. 72 (2006) 210–219. [48] R. Schulz, S. Belosjorow, P. Gres, J. Jansen, M. Michel, G. Heusch, p38 MAP kinase is a mediator of ischemic preconditioning in pigs, Cardiovasc. Res. 55 (2002) 690–700. [49] Y. Shen, G. Devgan, J.E. Darnell, J.F. Bromberg, Constitutively activated Stat3 protects fibroblasts from serum withdrawal and UV-induced apoptosis and antagonizes the proapoptotic effects of activated Stat1, Proc. Natl. Acad. Sci. 98 (2001) 1543–1548. [50] R.M. Smith, N. Suleman, L. Lacerda, L.H. Opie, S. Akira, K.R. Chien, M.N. Sack, Genetic Depletion of Cardiac Myocyte STAT-3 Abolishes Classical Preconditioning, 2004 611–616. [51] A. Stephanou, Activated STAT-1 pathway in the myocardium as a novel therapeutic target in ischaemia/reperfusion injury, Eur. Cytokine Netw. 13 (2002) 401–403. [52] A. Stephanou, Role of STAT-1 and STAT-3 in ischaemia/reperfusion injury, J. Cell. Mol. Med. 8 (2004) 519–525. [53] A. Stephanou, B.K. Brar, T.M. Scarabelli, A.K. Jonassen, D.M. Yellon, M.S. Marber, R.A. Knight, D.S. Latchman, Ischemia-induced STAT-1 expression and activation play a critical role in cardiomyocyte apoptosis, J. Biol. Chem. 275 (2000) 10002–10008. [54] A. Stephanou, D.S. Latchman, Opposing actions of STAT-1 and STAT-3, Growth Factors 23 (2005) 177–182. [55] A. Stephanou, D.S. Latchman, STAT-1: a novel regulator of apoptosis, Int. J. Exp. Pathol. 84 (2003) 239–244. [56] A. Stephanou, T.M. Scarabelli, B.K. Brar, Y. Nakanishi, M. Matsumura, R.A. Knight, D.S. Latchman, Induction of apoptosis and Fas receptor/Fas ligand expression by

741

ischemia/reperfusion in cardiac myocytes requires serine 727 of the STAT-1 transcription factor but not tyrosine 701, J. Biol. Chem. 276 (2001) 28340–28347. [57] Y.J.H.J. Taverne, A.J.J.C. Bogers, D.J. Duncker, D. Merkus, Reactive oxygen species and the cardiovascular system, Oxidative Med. Cell. Longev. 2013 (2013) 15. [58] M. Thielmann, E. Kottenberg, K. Boengler, C. Raffelsieper, M. Neuhaeuser, J. Peters, H. Jakob, G. Heusch, Remote ischemic preconditioning reduces myocardial injury after coronary artery bypass surgery with crystalloid cardioplegic arrest, Basic Res. Cardiol. 105 (2010) 657–664. [59] G. Vassalli, G. Milano, T. Moccetti, Role of mitogen-activated protein kinases in myocardial ischemia-reperfusion injury during heart transplantation, J. Transplant. 2012 (2012) 16. [60] C. Weinbrenner, F. Schulze, L. Sarvary, R.H. Strasser, Remote preconditioning by infrarenal aortic occlusion is operative via delta1-opioid receptors and free radicals in vivo in the rat heart, Cardiovasc. Res. 61 (2004) 591–599. [61] H.D. White, F.J.J. Van de Werf, Thrombolysis for acute myocardial infarction, Circulation 97 (1998) 1632–1646. [62] Y.-T. Xuan, Y. Guo, H. Han, Y. Zhu, R. Bolli, An essential role of the JAK-STAT pathway in ischemic preconditioning, Proc. Natl. Acad. Sci. 98 (2001) 9050–9055. [63] C.-C. Yeh, H. Li, D. Malhotra, S. Turcato, S. Nicholas, R. Tu, B.-Q. Zhu, J. Cha, P.M. Swigart, B.-E. Myagmar, A.J. Baker, P.C. Simpson, M.J. Mann, Distinctive ERK and p38 signaling in remote and infarcted myocardium during post-MI remodeling in the mouse, J. Cell. Biochem. 109 (2010) 1185–1191. [64] F. Yin, P. Li, M. Zheng, L. Chen, Q. Xu, K. Chen, Y.Y. Wang, Y.Y. Zhang, C. Han, Interleukin-6 family of cytokines mediates isoproterenol-induced delayed STAT3 activation in mouse heart, J. Biol. Chem. 278 (2003) 21070–21075. [65] T. Yin, G. Sandhu, C.D. Wolfgang, A. Burrier, R.L. Webb, D.F. Rigel, T. Hai, J. Whelan, Tissue-specific pattern of stress kinase activation in ischemic/reperfused heart and kidney, J. Biol. Chem. 272 (1997) 19943–19950. [66] C. Zhou, Y. Liu, Y. Yao, S. Zhou, N. Fang, W. Wang, L. Li, Beta-blockers and volatile anesthetics may attenuate cardioprotection by remote preconditioning in adult cardiac surgery: a meta-analysis of 15 randomized trials, J. Cardiothorac. Vasc. Anesth. 27 (2013) 305–311. [67] T. Zhou, C.-C. Chuang, L. Zuo, Molecular characterization of reactive oxygen species in myocardial ischemia-reperfusion injury, BioMed Research International. (2015).