Removal of bisphenol A (BPA) in a nitrifying system with immobilized biomass

Bioresource Technology 171 (2014) 305–313

Contents lists available at ScienceDirect

Bioresource Technology journal homepage: www.elsevier.com/locate/biortech

Removal of bisphenol A (BPA) in a nitrifying system with immobilized biomass Magdalena Zielin´ska ⇑, Agnieszka Cydzik-Kwiatkowska, Katarzyna Bernat, Katarzyna Bułkowska, Irena Wojnowska-Baryła University of Warmia and Mazury in Olsztyn, Department of Environmental Biotechnology, Słoneczna Str. 45G, 10-709 Olsztyn, Poland

h i g h l i g h t s  Bisphenol A (BPA) in the influent limited ammonium oxidation.  The efficiency of BPA removal rose with increased BPA concentration in the influent.  BPA was mainly removed by heterotrophic bacteria.  Ammonia-oxidizing bacteria (AOB) made a limited contribution to BPA removal.  BPA affected the quantity and diversity of AOB in the immobilized biomass.

a r t i c l e

i n f o

Article history: Received 11 June 2014 Received in revised form 18 August 2014 Accepted 21 August 2014 Available online 28 August 2014 Keywords: Bisphenol A (BPA) Immobilized biomass Real-time PCR PCR–DGGE

a b s t r a c t The potential for bisphenol A (BPA) removal by mixed consortia of immobilized microorganisms with high nitrification activity was investigated with BPA concentrations in the influent from 2.5 to 10.0 mg/L. The presence of BPA limited ammonium oxidation; nitrification efficiency decreased from 91.2 ± 1.3% in the control series to 47.4 ± 9.4% when BPA concentration in wastewater was the highest. The efficiency of BPA removal rose from 87.1 ± 5.5% to 92.9 ± 2.9% with increased BPA concentration in the influent. Measurement of oxygen uptake rates by biomass exposed to BPA showed that BPA was mainly removed by heterotrophic bacteria. A strong negative correlation between the BPA removal efficiency and nitrification efficiency indicated the limited contribution of ammonia-oxidizing bacteria (AOB) to BPA biodegradation. Exposure of biomass to BPA changed the quantity and diversity of AOB in the biomass as shown by real-time PCR and denaturing gradient gel electrophoresis. Ó 2014 Elsevier Ltd. All rights reserved.

1. Introduction In the last few years, many new trace chemical compounds have been identified in the environment, such as endocrine disrupting compounds (EDCs). EDCs are defined by the US Environmental Protection Agency as exogenous chemicals that affect the structure or function of the endocrine system and cause adverse effects. EDCs include bisphenol A (2,2-bis-4-hydroxyphenylpropane) (BPA), which is mainly used in the production of polycarbonate plastics and epoxy resins. Because of mass production and widespread industrial use, the most common source of BPA in natural water is industrial and municipal wastewater. Although EDCs ⇑ Corresponding author. Tel.: +48 89 523 41 85; fax: +48 89 523 41 31. E-mail addresses: [email protected] (M. Zielin´ska), agnieszka. [email protected] (A. Cydzik-Kwiatkowska), [email protected] (K. Bernat), [email protected] (K. Bułkowska), [email protected] (I. Wojnowska-Baryła). http://dx.doi.org/10.1016/j.biortech.2014.08.087 0960-8524/Ó 2014 Elsevier Ltd. All rights reserved.

contribution to the total amount of dissolved organic carbon in polluted water is low (<1%) (Seyhi et al., 2012), BPA exhibits estrogenic activity even at concentrations below 1 ng/L (Tanaka et al., 2000), thus it is important to reduce its concentration in the environment as much as possible. Because BPA is a relatively hydrophobic compound that is degradable by microorganisms, biodegradation and biosorption can be effective methods for its removal from wastewater. Studies have shown that effective BPA removal is possible in biological wastewater treatment systems. According to Clara et al. (2005), the efficiency of EDCs removal increases at a sludge age (SRT) higher than 10 days, which is suitable for nitrogen removal. Because systems with immobilized biomass are operated at higher sludge ages and are less sensitive to toxic chemicals, they are more advantageous for micropollutant removal than suspended-growth systems. Despite these promising developments, the removal of micropollutants is not currently taken into account when designing municipal wastewater treatment plants.

306

´ ska et al. / Bioresource Technology 171 (2014) 305–313 M. Zielin

The results of studies on whether nitrifiers’ activity is crucial for the biodegradation of BPA are still ambiguous. Tanghe et al. (1998) have indirectly concluded that nitrifying activity is related to EDC degradation. They noted a positive correlation between EDC removal efficiency and temperature increase that stimulates the activity of nitrifiers. Shi et al. (2004) have reported the ability of Nitrosomonas europaea to oxidize organic micropollutants in the presence of ammonium. The activity of AOB may stimulate indirect degradation of many low molecular weight organic compounds through cometabolic processes, in which both growth and nongrowth substrates are oxidized (Miserez et al., 1999). In a study by Roh et al. (2009), N. europaea degraded BPA only in the absence of allylthiourea, a nitrification inhibitor; this suggests the contribution of ammonia monooxygenase in BPA degradation. Kim et al. (2007) have reported that BPA concentration in the effluent decreases simultaneously with oxidation of ammonium into nitrate. When ammonium was replaced by nitrite in the influent, an acclimation period was needed before significant degradation of BPA. According to these authors, this period was necessary for heterotrophs’ adaptation to using BPA as an energy source, although the contribution of heterotrophs was limited. In contrast, it has been reported from studies on municipal wastewater treatment in membrane bioreactors and reactors with conventional activated sludge that micropollutants, including BPA, were biodegraded but not as a result of co-metabolic processes (De Wever et al., 2007). Regardless of whether biodegradation of a given compound is direct or indirect, bioreactor performance is dependent on the diversity of particular microbial groups (Daims et al., 2001). The presence of many species of microorganisms, capable of performing specific processes, ensures that wastewater treatment efficiency is maintained, even during a sudden deterioration of environmental conditions. The most resistant species adapt and ensure that specific metabolic pathways remain active (LaPara et al., 2002). Therefore, the operating conditions of bioreactors should be chosen to promote the development of highly diverse communities of microorganisms. The effect of BPA in wastewater on the species structure and the abundance of AOB in biomass is unclear. At the current stage of research, it is important to broaden knowledge of the mechanisms BPA removal in biological wastewater treatment systems and the role of AOB in this process. This information may be helpful in the implementation and operation of technologies to increase the efficiency of removal of micropollutants from wastewater. The study provides an insight into both system operation and the microbial community structure during BPA removal in a biological system with immobilized biomass. The objective of this study was to investigate the effect of BPA loading on the efficiency and mechanisms of BPA removal. To evaluate which group of bacteria, autotrophic or heterotrophic, was responsible for BPA removal and to verify if the activity of AOB is crucial in degradation of BPA, samples were taken from bioreactors for batch respirometric tests. The effect of BPA on the changes in AOB abundance and diversity was evaluated by molecular methods.

2. Methods 2.1. Experiment set-up The experiment was conducted in a continuous-flow reactor (Fig. 1-SM, Zielin´ska et al., 2012b) with a fixed cylindrical threechannelled ceramic support with a length of 1200 mm, an external diameter of 10 mm and a channel hydraulic diameter of 3.6 mm. The support, made of oxides of aluminum, titanium and zirconia, had a porosity of 35–40%, pore sizes of 3.5–4.0 lm, a total surface

area of 0.04 m2 and a specific surface area of 425 m2/m3. The ceramic support occupied 94 mL of the bioreactor (12.7% of total reactor volume), including its total volume of internal channels and pores, whereas 645 mL of the bioreactor was available for the liquid phase. For reactor inoculation, thickened activated sludge from a municipal wastewater treatment plant with effective nitrogen and phosphorus removal was used. The volatile fraction of the activated sludge was 74 ± 4% of total suspended solids. Activated sludge was immobilized by 24 h of circulation in the reactor, which caused the support loading with biomass to reach 30.6 kg TSS/m3. The reactor was operated with recirculation of 60 L/h, which allowed total mixing of wastewater. The reactor was shielded to prevent photodegradation of pollutants. The temperature and pH of the bulk liquid were 18–22 °C and 7–8, respectively. The reactor was continuously fed at a flow rate of 1.6 L/d which corresponded to a hydraulic retention time of 1.5 h and volumetric loading rates of 7.0 kg COD/(m3 d) and 1.0 kg NH+4-N/(m3 d). Dissolved oxygen in the bulk liquid was maintained in the range of 2.5–4.5 mg/L with air supply at a rate of 12 L/h. The experiment was carried out for about 420 days. The adaptation of the biomass to the increasing BPA concentrations lasted about 70 days in each series, until the values of the analyzed indicators of pollutants in the effluent did not change by more than 20% over the course of seven days. 2.2. Wastewater The composition of synthetic wastewater that imitated municipal wastewater was: NH4Cl – 76.1 mg/L, Na2HPO412H2O – 46.2 mg/L, NaCl – 10.1 mg/L, KCl – 4.7 mg/L, CaCl22H2O – 4.7 mg/L, MgSO47H2O – 16.7 mg/L, NaHCO3 – 243.3 mg/L, Na2CO3 – 162.2 mg/L, (FeCl36H2O, ZnSO4, MnSO4H2O, CuSO4) < 0.2 mg/L, CH4N2O – 80 mg/L, CH3COONa – 0.6 g/L. Sodium acetate was the source of organic compounds; ammonium chloride, the source of nitrogen; and sodium hydrogen phosphate, of phosphorus. The values of basic pollutant indicators in the influent were 435.0 ± 35.9 mg COD/L, 60.4 ± 5.0 mg NH+4-N/L, and 12.0 ± 2.5 mg P/L. In the control reactor (R0), synthetic wastewater did not contain BPA. BPA (P99% purity, Sigma–Aldrich) was dissolved in DMSO to prepare a stock solution, which was introduced into the synthetic wastewater to obtain BPA concentrations in the influent of 2.5 mg/L (R2.5), 5.0 mg/L (R5.0) and 10.0 mg/L (R10.0), which gave BPA loadings from 42 to 170 g/(m3 d). 2.3. Batch tests During stable operation of the control reactor, sludge was withdrawn for inoculation of batch experiments. The mixture of the suspended solids from the effluent and the biomass scraped from the support was used. The measurements of oxygen uptake by biomass were conducted in an OxiTop Control OC 110 closed respirometric unit (WTW) (Zielin´ska et al., 2012a). A suspension of biomass with a concentration of 2205 ± 162 mg TSS/L was introduced into the respirometric flasks. Next, synthetic wastewater was introduced into flasks; the wastewater contained the necessary concentration of pollutants to ensure that the loading in the flasks was identical to that in the reactor during the experimental series. The flasks were mixed during incubation at 20 °C. Respirometric activity was expressed as oxygen uptake rate (OUR) by biomass in the samples without BPA and the samples exposed to the experimental BPA doses (2.5, 5.0 and 10.0 mg BPA/L). Incubation of biomass and synthetic wastewater containing BPA in concentrations from 0 to 10 mg/L allowed the determination of total oxygen uptake rate (OURc). This is the sum of the rate of oxygen uptake for organic compounds oxidation (OUR1), the rate of oxygen uptake for

´ ska et al. / Bioresource Technology 171 (2014) 305–313 M. Zielin

nitrification (OUR2) and the endogenous respiration rate (OUR3). To calculate OUR1, it was necessary to add an ammonia monooxygenase inhibitor – allylthiourea (ATU) – at a concentration of 10 mg/L. The endogenous respiration rate (OUR3) was determined by conducting respirometric tests of biomass washed 3 times with tap water. The washed biomass was mixed with deionized water and then incubated. Incubation of all biomass samples lasted 20 days, after which the supernatant was sampled. The average of the results obtained in triplicate was used for further analysis. Non-linear regression was used to obtain the values of the oxygen uptake rates (OUR1, OUR2 and OUR3) from the plot of dissolved oxygen concentration versus time; OUR are given in terms of milligrams O2 used per litre per day for each experimental condition. Statistica 9.0 software (StatSoft) was used. The oxygen uptake rates were described by 1-order kinetics and defined by the Eq. (1):

OUR ¼ k  L0 ðmg O2 =ðL  dÞÞ

ð1Þ

and the solution for this could be fitted to the experimental data according to the Eq. (2):

L ¼ L0  ð1  ekt Þ ðmg O2 =LÞ

ð2Þ

Specific oxygen uptake rates (SOUR) were calculated according to the Eq. (3):

SOUR ¼ OUR=VSS ðmg O2 =ðg VSS  dÞÞ

ð3Þ

k – constant of reaction rate (d1) L0 – maximal concentration of oxygen used (mg O2/L) L – concentration of oxygen used after time t (mg O2/L) VSS – volatile suspended solids (g VSS/L). 2.4. Analytical methods During the series of experiments in the reactor and batch tests, analyses of physico-chemical descriptors of wastewater were determined, including pH, alkalinity, COD, BOD5, ammonium, nitrite, nitrate, TSS, and VSS (APHA, 1992). BPA concentrations in synthetic wastewater, in the effluent from the reactor, in the supernatant after batch tests and in biomass samples after incubation were determined using an HPLC (Varian) equipped with a UV–Vis detector. A Supelcosil LC-PAH (Supelco) column was eluted with an acetonitrile:water (70:30, v/v) solution. Chromatography analysis was preceded by solid phase extraction (SPE) of liquid samples and of supernatant obtained by shaking the biomass in the methanol solution. For

307

SPE, Supelclean ENVI-18 SPE/3 mL/500 mg columns (Supelco) were used.

2.5. Molecular analyses To estimate how the exposure of biomass to BPA influenced the diversity and the abundance of AOB, molecular analysis of the immobilized biomass was carried out in each experimental series. Sludge samples were scraped from the surface of the support at the end of each experimental series and stored at 20 °C until their analysis. DNA was extracted from approximately 100 mg of centrifuged sample using a FastDNAÒ SPINÒKit (Q-BIOgene) and measured spectrophotometrically using a BioPhotometer (Eppendorf).

2.5.1. PCR–DGGE The details of amplification and DGGE of the amoA gene are given in Cydzik-Kwiatkowska and Wojnowska-Baryła (2011). The primer sequences are given in Table 1. Amplicons that were clear and intense were excised from the DGGE gel, reamplified and sequenced at the Institute of Biochemistry and Biophysics of the Polish Academy of Science (http:// www.oligo.ibb.waw.pl). The nucleotide sequences were compared with the sequences in GenBank using the BLASTn program. To determine the genetic relationships, the sequences obtained in this study were aligned by the Maximum Likelihood method with the use of MEGA5 software (Tamura et al., 2011). The identified sequences were deposited in GenBank under accession no. KJ883586–KJ883590.

2.5.2. Real-time PCR AOB abundance in the biomass was assessed by Real-time PCR. Amplification of amoA and 16S rDNA genes was performed as described in Cydzik-Kwiatkowska and Wojnowska-Baryła (2011). Annealing temperatures and primer sequences are given in Table 2. Each sample was amplified in triplicate in the presence of negative and positive controls. The amplifications were followed by a denaturation step to confirm the melting temperature of the PCR products; these products were also electrophoresed in the presence of a molecular marker. Reactions were carried out in a 7500 Real-Time PCR System (Applied Biosystems, USA). Data were analyzed with Sequence Detection Software, version 1.3 (Applied Biosystems). Reactions were normalized by adding the same amount of DNA for each reaction tube.

Table 1 Primers used in DGGE. Primer

Sequence 50 –30

Product size (bp)

References

301F 302R amoA1F amoA2R amoA1F -clamp

50 actgggacttctggctggactggaa30 50 tttgatcccctctggaaagccttcttc30 50 ggggtttctactggtggt30 50 cccctctgcaaagccttcttc30 50 cgccgcgcggcgggcggggcgggggcggggtttctactggtggt30

674 674 491 491 491

Norton et al. (2002) Norton et al. (2002) Rotthauwe et al. (1997) Rotthauwe et al. (1997) Nicolaisen and Ramsing (2002)

Table 2 Primers used in real-time PCR. Primer

Sequence (50 –30 )

Annealing temperature (°C)

Product size (bp)

References

amoA1F amoA2R 519f 907r

ggggtttctactggtggt cccctc(gt)g(cg)aaagccttcttc cagcmgccgcggtaanwc ccgtcaattcmtttragtt

60

amoA/490

Rotthauwe et al. (1997)

50

16S rDNA/407

Lane (1991)

308

´ ska et al. / Bioresource Technology 171 (2014) 305–313 M. Zielin

2.6. Statistical analyses The normality of the distribution was confirmed by Shapiro–Wilk’s test. The differences between the mean values derived from particular groups were examined by RIR Tukey’s test. The relationships between groups of the results were determined using Pearson’s correlation coefficient (R). All statistical analyses were performed at a level of significance of p = 0.05. Statistica 9.0 PL (StatSoft) was used.

3. Results and discussion 3.1. The effect of BPA concentration in the influent on the efficiency of BPA removal Before beginning the study, a control test was conducted for wastewater treatment in the reactor with a clean support without immobilized biomass. This test indicated that neither photolysis, nor stripping nor adsorption of BPA on the support had a significant effect. BPA elimination from wastewater was solely the result of biomass activity. After wastewater was treated in a nitrifying system with immobilized biomass, the average BPA concentrations in the effluents were 0.32 ± 0.14 mg/L in R2.5, 0.48 ± 0.19 mg/L in R5.0 and 0.71 ± 0.29 mg/L in R10.0 (Fig. 1). BPA concentration was significantly higher in the effluent in R10.0 than in R2.5 (RIR Tukey’s test, t = 0.002, p < 0.0016). The total removal efficiency of BPA (EBPA) was 87.1 ± 5.5% in R2.5, 90.4 ± 3.9% in R5.0 and 92.9 ± 2.9% in R10.0. EBPA was significantly higher in R10.0 than in R2.5 (RIR Tukey’s test, t = 0.012, p < 0.05). The strong linear relationship (R = 0.96) between BPA removal efficiency and BPA loading showed that an increase in the concentration of BPA in wastewater stimulated the efficiency of its removal. A higher concentration of BPA or its

metabolites increases the degradation rate and shortens the halflife of BPA (De Wever et al., 2007). With polar compounds, such as BPA, initiation of biodegradation does not necessarily result from a change in operating conditions, such as pollution concentration or loading, or biomass concentration, but from the enzymatic adaptation of the microorganisms to the amount of substrate in wastewater (LaPara et al., 2006). These differences in enzyme activity result from the physiological adaptation of bacteria or the selection of a new bacteria population with the relevant metabolic pathways. In the present study, the operational conditions favoured the biodegradation of BPA, and its effective removal was achieved with a very short hydraulic retention time (HRT) of 1.5 h. This short HRT was compensated for by the long sludge age and high biomass concentration that are characteristic of systems with immobilized biomass. In reactors with high biomass concentration, the available amount of substrate per biomass unit is low, which stimulates the removal of organic compounds that are not readily biodegradable. At higher loadings, it is predominantly that more easily degradable substrates are metabolized. At lower loadings, the lack of easily degradable substrates forces the degradation of resistant substrates. For this reason, Urase and Kikuta (2005) have postulated that when operating an activated sludge system for removal of micropollutants from wastewater, preliminary elimination of easily degradable organic pollutants should be conducted. In systems with immobilized biomass, the contribution of suspended biomass in removing organic micropollutants is important, despite its small share of the total amount of biomass in the reactor (Yu et al., 2001). In the present study, the amount of suspended biomass in the reactor was equal to the amount of suspended solids in the effluent, which varied from 55 ± 10 to 112 ± 22 mg TSS/L and was not dependent on the BPA concentration in the influent. This suggests that immobilized biomass should be considered to be mainly responsible for eliminating BPA from wastewater.

Fig. 1. Concentrations of BPA and COD in the influent and effluent in the experimental series.

´ ska et al. / Bioresource Technology 171 (2014) 305–313 M. Zielin

Some BPA might have been degraded into CO2, and some might have been incompletely degraded into by-products. The high removal efficiency of BPA in the current research could be explained by the fact that the by-products could have been substrates for the growth of other bacteria, which would have created an extensive network of trophic relationships that favors biodegradation (cross-acclimation) (Yuan et al., 2002). 3.2. The effect of BPA concentration in the influent on nitrification, denitrification and C removal efficiency Based on previous studies (Clara et al., 2005), the operational conditions for this study were selected to provide high activity of nitrification, which has been shown to be beneficial for BPA removal. Immobilized biomass with high activity of both nitrification phases was selected. This activity was concluded on the basis of the composition of the effluent. In the control reactor (R0), the loading was 7 kg COD/(m3 d) (17.4 g COD/(m2 d)). Only when BPA was introduced at a concentration of 10 mg BPA/L, did the reactor loading significantly increased to 7.8 kg COD/(m3 d) in comparison to other experimental series (RIR Tukey’s test, t = 0.0003, p < 0.05). The concentration of nitrogen used for biomass synthesis was 5.0 ± 0.7 mg/L, as determined by nitrogen balance. The introduction into the reactor of increasing concentrations of BPA (2.5, 5.0 and 10.0 mg/L) resulted in a decrease in the nitrification activity of the biomass (Fig. 2). In R0, complete nitrification was observed. The average concentration of ammonia in the effluent increased with increasing BPA loadings, from 14.8 ± 6.1 mg/L in R2.5 to 22.9 ± 4.5 mg/L in R10.0. The second phase of nitrification was inhibited, and as a consequence, nitrites accumulated in the effluent in concentrations ranging from 20.0 ± 5.2 mg/L in R5.0 to 25.9 ± 6.6 mg/L in R2.5; nitrite concentrations in the effluent did not correlate with BPA loadings. Inhibi-

309

tion of nitrite oxidation also resulted in low concentrations of nitrate in the effluent that ranged from 2.2 ± 0.3 mg/L in R5.0 to 12.1 ± 2.3 mg/L in R2.5 (Fig. 2). Taking into account the use of nitrogen for biomass synthesis, the ammonium oxidation rate was calculated as the amount of ammonium oxidized per the support volume in the column reactor per day. In the control reactor (R0), the ammonium oxidation rate was 0.8 ± 0.05 kg/(m3 d). As the concentration of BPA in the influent increased, the rate lowered to 0.40 ± 0.04 kg/(m3 d) in R10.0. The changes in the ammonium oxidation rates negatively correlated with the BPA loading (R = 0.94) and with the organic compound concentration (COD) in the influent (R = 0.81). In the control reactor (R0), the average nitrification efficiency was 91.2 ± 1.3%. Introduction into the reactor of wastewater with increasing concentrations of BPA significantly decreased the efficiency of nitrification (RIR Tukey’s test, t = 0.0003–0.000008, p < 0.05). Nitrification efficiency dropped to 47.4 ± 9.4% in R10.0. Nitrification efficiency decreased with increasing COD concentrations in the influent (R = 0.77), probably due to the fact that in the presence of a large amount of organic substrate, nitrifying bacteria could have been outcompeted for oxygen (Xiangli et al., 2008). However, in our preliminary studies (data not shown) it was found that when easily degradable organics were added in an amount close to that in R10.0, nitrification efficiency was approximately 85%. This indicates that the decrease in the efficiency of nitrification was induced by the BPA loading in the influent and not by COD loading. Alternative substrates for ammonium monooxygenase may inhibit the oxidation of ammonia nitrogen as they compete with ammonia nitrogen for binding to monooxygenase. This suggests that the role of AOB in the removal of BPA may be limited, especially since many known strains of bacteria are capable of degrading BPA (Roh et al., 2009). In a study by Ren et al. (2007), the prevalence of co-metabolism of AOB in the biodegradation of EDCs in nitrifying activated sludge

Fig. 2. Effect of BPA concentration (0, 2.5, 5.0 and 10.0 mg/L) on the amount of ammonia, nitrites and nitrates in the effluent.

310

´ ska et al. / Bioresource Technology 171 (2014) 305–313 M. Zielin

was noted. The authors observed that with the increase in the COD loading, the rate of transformation of organic matter increased but the efficiency of ammonia oxidation and EDC degradation decreased. The high organics loading decreased the activity of AOB. Organics loading can therefore be a key factor in the removal of EDCs as a result of co-metabolism of nitrifying bacteria in activated sludge. In the present study, however, a different relationship was noted. At an organics loading of 7.0–7.8 kg/(m3 d), as BPA concentration increased from 0 to 10 mg/L, BPA removal efficiency increased from 87.1 to 92.9%, and nitrification efficiency significantly decreased from 91.2 to 47.4%. A strong linear relationship (R = 0.99) between the efficiency of BPA removal and nitrification efficiency indicated that under the investigated conditions co-metabolism could not have been responsible for the removal of BPA. Prolonged exposure to BPA or the release of its by-products could have caused damage to AOB cells or inactivation of ammonium oxidation. In a study by Alpaslan Kocamemi and Çeçen (2007), 1,2-dichloroethane inhibited the conversion of ammonium to hydroxylamine by binding to ammonia monooxygenase enzyme, whereas it had no inhibitory effect on the conversion of nitrite to nitrate. The inhibitory effect was reversible. In biofilm reactors with continuous aeration, anoxic microzones can form that support the reduction of oxidized forms of nitrogen (Puznava et al., 2001). In the current study, denitrification occurred in the immobilized biomass. Denitrification efficiency significantly increased with increasing BPA loading (RIR Tukey’s test, t = 0.000008, p < 0.05). The increase in COD and BPA loadings correlated with an increase in denitrification efficiency from 5.2 ± 3.7% in R0 to 44.3 ± 13.1% in R10.0 (respectively R = 0.89 and R = 0.99). The total efficiency of nitrogen removal through denitrification and biomass synthesis significantly increased from 13.6 ± 3.7% in R0 to 28.6 ± 4.4% in R10.0 (RIR Tukey’s test, t = 0.00001–0.000008, p < 0.05). Changes in the COD removal efficiency were also used to study how BPA concentrations affected the activity of microbial populations (Fig. 1). In R0, COD removal efficiency was 82.5 ± 5.4%. In R2.5, it significantly decreased to 65.7 ± 6.4% (RIR Tukey’s test, p = 0.0001, p < 0.05), although the presence of 2.5 mg/L of BPA in the influent did not cause a significant increase in the COD loading. Therefore BPA likely limited heterotrophic growth, as shown by significantly higher levels of COD in the effluent in R2.5, R5.0 and R10.0 (to 185 ± 28 mg/L) compared to R0 (RIR Tukey’s test, t = 0.000008, p < 0.05). BPA loading negatively correlated with COD removal efficiency by immobilized biomass (R = 0.79). A decrease in the content of volatile suspended solids in total suspended solids from 74.4% in R0 to 66.0% in R2.5 confirmed that BPA limited bacterial growth. In the literature, BPA has been reported to be toxic to immobilized biomass at concentrations above 5 mg/L, which is 10 times higher than concentrations that are toxic to activated sludge (Seyhi et al., 2012). In systems with immobilized biomass, the high concentration and long age of biomass support the growth and activity of microbial consortia that break down compounds that are difficult to degrade. In addition, the limited diffusion in biofilm layers and the pores of the support reduces the effect of toxic substances on the growth of microorganisms.

tion in the wastewater, the average oxygen uptake rate for endogenous respiration was 25.6 ± 4.2 mg O2/(g VSS d). To estimate SOUR1 and to verify if BPA removal was a result of AOB activity or heterotrophic activity, ATU inhibitor (ATU+) was used. After ATU was administered, ammonia was not removed (data not shown) although BPA was removed. This indicated that ATU effectively blocked ammonium oxidation and implies that BPA removal was connected with heterotrophic bacteria activity or with BPA adsorption on biomass particles. In R0, SOUR1 was 75.9 ± 9.0 mg O2/(g VSS d). After exposure to BPA, SOUR1 significantly increased to 105.3 ± 12.1 mg O2/(g VSS d) (R = 0.73) (Fig. 3). Therefore, the major BPA removal mechanism was degradation by heterotrophic bacteria. In the absence of inhibition of nitrification (ATU), increasing the BPA concentration in the influent did not alter the specific oxygen uptake rate for nitrification (SOUR2) (Fig. 3). The degradation capacity of BPA in ATU+ was comparable to ATU. There was no relationship either between the nitrification efficiency and BPA removal efficiency or between the BPA removal efficiency and SOUR2. These findings indicate that the activity of AOB could not have played a significant role in BPA degradation. Low organic loading reduces the availability of the substrate to a great extent, which promotes direct biodegradation rather than co-metabolic transformations (De Wever et al., 2007). With hydrophobic compounds like BPA, sorption on suspended solids or biofilm may affect the removal of micropollutants from wastewater (Stringfellow and Alvarez-Cohen, 1999). So far, there have been conflicting reports on the relative contributions of sorption and biodegradation to BPA removal in biological systems. In the present study, the results indicated that BPA was biodegraded after sorption. Regardless of the experimental conditions, i.e. inhibition or no inhibition of nitrification (ATU+ or ATU), 58–71% of BPA introduced into the bioreactor was sorbed on biomass. Increasing the initial BPA concentration from 2.5 to 10.0 mg/L resulted in an increase in the share of BPA in biomass (R = 0.88). However, there was no relationship between the amount of BPA sorbed on immobilized biomass and the efficiency of BPA removal from the liquid phase. This indicates that under these operating conditions, sorbed BPA was biodegraded. In addition, an increase in BPA concentration in the influent increased BPA removal efficiency. If sorption had been the main mechanism of BPA removal, the efficiency of BPA removal would have decreased as initial BPA concentration increased because of depletion of the sorption capacity of the solid phase. Also, with an initial BPA concentration of 10 mg/L, a by-product of BPA degradation was detected in the effluent, although this substance was not identified. These results are similar to those of Chen et al. (2008), who reported that in an

3.3. The effect of BPA concentration in the influent on the activity of microorganisms in immobilized biomass Oxygen uptake rates were measured to determine the activity of autotrophic and heterotrophic bacteria, and allow conclusions about the mechanisms of micropollutant removal from wastewater. Respiratory activity was measured at each concentration of BPA and in the control reactor. Independent of the BPA concentra-

Fig. 3. Specific total oxygen uptake rate (SOURtot), oxygen uptake rate for organic oxidation (SOUR1) and for ammonia oxidation (SOUR2) for biomass exposed to elevated BPA concentrations (R0–R10.0).

´ ska et al. / Bioresource Technology 171 (2014) 305–313 M. Zielin

activated sludge reactor and a membrane bioreactor, the participation of sorption in BPA removal was low; from 0.004 to 1.35% of BPA introduced was sorbed. They identified 4-hydroxyacetophenone as the primary by-product of BPA oxidation in the liquid

311

phase, which indicated the dominance of biodegradation in BPA removal. Biodegradation is favoured by the long age of biomass and the resulting long time of micropollutant retention in bioreactors with supports (Zhao et al., 2008). The above findings are in contrast to those of Boonyaroj et al. (2012), who reported that both biodegradation and sorption are important in the removal of BPA from wastewater. BPA has an octanol–water coefficient (log Kow) of 3.32, indicating that it has a moderate affinity for the solid phase, so under some operational conditions, sorption may play a more important role than in our study. 3.4. The effect of BPA concentration in the influent on AOB community structure in the immobilized biomass The number and percent abundance of AOB in the microbial consortia of the immobilized biomass were measured after adaptation to different concentrations of BPA in the influent. In the control reactor, the AOB number stabilized at 20,000 cells per 10 ng of DNA; AOB comprised a large fraction of the bacteria (ca. 20.8%). After BPA was introduced to the reactor at a concentration of 2.5 mg/L, the number of AOB sharply increased to 300,000 cells per 10 ng of DNA, comprising 44% of the bacteria. At higher concentrations of BPA, the number of AOB decreased but remained higher than in the control. In R5.0 and R10.0 the quantities of AOB were similar (29,000 and 48,000 cells per 10 ng of DNA, respectively), totalling 7% of the bacteria. The quantity of bacteria at these BPA loadings may have remained relatively stable because they adapted to the higher concentrations of BPA. This stability implies that the existing AOB community was quite resistant to inactivation caused by BPA. This can be related to features of immobilized biomass: lower sensitivity to toxic compounds because of limitation of substrate diffusion through the biofilm layer. The presence of BPA in the influent caused changes in the structure of the AOB communities (Fig. 4). Based on the image of electrophoretic separation of PCR products in denaturing gradient, a similarity tree of DGGE patterns obtained from each sample of immobilized biomass was constructed (Fig. 5). Analysis of a dendrogram indicated that the introduction of increasing amounts of BPA into wastewater resulted in changes in AOB consortia. Hillis and Bull (1993) state that bootstrap values greater than 70% correspond to a greater than 95% probability of real relationships. DGGE patterns obtained from biomass exposed to BPA grouped together with a very high probability of 90% in a separate clade; within this clade, the samples from R5.0 and R10.0 accounted for a separate branch. Sequencing of selected bands (indicated in Fig. 4) and phylogenetic analysis showed that AOB present in the immobilized biomass grouped in a phylogenetic tree with the sequences of microorganisms belonging to the genus Nitrosospira (Fig. 6). The microorganisms of the genus Nitrosospira prefer low concentrations of ammonia nitrogen in wastewater (Schramm et al., 1999), which explains their presence in the immobilized biomass in the

R0 R2.5 90

R10.0 63 R5.0

0.02

Fig. 4. DGGE analysis of PCR amplifications of partial amoA gene. The abbreviations above each lane represent the experimental series from which the biomass samples were taken. Bands that were sequenced are indicated. Colors in the picture were inverted.

Fig. 5. Dendrogram based on the DGGE profiles of the partial amoA gene obtained for each experimental series. The tree was constructed using the UPGMA method. For statistical support of the tree topology, 1000 bootstrap replicates were simultaneously estimated. The abbreviations next to each branch represent the experimental series from which the biomass samples were taken.

´ ska et al. / Bioresource Technology 171 (2014) 305–313 M. Zielin

312

1amo (KJ883586) 2amo (KJ883587) 3amo (KJ883588) 4amo (KJ883589) Nitrosospira sp. REGAU (AY635572) Uncultured bacterium clone S-F-17 (FN564923.1) Nitrosospira sp. NpAV (U92431.1) 5amo (KJ883590) Nitrosospira briensis (U76553.1) Nitrosospira sp. Np39-19 (AF016002.1) Nitrosospira sp. 9SS1 (DQ228455.1) Nitrosomonas sp. Nm104 (AF272409.1) Nitrosomonas sp. clone AOB-R4-2 (HQ230334.1) Nitrosomonas eutropha Nm57 (AJ298713) Nitrosomonas europaea (AF058692.1) Nitrosomonas sp. ENI11 (AB079055.1) 0.05

Fig. 6. Phylogenetic tree showing the similarity between the partial amoA gene sequences obtained in the study and reference sequences from Gene Bank (accession numbers in brackets).

tested operational conditions. Bands amo1, amo2 and amo4 with the sequence most similar to the Nitrosospira REGAU sequence (AY635572) were detected only in biomass from the reactors with BPA in the influent; of these bands, amo2 was present only in the DGGE pattern from R5.0 and R10.0. The analysis showed that Nitrosospira briensis (band amo5) occurred in biomass independently of BPA loading that proved its high tolerance to BPA concentrations used in this experiment. There was time for adaptation because BPA loading was gradually increased from 2.5 to 10.0 mg/L at the same level of ammonia loading. DGGE patterns were used to calculate values of the Shannon– Wiener index (H0 ) to describe how the diversity of the ammoniaoxidizing bacteria in the immobilized biomass depended on the concentration of BPA in the influent. The highest AOB diversity (H’ = 1.75) was observed in the biomass in the control reactor, without BPA in the influent. When BPA concentration was increased in the influent to R2.5, AOB diversity decreased to 1.55. However, in the next series, AOB diversity increased, and in R10.0 H0 reached a value close to that in the control reactor. Despite the similarity in H0 values between the control reactor and R10.0, AOB consortia in R10.0 were characterized by lower abundance or activity, as indicated by a decrease in the efficiency of nitrification from 91.2% in R0 to 47.4% in R10.0. There is disagreement about the effect of hard-to-degrade micropollutants on the species structure of the biomass. According to Xia et al. (2008), increasing the loading of organic compounds limits the diversity of AOB, because high concentrations of organic compounds in the wastewater favor fastgrowing bacteria that outcompete slower-growing species. Our results point out that at increasing BPA concentrations in wastewater did not lower the diversity of AOB community because some bacterial species successfully adapted to higher BPA loadings.

4. Conclusions A nitrifying system with immobilized biomass showed great potential for BPA removal from wastewater. BPA removal was associated with the activity of heterotrophic bacteria. The high efficiency of BPA removal indicates that heterotrophic communities in the biofilm were resistant to exposure to BPA.

Molecular studies indicated that exposing biomass to BPA affected the species composition and abundance of AOB in the biomass. The operational results and the results of molecular studies of immobilized biomass indicated that nitrification efficiency was not related to micropollutant removal, which suggests that the participation of nitrifying bacteria in BPA removal was limited. Acknowledgement This work has been financed by the Polish National Science Center (project No. NN 523 611939). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.biortech.2014. 08.087. References Alpaslan Kocamemi, B., Çeçen, F., 2007. Inhibitory effect of the xenobiotic 1,2-DCA in a nitrifying biofilm reactor. Water Sci. Technol. 55, 67–73. APHA Standard Methods for the Examination of Water and Wastewater, 1992, 18th ed. APHA, AWWA and WEF, Washington. Boonyaroj, V., Chiemchaisri, C., Chiemchaisri, W., Theepharaksapan, S., Yamamoto, K., 2012. Toxic organic micro-pollutants removal mechanisms in long-term operated membrane bioreactor treating municipal solid waste leachate. Bioresour. Technol. 113, 174–180. Chen, J., Huang, X., Lee, D., 2008. Bisphenol A removal by a membrane bioreactor. Process Biochem. 43, 451–456. Clara, M., Kreuzinger, N., Strenn, B., Gans, O., Kroiss, H., 2005. The solids retention time – a suitable design parameter to evaluate the capacity of wastewater treatment plants to remove micropollutants. Water Res. 39, 97–106. Cydzik-Kwiatkowska, A., Wojnowska-Baryła, I., 2011. Nitrifying granules cultivation in a sequencing batch reactor at a low organics-to-total nitrogen ratio in wastewater. Folia Microbiol. 56 (3), 201–208. Daims, H., Purkhold, U., Bjerrum, L., Arnold, E., Wilderer, P.A., Wagner, M., 2001. Nitrification in sequencing biofilm batch reactors: lessons from molecular approaches. Water Sci. Technol. 43, 9–18. De Wever, H., Weiss, S., Reemtsma, T., Vereecken, J., Müller, J., Knepper, T., Rörden, O., Gonzalez, S., Barcelo, D., Hernando, M.D., 2007. Comparison of sulfonated and other micropollutants removal in membrane bioreactor and conventional wastewater treatment. Water Res. 41, 935–945. Hillis, D.M., Bull, J.J., 1993. An empirical test of bootstrapping as a method for assessing confidence in phylogenetic analysis. Syst. Biol. 42, 182–192.

´ ska et al. / Bioresource Technology 171 (2014) 305–313 M. Zielin Kim, J.Y., Ryu, K., Kim, E.J., Choe, W.S., Cha, G.C., Yoo, I.K., 2007. Degradation of bisphenol A and nonylphenol by nitrifying activated sludge. Process Biochem. 42, 1470–1474. Lane, D.J., 1991. 16S/23S rRNA sequencing. In: Stackebrandt, E., Goodfellow, M. (Eds.), Nucleic Acid Techniques in Bacterial Systematics. Wiley, Oxford, pp. 205– 248. LaPara, T.M., Nakatsu, C.H., Pantea, L.M., Alleman, J.E., 2002. Stability of the bacterial communities supported by a seven-stage biological process treating pharmaceutical wastewater as revealed by PCR-DGGE. Water Res. 36, 638–646. LaPara, T.M., Klatt, C.G., Chen, R., 2006. Adaptations in bacterial catabolic enzyme activity and community structure in membrane-coupled bioreactors fed simple synthetic wastewater. J. Biotechnol. 121, 368–380. Miserez, K., Philips, S., Verstraete, W., 1999. New biology for advanced wastewater treatment. Water Sci. Technol. 40, 137–144. Nicolaisen, M.H., Ramsing, N.B., 2002. Denaturing gradient gel electrophoresis (DGGE) approaches to study the diversity of ammonia-oxidizing bacteria. J. Microbiol. Methods 50, 189–203. Norton, J.M., Alzerreca, J.J., Suwa, J., Klotz, M.G., 2002. Diversity of ammonia monooxygenase operon in autotrophic ammonia-oxidizing bacteria. Arch. Microbiol. 177, 139–149. Puznava, N., Payraudeau, M., Thornberg, D., 2001. Simultaneous nitrification and denitrification in biofilters with real time aeration control. Water Sci. Technol. 43, 269–276. Ren, Y.X., Nakano, K., Nomura, M., Chiba, N., Nishimura, O., 2007. Effects of bacterial activity on estrogen removal in nitrifying activated sludge. Water Res. 41, 3089–3096. Roh, H., Subramanya, N., Zhao, F., Yu, C.P., Sandt, J., Chu, K.H., 2009. Biodegradation potential of wastewater micropollutants by ammonia-oxidizing bacteria. Chemosphere 77, 1084–1089. Rotthauwe, J.H., Witzel, K.P., Liesack, W., 1997. The ammonia monooxygenase structural gene amoA as a functional marker: molecular fine-scale analysis of natural ammonia-oxidizing populations. Appl. Environ. Microbiol. 63, 4704– 4712. Schramm, A., de Beer, D., Heuvel, J.C., Ottengraf, S., Amman, R., 1999. Microscale distribution of populations and activities of Nitrosospira and Nitrospira spp. along a macroscale gradient in a nitrifying bioreactor: quantification by in situ hybridization and the use of microelectrode. Appl. Environ. Microbiol. 65, 3690–3696. Seyhi, B., Drogui, P., Buelna, G., Blais, J.F., 2012. Removal of bisphenol-A from spiked synthetic effluents using an immersed membrane activated sludge process. Sep. Purif. Technol. 87, 101–109.

313

Shi, J., Fujisawa, S., Nakai, S., Hosomi, M., 2004. Biodegradation of natural and synthetic estrogens by nitrifying activated sludge and ammonia-oxidizing bacterium Nitrosomonas europaea. Water Res. 38, 2323–2330. Stringfellow, W.T., Alvarez-Cohen, L., 1999. Evaluating the relationship between the sorption of PAHs to bacterial biomass and biodegradation. Water Res. 33, 2535– 2544. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28 (10), 2731–2739. Tanaka, T., Yamada, K., Tonosaki, T., Konishi, T., Goto, H., Taniguchi, M., 2000. Enzymatic degradation of alkylphenols, bisphenol A, synthetic estrogen and phthalic ester. Water Sci. Technol. 42, 89–95. Tanghe, T., Devriese, G., Verstraete, W., 1998. Nonylphenol degradation in lab scale activated sludge units is temperature dependent. Water Res. 32, 2889– 2896. Urase, T., Kikuta, T., 2005. Separate estimation of adsorption and degradation of pharmaceutical substances and estrogens in the activated sludge process. Water Res. 39, 1289–1300. Xia, S., Li, J., Wang, R., 2008. Nitrogen removal performance and microbial community structure dynamics response to carbon–nitrogen ratio in a compact suspended carrier biofilm reactor. Ecol. Eng. 32, 256–262. Xiangli, Q., Zhenjia, Z., Quingxuan, C., Yajie, C., 2008. Nitrification characteristics of PEG immobilized activated sludge at high ammonia and COD loading rates. Desalination 222, 340–347. Yu, H., Kim, B.J., Rittmann, B.E., 2001. Contributions of biofilm versus suspended bacteria in an aerobic circulating-bed biofilm reactor. Water Sci. Technol. 43, 303–310. Yuan, S.Y., Shiung, L.C., Chang, B.V., 2002. Biodegradation of polycyclic aromatic hydrocarbons by inoculated microorganisms in soil. Bull. Environ. Contam. Toxicol. 69, 66–73. Zhao, J., Li, Y., Zhang, C., Zeng, Q., Zhou, Q., 2008. Sorption and degradation of bisphenol A by aerobic activated sludge. J. Hazard. Mater. 155, 305–311. Zielin´ska, M., Bernat, K., Kulikowska, D., Cydzik-Kwiatkowska, A., WojnowskaBaryła, I., 2012a. Activated sludge activity in the treatment of anaerobic sludge digester supernatant. Environ. Prot. Eng. 38 (4), 17–27. _ P., Zielin´ska, M., Sobolewska, J., Bułkowska, K., Wojnowska-Baryła, I., Szela˛zek, 2012b. Removal of phenanthrene and 4-phenylphenanthrene from wastewater in an integrated technological system. Desalin. Water Treat. 50 (1–3), 78–86.