Repair and misrepair of site-specific DNA double-strand breaks by human cell extracts

Mutation Research, 299 (1993) 251-259

251

© 1993 Elsevier Science Publishers B.V. All rights reserved 0165-1218/93/$06.00

MUTGEN 00007

Repair and misrepair of site-specific DNA double-strand breaks by human cell extracts Anil Ganesh, Phillip North and John Thacker Cell and Molecular Biology Division, MRC Radiobiology Unit, Chilton, Didcot, Oxon OXl l ORD, UK

(Received 24 June 1992) (Revision received 18 August 1992) (Accepted 19 August 1992)

Keywords: Repair, in vitro; Misrepair; Deletion; Direct repeats; Human cell extracts

Summary The rejoining by human cell extracts of a double-strand break induced by endonuclease treatment at one of several sites within a small D N A molecule was studied. Rejoining was found at each of 8 sites tested, but the rejoin efficiency varied with the nature of the break (e.g., breaks with cohesive ends were rejoined more efficiently than blunt-ended breaks). Extracts from primary and immortalized cell lines, as well as those from individuals with ataxia telangiectasia (A-T), showed the same pattern of relative rejoin efficiencies. However, mis-rejoining varied with the cell extract used, and was particularly elevated with two immortalized A-T cell lines. Mixing experiments showed that the mis-rejoining property of extracts could act in a semi-dominant fashion, depending on the individual efficiencies of the component extracts. The mis-rejoin mechanism involved deletion at sites of short direct repeats at various distances from the initial break site. A model of deletion formation (the strand-exposure and repair model) is restated to explain the sequence repeat dependence found, and is compared to models of homologous D N A recombination.

It is known from many studies that doublestrand breaks (DSB) in DNA, despite their severity, can be rejoined by cells. The importance of this process to cellular survival is seen in experiments with micro-organisms. For example, in bacteria a number of different genes are involved in DSB repair; when mutated these genes confer

Correspondence: Dr. John Thacker, MRC RadiobiologyUnit, Chilton, Didcot, Oxon OXll 0RD, UK. Tel. (UK) 235-834393; Fax (UK) 235-834918.

hypersensitivity to DNA-breaking agents such as ionising radiation (e.g., Sargentini and Smith, 1986). In yeast, it has been found that the presence of approximately one radiation-induced DSB as measured by sedimentation methods correlates to one lethal event as measured in cellular survival studies (Ho, 1975; Resnick and Martin, 1976; Frankenberg et al., 1981). Also in yeast the use of a temperature-sensitive DSB-repair defective mutant (rad54-3) has demonstrated that repair of radiation-induced DSB is directly linked to survival probability (Frankenberg-Schwager et al., 1988).

252

In principle, rejoining of broken DNA molecules may occur either by ligation of broken termini or by intra- or inter-molecular recombination (e.g., Weibezahn and Coquerelle, 1981). Current models of recombination require a number of enzymes and a minimum of sequence homology (Cox and Lehman, 1987; Bollag et al., 1989). Depending upon the nature of the damage and subsequent processing, the consequences of rejoining may be restoration of the original sequence, deletion or duplication of DNA sequence (mutation), or chromosomal rearrangement. Over the last few years we have devised methods to look at fidelity of break rejoining by human cells: a site-specific DSB is introduced using a restriction endonuclease into defined molecules in vitro and the molecules are exposed to cells (review: Thacker, 1989) or cell extracts (North et al., 1990). Since the damage site is defined and localized, sites can be followed for analysis of subsequent processing. This report summarises experiments made with cell extracts, with addidouble-strand break

CELL EXTRACT (protein precipitate from isolated nuclei)

GENE

/ MIX

extract + DNA + reaction buffer

incubate

purify

/-... GEL ELECTROPHORESIS

BACTERIAL TRANSFORMATION (blue/white ratio)

tional data to those published earlier on the analysis of both the efficiency and fidelity of the break-rejoining process. Materials and methods

The experimental scheme is summarised in Fig. 1 (for details see North et al., 1990). Briefly, extracts were prepared from the nuclei of human cell lines, including those derived from normal individuals (HF19, Cox and Masson, 1974; MRC5V1, Huschtscha and Holliday, 1984) and patients with the cancer-prone disorder ataxia telangiectasia (AT5BIVA, Day et al., 1980; AT4BINE1, an immortalized line kindly supplied by Dr. C.F. Arlett). The extracts were mixed with DNA molecules (plasmid pUC18; Fig. 2) broken at one site with a restriction endonuclease. The reaction buffer was very simple: 65.5 mM TrisHC1 pH 7.5/10 mM MgSO4/1 mM ATP, mixed with broken DNA and the extract (with small amounts of storage buffer). After incubation at 14°C for 1-24 h, the DNA was purified and then a sample was run on a gel to separate non-rejoined from rejoined forms. This gel was blotted onto nitrocellulose and probed with radiolabelled pUC18 DNA to maximise detection of rejoining. Another sample from the purified reaction mix was used to transform bacteria. The transformation frequency, which results from uptake and expression of monomeric forms of the plasmid, gave an independent measure of the rejoin efficiency for comparison to the gel picture. Since the initial break was placed in the lacZ gene of pUC18 (Fig. 2) the fidelity of rejoining could also be measured. If the initial break was rejoined with fidelity, transformation of a suitable bacterial strain yielded blue colonies on indicator medium, but if the break was mis-rejoined a white colony was found. Results

SOUTHERN ANALYSIS DNA ISOLATION GEL ANALYSIS SEQUENCING

Fig. 1. Experimental scheme for analysis of break rejoining by human cell extracts. The gene shown is lacZ in the pUC18 molecule.

Rejoin efficiency: relationship to break site The efficiency of rejoining was related to the type of break, and possibly the site at which the break was introduced. Data obtained from gel analysis (fraction converted to closed-circular monomer) and from the frequency of trans-

253

Zimmerman, 1983), but PEG was not found to improve the rejoin efficiency with cell extracts (Fig. 4). An increase in the DNA concentration (and hence the j : i ratio; Dugaiczyk et al., 1975) of blunt-ended molecules in the reaction mixture gave some increase in bacterial transformation, but this was still poor compared to that from ends carrying single-stranded overhangs (Fig. 5B).

formed bacteria were in very good agreement (e.g., compare AT5BIVA rejoin profile in Fig. 3 with transformation data in Fig. 5A). Thus if the molecule was broken at the EcoRI site it was always rejoined less well by human nuclear extracts than if broken at the SalI site. All told, 8 different sites were assessed (Fig. 2) and the pattern of efficiency was SalI > HindlII > BamHI > SstI > PstI > EcoRI > AccI > HinclI. Thus the highest efficiency was found with 5' 4-base overhanging termini (except EcoRI), followed by 3' 4-base overhangs, then 2-base overhangs (AccI) and blunt-ended termini (HinclI). Results illustrating these features of the rejoin process are given in Figs. 3-5, along with the effects of the 'positive control' enzyme T4 DNA ligase. It should be noted that compared to cell extract treatment, pure prokaryotic ligase has a quite different relative rejoin efficiency to give monomeric forms at these break sites (Fig. 3). Fig. 4 shows that extracts could achieve rejoining with blunt-ended (HinclI) breaks, but that this was mainly into multimers (contrast T4 ligase on these ends or extract treatment of SalI ends in the same experiment). The agent polyethylene glycol (PEG) is commonly used to aid rejoining of blunt-ended breaks by T4 ligase (Pheiffer and

Relative efficiency of rejoining in extracts from different cell lines Extracts from several different cell lines were used, including those from patients with ataxia telangiectasia (A-T) and from normal individuals. In addition extracts from immortalized and primary lines were used. Each of these extracts gave the same profile of relative efficiency of rejoining at the break sites noted above. That is, relative efficiency of rejoining did not differ between these different cell types (e.g., compare results for a normal primary cell line, HF19, with those for the immortalized normal line MRC5V1 and the A-T line, AT5BIVA in Fig. 3; see also North et al., (1990) for data on the primary line HF12). We have previously shown that the absolute efficiency of rejoining a given type of DNA break (e.g. at the EcoRI site) does not differ for A-T

Multiple cloning site GCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAGG ATCCCCGGGTACCGAGOTCGA ATTC

I

I

H i n d III

I Pet I

I Sal I ACC I Hlnc II

I

I

I

Barn HI

I

I

I

Set I E c o RI

IAGCT]~]___

SalI

! I

ITT I

I

ICTAGI

BamHI

I

TCG'-'-"A]

HindIII

PstI

SstI

AccI HincII

~

IACGTl ~

ITCGAl

IGCI CTG cGA•GGAC C

Fig. 2. The pUC18 plasmid molecule (left) with an expanded view of the unique sequence sites for breakage (multiI~le cloning site), and the end-structures of the sites used in this study (right).

254

HF19 i

i i

AT5BIVA i i

ii iiii iiiiii~iiiiiii

(LIN)~

and normal cells (North et al., 1990). In further experiments we have found that this result is not affected by reducing the DNA concentration in the reaction by as much as 20-fold (data not shown).

Rejoin fidelity: dependence on cell line The majority of rejoining of site-specific DSB occurred with fidelity; i.e., on transformation into LIN

~i iiilil i!iil!i ii!il ¸ ii iii!iiiiiiiiiiili!!iiii!i!iiii!ili!!iiiiiiiii CC

no PEG ~.o~1

iiiiiii~!iii!i i~!i !i!iiiiiii!ii!i!iii!!i!!!i~i!i!~

MRC5Vl

T4 ligase (0.01 units)

5% PEG Hincll-cut

10% PEG i r~,

(LIN) 2

(LIN) 2

LIN LIN

CC

CC

Fig. 3. Rejoin profiles at 7 different break sites in pUCt8 for extracts from various human cell lines (primary HF19, immortalized AT5BIVA, immortalized MRC5V1) and for T4 DNA ligase. Broken DNA treated as in Fig. 1, separated by gel electrophoresis (1% agarose), blotted onto nitrocellulose and probed with radiolabelled pUC18. CC = closed circular monomer, LIN = linear monomer (reaction substrate), (LIN) 2 = linear dimer. Note that autoradiographic exposure varies somewhat, but that the relative efficiency of rejoining a given break site was similar for the 3 different extracts, while this was markedly different for T4 DNA ligase.

o..O o..OO Fig. 4. Efficiency of extract rejoining of pUC18 molecules broken at the HincII site (blunt-ended breaks), with and without polyethylene glycol (PEG). T4 DNA ligase (positive) and boiled extract (negative) controls are included, as well as the rejoin efficiency of the same extract with SalI cohesive ends. Experimental details as for Figs. 1 and 2; extract from AT4BINE1 cells.

255 bacteria, most rejoined molecules gave blue colonies, indicating correct reformation of the lacZ gene. However, a fraction of m o n o m e r plasmid was mis-rejoined: this amounted to about 0.5% in control treatments (e.g., no extract or boiled extract added to the reaction mix; North et al., 1990), but could increase to 10% or more with certain extracts and break-sites. In particular, this increase was found with extracts from the A-T cell line, AT5BIVA, especially at the EcoRI and AccI break-sites (North et al., 1990). High levels of mis-rejoining were also found at the HinclI site (data not shown). This increase in mis-rejoining is dependent upon the protein concentration in the reaction mixture (maximal at about 0.6 m g / m l final total protein concentration; data not shown). Additionally, we have observed a consistently high frequency of mis-rejoining with another immortalized A-T cell line, AT4BINE1 (Table 1), but preliminary experiments with other lines do not as yet give a consistent association of this phenotype with the A - T defect (data not shown). A mixing experiment was performed to look at the dominance of the mis-rejoining process. Extracts produced at 3 different times from the A T 5 B I V A line, each of which showed a high level of mis-rejoining with Eco RI-linearized D N A (10%, 5% and 6% respectively; see North et al., 1990), were mixed with two different extracts

TABLE 1 MIS-REJOIN OF EcoRI BREAKS IN pUC18 DNA BY NUCLEAR EXTRACTS FROM DIFFERENT CELL LINES Expt. 1

2

Cell l i n e extract MRC5V1 AT5BIVA AT4BINE1

Colonies counted 2012 2310 3512

MRC5V1 AT5BIVA AT4BINE1

237 427 225

White Percent colonies mis-rejoin 5 0.25 249 10.8 306 8.7 1 74 32

0.42 17.3 14.2

Protein concentrations varied in the range 0.6-1.7 mg/ml in the final reaction mix. from the MRC5V1 line which showed control levels of mis-rejoining (about 0.5%). The extent of mis-rejoining by the mixed extracts varied with the A T 5 B I V A extract component: the extract showing the highest mis-rejoining on its own (extract 1) gave a relatively high level of mis-rejoin in the mixture, while the less ' p o t e n t ' A T 5 B I V A extracts gave much lower levels of mis-rejoin when mixed with MRC5V1 extracts (Table 2).

Molecular analysis of the mis-rejoin process We have also examined the nature of the misrejoin events, primarily in AT5BIVA-extract treated samples. A large number ( > 300) of mis-

-2 10-2

(b)

ca

; i

.,~

i

.~

I

~OO

4

s

~pc, ~

*

~

,

cO" "~

extract-treated ~

*

1o'10

"

~

~"~' o"ff

~'°O ~

~

Hincll extract-treated

Fig. 5. Transformation frequencies for bacteria (DH5a) exposed to control or extract-treated pUC18 molecules. (A) Molecules broken at 7 different sites and treated with an A T 5 B I Y A extract (same Expt. as in Fig. 3). (B) Molecules broken at EcoRI, AccI and HozcII sites, the latter with increasing pUC18 D N A concentrations in the reaction mix, treated with an AT4BINE1 extract. Note that the control (cut-untreated) D N A was EcoRI-cut, and the standard D N A concentration per reaction was 2/~g.

256 TABLE 2 EFFECT OF MIXING EXTRACTS WITH DIFFERENT MIS-REJOIN CAPACITY

deletion included the initial break-site. More remarkably, when a number of these deletion molecules were sequenced each showed that a short direct sequence repeat occurred precisely at each end of the deleted region (Thacker et al., in preparation). This is illustrated in Fig. 6 for two different deletions, where it is seen that the parent molecule has both direct repeats and that only one of the repeats is retained in the final deleted molecule.

Extract No. Colonies W h i t e Percent MRC5V1 AT5BIVA counted colonies mis-rejoin 1 1 1 2 2 2

1 2 3 1 2 3

1338 1057 2823 927 946 926

83 6 51 62 4 15

6.2 0.57 1.8 6.7 0.42 1.6

Discussion

Extracts mixed in 1:1 ratio, using approximately the same total protein concentrations for different mixtures.

We have demonstrated that human cell extracts can be used to measure break rejoining, at least when the break is of a relatively simple type. Further, it seems that human cells from different origins have very similar relative efficiencies of rejoining at different sites, with extracts from all cell lines showing some break-sites rejoined better than others. Rejoin efficiency may in part relate to sequence at the break site: for example, base pairing at the EcoRI site (5' A A T T overhang) will be less thermally stable than for sites such as Sall (5' T C G A overhang). On this basis,

rejoined plasmids were purified from separate white bacterial colonies and these were examined for size changes on gels. This analysis showed that the vast majority of mis-rejoined molecules had suffered deletions of various sizes, and about 1% of mis-rejoined molecules had an increase in size (North et al., 1990). The positions of the deletions in pUC18 were mapped by looking for the p r e s e n c e / a b s e n c e of a number of different restriction sites: in each case it was found that the

Parent sequenoe I

i

120 bp

~

CCCCGGGTACCGAGC%cgaattcgtaat

Mutant

,

,

.......... tgcctaatgagtgagcteAACTCACATTAATT

sequence ~ CCCCGGGTACCGAGCTAACTCACATTAATT I

I

Parent sequence i

i.... i ~ TCTAGAGGATCCccgggtaccgagctcgaattc I. . . .

63 bp

i---~

......... t g a a a t t g t t a t c c G C T C A C A A T T C C A A

I

Mutant sequence ~ l--------e

TCTAGAGGATCCGCTCACAATTCCAA i j Fig. 6. Comparison of parent and mutant sequences for two deletions (120 bp and 63 bp respectively) induced by cell extracts. Arrow indicates initial break site (EcoRI restriction site); direct repeats are boxed; deleted sequence shown in lower case lettering (repeat shown as deleted is arbitrary).

257

sites having Y overhangs (PstI, SstI) should not in principle differ from those with similar 5' overhangs, yet it is seen that they have lower rejoin efficiencies Thus, additional factors such as the sequence in the neighbourhood of the break site may affect the rejoin probability by human nuclear extracts It may be that adjacent sequences determine DNA secondary structures which differentially influence break-rejoin probabilities, even for closely-spaced sites. Alternatively 'accessory' proteins in the extracts, which may affect rejoining (North et al., 1990; Thacker et al., in

preparation), could bind differentially to the DNA regions involved. It is clear that when little or no single-stranded overhang exists at the break site, rejoining to give monomeric forms is difficult. However, blunt-ended breaks are rejoined to give multimeric forms, often with similar efficiency to those found with cohesive-ended molecules (Fig. 4); this may suggest that some difference in mechanism of rejoining exists for monomeric vs. multimeric forms. The nature of the induced DSB also affects the frequency of misrepair found, particularly

STRAND-EXPOSURE AND REPAIR MODEL

DSB 5'.....

....

[3

3'.....

[3

3'

. . . .

EXONUCLEASE

5'....

3'

3'....

5'

I

.... 3'

I

I

|

.... 5'

3'--

REANNEAL AT REPEATS 5'

5' .... 3 t. .

.

\

3'~-~__ . . . . t---l~

. 3'--

.... 3' 5t

5'

SNIP ENDS POLYMERISE LIGATE

51....

3' ....

I---'1 I I

..o,3'

....

5'

Fig. 7. S E R model for deletion formation. Direct repeats in sequence are shown as boxes either side of initial break site (DSB). Exonuclease action (3' to 5' in this case) removes one strand beyond repeats, then repeats anneal leaving extended 'tails' which must be removed (snip ends). The recombinant molecule is then infilled by polymerase from the 3' ends and ligated to give the deleted form with only one copy of the r e p e a t

258

with extracts from certain cell types. We have found that extracts from A-T cells mis-rejoin break sites such as EcoRI more frequently than 'normal' cell extracts (see also North et al., 1990). While it cannot as yet be suggested that this phenomenon is specific to A-T cells, since too few lines have been tested, the mis-rejoining process is of mechanistic interest. Those mis-rejoined molecules that have been sequenced were found to be deletions having a specific form of sequence dependence: short direct repeats spaced up to a hundred or more bases apart in the parent molecule recombine to eliminate one copy of the repeat and form the deletion (Fig. 6). This mechanism of deletion formation has been observed before in a variety of systems, including experimental bacterial studies (e.g., Farabaugh et al., 1978, Conley et al., 1986) and in human disorders (e.g., Canning and Dryja, 1989; Kornreich et al., 1990). It is therefore of general importance to understand the way in which this form of deletion (or non-conservative recombination) occurs. A number of our detailed findings also have their parallel in bacterial studies; for example, in E. coli transfected with broken plasmid, it was found that rejoin efficiency and fidelity reflect the site and type of initial breakage (Conley et al., 1986). However, as we have found for human extracts, there does not seem to be a simple rule in bacteria relating the type of DNA terminus to deletion frequency; some apparently similar break-sites show significant differences in rejoin efficiency and in the frequency and distribution of deletions (Conley et al., 1986; Bien et al., 1988; Merz, 1989). These differences appear to relate to the opportunity for interaction of short homologies at or either side of the initial break site; thus, the outcome may differ considerably with the position of the break site. In bacterial systems, a model for this deletion process has been proposed in which exonucleases (or helicases) expose single DNA strands from the site of initial breakage; then repair synthesis drives a recyclization process using short homologies (e.g., direct repeats) to stabilize the intermediates (Conley et al., 1986). This process appears to be recA-independent, but it was found that E. coli xth mutants show very poor recyclization and little formation of this type of deletion, suggesting

that exonuclease III is involved in both repair and misrepair processes (Conley et al., 1986). A model of this type, the strand-exposure and repair (SER) model, is outlined in Fig. 7. It should be noted that there remain a number of unexplained steps in this model; i.e., it is not clear how the short homologies find each other, which enzymes are involved in removing single-stranded tails, etc. As noted above, the deletion process can in this instance be thought of as a type of 'illegitimate' recombination. What relationship does this process have to 'legitimate' (homologous) recombination events? Over many years the latter process has been explored experimentally, giving rise to a variety of molecular models. In relation to the present study, the model proposed by Resnick (1976) and extended by Szostak et al. (1983) for homologous recombination initiated at DSB is of considerable relevance. This model has been supported in part by the common observation that DSB stimulate recombination processes (Bollag et al., 1989). Resnick envisaged that, at the site of a DSB, limited single-strand degradation occurs (exonuclease action) to give single-stranded 'tails' which invade an undamaged homologous helix. The single-stranded tail pairs with homologous DNA in the unbroken helix, displacing the existing homologous strand and acting as a site for DNA 'repair' synthesis (Resnick, 1976). It is a relatively small step to adapt this model to the present data by suggesting that where a homologous helix cannot be found the process of helix invasion can occur intra-molecularly at regions of partial or short homology. If recombination is accomplished it will be non-conservative, leading to a deletion between the short homologies as observed in the present study. Similar enzymatic events as those proposed for homologous (conservative) recombination would occur: strand invasion, heteroduplex formation, repair synthesis and ligation. Indeed, the SER type of model (Fig. 7) has been suggested to account for observations of non-conservative homologous recombination in transfected DNA substrates, whether integrated into the genome (Lin et al., 1984) or not (Wake et al., 1985). The recombination mechanisms revealed in these experiments differ only from the present proposals in having an apparent require-

259

ment for long regions of homology to facilitate strand transfer. In reality this requirement may simply reflect the frequency of homologous events relative to those using only short direct repeats; i.e., where the homology is large a high frequency of intramolecular recombination (deletion) is found, while for short repeats the frequency is low due to the relative instability of the intermediates. We are at present using the in vitro system with human cell extracts to examine models and predicted enzymatic activities for both correct DSB rejoining and deletion formation.

Acknowledgements This study was supported in part by the Commission of the European Communities contract B17-0026.

References Bien, M., H. Steffen and D. Schulte-Frohlinde (1988) Repair of plasmid pBR322 damaged by gamma irradiation or by restriction endonucleases using different recombinationproficient E. coli strains, Mutation Res., 194, 193-205. Bollag, R.J., A.S. Waldman and R.M. Liskay (1989) Homologous recombination in mammalian cells, Annu. Rev. Genet., 23, 199-225. Canning, S., and T.P. Dryja (1989) Short, direct repeats at the breakpoints of deletions of the retinoblastoma gene, Proc. Natl. Acad. Sci. (U.S.A.), 86, 5044-5048. Conley, E.C., V.A. Saunders, V. Jackson and J.R. Saunders (1986) Mechanisms of intramolecular recyclization and deletion formation following transformation of Escherichia coli with linearized plasmid DNA, Nucleic Acids Res., 14, 8919-8932. Cox, M.M., and I.R. Lehman (1987) Enzymes of general recombination, Annu. Rev. Biochem., 56, 229-262. Cox, R., and W.K. Masson (1974) Changes in radiosensitivity during the in vitro growth of diploid human fibroblasts, Int. J. Radiat. Biol., 26, 193-196. Day, R.S., C.H.J. Ziolkowski, D.A. Scudiero, S.A. Meyer, A.S. Lubiniecki, A.J. Giradi, S.M. Galloway and G.D. Bynum (1980) Defective repair of alkylated DNA by human tumour and SV40-transformed human cell strains, Nature (London), 288, 724-727. Dugaiczyk, A., H.W. Boyer and H.M. Goodman (1975) Ligation of EcoRI endonuclease-generated DNA fragments into linear and circular structures, J. Mol. Biol., 96, 171184. Farabaugh, P.J., U. Schmeissner, M. Hofer and J.H. Miller (1978) Genetic studies of the lac repressor, VII. On the molecular nature of spontaneous hotspots in the lacI gene of Escherichia coli, J. Mol. Biol. 126, 847-857.

Frankenberg, D., M. Frankenberg-Schwager, D. Bloecher and R. Harbich (1981) Evidence for DNA double-strand breaks as the critical lesions in yeast cells irradiated with sparsely or densely ionising radiation under oxic or anoxic conditions, Radiat. Res., 88, 524-532. Frankenberg-Schwager, M., D. Frankenberg and R. Harbich (1988) Exponential or shouldered survival curves result from repair of DNA double-strand breaks depending on postirradiation conditions, Radiat. Res., 114, 54-63. Ho, K.Y. (1975) Induction of DNA double-strand breaks by X-rays in a radiosensitive strain of the yeast Saccharomyces cerevisiae, Mutation Res., 30, 327-334. Huschtscha, L.I., and R. Hoiliday (1983) Limited and unlimited growth of SV40-transformed cells from human diploid MRC-5 fibroblasts, J. Cell Sci., 63, 77-99. Kornreich, D., Bishop and R.J. Desnick (1990) a-Galactosidase A gene rearrangements causing Fabry disease, J. Biol. Chem. 265, 9319-9326. Lin, F.-L., K. Sperle and N. Sternberg (1984) Model for homologous recombination during transfer of DNA into mouse L cells: role for DNA ends in the recombination process, Mol. Cell. Biol., 4, 1020-1034. Merz, M. (1989) in: D. Schulte-Frohlinde, Studies of Radiation Effects on DNA in Aqueous Solution, ICRU News, 2, 4-15. North, P., A. Ganesh and J. Thacker (1990) The rejoining of double-strand breaks in DNA by human cell extracts, Nucleic Acids Res., 18, 6205-6210. Pheiffer, B.H., and S.B. Zimmerman (1983) Polymer-stimulated ligation: enhanced blunt- and cohesive-end ligation of DNA or deoxyribooligonucleotides by T4 DNA ligase in polymer solutions, Nucleic Acids Res., 11, 7853-7871. Resnick, M.A. (1976) The repair of double-strand breaks in DNA: a model involving recombination, J. Theoret. Biol., 59, 97-106. Resnick, M.A., and P. Martin (1976) Repair of double-strand breaks in the nuclear DNA of Saccharomyces cerevisiae and its genetic control, Mol. Gen. Genet., 143, 119-129. Sargentini.N.J. and K.C. Smith (1986) Quantitation of the involvement of the recA, recB, recC, recF, recJ, recN, lexA, radA, radB, uvrD, and umuC genes in the repair of X-ray induced DNA double-strand breaks in Escherichia coli, Radiat. Res., 107, 58-72. Szostak, J.W., T.L. Orr-Weaver, R.J. Rothstein and F.W. Stahl (1983) The double-strand break repair model for recombination, Cell, 33, 25-35. Thacker, J. (1989) The use of integrating DNA vectors to analyse the molecular defects in ionising radiation-sensitive mutants of mammalian cells including ataxiatelangiectasia. Mutation Res., 220, 187-204. Wake, C.T., F. Vernaleone and J. H. Wilson (1985) Topological requirements for homologous recombination among DNA molecules transfected into mammalian cells, Mol. Cell. Biol., 5, 2080-2089. Weibezahn, K.F., and T. Coquerelle (1981) Radiation-induced DNA double-strand breaks are rejoined by ligation and recombination processes. Nucleic Acids Res., 9, 31393150.