Repeated transient sulforaphane stimulation in astrocytes leads to prolonged Nrf2-mediated gene expression and protection from superoxide-induced damage

Neuropharmacology 60 (2011) 343e353

Contents lists available at ScienceDirect

Neuropharmacology journal homepage: www.elsevier.com/locate/neuropharm

Repeated transient sulforaphane stimulation in astrocytes leads to prolonged Nrf2-mediated gene expression and protection from superoxide-induced damage Petra Bergström a,1, Heléne C. Andersson b,1, Yue Gao a, Jan-Olof Karlsson c, Christina Nodin b, Michelle F. Anderson b, Michael Nilsson b, **, Ola Hammarsten a, * a

Institute of Biomedicine, Department of Clinical Chemistry and Transfusion Medicine, Sahlgrenska University Hospital, University of Gothenburg; Bruna Stråket 16, SE-413 45, Gothenburg, Sweden Center for Brain Repair and Rehabilitation (CBR), Institute of Neuroscience and Physiology, The Sahlgrenska Academy, University of Gothenburg; Medicinaregatan 11, Box 432, SE-405 30, Gothenburg, Sweden c Institute of Biomedicine, Department of Medical Chemistry and Cell Biology, The Sahlgrenska Academy, University of Gothenburg; PO Box 440, SE-405 30, Gothenburg, Sweden b

a r t i c l e i n f o

a b s t r a c t

Article history: Received 30 June 2010 Received in revised form 22 September 2010 Accepted 24 September 2010

Oxidative stress is a major contributor to slowly developing diseases like Parkinson’s disease, Alzheimer’s disease and cancer and one of the main causes of tissue damage following ischemic insults in the brain. Nrf2 is a transcription factor responsible for much of the inducible cellular defense against oxidative stress. Nrf2 can also be activated by xenobiotics like sulforaphane, a component highly enriched in cruciferous vegetables such as broccoli. Ingestion of broccoli or sulforaphane results in long-term protection against radical damage, although absorbed sulforaphane is cleared from the body within a few hours. Here we have examined whether the prolonged protection induced by sulforaphane is explained by a slow down regulation of the Nrf2 response. Furthermore, to simulate daily ingestion of sulforaphane, we examined the hypothesis that repeated transient sulforaphane stimulation results in an accumulation of Nrf2-mediated gene expression and an increased protection against oxidative damage. The kinetics of sulforaphane-induced Nrf2 response was studied in astrocytes, a cell type known to be highly involved in the defense against oxidative stress in the brain. Sulforaphane stimulation for 4 h induced an Nrf2-dependent increase of Nqo1 and Hmox1 mRNA that remained elevated for 24 h, and the corresponding proteins remained elevated for over 48 h. In addition, peroxide-clearing activity and the levels of glutathione were elevated for more than 20 h after stimulation for 4 h with sulforaphane, resulting in an increased resistance to superoxide-induced cell damage. Repeated sulforaphane stimulation resulted in an accumulation of mRNA and protein levels of Nqo1 and a persistent cell protection against oxidative damage. These findings indicate that brief stimulation of the Nrf2 pathway by sulforaphane results in long-lasting elevation of endogenous antioxidants in astrocytes. The findings also demonstrate that part of this response can be built up by repeated transient stimulation, possibly explaining how intermittent intake of sulforaphane can result in long-term protection from radicalinduced disease. Ó 2010 Elsevier Ltd. All rights reserved.

Keywords: Nrf2 Nqo1 Hmox1 Oxidative damage Sulforaphane Astrocytes Neuroprotection

1. Introduction Oxidative stress is one of the main causes of tissue damage following ischemic insults in the brain (Kuroda and Siesjo, 1997) and contributes to cell death in slowly developing neurological

* Corresponding author. Tel.: þ46 31 3421561; fax: þ46 31 828458. ** Corresponding author. Tel.: þ46 31 3422815; fax: þ46 31 47 42 63. E-mail addresses: [email protected] (M. Nilsson), ola.hammarsten@ clinchem.gu.se (O. Hammarsten). 1 Equal contribution of these two authors. 0028-3908/$ e see front matter Ó 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.neuropharm.2010.09.023

diseases like Parkinson’s disease and Alzheimer’s disease (Calabrese et al., 2007) as well as in atherosclerosis (Kaneto et al., 2010) and cancer (Benz and Yau, 2008). Oxidative stress occurs when the production of free radicals and other reactive substances exceeds the capacity of the cells natural defense systems. The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates the expression of many of the enzymes and free radical scavengers that defend the cell against free radical-induced damage. Thus Nrf2 activation represents a key step in endogenous cellular protection (Copple et al., 2008). Under normal conditions, most Nrf2 is inactive since it is sequestered in the cytoplasm by its repressor kelch-like

344

P. Bergström et al. / Neuropharmacology 60 (2011) 343e353

ECH-associated protein 1 (Keap1) (Itoh et al., 1999). Keap1 targets Nrf2 for ubiquitinylation and proteasome-mediated degradation (Cullinan et al., 2004). In response to oxidative damage or other reactive chemicals, cysteine residues in Keap1 are modified (Hong et al., 2005; Yamamoto et al., 2008), resulting in a conformational change that releases and activates Nrf2 (Eggler et al., 2005; Kobayashi et al., 2006; Tong et al., 2006). Activated Nrf2 is then transported to the nucleus where it binds to promoters containing the antioxidant response element (ARE) motif (Itoh et al., 1997). Binding of Nrf2 to the ARE upregulates transcription of numerous cytoprotective enzymes that induce glutathione (GSH) synthesis and degrade radicals and aldehydes, resulting in increased protection from a range of toxic substances (Ishii et al., 2000). Among these are the neuroprotective enzymes heme oxygenase-1 (Hmox1) (Alam et al., 1999) and NAD(P)H:quinone oxidoreductase 1 (Nqo1) (Venugopal and Jaiswal, 1996). Studies using genetically modified mice have further demonstrated the critical role of Nrf2 in the defense against oxidative damage. Nrf2/ mice develop diseases even from minor exposure to cigarette smoke (Rangasamy et al., 2004), sunlight (Hirota et al., 2005) and other radical inducers, likely because they are unable to activate their radical protection system properly (Chan and Kwong, 2000; Chan and Kan, 1999; Itoh et al., 1997; Ramos-Gomez et al., 2001). Nrf2/ mice also develop larger infarct volumes following stroke (Shih et al., 2005) and are more prone to develop Parkinson’s disease (Burton et al., 2006). Conversely, mice overexpressing Nrf2 are protected against neurodegeneration caused by Parkinson’s disease or amyotrophic lateral sclerosis (Chen et al., 2009; Vargas et al., 2008) and transplanted astrocytes overexpressing Nrf2 confer neuroprotection following brain injury induced by oxidative stress (Calkins et al., 2005; Jakel et al., 2007). Xenobiotics, like sulforaphane (SF) from broccoli, are also capable of modifying sulfhydryls in Keap1 resulting in the release and activation of Nrf2 (Dinkova-Kostova et al., 2001; DinkovaKostova and Talalay, 2008). Sulforaphane-mediated activation of the Nrf2 pathway protects against stroke in rats (Zhao et al., 2006), 6-hydroxydopamine toxicity in rat organotypic nigrostriatal cocultures (Siebert et al., 2009), kainate-induced cell death in the hippocampus (Rojo et al., 2008) and inhibit tumour development in a number of rodent models (Fahey et al., 2002; Pearson et al., 1983; Talalay et al., 1978; Zhang et al., 1994). Importantly, mice lacking the Nrf2 gene do not acquire cancer protection from broccoli, sulforaphane or other known Nrf2-activating drugs (Iida et al., 2004; Xu et al., 2006). This indicates that the positive effect of broccoli or sulforaphane requires a functional Nrf2 response and that activation of the Nrf2 system is involved in protection from free radicalinduced disease. Astrocytes play an essential role in the cellular antioxidant defense in the brain. They are the main source of GSH and supply the neurons with substrate for glutathione synthesis to improve the neuronal antioxidative reserves (Dringen, 2000; Dringen et al., 1999). Astrocytes remain viable and maintain their metabolic properties longer than neurons in a model of cerebral ischemia

(Thoren et al., 2005), allowing astrocytes to maintain their nursing function also during oxygen deprivation. In addition, although Nrf2 is active in neurons, recent results indicate that astrocytes constitute the most important target for Nrf2-stimulating therapy in the brain (Vargas and Johnson, 2009). In response to tert-butylhydroquinone, sulforaphane incubation or over-expression of Nrf2, astrocytes exhibit greater Nrf2 activation than neurons and this astrocytic response protects neurons against oxidative insults (Kraft et al., 2004; Shih et al., 2003). Studies in cultured astrocytes have shown that sulforaphane preconditioning for 48 h upregulates Nqo1 and protects cells against oxidative stress and death after oxygen and glucose deprivation in an Nrf2-dependent manner (Danilov et al., 2009; Kraft et al., 2004). Exactly how Nrf2-activated astrocytes contribute to neuroprotection is still unclear. However, genes regulated by Nrf2 control key steps in e.g. heme metabolism (Alam et al., 2000), reduction of quinones (Itoh et al., 1997) and glutathione synthesis (Shih et al., 2003), mechanisms that are all involved in cell protection. The pharmacokinetics of sulforaphane in humans indicate that it is cleared from the body within a few hours (Ye et al., 2002) but still offers long-term protection from oxidative stress (van Poppel et al., 1999). Although this suggests that brief stimulation of the Nrf2 pathway is sufficient to cause long-term changes in gene expression, previous studies in astrocytes have only investigated Nrf2-mediated gene expression and protection after constant sulforaphane incubation for 1e2 days (Danilov et al., 2009). At present it is not known how intermittent intake of Nrf2-activating drugs or vegetables can result in long-term protection from radical-induced damage. Therefore, in the present study we have examined the kinetics of two well-known Nrf2-mediated genes, Nqo1 and Hmox1, after exposing the astrocytes briefly (1e4 h), constantly (24 h) or repeatedly (4 h daily, up to 4 days) to sulforaphane. Results show that a brief exposure to sulforaphane was sufficient to induce prolonged Nrf2-mediated Nqo1 and Hmox1 expression and that repeated stimulation results in an accumulation of Nqo1 and sustained protection from oxidative stress. These findings potentially explain how intermittent intake of Nrf2 activators like sulforaphane can induce long-term protection from oxidativerelated disease. 2. Material and Methods 2.1. Cells and media Primary astrocyte cultures were obtained from newborn (P1eP2) SpragueeDawley rats. The experimental protocol was approved by the Ethical Committee of the University of Gothenburg (nr 65-2005, 6-2004). The rat pups were decapitated and the cortex was carefully dissected out and mechanically passed through an 80-mm nylon mesh into cell culture medium. The medium consisted of Minimum Essential Medium (MEM, GIBCO, Invitrogen) supplemented to the following composition: 20% (v/v) fetal calf serum, 1% penicillinestreptomycin, 1.2% MEM amino acids solution (50, GIBCO, Invitrogen), 2.2% MEM vitamin solution (100, GIBCO, Invitrogen), 1.6 mM L-glutamine (GIBCO, Invitrogen), 7.15 mM glucose and 48.5 mM NaHCO3.. The cells were cultured in T75 flasks or 6/24-well plates at 37  C in a humidified atmosphere of 95% air and 5% CO2. The medium was changed after three days in culture and thereafter three times a week. Cells were used after 14e17 days in culture when a confluent monolayer had formed. The basal levels of

Table 1 Gene expression assays used for quantitative PCR. Gene

Context sequence

Catalog number

Heme oxygenase (decycling) 1/Hmox1 NAD(P)H dehydrogenase, quinone 1/Nqo1 Nuclear factor, erythroid-derived 2, like 2/Nfe2l2 (Nrf2) Glutamate-cysteine ligase, catalytic subunit/Gclc Thioredoxin reductase 1/Txnrd1 Glutamate-cysteine ligase, modifier subunit/Gclm Polymerase (RNA) II (DNA directed) polypeptide A (mapped)/Polr2a

AAGGCTTTAAGCTGGTGATGGCCTC TCTGGCCAATTCAGAGTGGCATTCT GTCCCAGCAGGACATGGATTTGATT CTCAAGTGGGGTGACGAGGTGGAGT AACCTTAAAGACAACGAACGTGTCG CACAGCGAGGAGCTTCGAGACTGTA CAGACTGGCTATAAGGTGGAACGGC

Rn00561387_m1 Rn00566528_m1 Rn00477784_m1 Rn00563101_m1 Rn01503798_m1 Rn00568900_m1 Rn01752026_m1

P. Bergström et al. / Neuropharmacology 60 (2011) 343e353

2.2. Nrf2 stimulation L-sulforaphane (Enzo Life Sciences) was dissolved in 100% dimethyl sulfoxide (DMSO) to a 10 mM stock solution and was stored at 70  C. Sulforaphane was diluted to final concentrations in culture medium just before addition to the cultures. Final DMSO concentration in the diluents was 0.1%.

2.3. Peroxide production Peroxide production was assayed in white 96-well microtiter plates with transparent bottoms, essentially as described earlier (Petersen et al., 2008). Changes in peroxide production in sulforaphane-pretreated cells were measured using the non-fluorescent probe carboxy-H2DCFDA (5-(and-6)-carboxy-2-7-dichlorodihydrofluorescein diacetate (Invitrogen). In the cell, carboxy-H2DCFDA is cleaved by esterases, yielding polarized non-fluorescent dichlorofluorescein carboxy-DCFH. carboxy-DCFH is oxidized by peroxides to fluorescent carboxy-DCF. After careful washes with Earle’s Balanced Salt Solution (EBSS) (116 mM NaCl, 5 mM KCl, 1 mM NaH2PO4, 1.8 mM CaCl2, 0.8 mM MgCl2, 5.5 mM glucose, 25 mM 4-(2-hydroxyethyl)1-piperazineethanesulfonic acid (HEPES), 100 U/ml penicillin, 100 mg/ml streptomycin and 2.5 mg/ml amphotericin), astrocytes were incubated with 10 mM carboxyH2DCFDA for 2e3 h at 37  C. Peroxide production was then measured as fluorescence at an excitation wavelength of 493 nm and an emission wavelength of 522 nm in a SPECTRAmax GEMINI spectrofluorimeter (Molecular Devices). 2.4. Glutathione levels Levels of GSH were assayed in white 96-well microtiter plates with a transparent bottom essentially as described earlier (Petersen et al., 2008). The sulforaphanepretreated cells were rinsed with EBSS and then incubated in EBSS with 50 mM monochlorobimane (MCB) (Invitrogen). MCB forms a fluorescent conjugate with the reduced form of GSH in a reaction catalyzed by glutathione S-transferase (GST). Changes in GSH levels were measured after 2e3 h (excitation wavelength 380 nm, emission wavelength 460 nm).

measured 23 h later. As described earlier (Nodin et al., 2005), astrocyte cultures were rapidly rinsed with ice-cold phosphate buffered saline (PBS, pH 7.4) and incubated in 0.5% ice-cold trichloroacetic acid under gentle mixing for 20 min to extract ATP. A standardized amount of the ATP extract was collected and stored frozen at 80  C. ATP analysis was completed using an ATP Bioluminescence Assay CLS II kit (Roche Applied Science), according to the manufacturer’s instructions. Prior to analysis, 1.25 M KOH/1 M KH2PO4 was added to the ATP samples to achieve pH 7.6e8.0 and the samples were diluted in deionized H2O. Samples were loaded into white, flatbottomed 96-well plates and luminescence was determined using a Victor II plate reader (Wallac). The ATP levels were calculated as fold-change of untreated control for each independent experiment. To validate the use of ATP levels as a measure of cell viability, we compared the growth rate and ATP levels following superoxide challenge. The relative decrease of ATP levels and growth rate were closely correlated. 2.6. Cell survival and propidium iodide exclusion Propidium iodide (PI) exclusion measures the number of cells unable to sustain plasma membrane integrity as a marker of late stages of cell death. Here it was used as an unbiased marker of cell death, after H2O2 stress, detecting both necrotic and apoptotic cells. Cellular damage and death leads to leakage of PI into the cells. PI then combines with nucleic acids and emits fluorescence at 620 nm after excitation with 540 nm. Sulforaphane-pretreated astrocyte cultures were washed in EBSS and PI was added to a final concentration of 10 mM. The cells were stressed by the addition of 0 or 50 mM H2O2 and changes in fluorescence were measured every 30 min for 5 h.

A mRNA fold change

Hmox1 and Nqo1 mRNA and protein differed slightly between different astrocyte preparations for unknown reasons. However, the kinetics of Hmox1 and Nqo1 induction following sulforaphane stimulation remained unchanged between different astrocyte preparations. For fluorescence detection of peroxide production, GSH levels and propidium iodide (PI) exclusion, the confluent cultured cells were harvested with 0.25% trypsin and replated in white 96-well microtiter plates and in 0.8-cm2 chambered coverglass (Nalge Nunc Int. Corp) precoated with 0.1% collagen solution type 1 (SigmaeAldrich) for confocal imaging. For protein and gene expression, the cells were replated in 6- or 24-well plates, respectively.

Hmox1 Nqo1

30 25 20 15 10 5 0

2.5. Cell survival and analysis of intracellular ATP

0

8 Nrf2

7

Hmox1 Nqo1

6

Gclc Txnrd1

Gclm

5 4

6

12

18

24

Time (h) B 25 Protein fold change

Sulforaphane-pretreated astrocyte monolayers were exposed to superoxide radicals using a mixture of 0.5 mM xanthine (X) and 5e44 mU/ml xanthine oxidase (XO, EC 1.17.3.2, one unit produces 1.0 mmole of superoxide/min at pH 7.5 at 25  C) (both from SigmaeAldrich) for 1 h. ATP levels, as a measure of cell viability, were

mRNA fold change

345

20 15 10 5

3 2

0 0

1

6

12

18

24

30

36

42

48

Time (h)

0 Control

siRNA

6h SF

siRNA+ 6h SF

Fig. 1. siRNA-mediated knockdown of Nrf2 prevents sulforaphane-stimulated elevations of Nqo1, Hmox1, Gclc, Gclm and Txnrd1 mRNA. Rat astrocytes were treated with unrelated siRNA (control) or Nrf2 siRNA for 24 h before addition of 10 mM sulforaphane (SF), where indicated. Nrf2, Hmox1, Gclc, Gclm and Txnrd1 mRNA were measured by quantitative PCR after 6 h stimulation and Nqo1 mRNA after 24 h stimulation. Results from two separate experiments are presented as mean  range.

Fig. 2. Induction kinetics of Hmox1 and Nqo1 mRNA and protein during continuous sulforaphane stimulation. (A) Rat astrocytes were treated with 10 mM of sulforaphane and the levels of Hmox1 and Nqo1 mRNA were analyzed at 0, 6, 12 and 24 h by quantitative PCR. Results are presented as mean  range. (B) Rat astrocytes were treated with 10 mM sulforaphane and cellular levels of Hmox1 and Nqo1 protein were measured at 0, 4, 8, 16, 24 and 48 h by immunoblot. Results are presented as mean  range.

346

P. Bergström et al. / Neuropharmacology 60 (2011) 343e353

P. Bergström et al. / Neuropharmacology 60 (2011) 343e353 Finally, the cells were treated with detergent (0.2% 3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) and frozen at 20  C. After thawing, fluorescence measurement gave an estimate of total cellular nucleic acids in the permeabilized (dead) cells. Data are expressed as percentage of dead cells 3 h after peroxide administration.

347

bovine serum albumin (BSA) (SigmaeAldrich)] for 1 h and incubated with primary antibodies for Nqo1 (ab28947, Abcam) or Hmox1 (OSA-111, Stressgen) diluted in blocking buffer for 1 h at room temperature. After washing, membranes were incubated for 1 h with horseradish peroxidase (HRP)-labeled secondary antibodies in 5% milk with 0.1% Triton X-100, developed with SuperSignal HRP substrate (Thermo Scientific) and quantified with a Chemidoc EQ (BioRad).

2.7. mRNA extraction mRNA was extracted using a MagAttract Direct mRNA M48 Kit (Qiagen). Sulforaphane-pretreated cells were lysed directly on the 24-well plate by addition of 360 ml Buffer MRL/well. The lysate was collected and mRNA was purified with oligo (dT) covered magnetic beads on a GenoM-48 Robotic Workstation (Qiagen/GenoVision) according to protocol. Standard settings for mRNA extraction were used with 100 ml elution volumes. 2.8. cDNA synthesis cDNA was synthesized from 10 ml of mRNA from the GenoM-48 extraction in a 20 ml reaction. The reaction buffer consisted of First Strand Buffer 1, 10 mM dithiothretiol (DTT) and 5 U/ml SuperScriptÔ II Reverse Transcriptase (all from Invitrogen) and 1 U/ml Protector RNase Inhibitor, 20 pmol/ml Hexanucleotide Mix and 0.25 mM of each dNTP, Li-Salt from Roche Diagnostics. The RT reaction was performed on a PTC-200 Peltier Thermal Cycler (MJ Research) at 22  C for 10 min, 42  C for 45 min and 99  C for 3 min. 2.9. Quantitative PCR analysis Inventoried TaqManÒ Gene Expression Assays with FAM reporter dye were derived from Applied Biosystems. The exact primer sequences are unknown, according to Applied Biosystems’ policy, but a context sequence within the primer product is provided. Information about the gene expression assays used is summarized in Table 1. To avoid DNA amplification, the primer products span exoneexon junctions. QPCR reactions were performed with 5 ml of cDNA in MicroAmpÔ 96-well optical microtiter plates on a 7900HT Fast QPCR System in TaqManÒ Fast Universal PCR Master Mix (all from Applied Biosystems) according to protocol but with a total volume of 25 ml. cDNA was diluted 10 times prior to qPCR and all samples were run in duplicate. PCR results were analyzed with SDS 2.3 software (Applied Biosystems) and relative quantity was determined using the DDCT Method (Livak and Schmittgen, 2001), with DMSO-treated cells as calibrator and Polymerase (RNA) II (DNA directed) polypeptide A (Polr2a) as endogenous reference. 2.10. siRNA transfection Astrocytes were re-seeded in 24-well plates to reach 30e50% confluence at the time of transfection. The cells were rinsed once with culturing medium and once with 1 Opti-MEMÒ I Reduced Serum Medium (Invitrogen), before a 30-min incubation in 1 Opti-MEM. on TARGET plus smart pool against Nfe2l2 (Nrf2) or on TARGET plus non-targeting pool (Nordic Biolabs) was diluted to 100 mM in 1 OptiMEM together with 1.5 ml Lipofectamine 2000 ReagentÔ (Invitrogen)/well, according to the manufacturer’s instructions. After a 5 h incubation, the siRNA/ Lipofectamine-containing medium was exchanged for 1 Opti-MEM with 10% fetal calf serum for 19 h. After totally 24 h, Nrf2 was stimulated with 10 mM sulforaphane in culturing medium, as described above. mRNA levels of Nrf2 and its response genes Hmox1, Nqo1, Glutamate-cysteine ligase, catalytic subunit (Gclc), Glutamatecysteine ligase, modifier subunit (Gclm) and thioredoxin reductase 1 (Txnrd1) were measured with qPCR after 6 or 24 h. 2.11. Immunoblot After sulforaphane pretreatment, astrocytes were trypsinized and washed once with PBS. The cells were resuspended by mixing and lysed by addition of a buffer containing 100 mM NaCl, 1% Triton X-100, 1 protease-inhibiting cocktail (complete, ethylenediaminetetraacetic acid (EDTA) free) (Roche), 40 mg/ml Phenylmethanesulfonyl fluoride (PMSF) and 4 mM DTT (SigmaeAldrich) and gently mixed for 40 min on ice. After 25 min centrifugation at 16,000 g/0  C, the supernatant was mixed 1:4 with LDS loading buffer (Invitrogen) and mixed gently for 10 min at 75  C. Subsequently, the lysates were stored in 70  C for later electrophoreses or run directly on a NuPAGE TriseAcetate 3e8% gel (Invitrogen) at 100 V for 1.5 h. Transfer to a nitrocellulose Hybond ECL membrane (GE Healthcare) was performed at 150 V for 1.5 h in transfer buffer (0.1% SDS, 3.9 mM glycine, 4.8 mM Tris, 20% methanol). The membranes were incubated in blocking buffer [PBS, 0.1% Triton X-100 and 15 g/L

3. Results 3.1. Distinct induction kinetics of Nrf2-dependent genes by sulforaphane in primary astrocytes To examine the induction kinetics of the Nrf2 response, we treated primary rat astrocytes with the known Nrf2 inducer sulforaphane and analyzed induction of several known Nrf2-responsive mRNAs. As expected, siRNA-mediated knockdown of Nrf2 prevented sulforaphane-mediated induction of Nqo1, Hmox1, Txnrd1, Gclm and Gclc (Fig. 1). We focused our analysis on Nqo1 and Hmox1, as corresponding proteins have been shown to be important in Nrf2-mediated protection from oxidative damage in neurons and astrocytes (Chen et al., 2000; van Muiswinkel et al., 2000). Continuous stimulation of astrocytes with 1e10 mM sulforaphane resulted in a dose-dependent induction of both Nqo1 and Hmox1 (Supplementary Fig. 1A, B). The Nqo1 expression responded slower to sulforaphane stimulation compared to Hmox1 (Fig. 2) and three other Nrf2-responsive mRNAs (Supplementary Fig. 1C). Twelve hours of continuous 10 mM sulforaphane stimulation resulted in maximum expression of Hmox1 mRNA, whereas Nqo1 mRNA continued to accumulate even at 24 h (Fig. 2A). Similar kinetics were observed at the protein level using immunoblot (Fig. 2B). Hmox1 protein reached its maximum after 24 h of continuous 10 mM sulforaphane stimulation, and then decreased over the following 24 h, possibly due to feedback regulation. In contrast, the Nqo1 protein continued to accumulate during the 48 h sulforaphane treatment with no sign of downregulation. Sulforaphane treatment (1e10 mM) also induced a dose-dependent increase of the GSH content in the astrocytes (Fig. 3A) and increase in ability to degrade peroxides (Fig. 3B). The sulforaphane-treated astrocytes were also more resistant to superoxide-mediated cell death (Fig. 3C). 3.2. Delayed down regulation of the Nrf2 response in primary astrocytes To simulate the brief sulforaphane exposure expected after ingestion of broccoli (Hu et al., 2004; Ye et al., 2002), we analyzed the induction of Nrf2-responsive mRNA and protein at various time points following transient exposure to 10 mM sulforaphane. When Hmox1 mRNA was followed for totally 24 h after 1e4 h sulforaphane stimulation, the mRNA accumulated during the first 6 h and then declined gradually (Fig. 4A). When Hmox1 protein was analyzed at 18 h after brief sulforaphane stimulations, we found that 4 h sulforaphane stimulation was sufficient to increase Hmox1 to 50% of the levels observed after 18 h continuous stimulation (Fig. 4B). A detailed examination of the kinetics after a 4 h sulforaphane stimulation revealed that the Hmox1 protein continued to increase for the first 16 h and then declined, but remained elevated at 48 h (Fig. 4C), closely following the induction kinetics observed during continuous SF stimulation (Fig. 2B). After 4 h sulforaphane

Fig. 3. Sulforaphane induces glutathione synthesis, peroxide-degrading potential and protection against superoxide damage. Rat astrocytes were treated with 1, 3 or 10 mM sulforaphane (SF) for 24 h and cellular glutathione (A) and ability to degrade hydrogen peroxide (0, 50, 75 mM) (B) were measured. Results are presented as mean  SEM. Microscope images show rat astrocytes pretreated with 3 or 10 mM sulforaphane and stained with the reduced GSH-reactive stain MCB (see Material and Methods). Scale bar ¼ 20 mm. (C) Rat astrocytes were treated with 3 or 10 mM sulforaphane (SF) for 24 h before xanthine (0.5 mM) and xanthine oxidase (44 mU/ml) (X/XO) was added to produce superoxide radicals. Cellular ATP levels, as a marker of cellular viability, were analyzed 24 h after the 1 h superoxide challenge. Results are presented as mean  SD.

348

P. Bergström et al. / Neuropharmacology 60 (2011) 343e353

A

Constant

Hmox1 mRNA fold change

35

SF 1h

30

SF 2h

25

SF 4h

20 15 10 5 0 0

6

12

18

24

stimulation, Nqo1 mRNA again showed slower induction kinetics with no clear sign of down regulation even at 24 h (Fig. 5A) and the Nqo1 protein levels continued to accumulate even at 48 h (Fig. 5B). After transient 10 mM sulforaphane stimulation (1e4 h) the cellular GSH levels remained elevated even at 24 h (Fig. 6A). Stimulation with 3e10 mM sulforaphane for 4 h also increased the cellular capacity to clear peroxides 24 h later (Fig. 6B). As a result, resistance to peroxide remained elevated for 24 h as indicated by the lower percentage of propidium iodide (PI)-permeable cells after a hydrogen peroxide challenge among transiently sulforaphanepretreated cells (Fig. 6C). PI exclusion, a measure of plasma membrane integrity, is a late marker of many forms of cell death. We therefore analyzed resistance to peroxide challenge by measuring cellular ATP content, an early marker of cell death.

Total incubation time (h)

B

A

Hmox1 protein fold change

30

Constant

Nqo1 mRNA fold change

25

10

20 15 10 5

0 Tot. incub. (h)

18

18

18

18

18

18

SF stim. (h)

0

0.5

1

2

4

18

SF 1h

8

SF 2h 6

SF 4h

4

2

C

0

Gapdh

0

Hmox1

24

B

12 SF 4 h 10

Gapdh Nqo1

8 6 4 2 0 0

8

16

24

32

40

48

Nqo1 protein fold change

Hmox1 protein fold change

6 12 18 Total incubation time (h)

SF 4h

3

2

1

Total incubation time (h) Fig. 4. Induction kinetics of Hmox1 mRNA and protein after 4 h sulforaphane stimulation. (A) Rat astrocytes were treated with 10 mM sulforaphane (SF) for 1, 2 or 4 h and Hmox1 mRNA levels were measured by quantitative PCR at 0, 6, 12 and 24 h. As control, rat astrocytes with continuous 10 mM sulforaphane stimulation were included (constant). Results are presented as mean  range. (B) Rat astrocytes were treated with 10 mM sulforaphane (SF) for 0.5, 1, 2 or 4 h and Hmox1 protein levels were analyzed by immunoblot after totally 18 h. As control, rat astrocytes with 18 h continuous 10 mM sulforaphane stimulation were included. Results are presented as mean  range. (C) Kinetics of Hmox1 expression after transient sulforaphane stimulation was assessed by exposing rat astrocytes to 10 mM sulforaphane (SF) for 4 h. Cellular content of Hmox1 protein was analyzed at 4, 8, 12, 16, 24, 28, 32 and 48 h by immunoblot. Results are presented as mean  range.

0 0

6

12

18

24

30

36

42

48

Total incubation time (h) Fig. 5. Short sulforaphane stimulation results in a prolonged induction of Nqo1. (A) Rat astrocytes were treated with 10 mM sulforaphane (SF) for 1, 2 or 4 h and Nqo1 mRNA levels were measured by quantitative PCR at 0, 6, 12 and 24 h. As control, rat astrocytes treated with continuous 10 mM sulforaphane stimulation were included. Results are presented as mean  range. (B) Kinetics of Nqo1 protein expression after short sulforaphane stimulation was assessed by exposing rat astrocytes to 10 mM sulforaphane (SF) for 4 h. Cellular content of Nqo1 protein was analyzed at 12, 16, 24, 28, 32 and 48 h by immunoblot. Results are presented as mean  range.

P. Bergström et al. / Neuropharmacology 60 (2011) 343e353

349

Fig. 6. Short sulforaphane stimulation induces prolonged radical protection. (A) Rat astrocytes were stimulated for 1, 2 or 4 h with 10 mM sulforaphane (SF) and cellular GSH content was measured after totally 24 h. As control, GSH was measured in rat astrocytes under continuous 10 mM sulforaphane treatment for 24 h. Results are presented as mean  SEM. (B) Rat astrocytes were treated for 4 h with 3 or 10 mM sulforaphane (SF) and cellular peroxides were measured after 24 h with or without a 30 min 50 mM hydrogen peroxide challenge. Results are presented as mean  SEM. (C) Rat astrocytes were stimulated for 4 h with 3, 5 or 10 mM sulforaphane (SF) and the percentage propidium iodide (PI)-permeable cells after a 50 mM hydrogen peroxide challenge was analyzed 24 h later (bar graph). Results are presented as mean  SEM. Representative images show rat astrocytes pretreated with 0 or

350

P. Bergström et al. / Neuropharmacology 60 (2011) 343e353

B

8

Nqo1 protein fold change

Nqo1 mRNA fold change

A

6

4

25

20

15

10

2

0 Day 4

5

0 0

4

4

4

4

Day 4

0

4

4

4

4

0

0

4

4

4

Day 3

0

0

4

4

4

Day 3

Day 2

0

0

0

4

4

Day 2

0

0

0

4

4

Day 1

0

0

0

0

4

Day 1

0

0

0

0

4

C

14

D

3

Hmox1 protein fold change

Hmox1 mRNA fold change

12 10 8 6 4

2

1

2 0

0 Day 4

0

4

4

4

4

Day 4

0

4

4

4

4

Day 3

0

0

4

4

4

Day 3

0

0

4

4

4

Day 2

0

0

0

4

4

Day 2

0

0

0

4

4

4

Day 1

0

0

0

0

4

Day 1

0

0

0

0

SF stimulation (h)

SF stimulation (h)

Fig. 7. Repeated daily sulforaphane stimulations result in accumulation of Nqo1. Rat astrocytes were stimulated with 10 mM sulforaphane (SF) for 4 h for the number of days indicated. (A) Nqo1 mRNA was measured with quantitative PCR 4 h after the final sulforaphane stimulation. Results are presented as mean  SD. (B) Nqo1 protein was measured with immunoblot 4 h after the final sulforaphane stimulation. Results are presented as mean  range. (C) Hmox1 mRNA was measured with quantitative PCR 4 h after the final sulforaphane stimulation. Results are presented as mean  SD. (D) Hmox1 protein was measured with immunoblot 4 h after the final sulforaphane stimulation. Results are presented as mean  range.

Consistent with the findings using PI exclusion, resistance to superoxide remained elevated 24 h after a 4 h 3e10 mM sulforaphane stimulation as demonstrated by the relative preservation of cellular ATP content in sulforaphane-prestimulated astrocytes after a superoxide challenge (Fig. 6D). These data demonstrate that the Nrf2 response remains functionally elevated for more than 24 h in primary astrocytes after brief sulforaphane stimulation. 3.3. Repeated daily sulforaphane stimulations mediate sustained protection from superoxide-induced damage Our data indicated that the Nrf2 response remained elevated for more than 24 h after brief sulforaphane treatment. Daily sulforaphane stimulation could therefore result in an

accumulation of Nrf2-induced mRNA and protein and an increased Nrf2 response. To test this possibility we stimulated astrocytes with 10 mM sulforaphane for 4 h per day for up to 4 days. This repeated treatment resulted in a daily accumulation of both Nqo1 mRNA and protein (Fig. 7A, B). In contrast, daily 4 h sulforaphane stimulations increased Hmox1 mRNA the first day but no further increase was observed when the treatment was repeated (Fig. 7C). Hmox1 protein also increased the first day, as expected, but failed to increase over unstimulated levels when the 4 h daily sulforaphane stimulation was repeated (Fig. 7D). However, upon continuous 10 mM stimulation for 24 h also prestimulated astrocytes were able to increase Hmox1 protein although the response was slightly attenuated (Supplementary Fig. 2). GSH remained elevated when 4 h stimulations with

10 mM sulforaphane using phase contrast (PC) and fluorescence representing peroxide (Perox) or propidium iodide and 40 -6-Diamidino-2-phenylindole (PI/DAPI) staining. Scale bar ¼ 20 mm. (D) Rat astrocytes were treated with 3 or 10 mM sulforaphane (SF) for 4 h. Xanthine (0.5 mM) and xanthine oxidase (44 mU/ml) (X/XO) was added 24 h later to produce superoxide radicals. Cellular ATP levels, as a marker of cellular viability, were analyzed 24 h after the 1 h superoxide challenge (open bars). Astrocytes under continuous 10 mM sulforaphane stimulation for 24 h before superoxide challenge were used as control (black bars). Results are presented as mean  SD.

P. Bergström et al. / Neuropharmacology 60 (2011) 343e353

10 mM sulforaphane were repeated but we found no evidence of GSH accumulation (Fig. 8A). Superoxide protection following daily 4 h sulforaphane stimulations remained elevated but showed no sign of potentiation when the stimulation was repeated (Fig. 8B). We conclude that daily sulforaphane stimulations result in an accumulation of Nqo1, continuous induction of GSH, persistent protection from peroxide-induced damage but attenuation of the Nrf2-dependent Hmox1 induction. This potentially explains how intermittent intake of sulforaphane can result in long-term elevation of the radical defense but also points to a possibility that some aspects of the Nrf2 response can be attenuated by repeated sulforaphane stimulations.

GSH fold change

A

0.6

0.4

0.2

0 Day 3

0

24

24

Day 2

0

0

4

Day 1

0

0

0

SF stimulation (h)

ATP fold change

B

1.5

1

0.5

0 X/XO

-

+

+

+

+

+

Day 3

0

0

24

24

24

24

Day 2

0

0

0

4

4

0

Day 1

0

0

0

0

4

4

SF stimulation (h) Fig. 8. Repeated daily sulforaphane stimulations lead to prolonged protection against superoxides. (A) Rat astrocytes were stimulated with 10 mM sulforaphane (SF) for 4 h for the number of days indicated. On day 3, all cells were stimulated with 10 mM sulforaphane for 24 h and analyzed for GSH content. Results are presented as mean  SD. (B) Rat astrocytes were stimulated with 10 mM sulforaphane (SF) for 4 h on the days indicated. After a final 24 h sulforaphane stimulation, astrocytes were exposed to superoxide using xanthine (0.5 mM) and xanthine oxidase (5 mU/ml) (X/ XO) for 1 h and the cells were analyzed for changes in ATP as a marker for cell survival 24 h later. Results are presented as mean  SD.

351

4. Discussion The present study provides a kinetic profile of Nrf2-mediated gene expression following sulforaphane exposure in cultured astrocytes. Sulforaphane stimulation for 4 h induced a long-term Nrf2-dependent increase in Nqo1 and Hmox1, two enzymes important for free radical protection in neurons and astrocytes (Chen et al., 2000; van Muiswinkel et al., 2000). Nqo1 and Hmox1 mRNA remained elevated in astrocytes for 24 h, and the corresponding proteins remained elevated for at least 48 h. In addition, peroxide-clearing activity and GSH levels were elevated for at least 20 h after a transient 4 h sulforaphane stimulation, resulting in an increased resistance to superoxide-induced cell damage. Furthermore, repeated transient sulforaphane stimulation for up to 4 days resulted in an accumulation of Nqo1 and a persistent protection against superoxides. Thus, brief stimulation of the Nrf2 pathway by sulforaphane in cultured astrocytes results in longlasting elevation of endogenous antioxidants that can be maintained and partly built up by repeatedly transient stimulation with sulforaphane. Previous studies in cultured astrocytes have shown that pretreatment for 48 h with sulforaphane upregulates Nqo1 expression and provides protection against oxygen and glucose deprivation (Danilov et al., 2009). As a significant degradation of sulforaphane can be expected during 48 h stimulation, Nrf2 activation is likely limited at late stages of the experiment. By using repeated sulforaphane stimulations the astrocytes are exposed to a high concentration each day, possibly allowing more efficient stimulation of Nqo1 expression. The current study provides a detailed kinetic profile of the change in expression of a number of Nrf2-dependent genes in response to different exposure times to sulforaphane. Furthermore, this study demonstrates that only a brief exposure to sulforaphane is needed to produce long-lasting upregulation of Nqo1 and Hmox1 in cultured astrocytes. Prolonged gene expression has also been observed following sulforaphane treatment in mice, in which a single intraperitoneal injection of sulforaphane crossed the bloodebrain barrier and upregulated Hmox1 levels in the brain for up to 2 days (Innamorato et al., 2008). Importantly, the present study demonstrates Nqo1 accumulation following daily sulforaphane stimulation. The accumulation of Nqo1 protein, a known multi-protective enzyme (Dinkova-Kostova and Talalay, 2010; van Muiswinkel et al., 2000), opens the possibility that the resistance to drugs cleared by Nqo1 will be gradually increased following daily sulforaphane stimulations. In contrast, continuous or repeated daily sulforaphane stimulation did not result in an accumulation of Hmox1 mRNA or protein, despite the fact that Hmox1 protein remained elevated 48 h after a single short sulforaphane stimulation (Fig. 4C). This finding indicates that the Hmox1 response is subject to feedback regulation, possibly to prevent overproduction that might be toxic. Hmox1 mRNA and protein followed biphasic rise-and-fall kinetics during continuous sulforaphane stimulation consistent with feedback regulation (Fig. 2). The prolonged increase in Nrf2-mediated gene expression in response to brief sulforaphane exposure suggests a possible molecular basis underlying free radical-induced hormesis. Hormesis is defined as an adaptive response that protects an organism from noxious stimuli, such as free radicals, when the organism is exposed to submaximal levels of a stimulus (Mattson, 2008a, b). For example, preconditioning with mild non-lethal ischemia and reperfusion protects the brain against subsequent ischemic insults (Dirnagl et al., 2003). The free radicals produced by brief mild ischemia may result in a prolonged activation of Nrf2-mediated gene expression, in turn protecting the brain from toxic levels of free radicals following a subsequent ischemic event. As astrocytes

352

P. Bergström et al. / Neuropharmacology 60 (2011) 343e353

coordinate the upregulation of antioxidant defenses and confer protection to neighboring neurons (Wilson, 1997), it is tempting to hypothesize that astrocytes are key players in hormesis and preconditioning in the brain and constitute the primary target for future Nrf2-stimulating therapy. Our study provides a kinetic insight into how the Nrf2 system might be stimulated to optimize neuroprotection. Many studies have shown that the protective effects of eating broccoli or sulforaphane require a functional Nrf2 response (Iida et al., 2004; Xu et al., 2006) and that even intermittent intake of broccoli induces long-term protection from oxidative DNA damage (van Poppel et al., 1999) and cancer in human subjects. Sulforaphane is absorbed within 1 h and then cleared from the body with a half-life of 2 h (Ye et al., 2002). Our in vitro findings show that the Nrf2 response remains elevated for 24 h after brief stimulation and that some aspects of the response can be enhanced after repeated stimulation with sulforaphane. These observations may provide a molecular basis for how short-term exposure to sulforaphane can provide prolonged protection against free radical-linked disease. Acknowledgements This work was supported by the Swedish Cancer Society, Swedish Research Council, LUA/ALF. Funding at Sahlgrenska University Hospital, Swedish Pain Foundation (SSF), King Gustav V Jubilee Clinic Cancer Research Foundation, Assar Gabrielsson Cancer Research Foundation, Edit Jacobsson Foundation, Axel Linder Foundation, Swedish Stroke Association, Yngve Lands Foundation, Per-Olof Ahl foundation, John and Brit Wennerström foundation and the Sahlgrenska University Hospital Research Foundation. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Appendix. Supplementary material Supplementary data associated with this article can be found in the online version at doi:10.1016/j.neuropharm.2010.09.023. References Alam, J., Stewart, D., Touchard, C., Boinapally, S., Choi, A.M., Cook, J.L., 1999. Nrf2, a cap ‘n’ collar transcription factor, regulates induction of the heme oxygenase1 gene. J. Biol. Chem. 274, 26071e26078. Alam, J., Wicks, C., Stewart, D., Gong, P., Touchard, C., Otterbein, S., Choi, A.M., Burow, M.E., Tou, J., 2000. Mechanism of heme oxygenase-1 gene activation by cadmium in MCF-7 mammary epithelial cells. Role of p38 kinase and Nrf2 transcription factor. J. Biol. Chem. 275, 27694e27702. Benz, C.C., Yau, C., 2008. Ageing, oxidative stress and cancer: paradigms in parallax. Nat. Rev. Cancer 8, 875e879. Burton, N.C., Kensler, T.W., Guilarte, T.R., 2006. In vivo modulation of the Parkinsonian phenotype by Nrf2. Neurotoxicology 27, 1094e1100. Calabrese, V., Guagliano, E., Sapienza, M., Panebianco, M., Calafato, S., Puleo, E., Pennisi, G., Mancuso, C., Butterfield, D.A., Stella, A.G., 2007. Redox regulation of cellular stress response in aging and neurodegenerative disorders: role of vitagenes. Neurochem. Res. 32, 757e773. Calkins, M.J., Jakel, R.J., Johnson, D.A., Chan, K., Kan, Y.W., Johnson, J.A., 2005. Protection from mitochondrial complex II inhibition in vitro and in vivo by Nrf2-mediated transcription. Proc. Natl. Acad. Sci. U S A 102, 244e249. Chan, K., Kan, Y.W., 1999. Nrf2 is essential for protection against acute pulmonary injury in mice. Proc. Natl. Acad. Sci. U S A 96, 12731e12736. Chan, J.Y., Kwong, M., 2000. Impaired expression of glutathione synthetic enzyme genes in mice with targeted deletion of the Nrf2 basic-leucine zipper protein. Biochim. Biophys. Acta 1517, 19e26. Chen, K., Gunter, K., Maines, M.D., 2000. Neurons overexpressing heme oxygenase-1 resist oxidative stress-mediated cell death. J. Neurochem. 75, 304e313. Chen, P.C., Vargas, M.R., Pani, A.K., Smeyne, R.J., Johnson, D.A., Kan, Y.W., Johnson, J.A., 2009. Nrf2-mediated neuroprotection in the MPTP mouse model of Parkinson’s disease: critical role for the astrocyte. Proc. Natl. Acad. Sci. U S A 106, 2933e2938. Copple, I.M., Goldring, C.E., Kitteringham, N.R., Park, B.K., 2008. The Nrf2-Keap1 defence pathway: role in protection against drug-induced toxicity. Toxicology 246, 24e33.

Cullinan, S.B., Gordan, J.D., Jin, J., Harper, J.W., Diehl, J.A., 2004. The Keap1-BTB protein is an adaptor that bridges Nrf2 to a Cul3-based E3 ligase: oxidative stress sensing by a Cul3-Keap1 ligase. Mol. Cell Biol. 24, 8477e8486. Danilov, C.A., Chandrasekaran, K., Racz, J., Soane, L., Zielke, C., Fiskum, G., 2009. Sulforaphane protects astrocytes against oxidative stress and delayed death caused by oxygen and glucose deprivation. Glia 57, 645e656. Dinkova-Kostova, A.T., Massiah, M.A., Bozak, R.E., Hicks, R.J., Talalay, P., 2001. Potency of Michael reaction acceptors as inducers of enzymes that protect against carcinogenesis depends on their reactivity with sulfhydryl groups. Proc. Natl. Acad. Sci. U S A 98, 3404e3409. Dinkova-Kostova, A.T., Talalay, P., 2008. Direct and indirect antioxidant properties of inducers of cytoprotective proteins. Mol. Nutr. Food Res. 52 (Suppl.1), S128eS138. Dinkova-Kostova, A.T., Talalay, P., 2010. NAD(P)H:quinone acceptor oxidoreductase 1 (NQO1), a multifunctional antioxidant enzyme and exceptionally versatile cytoprotector. Arch. Biochem. Biophys 501 (1), 116e123. Dirnagl, U., Simon, R.P., Hallenbeck, J.M., 2003. Ischemic tolerance and endogenous neuroprotection. Trends Neurosci. 26, 248e254. Dringen, R., 2000. Metabolism and functions of glutathione in brain. Prog. Neurobiol. 62, 649e671. Dringen, R., Pfeiffer, B., Hamprecht, B., 1999. Synthesis of the antioxidant glutathione in neurons: supply by astrocytes of CysGly as precursor for neuronal glutathione. J. Neurosci. 19, 562e569. Eggler, A.L., Liu, G., Pezzuto, J.M., van Breemen, R.B., Mesecar, A.D., 2005. Modifying specific cysteines of the electrophile-sensing human Keap1 protein is insufficient to disrupt binding to the Nrf2 domain Neh2. Proc. Natl. Acad. Sci. U S A 102, 10070e10075. Fahey, J.W., Haristoy, X., Dolan, P.M., Kensler, T.W., Scholtus, I., Stephenson, K.K., Talalay, P., Lozniewski, A., 2002. Sulforaphane inhibits extracellular, intracellular, and antibiotic-resistant strains of Helicobacter pylori and prevents benzo [a]pyrene-induced stomach tumors. Proc. Natl. Acad. Sci. U S A 99, 7610e7615. Hirota, A., Kawachi, Y., Itoh, K., Nakamura, Y., Xu, X., Banno, T., Takahashi, T., Yamamoto, M., Otsuka, F., 2005. Ultraviolet A irradiation induces NF-E2-related factor 2 activation in dermal fibroblasts: protective role in UVA-induced apoptosis. J. Invest. Dermatol. 124, 825e832. Hong, F., Freeman, M.L., Liebler, D.C., 2005. Identification of sensor cysteines in human Keap1 modified by the cancer chemopreventive agent sulforaphane. Chem. Res. Toxicol. 18, 1917e1926. Hu, R., Hebbar, V., Kim, B.R., Chen, C., Winnik, B., Buckley, B., Soteropoulos, P., Tolias, P., Hart, R.P., Kong, A.N., 2004. In vivo pharmacokinetics and regulation of gene expression profiles by isothiocyanate sulforaphane in the rat. J. Pharmacol. Exp. Ther. 310, 263e271. Iida, K., Itoh, K., Kumagai, Y., Oyasu, R., Hattori, K., Kawai, K., Shimazui, T., Akaza, H., Yamamoto, M., 2004. Nrf2 is essential for the chemopreventive efficacy of oltipraz against urinary bladder carcinogenesis. Cancer Res. 64, 6424e6431. Innamorato, N.G., Rojo, A.I., Garcia-Yague, A.J., Yamamoto, M., de Ceballos, M.L., Cuadrado, A., 2008. The transcription factor Nrf2 is a therapeutic target against brain inflammation. J. Immunol. 181, 680e689. Ishii, T., Itoh, K., Takahashi, S., Sato, H., Yanagawa, T., Katoh, Y., Bannai, S., Yamamoto, M., 2000. Transcription factor Nrf2 coordinately regulates a group of oxidative stress-inducible genes in macrophages. J. Biol. Chem. 275, 16023e16029. Itoh, K., Chiba, T., Takahashi, S., Ishii, T., Igarashi, K., Katoh, Y., Oyake, T., Hayashi, N., Satoh, K., Hatayama, I., Yamamoto, M., Nabeshima, Y., 1997. An Nrf2/small Maf heterodimer mediates the induction of phase II detoxifying enzyme genes through antioxidant response elements. Biochem. Biophys. Res. Commun. 236, 313e322. Itoh, K., Wakabayashi, N., Katoh, Y., Ishii, T., Igarashi, K., Engel, J.D., Yamamoto, M., 1999. Keap1 represses nuclear activation of antioxidant responsive elements by Nrf2 through binding to the amino-terminal Neh2 domain. Genes Dev. 13, 76e86. Jakel, R.J., Townsend, J.A., Kraft, A.D., Johnson, J.A., 2007. Nrf2-mediated protection against 6-hydroxydopamine. Brain Res. 1144, 192e201. Kaneto, H., Katakami, N., Matsuhisa, M., Matsuoka, T.A., 2010. Role of reactive oxygen species in the progression of type 2 diabetes and atherosclerosis. Mediators Inflamm. 2010 (453892). Kobayashi, A., Kang, M.I., Watai, Y., Tong, K.I., Shibata, T., Uchida, K., Yamamoto, M., 2006. Oxidative and electrophilic stresses activate Nrf2 through inhibition of ubiquitination activity of Keap1. Mol. Cell Biol. 26, 221e229. Kraft, A.D., Johnson, D.A., Johnson, J.A., 2004. Nuclear factor E2-related factor 2dependent antioxidant response element activation by tert-butylhydroquinone and sulforaphane occurring preferentially in astrocytes conditions neurons against oxidative insult. J. Neurosci. 24, 1101e1112. Kuroda, S., Siesjo, B.K., 1997. Reperfusion damage following focal ischemia: pathophysiology and therapeutic windows. Clin. Neurosci. 4, 199e212. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402e408. Mattson, M.P., 2008a. Dietary factors, hormesis and health. Ageing Res. Rev. 7, 43e48. Mattson, M.P., 2008b. Hormesis defined. Ageing Res. Rev. 7, 1e7. Nodin, C., Nilsson, M., Blomstrand, F., 2005. Gap junction blockage limits intercellular spreading of astrocytic apoptosis induced by metabolic depression. J. Neurochem. 94, 1111e1123. Pearson, W.R., Windle, J.J., Morrow, J.F., Benson, A.M., Talalay, P., 1983. Increased synthesis of glutathione S-transferases in response to anticarcinogenic antioxidants. Cloning and measurement of messenger RNA. J. Biol. Chem. 258, 2052e2062.

P. Bergström et al. / Neuropharmacology 60 (2011) 343e353 Petersen, A., Carlsson, T., Karlsson, J.O., Jonhede, S., Zetterberg, M., 2008. Effects of dexamethasone on human lens epithelial cells in culture. Mol. Vis. 14, 1344e1352. Ramos-Gomez, M., Kwak, M.K., Dolan, P.M., Itoh, K., Yamamoto, M., Talalay, P., Kensler, T.W., 2001. Sensitivity to carcinogenesis is increased and chemoprotective efficacy of enzyme inducers is lost in nrf2 transcription factor-deficient mice. Proc. Natl. Acad. Sci. U S A 98, 3410e3415. Rangasamy, T., Cho, C.Y., Thimmulappa, R.K., Zhen, L., Srisuma, S.S., Kensler, T.W., Yamamoto, M., Petrache, I., Tuder, R.M., Biswal, S., 2004. Genetic ablation of Nrf2 enhances susceptibility to cigarette smoke-induced emphysema in mice. J. Clin. Invest. 114, 1248e1259. Rojo, A.I., Rada, P., Egea, J., Rosa, A.O., Lopez, M.G., Cuadrado, A., 2008. Functional interference between glycogen synthase kinase-3 beta and the transcription factor Nrf2 in protection against kainate-induced hippocampal cell death. Mol. Cell Neurosci. 39, 125e132. Shih, A.Y., Johnson, D.A., Wong, G., Kraft, A.D., Jiang, L., Erb, H., Johnson, J.A., Murphy, T.H., 2003. Coordinate regulation of glutathione biosynthesis and release by Nrf2-expressing glia potently protects neurons from oxidative stress. J. Neurosci. 23, 3394e3406. Shih, A.Y., Li, P., Murphy, T.H., 2005. A small-molecule-inducible Nrf2-mediated antioxidant response provides effective prophylaxis against cerebral ischemia in vivo. J. Neurosci. 25, 10321e10335. Siebert, A., Desai, V., Chandrasekaran, K., Fiskum, G., Jafri, M.S., 2009. Nrf2 activators provide neuroprotection against 6-hydroxydopamine toxicity in rat organotypic nigrostriatal cocultures. J. Neurosci. Res. 87, 1659e1669. Talalay, P., Batzinger, R.P., Benson, A.M., Bueding, E., Cha, Y.N., 1978. Biochemical studies on the mechanisms by which dietary antioxidants suppress mutagenic activity. Adv. Enzym. Regul. 17, 23e36. Thoren, A.E., Helps, S.C., Nilsson, M., Sims, N.R., 2005. Astrocytic function assessed from 1-14C-acetate metabolism after temporary focal cerebral ischemia in rats. J. Cereb. Blood Flow Metab. 25, 440e450. Tong, K.I., Kobayashi, A., Katsuoka, F., Yamamoto, M., 2006. Two-site substrate recognition model for the Keap1-Nrf2 system: a hinge and latch mechanism. Biol. Chem. 387, 1311e1320.

353

van Muiswinkel, F.L., Riemers, F.M., Peters, G.J., LaFleur, M.V., Siegel, D., Jongenelen, C.A., Drukarch, B., 2000. l-Dopa stimulates expression of the antioxidant enzyme NAD(P)H:quinone oxidoreductase (NQO) in cultured astroglial cells. Free Radic. Biol. Med. 29, 442e453. van Poppel, G., Verhoeven, D.T., Verhagen, H., Goldbohm, R.A., 1999. Brassica vegetables and cancer prevention. Epidemiology and mechanisms. Adv. Exp. Med. Biol. 472, 159e168. Vargas, M.R., Johnson, J.A., 2009. The Nrf2-ARE cytoprotective pathway in astrocytes. Expert Rev. Mol. Med. 11, e17. Vargas, M.R., Johnson, D.A., Sirkis, D.W., Messing, A., Johnson, J.A., 2008. Nrf2 activation in astrocytes protects against neurodegeneration in mouse models of familial amyotrophic lateral sclerosis. J. Neurosci. 28, 13574e13581. Venugopal, R., Jaiswal, A.K., 1996. Nrf1 and Nrf2 positively and c-Fos and Fra1 negatively regulate the human antioxidant response element-mediated expression of NAD(P)H:quinone oxidoreductase1 gene. Proc. Natl. Acad. Sci. U S A 93, 14960e14965. Wilson, J.X., 1997. Antioxidant defense of the brain: a role for astrocytes. Can. J. Physiol. Pharmacol. 75, 1149e1163. Xu, C., Huang, M.T., Shen, G., Yuan, X., Lin, W., Khor, T.O., Conney, A.H., Kong, A.N., 2006. Inhibition of 7,12-dimethylbenz(a)anthracene-induced skin tumorigenesis in C57BL/6 mice by sulforaphane is mediated by nuclear factor E2-related factor 2. Cancer Res. 66, 8293e8296. Yamamoto, T., Suzuki, T., Kobayashi, A., Wakabayashi, J., Maher, J., Motohashi, H., Yamamoto, M., 2008. Physiological significance of reactive cysteine residues of Keap1 in determining Nrf2 activity. Mol. Cell Biol. 28, 2758e2770. Ye, L., Dinkova-Kostova, A.T., Wade, K.L., Zhang, Y., Shapiro, T.A., Talalay, P., 2002. Quantitative determination of dithiocarbamates in human plasma, serum, erythrocytes and urine: pharmacokinetics of broccoli sprout isothiocyanates in humans. Clin. Chim. Acta 316, 43e53. Zhang, Y., Kensler, T.W., Cho, C.G., Posner, G.H., Talalay, P., 1994. Anticarcinogenic activities of sulforaphane and structurally related synthetic norbornyl isothiocyanates. Proc. Natl. Acad. Sci. U S A 91, 3147e3150. Zhao, J., Kobori, N., Aronowski, J., Dash, P.K., 2006. Sulforaphane reduces infarct volume following focal cerebral ischemia in rodents. Neurosci. Lett. 393,108e112.