- Email: [email protected]
Replication and transcription of viral RNAs by recombinant L proteins of New Jersey serotype of vesicular stomatitis virus
Virus Research 90 (2002) 347 /364 www.elsevier.com/locate/virusres
Replication and transcription of viral RNAs by recombinant L proteins of New Jersey serotype of vesicular stomatitis virus Gyoung Nyoun Kim, Woo-young Choi 1, Manhoon Park 2, C. Yong Kang * Department of Microbiology and Immunology, Faculty of Medicine and Dentistry, Siebens-Drake Research Institute, University of Western Ontario, London, Ont., Canada N6G 2V4 Received 23 August 2002; received in revised form 10 September 2002; accepted 10 September 2002
Abstract The large (L) protein of vesicular stomatitis virus (VSV), catalytic subunit of RNA-dependent RNA polymerase is responsible for the transcription and replication of VSV. The L protein of the Indiana serotype of VSV (VSVInd) has previously been cloned and expressed, and used in the reverse genetics of VSVInd. However, the cDNA clones expressing functional L proteins of the VSVNJ serotype were not available. It was necessary to obtain functional clones of the New Jersey serotype of VSV (VSVNJ) in order to study homologous viral interference. Here we report the cDNA cloning, expression, and functional analyses of L proteins from both the Hazelhurst subtype and Concan subtype of VSVNJ. The analysis of the expressed L proteins for the transcription and replication of VSV demonstrate that both VSVNJ L clones express functional RNA-dependent RNA polymerase. # 2002 Elsevier Science B.V. All rights reserved. Keywords: Vesicular stomatitis virus; New Jersey serotype; L protein; RNA-dependent RNA polymerase; RNA synthesis
1. Introduction Vesicular stomatitis virus (VSV) is a prototypic rhabdovirus, which has long been studied to understand the biology of the viruses that belong * Corresponding author. Tel.: /1-519-661-3226; fax: /1519-661-3359 E-mail address: [email protected] (C.Y. Kang). 1 Present address: Department of Virology, National Institute of Health, Ministry of Health and Welfare, NokbunDong, Eunpyung-Gu, Seoul 122-701, South Korea. 2 Present address: Mogam Biotechnology Research Institute, 341 Pajung-Ri, Koonsung-Myon, Yongin-Kun, Kyonggi-Do 449-910, South Korea.
to the family Rhabdoviridae . VSV has two different serotypes: Indiana (VSVInd) and New Jersey (VSVNJ; Cartwright and Brown, 1972). Five isolates of the VSVNJ serotype were grouped into two subtypes: Hazelhurst, which includes Hazelhurst (VSVNJ-Haz), Guatemala (VSVGua), and Missouri (VSVMis) isolates, and Concan, which includes Concan (VSVNJ-Con) and Ogden (VSVOgd) isolates. The classification of VSVNJ was based on reciprocal differences in antibody neutralization of virion infectivity, nucleotide base sequence homology, oligonucleotide maps of virion RNA, and interference by defective interfering (DI) particles (Reichmann et al., 1978).
0168-1702/02/$ - see front matter # 2002 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 8 - 1 7 0 2 ( 0 2 ) 0 0 2 5 5 - 1
348
G.N. Kim et al. / Virus Research 90 (2002) 347 /364
VSV is a negative-stranded, non-segmented RNA virus whose genome encodes five viral proteins; N, P, M, G, and L (Kang and Prevec, 1969; Wagner et al., 1969). The proteins are expressed through the transcription of monocistronic mRNAs from a negative-sense genomic RNA tightly encapsidated with N protein (RNA /N protein complex). The RNA /N protein complex is associated with the VSV RNA-dependent RNA polymerase complex (P and L) in the virion and also in infected cells (Emerson and Yu, 1975). In the polymerase complex, L protein functions as a catalytic subunit, which is involved not only in the synthesis of full-length negative sense genomic and positive sense antigenomic RNA (replication) but also in the synthesis of monocistronic mRNAs (transcription; Emerson and Wagner, 1973; Emerson and Yu, 1975; Moyer and Banerjee, 1975). Posttranscriptional modifications of mRNAs such as 5? capping, methylation, and 3? polyadenylation are believed to be carried out by the L protein (Herman et al., 1980; Horikami et al., 1984; Horikami and Moyer, 1982; Schubert and Lazzarini, 1981; Testa and Banerjee, 1977). Even with these important functions of L protein in the VSV life cycle, the L protein is the least studied among the VSV proteins. The VSV L gene occupies approximately 60% of the virus genome. The 2109 amino acid long polypeptide, with a molecular mass of 241 kDa, is translated from 6380 bases of mRNA from VSVInd L and 6398 bases of mRNA from VSVNJ (Barik et al., 1990; Feldhaus and Lesnaw, 1988; Schubert et al., 1984). The size of the open reading frame (ORF) in the L gene is 6330 bases, which is the same in both serotypes. In 1984, Schubert et al. constructed a complete cDNA clone of the VSVInd L gene and analyzed the primary structure (Schubert et al., 1984). A full-length cDNA of the VSVInd L gene was assembled with five overlapping subclones to avoid the introduction of possible mutations in this large gene. The expected size was confirmed by expression of [35S]methionine-labelled recombinant L protein from cDNA in COS cells. The recombinant L protein was functional in transcription and replication as confirmed by rescue of a temperature-sensitive L gene mutant of VSVInd at the
nonpermissive temperature (Schubert et al., 1985). The primary structures of the L genes from the VSVNJ-Mis and VSVNJ-Ogd were also determined in 1988 and 1990, respectively (Barik et al., 1990; Feldhaus and Lesnaw, 1988). Due to the method employed for the sequencing of the VSVNJ L genes, using genomic RNAs of VSVNJ as templates for the sequencing, functional cDNA clones of VSVNJ L genes, which would be useful for the genetic analysis of VSVNJ, have not been constructed. After primary transcription of mRNAs and accumulation of stoichiometric quantities of N, P, and L proteins, the transcription mode is switched to the replication mode (Blumberg and Kolakofsky, 1981). It has been proposed that two different polymerase complexes are involved in transcription and replication, L-P3 as a transcriptase and L /(N /P) as a replicase (Das et al., 1997). Replication includes encapsidation of the positive sense leader sequence that leads to the synthesis of full-length positive sense antigenomic RNA encapsidated with the N protein and full-length negative sense genomic RNA synthesis from the antigenomic positive sense RNA. For the synthesis of negative sense genomic RNA from the positive sense antigenome, 3? terminal sequences of the positive sense antigenome are used as a promoter (Li and Pattnaik, 1997). We have been studying the homologous viral interference mediated by DI particles from both serotypes of VSV in our lab. Previous results reported by ourselves (Choi, 1997; Prevec and Kang, 1970) and by others (Khan and Lazzarini, 1977; Reichmann et al., 1978) indicated that DI particles from the two serotypes had different heterotypic interference activities. VSVInd DI particles interfered with the replication of both VSVInd and VSVNJ, but VSVNJ DI particles interfered with the replication of only VSVNJ standard virus. The results suggested that DI particles from the two serotypes use heterotypic viral proteins differently for replication and/or assembly. The different heterotypic interference properties may have been the result of differing efficiencies with which the promoters of the DI particle genomes to use the heterotypic polymerase complex. To address these issues, we require
G.N. Kim et al. / Virus Research 90 (2002) 347 /364
functional cDNA clones of VSVNJ L protein. In this report, we demonstrate that the construction and expression of cDNA clones of VSVNJ L genes from VSVNJ-Haz and VSVNJ-Ogd were successful and that the recombinant VSVNJ L proteins are enzymatically functional both in transcription of a reporter gene and in replication of VSVNJ DI particle genomes.
2. Materials and methods 2.1. Cell culture BHK-21 cells were obtained from the American Type Culture Collection (ATCC). Human thymidine kinase-negative 143 B (TK 143) cells (Rhim et al., 1975) were obtained from Dr K. Wright (University of Ottawa, Ottawa). BHK-21 cells and TK 143 cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 5% fetal calf serum (Gibco BRL), 100 U/ml of penicillin, 100 mg/ml of streptomycin and kanamycin, and 2 mM L-glutamine. 2.2. Virus preparation, purification of DI particles, and antibodies
349
the fourth undiluted passage, culture fluid was harvested at 18 h postinfection. Cellular debris was removed by centrifugation at 2240/g, 4 8C for 10 min. VSVNJ-Ogd standard virus and DI particles were collected by ultracentrifugation at 151 000 / g in a Beckman SW41 rotor, 4 8C for 1 h. The viral pellet was resuspended in TNE buffer (10 mM Tris-HCl, pH 7.4, 100 mM NaCl, 1 mM EDTA). Putative VSVNJ-Ogd DI particles were separated from the standard virus by centrifugation using a 5 /30% (wt/vol) linear sucrose gradient. A DI particle band was collected carefully by side puncturing the centrifuge tube. Genomic RNA of the newly generated DI particle was isolated for cloning. Rabbit polyclonal antibodies against total proteins of VSVNJ-Haz, and VSVNJ-Ogd were produced previously in our lab (Choi, 1997). Polyclonal antibody against VSVNJ L protein was raised in a rabbit using 18 amino acid long synthetic peptide conjugated with keyhole limpet haemocyanin (KLH). The region from which the peptide was synthesized is located between amino acids 1946 and 1964: NH2-IRTTDSMPGPPSDGDVNKCOOH and is conserved in both VSVNJ-Haz L and VSVNJ-Ogd L proteins. 2.3. RNA isolation
VSVNJ-Haz was originally obtained from Dr S. Emerson (National Institutes of Health, Bethesda). VSVNJ-Ogd was obtained from Dr L. Prevec (McMaster University, Hamilton). All strains of VSVNJ were plaque purified at least three times, and amplified by infecting BHK-21 cells with a multiplicity of infection (MOI) of 0.1. Recombinant vaccinia virus vTF7-3 (Fuerst et al., 1986) was obtained from Dr B. Moss (National Institute of Health, Bethesda). vTF7-3 was prepared as described by Mackett et al. (Mackett et al., 1985). For the generation of new DI particles from the VSVNJ-Ogd, BHK-21 cells in 100 mm culture dishes were infected with a MOI of 50 with VSVNJ-Ogd. Culture media was harvested at 18 h post-infection and passed three more times. For the second to fourth infections, 1 ml of harvested culture medium from the previous infection was used to infect fresh BHK-21 cells in a 100 mm culture dish. After
For the cloning of L genes of VSVNJ-Haz and VSVNJ-Ogd, total mRNA was isolated from BHK21 cells infected with VSVNJ-Haz or VSVNJ-Ogd. BHK-21 cells from 100 mm culture dishes were infected with a MOI of 10 with VSVNJ-Haz or VSVNJ-Ogd in the presence of 2 mg/ml Actinomycin D (Act D: Sigma-Aldrich). At 5 h postinfection, the infected cells were harvested and total mRNA was isolated using the FasTrackTM 2.0 kit (Invitrogen), according to the manufacture’s manual. 1.4 mg of isolated total mRNA was used for cDNA synthesis using revere transcriptase (RT). Genomic RNAs from VSVNJ-Ogd DI particles were isolated from purified DI particles. After separation of DI particles from the standard virus by density gradient centrifugation using a 5 /30% linear sucrose gradient, the DI particles were collected from the gradient and resuspended in TNE buffer and concentrated by ultracentrifuga-
350
G.N. Kim et al. / Virus Research 90 (2002) 347 /364
tion at 151 000/g for 1 h, at 4 8C using a Beckman SW41 rotor. The concentrated DI particles were disrupted with 300 ml of lysis buffer-2 (10 mM Tris-HCl, pH 7.4, 1% Nonidet P-40, 0.4% Na-deoxycholate, 10 mM Na2EDTA). RNAs were extracted from the lysate with an equivalent volume of phenol/chloroform/isoamylalcohol. RNAs in the aqueous phase were precipitated by adding 0.5 vol of 7.5 mM ammonium acetate and 2 vol of 100% ethanol. RNA was pelleted by centrifugation at 14 500 /g for 15 min, at 4 8C and resuspended in 10 ml of DEPC-treated dH2O. Isolation of VSVNJ DI particle RNAs, containing 2322 bases of bacteriophage l sequences in the middle of the genome (DI-l), from the transfected cells were carried out by immunoprecipitation of encapsidated RNAs by adding 5 ml of antibody against VSVNJ-Haz or VSVNJ-Ogd to 400 ml of transfected cellular extract. After overnight incubation at 4 8C, antibody /RNP complex was brought down by adding 50 ml of protein Asepharose CL 4B (at 50 mg/ml in the lysis buffer-2 containing 0.1% SDS) followed by 1 h incubation at 4 8C. The antibody /RNP /protein A sepharose complex was pelleted and washed three times with washing solution (lysis buffer-2 containing 0.1% SDS and 150 mM NaCl) and resuspended in 200 ml of 10 mM Tris-HCl, pH 7.4, 100 mM NaCl, 1 mM EDTA, and 0.5% SDS. Heating the immunecomplex in a boiling water-bath eluted the immunoprecipitated RNP. RNA was extracted from the RNP with phenol/chloroform/isoamylalcohol. The extracted RNA was resuspended in 2.5 ml of DEPC-treated dH2O and mixed with 8.5 ml of RNA sample buffer (10 ml of deionized formamide, 3.5 ml of 37% formaldehyde, 2 ml of 10X MOPs) and 1 ml of loading buffer (50% glycerol, 1 mM Na2 EDTA, and 0.4% Bromphenol blue) to a total volume of 12 ml. 2.4. Reverse transcription and polymerase chain reaction Reverse transcription was carried out using the SuperScriptTM II system (Gibco BRL/Invitrogen) according to the manufacturer’s protocol. Two microliters (out of 20 ml) of the first strand cDNA reaction mixture was used for amplification of
double stranded DNA by PCR. PCR was carried out using pfu DNA polymerase (Stratagene) according to the manufacturer’s protocol. 2.5. Construction and preparation of plasmids The cDNA cloning of DI particles from VSVNJOgd (ODI) genomic RNA and construction of pTV-HDI-l (/) and pTV-ODI-l (/): A cDNA clone of DI particles from VSVNJ-Haz (HDI) genome in the pGEM-derived transcription vector (pTV) was previously constructed in our lab. The complete sequence of the HDI genome was analyzed and submitted to Genbank (Accession No: AY102918). pTV was kindly provided by Dr Andrew Ball (University of Alabama, Birmingham). pTV contains a copy of the T7 transcriptional promoter, the hepatitis delta virus (HDV) ribozyme encoding sequence, and the T7 transcriptional terminator. cDNA of wild type HDI was inserted between the T7 transcriptional promoter and HDV ribozyme encoding sequences in an orientation such that T7 transcripts contained positive sense antigenomic RNA of the VSVNJ HDI particle. The resultant cDNA clone was named pTV-HDI(/). pTV-HDI(/) was used for the construction of pTV-HDI-l(/) and pTVODI(/). A new panhandle type DI particle from the VSVNJ-Ogd isolate (ODI) was generated and cDNA representing its genomic RNA was cloned into pBluescript II KS by RT-PCR using the primer VSV NJ. First strand cDNA of the ODI genome was synthesized using a primer, VSV NJ, which was complementary to the 3? end of VSVNJ DI particle. Since 3? and 5? genomic end sequences of the VSVNJ DI particles were inversely complementary, the primer VSV NJ bound to the 3? and 5? ends of the template. Therefore, the same primer, VSV NJ, was used for the amplification of double stranded DI particle DNA by PCR. The clone was designated as pBKS-ODI. The genomic structure of ODI was determined by cDNA sequencing and the sequence was submitted to Genbank (Accession No.: AY102919). pTV-ODI(/) was generated by replacing the majority of HDI sequences in the pTV-HDI(/) with sequences of ODI. DNA sequences of the HDI genome were excised from
G.N. Kim et al. / Virus Research 90 (2002) 347 /364
pTV-HDI(/) by digesting with Bbs I , whose recognition sequences are located close to the genomic ends of both DI particles. There was an additional Bbs I site in the ODI genomic sequence, therefore, intact sequences of ODI were excised from pBKS-ODI by partial digestion with Bbs I. The DNA clone of the HDI genome containing bacteriophage l sequences, TV-HDI-l(/), was constructed by substituting the internal region of the HDI cDNA sequence with a 2322 base pair long Hind III fragment from bacteriophage l DNA. pTV-HDI(/) was digested with Afl II and EcoR V , which resulted in removal of most of the internal region of wild type VSVNJ HDI particle cDNA except for 227 nucleotides and 188 nucleotides representing the 5? and 3? genomic termini. After filling in the 3? recessed Afl II and Hind III termini with DNA polymerase I Klenow fragment (United States Biochemical corp.), the two DNA fragments were ligated and used to transform DH5a competent cells (Gibco-BRL/Invitrogen). The construct was named pTV-HDI-l(/). pTVODI-l(/) was also constructed by replacing internal sequences of the wild type DI particle with the same bacteriophage l sequences after digestion of ODI cDNA with EcoR V . pTV-ODIl(/) contains 99 nucleotides and 230 nucleotides representing the 5? and 3? ends, respectively, of the genomic RNA of ODI. The Hind III fragment of l DNA was oriented such that position 25 157 of l DNA followed the DI particle genomic end sequences immediately after the T7 transcriptional promoter. Plasmids encoding the minigenome of Ind/CAT (pTV-Ind/CAT) and VSV N and P proteins (pBKS-IN, -IP, -HN, -HP, -ON, -OP) were constructed previously in our lab (Choi, 1997). pGem4-IL expressing the L protein of VSVInd was kindly provided by Dr M. Schubert (National institute of health, Bethesda). Construction of pBKS-l E/E1 and pBKS-l E/ E2: As templates for the synthesis of riboprobes, a 717 bp long l DNA fragment located in the 2322 bp long Hind III fragment of l DNA was cloned into pBluescript II KS vector in both directions. The 717 bp l DNA clone in which the l sequence was inserted in the opposite orientation with respect to the l DNA in the pTV-DI-l was
351
designated pBKS-l E/E1. The clone which contains the l DNA in the same orientation with respect to that in pTV-DI-l was designated pBKSl E/E2.
2.6. Preparation of riboprobe The l sequence specific riboprobes (l E/E1 and l E/E2) were synthesized from the linearized pBKS-l E/E1 and pBKS-l E/E2 using the Riboprobe in vitro transcription system (Melton et al., 1984) (Promega) according to the manufacturer’s protocol. [a-32P]CTP (50 mCi at 10 mCi/ml) (NEN) was added to the in vitro transcription reaction to label the riboprobe. After dissolving the riboprobe in the DEPC treated dH2O, total incorporated cpm per total mg of synthesized RNA was determined. The proper volume of riboprobes containing total 6.25 /106 cpm was used for Northern blot analysis.
2.7. DNA transfection Transfection was carried out using Lipofectin (Gibco-BRL/Invitrogen), according to the manufacturer’s protocol. The cells were transfected with 6 mg of pBKS-N, 3 mg of pBKS-P, 1 mg of pBKSL, 5 mg of pTV-NJ DI-l or pTV-Ind/CAT. To examine the expression of VSVNJ-Haz L and VSVNJ-Ogd L proteins from cDNA clones, 6 mg of pBKS-HL or pBKS-OL was transfected into vTF7-3 infected cells in a 60 mm culture dish.
2.8. CAT assay The CAT assay was carried out using the CAT enzyme assay system (Cullen, 1987) according to the manufacturer’s manual (Promega). Briefly, 100 ml of cell lysate of transfected cells and 3 ml of [14C]chloramphenicol (at 0.05 mCi/ml; NEN) was added to 125 ml of reaction solution. Cell lysates were incubated in a reaction mix containing [14C] chloramphenicol and n -Butyryl Coenzyme A (n Butyryl CoA). CAT activity was determined by liquid scintillation counting (LSC) assay.
352
G.N. Kim et al. / Virus Research 90 (2002) 347 /364
2.9. Northern blot analysis After completion of gel electrophoresis, RNAs were transferred to a Zeta probe nylon membrane (BioRad) using a PosiBlot 30-30 pressure blotter (Stratagene). RNAs on the membrane were crosslinked with a Stratalinker UV crosslinker (Stratagene). The membrane was washed once with DEPC-treated dH2O and soaked in 2X SSC (0.3 M NaCl, 30 mM sodium citrate-trisodium salt) before hybridization. The washed membrane was prehybridized in 5 ml of QuikHyb hybridization solution (Stratagene) for 15 min at 60 8C. About 6.25 /106 cpm of riboprobe (l-E/E1 or l-E/E2) and 1 mg of sonicated salmon sperm DNA were added to the hybridization solution and the membrane was incubated for 1 h. The membrane was washed four times with three changes of washing solutions. The membrane was first washed twice with 2X SSC solution containing 0.1% SDS at 60 8C for 15 min each, followed by washing with 1X SSC (0.15 M NaCl, 15 mM sodium citrate-trisodium salt) containing 0.1% SDS at the same temperature for 30 min. For the last wash, 0.1X SSC (0.015 M NaCl, 1.5 mM sodium citrate-trisodium salt) containing 0.1% SDS was used. The membrane was soaked once briefly in 2X SSC and RNA bands were detected by autoradiography.
3. Results 3.1. The cDNA cloning of the L genes of VSVNJHaz and VSVNJ-Ogd For construction of the VSVNJ-Haz L gene cDNA, first strand cDNA was synthesized by RT-PCR. Six different oligonucleotide primers (Table 1A) that are complementary to various regions of VSVNJ-Haz L mRNA were used for reverse transcription (Fig. 1A). Six separate double-stranded DNA fragments of the VSVNJ-Haz L gene were amplified from each RT product by adding HL-1 and HL-2 primers (Table 1A) in the PCR reaction. To generate six subclones, the Not I site was introduced into the HL-1 primers, and the Xho I site was introduced into the HL-2 primers.
Table 1 Primers used for the construction of cDNA clones of VSVNJ L genes, VSVNJ ODI genome, and DNA sequencing Primers
5?
A HL HL HL HL HL HL HL HL HL HL HL HL
GGAAAGCGGCCGCCATGGATTTCAACTTTTGAA GGAAAGCGGCCGCCGAATCTTGGAGCAGTG GGAAAGCGGCCGCATCCATCACTCATAGAAAG GGAAAGCGGCCGCCAGAAATTCTTTAAAAGGA GGAAAGCGGCCGCTGCTGTCAAGTAATCCAT GGAAAGCGGCCGCAAAGATATCAAAGATGAATTC GGAAACTCGAGCAAATAGGTTCAATCATTTTT GGAAACTCGAGATGTACCGTTTCTAATAGT GGAAACTCGAGATATCTCACTCTTGATTATC GGAAACTCGAGCTTAGTTTATCAATGAGGTA GGAAACTCGAGCTATTTGAAACAGTGTTTC GGAAACTCGAGTCAATTTTGCCAAGCTTG
1-1 2-1 3-1 4-1 5-1 6-1 1-2 2-2 3-2 4-2 5-2 6-2
B OL 5? OL 3?
GGGCGGCCGCACAGGAATCAACATGGATTTC GGGCGGCCGCGATCAATTTTGCCAAGCTTG
C VSV NJ
GGGCGGCCGCCGTACGAAGACAAAAAAACCA
D M13 Forward M13 Reverse TV-A TV-B
CGGCCAGGGTTTTCCCAGTCACGAC TCACACAGGAAACAGCTATGAC GAGGAAGCGGAAGAGCGCGCCC CAGCCGGATCCGAGCTCTCC
(A) Primers used for the cDNA cloning of VSVNJ-Haz L gene. (B) Primers used for the cDNA cloning of VSVNJ-Ogd L gene. (C) Primer for the amplification and cloning of VSVNJ DI cDNA by RT-PCR. (D) Primers used for cDNA sequencing. M13 forward and M13 reverse primers were used for the sequencing of cDNA clones in the pBluescript II KS vector. Primers, TV-A and TV-B were used for the sequencing of cDNA clones made in the transcription vector, pTV. Not I : GCGGCCG; Xho I : CTCGAG.
Both restriction enzyme recognition (RE) sites were not present in the VSVNJ-Haz L gene. The absence of these RE sites was determined by examining the sequence of the VSVNJ-Mis L gene reported previously (Feldhaus and Lesnaw, 1988) and from our own previous cDNA clone of VSVNJ-Haz L (unpublished data). The six PCR products of the VSVNJ-Haz L gene were digested with the REs Not I and Xho I , whose recognition sites were introduced at the ends of the PCR products. The products were inserted into the pBluescript II KS (Stratagene), which was also cut with the same enzymes. Assembly of the six fragments into a full-length
3?
G.N. Kim et al. / Virus Research 90 (2002) 347 /364
353
Fig. 1. Schematic representation of cloning of VSVNJ L genes. (A) Cloning of VSVNJ-Haz L gene. Not I , in the beginning, and Xho I sites at the end of each PCR product were used for subcloning. Nde I , Aat II , Bgel II , BspM I , and Sma I sites at the end of each sublone and a Xho I site in the vector were used to assemble the full-length clone of VSVNJ-Haz L gene. Nucleotide positions of the RE sites used for the full length cDNA cloning are shown in the parenthesis. Numbers with small arrows immediately over and under the open box indicate primers used for the RT-PCR. The size of each product is shown as numbers in the open box. Numbers in the circle indicate the order of assembly for the cloning of full-length VSVNJ-Haz L gene. (B) Schematic representation of cloning of VSVNJ-Ogd L gene and subcloning for the cDNA sequencing. Not I sites at the ends of the cDNA were used for the cloning of the full-length VSVNJOgd L gene. RE sites under the open bar were used for the construction of eight subclones.
cDNA of the VSVNJ-Haz L gene was accomplished by adding each fragment sequentially from subclone one to six using RE sites located in the overlapping regions at the ends of each fragment. For instance, the second fragment was excised from pBluescript II KS with Nde I and Xho I , and ligated to the first fragment, which was also cut with the same enzymes. The Aat II site at the end of the second fragment and beginning of the third fragment was used to add the third fragment (Fig. 1A) and so on. The full-length cDNA clone of VSVNJ-Haz L gene was named pBKS-HL. First strand cDNA of VSVNJ-Ogd L mRNA was synthesized using a single primer, OL 3? which was
complementary to the 3? end of VSVNJ-Ogd L mRNA (Table 1B). Double-stranded full-length cDNA of the VSVNJ-Ogd L gene was amplified by PCR using the primers OL 5? and OL 3?, which were complementary to the 5? and 3? end of mRNA and contained Not I recognition site (Table 1B). The full-length PCR product of the VSVNJ-Ogd L gene was cut with Not I and cloned into the pBluescript II KS as well, and named pBKS-OL. L genes in pBluescript II KS are under the control of the T7 promoter. Six subclones of the VSVNJ-Haz L gene in pBKS vector were used to obtain the full-length nucleotide sequence. For nucleotide sequence analysis of
354
G.N. Kim et al. / Virus Research 90 (2002) 347 /364
VSVNJ-Ogd L gene, eight subclones were constructed in pBluescript II KS from the full-length clone of pBKS-OL. RE sites utilized for the subcloning are illustrated in Fig. 1B. 3.2. Comparison of nucleotide sequences and amino acid sequences between the previously published VSVNJ L and our new VSVNJ L The L genes of VSVNJ-Mis and VSVNJ-Ogd in their respective RNA genomes have been sequenced previously using the primer extension/ dideoxy chain termination method without cDNA cloning (Barik et al., 1990; Feldhaus and Lesnaw, 1988). Therefore, the previously reported nucleotide and deduced amino acid sequences in the ORF of VSVNJ-Mis L and VSVNJ-Ogd L were compared with those of our new VSVNJ-Haz L and VSVNJ-Ogd L cDNAs. The previous VSVNJ L gene sequence of the Hazelhurst subtype was obtained using genomic RNA from Missouri isolate while our new VSVNJ L sequence of Hazelhurst subtype is from the Hazelhurst isolate. Both VSVNJ-Ogd L sequences are derived from the same Ogden isolate. Previous VSVInd L gene sequence analyses using cDNAs from two different strains demonstrated that the frequency of mutation in the same strain was approximately 1/ 103 and that between different strains was 2.5 /103 (Schubert et al., 1984). Therefore, we expected more nucleotide and amino acid sequence differences in VSVNJ-Haz L and VSVNJ-Mis L than in VSVNJ-Ogd L. The nucleotide sequence of our new VSVNJ-Haz L (Genbank accession No.: AY074803) gene showed 96.4% identity with the previously reported nucleotide sequences of the VSVNJ-Mis L ORF, with 231 nucleotide differences. There were two nucleotide insertions and two nucleotide deletions in the VSVNJ-Haz L gene when compared with the nucleotide sequence of VSVNJ-Mis. The deletions and insertions were separated by ten nucleotides between nucleotide positions 2754 and 2765, and by nine nucleotides between the nucleotide positions 5750 and 5760. Amino acid sequences of VSVNJ-Haz and VSVNJMis L had 96.9% identity (160 amino acid differences out of 2109 amino acids; Fig. 2) and 97.3% similarity. Our previously reported sequence
(Barik et al., 1990) and our new nucleotide sequence of the VSVNJ-Ogd L gene (Genbank accession No.: AY074804) had 99.2% identity, with only 52 nucleotide differences, two nucleotide insertions at positions 685 and 2792, and two nucleotide deletions at positions 703 and 2804. VSVNJ-Ogd L proteins had 98.5% identity (32 amino acid differences out of 2109 amino acids; Fig. 2) and 98.7% similarity in their amino acid sequences. 3.3. Expression of VSVNJ-Haz L and VSVNJ-Ogd L from cDNA clones Although the cDNA sequence analysis of our VSVNJ L genes revealed that there was no introduction of translational stop codons in the middle of the ORF, we wanted to confirm that recombinant VSVNJ L proteins were expressed at the expected sizes of 241 kDa. The full-length clones of the L genes of VSVNJ-Haz and VSVNJ-Ogd in pBluescript II KS (pBKS-HL and pBKS-OL) were used for the expression of the protein (Fig. 3A). The L genes were inserted downstream of the T7 transcriptional promoter. The molecular mass of VSV L was deduced from the number of amino acids (2109 amino acids), which is the same for the L proteins of VSVInd and VSVNJ (Barik et al., 1990; Feldhaus and Lesnaw, 1988; Schubert et al., 1984). To examine the expression of the 241 kDa recombinant L proteins of VSVNJ-Haz and VSVNJ-Ogd, BHK-21 cells were infected with recombinant vaccinia virus (vTF7-3), which supplied T7 RNA polymerase for the transcription of the L gene mRNA. The infected cells were transfected with pBKS-HL, pBKS-OL, or an empty vector, pBKS. The transfected cells were labelled with [35S]methionine for 2 h at 24 h post-transfection. After lysis of the [35S]methionine labelled cells, monospecific polyclonal antibody raised against the carboxy terminal region of the L protein was added to the cytoplasmic extract. The immunoprecipitates were brought down with protein-A sepharose CL 4B, boiled in 25 ml of protein sample buffer, and analyzed by 10% SDS-PAGE. To confirm the size of the L proteins expressed from the cDNA, BHK-21 cells infected with standard
G.N. Kim et al. / Virus Research 90 (2002) 347 /364
355
Fig. 2. Comparison of amino acid sequences between previously published VSVNJ L proteins and two new VSVNJ L. Amino acid sequences of the new VSVNJ-Ogd L (Ogd-1) are written in full length. Previously published amino acid sequences of VSVNJ-Ogd L (Ogd2), new VSVNJ-Haz L (Haz), and previously published VSVNJ-Mis L (Mis) are shown. Amino acid sequences that are different from the Ogd-1 are typed in bold; the same amino acid sequences to the Ogd-1 are shown as dots.
viruses, VSVNJ-Haz or VSVNJ-Ogd, were labelled for 2 h at 3 h post-infection. The L proteins expressed by the standard viruses were immunoprecipitated using the same antibody against L protein. The L gene clones expressed proteins equivalent to the size of 241 kDa (Fig. 3B, lanes 3 and 4), which were the same in size as the proteins expressed in cells infected with the standard viruses (Fig. 3B, lanes 1 and 2). The protein was not detected in cells transfected with an empty vector, pBKS (Fig. 3B lane 5). This result indicates that VSVNJ-Haz L and VSVNJ-Ogd L were expressed and were of the expected size of 241 kDa.
3.4. Recombinant VSVNJ-Haz L and VSVNJ-Ogd L support the transcription of VSV As a catalytic subunit of the RNA-dependent RNA polymerase complex, the L protein is absolutely required for the transcription and replication of VSV. One of the DI particles of VSVInd, transcribing DI-LT, was found to transcribe its mRNAs by proteins provided by VSVNJ (Chow et al., 1977). Therefore, a minigenome containing terminal genomic sequences of VSVInd could be used for the transcriptional analysis of VSVNJ L proteins. To examine whether or not our
356
G.N. Kim et al. / Virus Research 90 (2002) 347 /364
Fig. 2 (Continued)
VSVNJ L proteins are functional for the transcription of VSV mRNAs, we used a plasmid, pTV-Ind/ CAT, encoding a minigenome containing the VSVInd 3? leader region (l) and leader/N gene intercistronic sequences, the chloramphenicol acetyl transferase (CAT) gene as a reporter gene, and an untranslated region of the L gene and 5? end trailer region (t; Fig. 4A). The minigenome contains the minimal cis- acting signals for transcription initiation (3? genomic end sequences), transcription termination of the leader sequence (l/N junction sequences), transcription reinitiation (beginning of N gene), polyadenylation at the 3? end of the mRNA (untranslated region of L gene), and encapsidation by N protein (5? end trailer region). The minigenome was constructed such that T7 transcripts are synthesized as negative
sense genomic RNAs of VSVInd containing antisense CAT RNA sequences. BHK-21 cells were infected at a MOI of 5 with recombinant vaccinia virus (vTF7-3) expressing T7 RNA polymerase. The infected cells were transfected with plasmids encoding the minigenome (pTV-Ind/CAT), N, P, and L proteins (pBKS-N, pBKS-P, pBKS-L). At 30 h posttransfection, cell lysates were prepared and CAT activity was determined. The results shown in Fig. 4B represent the average value of two separate experiments. CAT activity was detected only in cells, which were transfected with all four of the plasmids (pN, pP, and pL of VSVInd, VSVNJ-Haz, or VSVNJ-Ogd and pInd/CAT), indicating that the CAT activity indeed originated from CAT protein expressed from the minigenome. The absence of plasmids,
G.N. Kim et al. / Virus Research 90 (2002) 347 /364
357
Fig. 2 (Continued)
pBKS-HL, pBKS-OL, or pInd/CAT resulted in a background level of CAT activity (Fig. 4B). The results confirmed that the recombinant L proteins of VSVNJ-Haz and VSVNJ-Ogd were functional for the transcription of the VSV minigenome. 3.5. Recombinant VSVNJ-Haz L and VSVNJ-Ogd L support the replication of genomic RNAs from pTVHDI-l(/) and pTV-ODI-l(/) As a catalytic subunit of VSV polymerase complex, the L protein is crucial for the replication of the VSV genome. Therefore, it was important to test whether or not recombinant VSVNJ L proteins were functional in supporting the replication of the VSV genome. The genomes of panhandle type DI particles of VSV contain the same 3? terminal sequences as the positive sense antigenome of VSV standard virus (Kolakofsky, 1982; Perrault, 1976). Therefore, the panhandle type DI particle genome can be used as a tool to study the replication of VSV. Two panhandle type DI particles of VSVNJ [VSVNJHaz DI particle (HDI) and VSVNJ-Ogd DI particle (ODI)] were isolated, cDNAs representing their
genomes were cloned, and characterized by cDNA sequencing. Both DI particles contained the same genomic structure as other panhandle type DI particles. The VSVNJ-Haz DI particle genome contained 71 nucleotides inverse complementarity at the 3? and 5? ends (Choi, 1997). The ODI genome contained 99 nucleotide inversely complementary sequences at its termini (Genbank accession No.: AY102919). It has been demonstrated that the VSVInd DI particle, containing only 51 nucleotides of its genomic end sequences at both the 3? and 5? termini, and with replacement of internal sequences with those of non-VSV origin, could replicate in the presence of N, P, and L proteins (Pattnaik et al., 1995). To test whether or not the VSVNJ L proteins are functional for the replication of VSV genome, we constructed cDNA clones of two chimeric VSVNJ DI-l particle genomes, which encode positive-sense genomic RNA: pTV-HDIl(/) and pTV-ODI-l(/). These chimeric DI-l genomes contained genomic termini of different nucleotide length, but which were larger than the inversely complementary terminal sequences of wild type DI particles. The internal sequences of
358
G.N. Kim et al. / Virus Research 90 (2002) 347 /364
Fig. 3. Expression of recombinant VSVNJ L proteins. (A) Full-length cDNA clones of VSVNJ-Haz L and VSVNJ-Ogd L genes in pBluescript II KS (pBluescript II KS-HL and -OL). Expression of the VSVNJ L gene is under the control of the T7 transcriptional promoter. (B) Detection of expressed recombinant VSVNJ L proteins. vTF7-3 infected BHK-21 cells were transfected with pBKS-HL, pBKS-OL, or pBKS. At 24 h post-transfection, transfected cells were starved for 1 h and labelled with [35S]methionine for 2 h. VSVNJ L proteins were immunoprecipitated with rabbit polyclonal antibody against the carboxyl terminal 18 amino acid long peptides of the VSVNJ L proteins described in Section 2, analyzed by SDS-PAGE, and detected by autoradiography. The arrow indicates the 241 kDa VSVNJ-Haz L and VSVNJ-Ogd L, from standard virus infected cells (lanes 1 and 2) and from cells transfected with pBKS-HL and pBKSOL (lanes 3 and 4).
the HDI genome and ODI genome were replaced with bacteriophage l sequences (Fig. 5A). For the analysis of intracellular replication of HDI-l(/) and ODI-l(/), BHK-21 cells were infected with recombinant vaccinia virus (vTF7-3) and cotransfected with plasmids encoding the VSVNJ N, P, and L proteins, and with a plasmid encoding the antigenomic RNA of HDI-l(/) or ODI-l(/). As controls, transfections omitting pBKS-HL or pBKS-OL were carried out as well. At 30 h posttransfection, cytoplasmic extracts of transfected cells were prepared and antibodies against total proteins of VSVNJ-Haz or VSVNJ-Ogd were added to immunoprecipitate RNA /N protein complexes. The immune complexes were concentrated using protein A-Sepharose CL 4B, and RNA was
extracted by treating immune complexes with phenol/chloroform/isoamylalcohol. Synthesis of RNA was detected by Northern blot analysis using two different l sequence specific riboprobes with opposite orientation (Fig. 5B). The RNAs synthesized by T7 RNA polymerase are encapsidated by N protein and could be detected by riboprobe l-E/E1, regardless of whether or not L protein was expressed (Fig. 5B, lane 1, 2, 5 and 6). These encapsidated positive sense RNAs are used as templates for the synthesis of negative sense RNAs by the VSVNJ polymerase complex (P and L). Negative-sense RNA synthesis was only detected using riboprobe l-E/E2 when VSVNJ L proteins were expressed (Fig. 5B, lanes 3 and 7). The results confirmed that recombinant L proteins
G.N. Kim et al. / Virus Research 90 (2002) 347 /364
359
Fig. 4. Expression of CAT from minigenome, pTV-Ind/CAT by recombinant VSVNJ L proteins. (A) BHK-21 cells were infected with vTF7-3 and transfected with plasmids encoding N, P, and L proteins and pTV-Ind/CAT encoding the minigenome of Ind/CAT. Minigenomic RNAs are synthesized by T7 RNA polymerase and encapsidated by nucleocapsid protein (N). The RNA /N protein complex is equivalent to the negative sense genomic RNA of VSV containing the antisense gene of CAT [TAC (/)]. From the encapsidated negative sense genomic RNA of Ind/CAT, CAT mRNAs are transcribed by the functional P and L protein complex and CAT protein is expressed. (B) CAT activities from cells infected with vTF7-3 and cotransfected with plasmids encoding VSVInd N, P, and L proteins (pBKS-IN, -IP, pGem4-IL) and pTV-Ind/CAT or plasmids encoding VSVNJ-Haz or VSVNJ-Ogd N, P, and L proteins [pBKS-H(O)N /H(O)P, -H(O)L] and pTV-Ind/CAT. As negative controls, transfection was performed by omitting pBKS-HL, pBKSOL, or pTV-Ind/CAT. At 30 h posttransfection, cytoplasmic extracts were prepared and CAT activities in the cell lysates were measured by LSC.
360
G.N. Kim et al. / Virus Research 90 (2002) 347 /364
Fig. 5. Intracellular replication of chimeric VSVNJ DI-l RNAs using recombinant VSVNJ L proteins. (A) Schematic representation of pTV-HDI-l(/) and pTV-ODI-l(/). pTV-HDI-l(/) transcribes HDI-l RNA containing 227 nucleotides at the 5? terminus and 188 nucleotides at the 3? terminus of the positive-sense HDI genome plus 2332 nucleotides of bacteriophage l sequences in the middle. The size of the HDI-l(/) transcript is 2737 bases. pTV-ODI-l(/) transcribes ODI-l RNA containing 99 nucleotides at the 5? terminus and 230 nucleotides at the 3? terminus of the positive-sense ODI genome plus 2332 nucleotides of bacteriophage l sequences in the middle. The size of the ODI-l transcript is 2651 bases. (B) Synthesis of chimeric HDI-l and ODI-l RNAs. BHK-21 cells were infected with vTF7-3, cotransfected with plasmids in the combination of pBKS-HN, -HP, -HL, and pTV-HDI-l(/) or pBKS-ON, -OP, -OL, and pTV-ODI-l (/). Transfections without pBKS-HL or pBKS-OL (lanes 4 and 8) were performed as negative controls. The isolated RNAs from transfected cells were detected by Northern blot analysis using l sequence specific riboprobes (l-E/E1 and l-E/E2). RNAs synthesized by T7 RNA polymerase and encapsidated by the N protein were detected with riboprobe l-E/E1 (lanes 1, 2, 5, and 6). RNAs synthesized by VSVNJ polymerase complex (P and L) and encapsidated by N proteins were detected with riboprobe, l-E/E2 (lanes 3, 4, 7, and 8).
of VSVNJ-Haz and VSVNJ-Ogd supported the intracellular replication of HDI-l(/) and ODIl(/) RNAs.
4. Discussion Complete nucleotide sequence analyses of VSVNJ-Haz L and VSVNJ-Ogd L ORFs were carried out using newly generated cDNA clones. The nucleotide sequences of these new VSVNJ L gene cDNA clones were compared with the published sequences of VSVNJ L genes from VSVNJ-Mis and VSVNJ-Ogd. We have compared deduced amino acid sequences from these data. There were
nucleotide differences scattered throughout the L gene with some amino acid changes. Overall, amino acid sequences were highly conserved with a similarity of 96% in VSVNJ-Mis L and VSVNJ-Haz L, and 98.7% in two VSVNJ-Ogd L sequences. There were 65 amino acid differences between the previously published amino acid sequence of VSVNJ-Mis and our new VSVNJ-Haz L sequences (Fig. 2). Thirty-two amino acid differences were found in our previously published sequences of VSVNJ-Ogd L and our new VSVNJ-Ogd L proteins (Fig. 2). We have used reverse transcription followed by PCR (RT-PCR) for the cloning of VSVNJ L genes while the published sequences of VSVNJ L were obtained through direct RNA
G.N. Kim et al. / Virus Research 90 (2002) 347 /364
sequencing using reverse transcriptase without PCR. Therefore, nucleotide sequence differences could have resulted from reverse transcriptase and/ or PCR error during the cloning of the new cDNAs of the VSVNJ L genes or reverse transcriptase error during direct RNA sequencing of the VSVNJ L genes. It has been found that the sequence of the VSVInd L gene varies among cDNA clones from the same VSVInd isolate (Schubert et al., 1984). Like reverse transcriptase, VSV RNA-dependent RNA polymerase itself lacks 3?/5? exonuclease proof-reading activity (Steinhauer et al., 1992). Therefore, it is possible that the VSV RNA polymerase itself, considering the size of the L gene ORF (which is 6330 nucleotides long and covers about 60% of genome) may be responsible for nucleotide differences in L gene sequences. Four blocks (Block A /D) of highly conserved amino acids in the VSV L proteins had been identified after amino acid comparisons between VSV L proteins and L proteins from other negative sense RNA viruses (Barik et al., 1990; Poch et al., 1989). Amino acids located in the four domains were examined to see whether or not any substitutions were present in these regions. There were four amino acid differences in blocks C and D between the published and the new VSVNJ-Haz L sequences. One of the different amino acids in the three positions were the same as the amino acid in the same position of VSVNJ-Ogd L. Therefore, only one of the four amino acids was different from that of VSVNJ-Ogd L and each other. No amino acid changes were found in the four domains of VSVNJ-Ogd L. The GDN motif in block B of the L protein was defined as a conserved and essential motif in VSV L proteins and other RNA dependent RNA polymerases for their polymerase activity (Kamer and Argos, 1984; Sleat and Banerjee, 1993). The GDN motif was intact in the amino acid sequences of our VSVNJ L proteins. We believe that most of the amino acid differences between the published VSVNJ L sequences and our new VSVNJ L sequences are conservative substitutions of amino acids, which may not affect the catalytic function of the L protein. Regardless of some sequence diversity, we believe that sequences presented in this paper must be reasonably faithful
361
representations of the sequences present in the genomic RNAs, since the cloned L genes are functional. Labelling with [35S]methionine and immunoprecipitation of recombinant L proteins of VSVNJ-Haz and VSVNJ-Ogd using a monospecific polyclonal antibody against the VSVNJ L protein confirmed that the cDNA clones expressed L proteins of the expected size compared with what can be detected in infected cells (Thomas et al., 1985). We used antibodies raised against a peptide containing 18 amino acids, which were deduced from the cDNA sequence of the new VSVNJ L gene, and are located close to the carboxy terminus of both the VSVNJ-Haz and VSVNJ-Ogd L proteins. Therefore, the results showing the detection of VSVNJ L proteins expressed from the cDNA (Fig. 3B, lanes 3 and 4) and L proteins synthesized from VSVNJHaz and VSVNJ-Ogd standard virus infections indicate that the L proteins expressed from the cDNA are the same as the L proteins expressed from the standard virus. We used a well-controlled system of VSV transcription in which the expression of L protein was optimized by adjusting the amount of plasmid encoding L protein that is transfected into cells. Several studies on the cis -acting signals involved in VSV transcription used a plasmid minireplicon, which encodes a smaller version of the VSV genome containing 3? and 5? genomic termini of negative sense genomic RNA of VSV and a portion of the VSV genome or foreign genes such as GFP or CAT (Barr et al., 1997; Stillman and Whitt, 1999; Whelan and Wertz, 1999). To examine whether or not the recombinant VSVNJ L proteins were functional for the transcription of VSV, we used a minigenome containing the 3? genomic promoter sequences of VSVInd, transcription initiation sequences of the N gene, the CAT gene as a reporter, the untranslated region of the L gene with poly(A) signals, and the 5? trailer region of VSVInd. Intracellular CAT activity was measured as an indicator of VSVNJ L function. Although we used the promoter sequences of the minigenome from VSVInd, recombinant L proteins from both VSVNJ-Haz and VSVNJ-Ogd supported the transcription efficiently when co-expressed with VSVNJ N and P proteins (Fig. 4). The
362
G.N. Kim et al. / Virus Research 90 (2002) 347 /364
possibility that RNA polymerases from the host cell or recombinant vaccinia virus transcribe CAT mRNA from the transfected minigenome was ruled out by measuring the CAT activity in cells transfected with all plasmids except pBKS-HL, pBKS-OL or pTV-Ind/CAT. The results clearly demonstrated that CAT activity was dependent upon the expression of the recombinant VSVNJ L proteins. The transcription of mRNAs of VSVInd by VSVNJ polymerase was indirectly demonstrated previously after coinfecting cells with transcribing DI particle of VSVInd DI-LT and the standard virus of VSVNJ (Chow et al., 1977). Therefore, these results confirm that VSVNJ polymerase complexes can utilize promoter sequences of VSVInd for transcription initiation. In addition to the transcriptional activity, L proteins replicate both positive sense antigenomic and negative sense genomic RNAs of VSV (Testa et al., 1980). The synthesis of negative sense genomic RNA from the positive sense antigenomic RNA is initiated by the polymerase complex (P and L) through the promoter sequences located at the 3? terminus of positive sense antigenomic RNA. The same promoter sequences can be found in the genomic termini of panhandle type DI particles. Therefore, the panhandle type VSV DI particle genome is a good model to study the replication of VSV and related cis - and trans acting signals (Das et al., 1997; Hwang et al., 1999; Li and Pattnaik, 1997; Pattnaik et al., 1997). In our experiments using the HDI-l(/) and ODIl(/), genomic RNAs replicated only in the combined presence of recombinant VSVNJ L protein, N protein, and P protein (Fig. 5), confirming that recombinant VSVNJ L proteins are also functional for the replication of VSVNJ DI particle RNA and possibly that of VSVNJ standard virus. Since chimeric VSVNJ DI-l RNAs containing internal sequences of non-VSV origin replicate well, the DI-l RNA will be a good tool to study the 3? promoter sequences in the positive sense genomic RNA of VSVNJ, which is not yet well characterized. Although much of the information on transcription, replication, and assembly of VSV has been obtained by using cDNA clones of VSVInd, there are still unanswered questions regarding protein interactions between the RNA-
N protein and polymerase complexes and the specificity of promoter usage by the heterotypic polymerase complex during heterotypic viral interference mediated by VSV DI particles. The cDNA clones of VSVNJ-Haz L and VSVNJ-Ogd L will be very useful for these studies.
Acknowledgements We thank Dr Tomas Dobransky and Elizabeth Banasikowska for helping us to generate an antibody against VSVNJ L epitope. We thank Chad Michalski, Jason Kinkartz, and Jailal Ablack for reading the manuscript. This work was supported by grants from the Medical Research Council of Canada (Canadian Institute of Health Research).
References Barik, S., Rud, E.W., Luk, D., Banerjee, A.K., Kang, C.Y., 1990. Nucleotide sequence analysis of the L gene of vesicular stomatitis virus (New Jersey serotype): identification of conserved domains in L proteins of nonsegmented negative-strand RNA viruses. Virology 1751, 332 /337. Barr, J.N., Whelan, S.P., Wertz, G.W., 1997. cis-Acting signals involved in termination of vesicular stomatitis virus mRNA synthesis include the conserved AUAC and the U7 signal for polyadenylation. J. Virol. 7111, 8718 /8725. Blumberg, B.M., Kolakofsky, D., 1981. Intracellular vesicular stomatitis virus leader RNAs are found in nucleocapsid structures. J. Virol. 402, 568 /576. Cartwright, B., Brown, F., 1972. Serological relationships between different strains of vesicular stomatis virus. J. Gen. Virol. 163, 391 /398. Choi, W.Y., 1997. Molecular biological characterization of defective interfering particles of Vesicular stomatitis virus. Ph.D. thesis, University of Ottawa. Chow, J.M., Schnitzlein, W.M., Reichmann, M.E., 1977. Expression of genetic information contained in the RNA of a defective interfering particle of vesicular stomatitis virus. Virology 772, 579 /588. Cullen, B.R., 1987. Use of eukaryotic expression technology in the functional analysis of cloned genes. Methods Enzymol. 152, 684 /704. Das, T., Pattnaik, A.K., Takacs, A.M., Li, T., Hwang, L.N., Banerjee, A.K., 1997. Basic amino acid residues at the carboxy-terminal eleven amino acid region of the phosphoprotein (P) are required for transcription but not for replication of vesicular stomatitis virus genome RNA. Virology 2381, 103 /114.
G.N. Kim et al. / Virus Research 90 (2002) 347 /364 Emerson, S.U., Wagner, R.R., 1973. L protein requirement for in vitro RNA synthesis by vesicular stomatitis virus. J. Virol. 126, 1325 /1335. Emerson, S.U., Yu, Y., 1975. Both NS and L proteins are required for in vitro RNA synthesis by vesicular stomatitis virus. J. Virol. 156, 1348 /1356. Feldhaus, A.L., Lesnaw, J.A., 1988. Nucleotide sequence of the L gene of vesicular stomatitis virus (New Jersey): identification of conserved domains in the New Jersey and Indiana L proteins. Virology 1632, 359 /368. Fuerst, T.R., Niles, E.G., Studier, F.W., Moss, B., 1986. Eukaryotic transient-expression system based on recombinant vaccinia virus that synthesizes bacteriophage T7 RNA polymerase. Proc. Natl. Acad. Sci. USA 8321, 8122 /8126. Herman, R.C., Schubert, M., Keene, J.D., Lazzarini, R.A., 1980. Polycistronic vesicular stomatitis virus RNA transcripts. Proc. Natl. Acad. Sci. USA 778, 4662 /4665. Horikami, S.M., Moyer, S.A., 1982. Host range mutants of vesicular stomatitis virus defective in in vitro RNA methylation. Proc. Natl. Acad. Sci. USA 7924, 7694 /7698. Horikami, S.M., De Ferra, F., Moyer, S.A., 1984. Characterization of the infections of permissive and nonpermissive cells by host range mutants of vesicular stomatitis virus defective in RNA methylation. Virology 1381, 1 /15. Hwang, L.N., Englund, N., Das, T., Banerjee, A.K., Pattnaik, A.K., 1999. Optimal replication activity of vesicular stomatitis virus RNA polymerase requires phosphorylation of a residue(s) at carboxy-terminal domain II of its accessory subunit, phosphoprotein P. J. Virol. 737, 5613 /5620. Kamer, G., Argos, P., 1984. Primary structural comparison of RNA-dependent polymerases from plant, animal and bacterial viruses. Nucleic Acids Res. 1218, 7269 /7282. Kang, C.Y., Prevec, L., 1969. Proteins of vesicular stomatitis virus. I. Polyacrylamide gel analysis of viral antigens. J. Virol. 34, 404 /413. Khan, S.R., Lazzarini, R.A., 1977. The relationship between autointerference and the replication of defective interfering particle. Virology 771, 189 /201. Kolakofsky, D., 1982. Isolation of vesicular stomatitis virus defective interfering genomes with different amounts of 5?terminal complementarity. J. Virol. 412, 566 /574. Li, T., Pattnaik, A.K., 1997. Replication signals in the genome of vesicular stomatitis virus and its defective interfering particles: identification of a sequence element that enhances DI RNA replication. Virology 2322, 248 /259. Mackett, M., Yilma, T., Rose, J.K., Moss, B., 1985. Vaccinia virus recombinants: expression of VSV genes and protective immunization of mice and cattle. Science 227, 433 /435. Melton, D.A., Krieg, P.A., Rebagliati, M.R., Maniatis, T., Zinn, K., Green, M.R., 1984. Efficient in vitro synthesis of biologically active RNA and RNA hybridization probes from plasmids containing a bacteriophage SP6 promoter. Nucleic Acids Res. 1218, 7035 /7056. Moyer, S.A., Banerjee, A.K., 1975. Messenger RNA species synthesized in vitro by the virion-associated RNA polymerase of vesicular stomatitis virus. Cell 41, 37 /43.
363
Pattnaik, A.K., Ball, L.A., LeGrone, A., Wertz, G.W., 1995. The termini of VSV DI particle RNAs are sufficient to signal RNA encapsidation, replication, and budding to generate infectious particles. Virology 2061, 760 /764. Pattnaik, A.K., Hwang, L., Li, T., Englund, N., Mathur, M., Das, T., Banerjee, A.K., 1997. Phosphorylation within the amino-terminal acidic domain I of the phosphoprotein of vesicular stomatitis virus is required for transcription but not for replication. J. Virol. 7111, 8167 /8175. Perrault, J., 1976. Cross-linked double-stranded RNA from a defective vesicular stomatitis virus particle. Virology 702, 360 /371. Poch, O., Sauvaget, I., Delarue, M., Tordo, N., 1989. Identification of four conserved motifs among the RNA-dependent polymerase encoding elements. EMBO J. 812, 3867 / 3874. Prevec, L., Kang, C.Y., 1970. Homotypic and heterotypic interference by defective particles of vesicular stomatitis virus. Nature 228, 25 /27. Reichmann, M.E., Schnitzlein, W.M., Bishop, D.H., Lazzerini, R.A., Beatrice, S.T., Wagner, R.R., 1978. Classification of the New Jersey serotype of vesicular stomatitis virus into two subtypes. J. Virol. 251, 446 /449. Rhim, J.S., Cho, H.Y., Huebner, R.J., 1975. Non-producer human cells induced by murine sarcoma virus. Int. J. Cancer 151, 23 /29. Schubert, M., Lazzarini, R.A., 1981. In vivo transcription of the 5?-terminal extracistronic region of vesicular stomatitis virus RNA. J. Virol. 381, 256 /262. Schubert, M., Harmison, G.G., Meier, E., 1984. Primary structure of the vesicular stomatitis virus polymerase (L) gene: evidence for a high frequency of mutations. J. Virol. 512, 505 /514. Schubert, M., Harmison, G., Richardson, C., Meier, E., 1985. Expression of a cDNA encoding a functional 241-kDa vesicular stomatitis virus RNA polymerase. Proc. Natl. Acad. Sci. USA 8223, 7984 /7988. Sleat, D.E., Banerjee, A.K., 1993. Transcriptional activity and mutational analysis of recombinant vesicular stomatitis virus RNA polymerase. J. Virol. 673, 1334 /1339. Steinhauer, D.A., Domingo, E., Holland, J.J., 1992. Lack of evidence for proofreading mechanisms associated with an RNA virus polymerase. Gene 1222, 281 /288. Stillman, E.A., Whitt, M.A., 1999. Transcript initiation and 5?end modifications are separable events during vesicular stomatitis virus transcription. J. Virol. 739, 7199 /7209. Testa, D., Banerjee, A.K., 1977. Two methyltransferase activities in the purified virions of vesicular stomatitis virus. J. Virol. 243, 786 /793. Testa, D., Chanda, P.K., Banerjee, A.K., 1980. In vitro synthesis of the full-length complement of the negativestrand genome RNA of vesicular stomatitis virus. Proc. Natl. Acad. Sci. USA 771, 294 /298. Thomas, D., Newcomb, W.W., Brown, J.C., Wall, J.S., Hainfeld, J.F., Trus, B.L., Steven, A.C., 1985. Mass and molecular composition of vesicular stomatitis virus: a
364
G.N. Kim et al. / Virus Research 90 (2002) 347 /364
scanning transmission electron microscopy analysis. J. Virol. 542, 598 /607. Wagner, R.R., Schnaitman, T.C., Snyder, R.M., Schnaitman, C.A., 1969. Protein composition of the structural components of vesicular stomatitis virus. J. Virol. 36, 611 /618.
Whelan, S.P., Wertz, G.W., 1999. Regulation of RNA synthesis by the genomic termini of vesicular stomatitis virus: identification of distinct sequences essential for transcription but not replication. J. Virol. 731, 297 /306.
Replication and transcription of viral RNAs by recombinant L proteins of New Jersey serotype of vesicular stomatitis virus Gyoung Nyoun Kim, Woo-young Choi 1, Manhoon Park 2, C. Yong Kang * Department of Microbiology and Immunology, Faculty of Medicine and Dentistry, Siebens-Drake Research Institute, University of Western Ontario, London, Ont., Canada N6G 2V4 Received 23 August 2002; received in revised form 10 September 2002; accepted 10 September 2002
Abstract The large (L) protein of vesicular stomatitis virus (VSV), catalytic subunit of RNA-dependent RNA polymerase is responsible for the transcription and replication of VSV. The L protein of the Indiana serotype of VSV (VSVInd) has previously been cloned and expressed, and used in the reverse genetics of VSVInd. However, the cDNA clones expressing functional L proteins of the VSVNJ serotype were not available. It was necessary to obtain functional clones of the New Jersey serotype of VSV (VSVNJ) in order to study homologous viral interference. Here we report the cDNA cloning, expression, and functional analyses of L proteins from both the Hazelhurst subtype and Concan subtype of VSVNJ. The analysis of the expressed L proteins for the transcription and replication of VSV demonstrate that both VSVNJ L clones express functional RNA-dependent RNA polymerase. # 2002 Elsevier Science B.V. All rights reserved. Keywords: Vesicular stomatitis virus; New Jersey serotype; L protein; RNA-dependent RNA polymerase; RNA synthesis
1. Introduction Vesicular stomatitis virus (VSV) is a prototypic rhabdovirus, which has long been studied to understand the biology of the viruses that belong * Corresponding author. Tel.: /1-519-661-3226; fax: /1519-661-3359 E-mail address: [email protected] (C.Y. Kang). 1 Present address: Department of Virology, National Institute of Health, Ministry of Health and Welfare, NokbunDong, Eunpyung-Gu, Seoul 122-701, South Korea. 2 Present address: Mogam Biotechnology Research Institute, 341 Pajung-Ri, Koonsung-Myon, Yongin-Kun, Kyonggi-Do 449-910, South Korea.
to the family Rhabdoviridae . VSV has two different serotypes: Indiana (VSVInd) and New Jersey (VSVNJ; Cartwright and Brown, 1972). Five isolates of the VSVNJ serotype were grouped into two subtypes: Hazelhurst, which includes Hazelhurst (VSVNJ-Haz), Guatemala (VSVGua), and Missouri (VSVMis) isolates, and Concan, which includes Concan (VSVNJ-Con) and Ogden (VSVOgd) isolates. The classification of VSVNJ was based on reciprocal differences in antibody neutralization of virion infectivity, nucleotide base sequence homology, oligonucleotide maps of virion RNA, and interference by defective interfering (DI) particles (Reichmann et al., 1978).
0168-1702/02/$ - see front matter # 2002 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 8 - 1 7 0 2 ( 0 2 ) 0 0 2 5 5 - 1
348
G.N. Kim et al. / Virus Research 90 (2002) 347 /364
VSV is a negative-stranded, non-segmented RNA virus whose genome encodes five viral proteins; N, P, M, G, and L (Kang and Prevec, 1969; Wagner et al., 1969). The proteins are expressed through the transcription of monocistronic mRNAs from a negative-sense genomic RNA tightly encapsidated with N protein (RNA /N protein complex). The RNA /N protein complex is associated with the VSV RNA-dependent RNA polymerase complex (P and L) in the virion and also in infected cells (Emerson and Yu, 1975). In the polymerase complex, L protein functions as a catalytic subunit, which is involved not only in the synthesis of full-length negative sense genomic and positive sense antigenomic RNA (replication) but also in the synthesis of monocistronic mRNAs (transcription; Emerson and Wagner, 1973; Emerson and Yu, 1975; Moyer and Banerjee, 1975). Posttranscriptional modifications of mRNAs such as 5? capping, methylation, and 3? polyadenylation are believed to be carried out by the L protein (Herman et al., 1980; Horikami et al., 1984; Horikami and Moyer, 1982; Schubert and Lazzarini, 1981; Testa and Banerjee, 1977). Even with these important functions of L protein in the VSV life cycle, the L protein is the least studied among the VSV proteins. The VSV L gene occupies approximately 60% of the virus genome. The 2109 amino acid long polypeptide, with a molecular mass of 241 kDa, is translated from 6380 bases of mRNA from VSVInd L and 6398 bases of mRNA from VSVNJ (Barik et al., 1990; Feldhaus and Lesnaw, 1988; Schubert et al., 1984). The size of the open reading frame (ORF) in the L gene is 6330 bases, which is the same in both serotypes. In 1984, Schubert et al. constructed a complete cDNA clone of the VSVInd L gene and analyzed the primary structure (Schubert et al., 1984). A full-length cDNA of the VSVInd L gene was assembled with five overlapping subclones to avoid the introduction of possible mutations in this large gene. The expected size was confirmed by expression of [35S]methionine-labelled recombinant L protein from cDNA in COS cells. The recombinant L protein was functional in transcription and replication as confirmed by rescue of a temperature-sensitive L gene mutant of VSVInd at the
nonpermissive temperature (Schubert et al., 1985). The primary structures of the L genes from the VSVNJ-Mis and VSVNJ-Ogd were also determined in 1988 and 1990, respectively (Barik et al., 1990; Feldhaus and Lesnaw, 1988). Due to the method employed for the sequencing of the VSVNJ L genes, using genomic RNAs of VSVNJ as templates for the sequencing, functional cDNA clones of VSVNJ L genes, which would be useful for the genetic analysis of VSVNJ, have not been constructed. After primary transcription of mRNAs and accumulation of stoichiometric quantities of N, P, and L proteins, the transcription mode is switched to the replication mode (Blumberg and Kolakofsky, 1981). It has been proposed that two different polymerase complexes are involved in transcription and replication, L-P3 as a transcriptase and L /(N /P) as a replicase (Das et al., 1997). Replication includes encapsidation of the positive sense leader sequence that leads to the synthesis of full-length positive sense antigenomic RNA encapsidated with the N protein and full-length negative sense genomic RNA synthesis from the antigenomic positive sense RNA. For the synthesis of negative sense genomic RNA from the positive sense antigenome, 3? terminal sequences of the positive sense antigenome are used as a promoter (Li and Pattnaik, 1997). We have been studying the homologous viral interference mediated by DI particles from both serotypes of VSV in our lab. Previous results reported by ourselves (Choi, 1997; Prevec and Kang, 1970) and by others (Khan and Lazzarini, 1977; Reichmann et al., 1978) indicated that DI particles from the two serotypes had different heterotypic interference activities. VSVInd DI particles interfered with the replication of both VSVInd and VSVNJ, but VSVNJ DI particles interfered with the replication of only VSVNJ standard virus. The results suggested that DI particles from the two serotypes use heterotypic viral proteins differently for replication and/or assembly. The different heterotypic interference properties may have been the result of differing efficiencies with which the promoters of the DI particle genomes to use the heterotypic polymerase complex. To address these issues, we require
G.N. Kim et al. / Virus Research 90 (2002) 347 /364
functional cDNA clones of VSVNJ L protein. In this report, we demonstrate that the construction and expression of cDNA clones of VSVNJ L genes from VSVNJ-Haz and VSVNJ-Ogd were successful and that the recombinant VSVNJ L proteins are enzymatically functional both in transcription of a reporter gene and in replication of VSVNJ DI particle genomes.
2. Materials and methods 2.1. Cell culture BHK-21 cells were obtained from the American Type Culture Collection (ATCC). Human thymidine kinase-negative 143 B (TK 143) cells (Rhim et al., 1975) were obtained from Dr K. Wright (University of Ottawa, Ottawa). BHK-21 cells and TK 143 cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 5% fetal calf serum (Gibco BRL), 100 U/ml of penicillin, 100 mg/ml of streptomycin and kanamycin, and 2 mM L-glutamine. 2.2. Virus preparation, purification of DI particles, and antibodies
349
the fourth undiluted passage, culture fluid was harvested at 18 h postinfection. Cellular debris was removed by centrifugation at 2240/g, 4 8C for 10 min. VSVNJ-Ogd standard virus and DI particles were collected by ultracentrifugation at 151 000 / g in a Beckman SW41 rotor, 4 8C for 1 h. The viral pellet was resuspended in TNE buffer (10 mM Tris-HCl, pH 7.4, 100 mM NaCl, 1 mM EDTA). Putative VSVNJ-Ogd DI particles were separated from the standard virus by centrifugation using a 5 /30% (wt/vol) linear sucrose gradient. A DI particle band was collected carefully by side puncturing the centrifuge tube. Genomic RNA of the newly generated DI particle was isolated for cloning. Rabbit polyclonal antibodies against total proteins of VSVNJ-Haz, and VSVNJ-Ogd were produced previously in our lab (Choi, 1997). Polyclonal antibody against VSVNJ L protein was raised in a rabbit using 18 amino acid long synthetic peptide conjugated with keyhole limpet haemocyanin (KLH). The region from which the peptide was synthesized is located between amino acids 1946 and 1964: NH2-IRTTDSMPGPPSDGDVNKCOOH and is conserved in both VSVNJ-Haz L and VSVNJ-Ogd L proteins. 2.3. RNA isolation
VSVNJ-Haz was originally obtained from Dr S. Emerson (National Institutes of Health, Bethesda). VSVNJ-Ogd was obtained from Dr L. Prevec (McMaster University, Hamilton). All strains of VSVNJ were plaque purified at least three times, and amplified by infecting BHK-21 cells with a multiplicity of infection (MOI) of 0.1. Recombinant vaccinia virus vTF7-3 (Fuerst et al., 1986) was obtained from Dr B. Moss (National Institute of Health, Bethesda). vTF7-3 was prepared as described by Mackett et al. (Mackett et al., 1985). For the generation of new DI particles from the VSVNJ-Ogd, BHK-21 cells in 100 mm culture dishes were infected with a MOI of 50 with VSVNJ-Ogd. Culture media was harvested at 18 h post-infection and passed three more times. For the second to fourth infections, 1 ml of harvested culture medium from the previous infection was used to infect fresh BHK-21 cells in a 100 mm culture dish. After
For the cloning of L genes of VSVNJ-Haz and VSVNJ-Ogd, total mRNA was isolated from BHK21 cells infected with VSVNJ-Haz or VSVNJ-Ogd. BHK-21 cells from 100 mm culture dishes were infected with a MOI of 10 with VSVNJ-Haz or VSVNJ-Ogd in the presence of 2 mg/ml Actinomycin D (Act D: Sigma-Aldrich). At 5 h postinfection, the infected cells were harvested and total mRNA was isolated using the FasTrackTM 2.0 kit (Invitrogen), according to the manufacture’s manual. 1.4 mg of isolated total mRNA was used for cDNA synthesis using revere transcriptase (RT). Genomic RNAs from VSVNJ-Ogd DI particles were isolated from purified DI particles. After separation of DI particles from the standard virus by density gradient centrifugation using a 5 /30% linear sucrose gradient, the DI particles were collected from the gradient and resuspended in TNE buffer and concentrated by ultracentrifuga-
350
G.N. Kim et al. / Virus Research 90 (2002) 347 /364
tion at 151 000/g for 1 h, at 4 8C using a Beckman SW41 rotor. The concentrated DI particles were disrupted with 300 ml of lysis buffer-2 (10 mM Tris-HCl, pH 7.4, 1% Nonidet P-40, 0.4% Na-deoxycholate, 10 mM Na2EDTA). RNAs were extracted from the lysate with an equivalent volume of phenol/chloroform/isoamylalcohol. RNAs in the aqueous phase were precipitated by adding 0.5 vol of 7.5 mM ammonium acetate and 2 vol of 100% ethanol. RNA was pelleted by centrifugation at 14 500 /g for 15 min, at 4 8C and resuspended in 10 ml of DEPC-treated dH2O. Isolation of VSVNJ DI particle RNAs, containing 2322 bases of bacteriophage l sequences in the middle of the genome (DI-l), from the transfected cells were carried out by immunoprecipitation of encapsidated RNAs by adding 5 ml of antibody against VSVNJ-Haz or VSVNJ-Ogd to 400 ml of transfected cellular extract. After overnight incubation at 4 8C, antibody /RNP complex was brought down by adding 50 ml of protein Asepharose CL 4B (at 50 mg/ml in the lysis buffer-2 containing 0.1% SDS) followed by 1 h incubation at 4 8C. The antibody /RNP /protein A sepharose complex was pelleted and washed three times with washing solution (lysis buffer-2 containing 0.1% SDS and 150 mM NaCl) and resuspended in 200 ml of 10 mM Tris-HCl, pH 7.4, 100 mM NaCl, 1 mM EDTA, and 0.5% SDS. Heating the immunecomplex in a boiling water-bath eluted the immunoprecipitated RNP. RNA was extracted from the RNP with phenol/chloroform/isoamylalcohol. The extracted RNA was resuspended in 2.5 ml of DEPC-treated dH2O and mixed with 8.5 ml of RNA sample buffer (10 ml of deionized formamide, 3.5 ml of 37% formaldehyde, 2 ml of 10X MOPs) and 1 ml of loading buffer (50% glycerol, 1 mM Na2 EDTA, and 0.4% Bromphenol blue) to a total volume of 12 ml. 2.4. Reverse transcription and polymerase chain reaction Reverse transcription was carried out using the SuperScriptTM II system (Gibco BRL/Invitrogen) according to the manufacturer’s protocol. Two microliters (out of 20 ml) of the first strand cDNA reaction mixture was used for amplification of
double stranded DNA by PCR. PCR was carried out using pfu DNA polymerase (Stratagene) according to the manufacturer’s protocol. 2.5. Construction and preparation of plasmids The cDNA cloning of DI particles from VSVNJOgd (ODI) genomic RNA and construction of pTV-HDI-l (/) and pTV-ODI-l (/): A cDNA clone of DI particles from VSVNJ-Haz (HDI) genome in the pGEM-derived transcription vector (pTV) was previously constructed in our lab. The complete sequence of the HDI genome was analyzed and submitted to Genbank (Accession No: AY102918). pTV was kindly provided by Dr Andrew Ball (University of Alabama, Birmingham). pTV contains a copy of the T7 transcriptional promoter, the hepatitis delta virus (HDV) ribozyme encoding sequence, and the T7 transcriptional terminator. cDNA of wild type HDI was inserted between the T7 transcriptional promoter and HDV ribozyme encoding sequences in an orientation such that T7 transcripts contained positive sense antigenomic RNA of the VSVNJ HDI particle. The resultant cDNA clone was named pTV-HDI(/). pTV-HDI(/) was used for the construction of pTV-HDI-l(/) and pTVODI(/). A new panhandle type DI particle from the VSVNJ-Ogd isolate (ODI) was generated and cDNA representing its genomic RNA was cloned into pBluescript II KS by RT-PCR using the primer VSV NJ. First strand cDNA of the ODI genome was synthesized using a primer, VSV NJ, which was complementary to the 3? end of VSVNJ DI particle. Since 3? and 5? genomic end sequences of the VSVNJ DI particles were inversely complementary, the primer VSV NJ bound to the 3? and 5? ends of the template. Therefore, the same primer, VSV NJ, was used for the amplification of double stranded DI particle DNA by PCR. The clone was designated as pBKS-ODI. The genomic structure of ODI was determined by cDNA sequencing and the sequence was submitted to Genbank (Accession No.: AY102919). pTV-ODI(/) was generated by replacing the majority of HDI sequences in the pTV-HDI(/) with sequences of ODI. DNA sequences of the HDI genome were excised from
G.N. Kim et al. / Virus Research 90 (2002) 347 /364
pTV-HDI(/) by digesting with Bbs I , whose recognition sequences are located close to the genomic ends of both DI particles. There was an additional Bbs I site in the ODI genomic sequence, therefore, intact sequences of ODI were excised from pBKS-ODI by partial digestion with Bbs I. The DNA clone of the HDI genome containing bacteriophage l sequences, TV-HDI-l(/), was constructed by substituting the internal region of the HDI cDNA sequence with a 2322 base pair long Hind III fragment from bacteriophage l DNA. pTV-HDI(/) was digested with Afl II and EcoR V , which resulted in removal of most of the internal region of wild type VSVNJ HDI particle cDNA except for 227 nucleotides and 188 nucleotides representing the 5? and 3? genomic termini. After filling in the 3? recessed Afl II and Hind III termini with DNA polymerase I Klenow fragment (United States Biochemical corp.), the two DNA fragments were ligated and used to transform DH5a competent cells (Gibco-BRL/Invitrogen). The construct was named pTV-HDI-l(/). pTVODI-l(/) was also constructed by replacing internal sequences of the wild type DI particle with the same bacteriophage l sequences after digestion of ODI cDNA with EcoR V . pTV-ODIl(/) contains 99 nucleotides and 230 nucleotides representing the 5? and 3? ends, respectively, of the genomic RNA of ODI. The Hind III fragment of l DNA was oriented such that position 25 157 of l DNA followed the DI particle genomic end sequences immediately after the T7 transcriptional promoter. Plasmids encoding the minigenome of Ind/CAT (pTV-Ind/CAT) and VSV N and P proteins (pBKS-IN, -IP, -HN, -HP, -ON, -OP) were constructed previously in our lab (Choi, 1997). pGem4-IL expressing the L protein of VSVInd was kindly provided by Dr M. Schubert (National institute of health, Bethesda). Construction of pBKS-l E/E1 and pBKS-l E/ E2: As templates for the synthesis of riboprobes, a 717 bp long l DNA fragment located in the 2322 bp long Hind III fragment of l DNA was cloned into pBluescript II KS vector in both directions. The 717 bp l DNA clone in which the l sequence was inserted in the opposite orientation with respect to the l DNA in the pTV-DI-l was
351
designated pBKS-l E/E1. The clone which contains the l DNA in the same orientation with respect to that in pTV-DI-l was designated pBKSl E/E2.
2.6. Preparation of riboprobe The l sequence specific riboprobes (l E/E1 and l E/E2) were synthesized from the linearized pBKS-l E/E1 and pBKS-l E/E2 using the Riboprobe in vitro transcription system (Melton et al., 1984) (Promega) according to the manufacturer’s protocol. [a-32P]CTP (50 mCi at 10 mCi/ml) (NEN) was added to the in vitro transcription reaction to label the riboprobe. After dissolving the riboprobe in the DEPC treated dH2O, total incorporated cpm per total mg of synthesized RNA was determined. The proper volume of riboprobes containing total 6.25 /106 cpm was used for Northern blot analysis.
2.7. DNA transfection Transfection was carried out using Lipofectin (Gibco-BRL/Invitrogen), according to the manufacturer’s protocol. The cells were transfected with 6 mg of pBKS-N, 3 mg of pBKS-P, 1 mg of pBKSL, 5 mg of pTV-NJ DI-l or pTV-Ind/CAT. To examine the expression of VSVNJ-Haz L and VSVNJ-Ogd L proteins from cDNA clones, 6 mg of pBKS-HL or pBKS-OL was transfected into vTF7-3 infected cells in a 60 mm culture dish.
2.8. CAT assay The CAT assay was carried out using the CAT enzyme assay system (Cullen, 1987) according to the manufacturer’s manual (Promega). Briefly, 100 ml of cell lysate of transfected cells and 3 ml of [14C]chloramphenicol (at 0.05 mCi/ml; NEN) was added to 125 ml of reaction solution. Cell lysates were incubated in a reaction mix containing [14C] chloramphenicol and n -Butyryl Coenzyme A (n Butyryl CoA). CAT activity was determined by liquid scintillation counting (LSC) assay.
352
G.N. Kim et al. / Virus Research 90 (2002) 347 /364
2.9. Northern blot analysis After completion of gel electrophoresis, RNAs were transferred to a Zeta probe nylon membrane (BioRad) using a PosiBlot 30-30 pressure blotter (Stratagene). RNAs on the membrane were crosslinked with a Stratalinker UV crosslinker (Stratagene). The membrane was washed once with DEPC-treated dH2O and soaked in 2X SSC (0.3 M NaCl, 30 mM sodium citrate-trisodium salt) before hybridization. The washed membrane was prehybridized in 5 ml of QuikHyb hybridization solution (Stratagene) for 15 min at 60 8C. About 6.25 /106 cpm of riboprobe (l-E/E1 or l-E/E2) and 1 mg of sonicated salmon sperm DNA were added to the hybridization solution and the membrane was incubated for 1 h. The membrane was washed four times with three changes of washing solutions. The membrane was first washed twice with 2X SSC solution containing 0.1% SDS at 60 8C for 15 min each, followed by washing with 1X SSC (0.15 M NaCl, 15 mM sodium citrate-trisodium salt) containing 0.1% SDS at the same temperature for 30 min. For the last wash, 0.1X SSC (0.015 M NaCl, 1.5 mM sodium citrate-trisodium salt) containing 0.1% SDS was used. The membrane was soaked once briefly in 2X SSC and RNA bands were detected by autoradiography.
3. Results 3.1. The cDNA cloning of the L genes of VSVNJHaz and VSVNJ-Ogd For construction of the VSVNJ-Haz L gene cDNA, first strand cDNA was synthesized by RT-PCR. Six different oligonucleotide primers (Table 1A) that are complementary to various regions of VSVNJ-Haz L mRNA were used for reverse transcription (Fig. 1A). Six separate double-stranded DNA fragments of the VSVNJ-Haz L gene were amplified from each RT product by adding HL-1 and HL-2 primers (Table 1A) in the PCR reaction. To generate six subclones, the Not I site was introduced into the HL-1 primers, and the Xho I site was introduced into the HL-2 primers.
Table 1 Primers used for the construction of cDNA clones of VSVNJ L genes, VSVNJ ODI genome, and DNA sequencing Primers
5?
A HL HL HL HL HL HL HL HL HL HL HL HL
GGAAAGCGGCCGCCATGGATTTCAACTTTTGAA GGAAAGCGGCCGCCGAATCTTGGAGCAGTG GGAAAGCGGCCGCATCCATCACTCATAGAAAG GGAAAGCGGCCGCCAGAAATTCTTTAAAAGGA GGAAAGCGGCCGCTGCTGTCAAGTAATCCAT GGAAAGCGGCCGCAAAGATATCAAAGATGAATTC GGAAACTCGAGCAAATAGGTTCAATCATTTTT GGAAACTCGAGATGTACCGTTTCTAATAGT GGAAACTCGAGATATCTCACTCTTGATTATC GGAAACTCGAGCTTAGTTTATCAATGAGGTA GGAAACTCGAGCTATTTGAAACAGTGTTTC GGAAACTCGAGTCAATTTTGCCAAGCTTG
1-1 2-1 3-1 4-1 5-1 6-1 1-2 2-2 3-2 4-2 5-2 6-2
B OL 5? OL 3?
GGGCGGCCGCACAGGAATCAACATGGATTTC GGGCGGCCGCGATCAATTTTGCCAAGCTTG
C VSV NJ
GGGCGGCCGCCGTACGAAGACAAAAAAACCA
D M13 Forward M13 Reverse TV-A TV-B
CGGCCAGGGTTTTCCCAGTCACGAC TCACACAGGAAACAGCTATGAC GAGGAAGCGGAAGAGCGCGCCC CAGCCGGATCCGAGCTCTCC
(A) Primers used for the cDNA cloning of VSVNJ-Haz L gene. (B) Primers used for the cDNA cloning of VSVNJ-Ogd L gene. (C) Primer for the amplification and cloning of VSVNJ DI cDNA by RT-PCR. (D) Primers used for cDNA sequencing. M13 forward and M13 reverse primers were used for the sequencing of cDNA clones in the pBluescript II KS vector. Primers, TV-A and TV-B were used for the sequencing of cDNA clones made in the transcription vector, pTV. Not I : GCGGCCG; Xho I : CTCGAG.
Both restriction enzyme recognition (RE) sites were not present in the VSVNJ-Haz L gene. The absence of these RE sites was determined by examining the sequence of the VSVNJ-Mis L gene reported previously (Feldhaus and Lesnaw, 1988) and from our own previous cDNA clone of VSVNJ-Haz L (unpublished data). The six PCR products of the VSVNJ-Haz L gene were digested with the REs Not I and Xho I , whose recognition sites were introduced at the ends of the PCR products. The products were inserted into the pBluescript II KS (Stratagene), which was also cut with the same enzymes. Assembly of the six fragments into a full-length
3?
G.N. Kim et al. / Virus Research 90 (2002) 347 /364
353
Fig. 1. Schematic representation of cloning of VSVNJ L genes. (A) Cloning of VSVNJ-Haz L gene. Not I , in the beginning, and Xho I sites at the end of each PCR product were used for subcloning. Nde I , Aat II , Bgel II , BspM I , and Sma I sites at the end of each sublone and a Xho I site in the vector were used to assemble the full-length clone of VSVNJ-Haz L gene. Nucleotide positions of the RE sites used for the full length cDNA cloning are shown in the parenthesis. Numbers with small arrows immediately over and under the open box indicate primers used for the RT-PCR. The size of each product is shown as numbers in the open box. Numbers in the circle indicate the order of assembly for the cloning of full-length VSVNJ-Haz L gene. (B) Schematic representation of cloning of VSVNJ-Ogd L gene and subcloning for the cDNA sequencing. Not I sites at the ends of the cDNA were used for the cloning of the full-length VSVNJOgd L gene. RE sites under the open bar were used for the construction of eight subclones.
cDNA of the VSVNJ-Haz L gene was accomplished by adding each fragment sequentially from subclone one to six using RE sites located in the overlapping regions at the ends of each fragment. For instance, the second fragment was excised from pBluescript II KS with Nde I and Xho I , and ligated to the first fragment, which was also cut with the same enzymes. The Aat II site at the end of the second fragment and beginning of the third fragment was used to add the third fragment (Fig. 1A) and so on. The full-length cDNA clone of VSVNJ-Haz L gene was named pBKS-HL. First strand cDNA of VSVNJ-Ogd L mRNA was synthesized using a single primer, OL 3? which was
complementary to the 3? end of VSVNJ-Ogd L mRNA (Table 1B). Double-stranded full-length cDNA of the VSVNJ-Ogd L gene was amplified by PCR using the primers OL 5? and OL 3?, which were complementary to the 5? and 3? end of mRNA and contained Not I recognition site (Table 1B). The full-length PCR product of the VSVNJ-Ogd L gene was cut with Not I and cloned into the pBluescript II KS as well, and named pBKS-OL. L genes in pBluescript II KS are under the control of the T7 promoter. Six subclones of the VSVNJ-Haz L gene in pBKS vector were used to obtain the full-length nucleotide sequence. For nucleotide sequence analysis of
354
G.N. Kim et al. / Virus Research 90 (2002) 347 /364
VSVNJ-Ogd L gene, eight subclones were constructed in pBluescript II KS from the full-length clone of pBKS-OL. RE sites utilized for the subcloning are illustrated in Fig. 1B. 3.2. Comparison of nucleotide sequences and amino acid sequences between the previously published VSVNJ L and our new VSVNJ L The L genes of VSVNJ-Mis and VSVNJ-Ogd in their respective RNA genomes have been sequenced previously using the primer extension/ dideoxy chain termination method without cDNA cloning (Barik et al., 1990; Feldhaus and Lesnaw, 1988). Therefore, the previously reported nucleotide and deduced amino acid sequences in the ORF of VSVNJ-Mis L and VSVNJ-Ogd L were compared with those of our new VSVNJ-Haz L and VSVNJ-Ogd L cDNAs. The previous VSVNJ L gene sequence of the Hazelhurst subtype was obtained using genomic RNA from Missouri isolate while our new VSVNJ L sequence of Hazelhurst subtype is from the Hazelhurst isolate. Both VSVNJ-Ogd L sequences are derived from the same Ogden isolate. Previous VSVInd L gene sequence analyses using cDNAs from two different strains demonstrated that the frequency of mutation in the same strain was approximately 1/ 103 and that between different strains was 2.5 /103 (Schubert et al., 1984). Therefore, we expected more nucleotide and amino acid sequence differences in VSVNJ-Haz L and VSVNJ-Mis L than in VSVNJ-Ogd L. The nucleotide sequence of our new VSVNJ-Haz L (Genbank accession No.: AY074803) gene showed 96.4% identity with the previously reported nucleotide sequences of the VSVNJ-Mis L ORF, with 231 nucleotide differences. There were two nucleotide insertions and two nucleotide deletions in the VSVNJ-Haz L gene when compared with the nucleotide sequence of VSVNJ-Mis. The deletions and insertions were separated by ten nucleotides between nucleotide positions 2754 and 2765, and by nine nucleotides between the nucleotide positions 5750 and 5760. Amino acid sequences of VSVNJ-Haz and VSVNJMis L had 96.9% identity (160 amino acid differences out of 2109 amino acids; Fig. 2) and 97.3% similarity. Our previously reported sequence
(Barik et al., 1990) and our new nucleotide sequence of the VSVNJ-Ogd L gene (Genbank accession No.: AY074804) had 99.2% identity, with only 52 nucleotide differences, two nucleotide insertions at positions 685 and 2792, and two nucleotide deletions at positions 703 and 2804. VSVNJ-Ogd L proteins had 98.5% identity (32 amino acid differences out of 2109 amino acids; Fig. 2) and 98.7% similarity in their amino acid sequences. 3.3. Expression of VSVNJ-Haz L and VSVNJ-Ogd L from cDNA clones Although the cDNA sequence analysis of our VSVNJ L genes revealed that there was no introduction of translational stop codons in the middle of the ORF, we wanted to confirm that recombinant VSVNJ L proteins were expressed at the expected sizes of 241 kDa. The full-length clones of the L genes of VSVNJ-Haz and VSVNJ-Ogd in pBluescript II KS (pBKS-HL and pBKS-OL) were used for the expression of the protein (Fig. 3A). The L genes were inserted downstream of the T7 transcriptional promoter. The molecular mass of VSV L was deduced from the number of amino acids (2109 amino acids), which is the same for the L proteins of VSVInd and VSVNJ (Barik et al., 1990; Feldhaus and Lesnaw, 1988; Schubert et al., 1984). To examine the expression of the 241 kDa recombinant L proteins of VSVNJ-Haz and VSVNJ-Ogd, BHK-21 cells were infected with recombinant vaccinia virus (vTF7-3), which supplied T7 RNA polymerase for the transcription of the L gene mRNA. The infected cells were transfected with pBKS-HL, pBKS-OL, or an empty vector, pBKS. The transfected cells were labelled with [35S]methionine for 2 h at 24 h post-transfection. After lysis of the [35S]methionine labelled cells, monospecific polyclonal antibody raised against the carboxy terminal region of the L protein was added to the cytoplasmic extract. The immunoprecipitates were brought down with protein-A sepharose CL 4B, boiled in 25 ml of protein sample buffer, and analyzed by 10% SDS-PAGE. To confirm the size of the L proteins expressed from the cDNA, BHK-21 cells infected with standard
G.N. Kim et al. / Virus Research 90 (2002) 347 /364
355
Fig. 2. Comparison of amino acid sequences between previously published VSVNJ L proteins and two new VSVNJ L. Amino acid sequences of the new VSVNJ-Ogd L (Ogd-1) are written in full length. Previously published amino acid sequences of VSVNJ-Ogd L (Ogd2), new VSVNJ-Haz L (Haz), and previously published VSVNJ-Mis L (Mis) are shown. Amino acid sequences that are different from the Ogd-1 are typed in bold; the same amino acid sequences to the Ogd-1 are shown as dots.
viruses, VSVNJ-Haz or VSVNJ-Ogd, were labelled for 2 h at 3 h post-infection. The L proteins expressed by the standard viruses were immunoprecipitated using the same antibody against L protein. The L gene clones expressed proteins equivalent to the size of 241 kDa (Fig. 3B, lanes 3 and 4), which were the same in size as the proteins expressed in cells infected with the standard viruses (Fig. 3B, lanes 1 and 2). The protein was not detected in cells transfected with an empty vector, pBKS (Fig. 3B lane 5). This result indicates that VSVNJ-Haz L and VSVNJ-Ogd L were expressed and were of the expected size of 241 kDa.
3.4. Recombinant VSVNJ-Haz L and VSVNJ-Ogd L support the transcription of VSV As a catalytic subunit of the RNA-dependent RNA polymerase complex, the L protein is absolutely required for the transcription and replication of VSV. One of the DI particles of VSVInd, transcribing DI-LT, was found to transcribe its mRNAs by proteins provided by VSVNJ (Chow et al., 1977). Therefore, a minigenome containing terminal genomic sequences of VSVInd could be used for the transcriptional analysis of VSVNJ L proteins. To examine whether or not our
356
G.N. Kim et al. / Virus Research 90 (2002) 347 /364
Fig. 2 (Continued)
VSVNJ L proteins are functional for the transcription of VSV mRNAs, we used a plasmid, pTV-Ind/ CAT, encoding a minigenome containing the VSVInd 3? leader region (l) and leader/N gene intercistronic sequences, the chloramphenicol acetyl transferase (CAT) gene as a reporter gene, and an untranslated region of the L gene and 5? end trailer region (t; Fig. 4A). The minigenome contains the minimal cis- acting signals for transcription initiation (3? genomic end sequences), transcription termination of the leader sequence (l/N junction sequences), transcription reinitiation (beginning of N gene), polyadenylation at the 3? end of the mRNA (untranslated region of L gene), and encapsidation by N protein (5? end trailer region). The minigenome was constructed such that T7 transcripts are synthesized as negative
sense genomic RNAs of VSVInd containing antisense CAT RNA sequences. BHK-21 cells were infected at a MOI of 5 with recombinant vaccinia virus (vTF7-3) expressing T7 RNA polymerase. The infected cells were transfected with plasmids encoding the minigenome (pTV-Ind/CAT), N, P, and L proteins (pBKS-N, pBKS-P, pBKS-L). At 30 h posttransfection, cell lysates were prepared and CAT activity was determined. The results shown in Fig. 4B represent the average value of two separate experiments. CAT activity was detected only in cells, which were transfected with all four of the plasmids (pN, pP, and pL of VSVInd, VSVNJ-Haz, or VSVNJ-Ogd and pInd/CAT), indicating that the CAT activity indeed originated from CAT protein expressed from the minigenome. The absence of plasmids,
G.N. Kim et al. / Virus Research 90 (2002) 347 /364
357
Fig. 2 (Continued)
pBKS-HL, pBKS-OL, or pInd/CAT resulted in a background level of CAT activity (Fig. 4B). The results confirmed that the recombinant L proteins of VSVNJ-Haz and VSVNJ-Ogd were functional for the transcription of the VSV minigenome. 3.5. Recombinant VSVNJ-Haz L and VSVNJ-Ogd L support the replication of genomic RNAs from pTVHDI-l(/) and pTV-ODI-l(/) As a catalytic subunit of VSV polymerase complex, the L protein is crucial for the replication of the VSV genome. Therefore, it was important to test whether or not recombinant VSVNJ L proteins were functional in supporting the replication of the VSV genome. The genomes of panhandle type DI particles of VSV contain the same 3? terminal sequences as the positive sense antigenome of VSV standard virus (Kolakofsky, 1982; Perrault, 1976). Therefore, the panhandle type DI particle genome can be used as a tool to study the replication of VSV. Two panhandle type DI particles of VSVNJ [VSVNJHaz DI particle (HDI) and VSVNJ-Ogd DI particle (ODI)] were isolated, cDNAs representing their
genomes were cloned, and characterized by cDNA sequencing. Both DI particles contained the same genomic structure as other panhandle type DI particles. The VSVNJ-Haz DI particle genome contained 71 nucleotides inverse complementarity at the 3? and 5? ends (Choi, 1997). The ODI genome contained 99 nucleotide inversely complementary sequences at its termini (Genbank accession No.: AY102919). It has been demonstrated that the VSVInd DI particle, containing only 51 nucleotides of its genomic end sequences at both the 3? and 5? termini, and with replacement of internal sequences with those of non-VSV origin, could replicate in the presence of N, P, and L proteins (Pattnaik et al., 1995). To test whether or not the VSVNJ L proteins are functional for the replication of VSV genome, we constructed cDNA clones of two chimeric VSVNJ DI-l particle genomes, which encode positive-sense genomic RNA: pTV-HDIl(/) and pTV-ODI-l(/). These chimeric DI-l genomes contained genomic termini of different nucleotide length, but which were larger than the inversely complementary terminal sequences of wild type DI particles. The internal sequences of
358
G.N. Kim et al. / Virus Research 90 (2002) 347 /364
Fig. 3. Expression of recombinant VSVNJ L proteins. (A) Full-length cDNA clones of VSVNJ-Haz L and VSVNJ-Ogd L genes in pBluescript II KS (pBluescript II KS-HL and -OL). Expression of the VSVNJ L gene is under the control of the T7 transcriptional promoter. (B) Detection of expressed recombinant VSVNJ L proteins. vTF7-3 infected BHK-21 cells were transfected with pBKS-HL, pBKS-OL, or pBKS. At 24 h post-transfection, transfected cells were starved for 1 h and labelled with [35S]methionine for 2 h. VSVNJ L proteins were immunoprecipitated with rabbit polyclonal antibody against the carboxyl terminal 18 amino acid long peptides of the VSVNJ L proteins described in Section 2, analyzed by SDS-PAGE, and detected by autoradiography. The arrow indicates the 241 kDa VSVNJ-Haz L and VSVNJ-Ogd L, from standard virus infected cells (lanes 1 and 2) and from cells transfected with pBKS-HL and pBKSOL (lanes 3 and 4).
the HDI genome and ODI genome were replaced with bacteriophage l sequences (Fig. 5A). For the analysis of intracellular replication of HDI-l(/) and ODI-l(/), BHK-21 cells were infected with recombinant vaccinia virus (vTF7-3) and cotransfected with plasmids encoding the VSVNJ N, P, and L proteins, and with a plasmid encoding the antigenomic RNA of HDI-l(/) or ODI-l(/). As controls, transfections omitting pBKS-HL or pBKS-OL were carried out as well. At 30 h posttransfection, cytoplasmic extracts of transfected cells were prepared and antibodies against total proteins of VSVNJ-Haz or VSVNJ-Ogd were added to immunoprecipitate RNA /N protein complexes. The immune complexes were concentrated using protein A-Sepharose CL 4B, and RNA was
extracted by treating immune complexes with phenol/chloroform/isoamylalcohol. Synthesis of RNA was detected by Northern blot analysis using two different l sequence specific riboprobes with opposite orientation (Fig. 5B). The RNAs synthesized by T7 RNA polymerase are encapsidated by N protein and could be detected by riboprobe l-E/E1, regardless of whether or not L protein was expressed (Fig. 5B, lane 1, 2, 5 and 6). These encapsidated positive sense RNAs are used as templates for the synthesis of negative sense RNAs by the VSVNJ polymerase complex (P and L). Negative-sense RNA synthesis was only detected using riboprobe l-E/E2 when VSVNJ L proteins were expressed (Fig. 5B, lanes 3 and 7). The results confirmed that recombinant L proteins
G.N. Kim et al. / Virus Research 90 (2002) 347 /364
359
Fig. 4. Expression of CAT from minigenome, pTV-Ind/CAT by recombinant VSVNJ L proteins. (A) BHK-21 cells were infected with vTF7-3 and transfected with plasmids encoding N, P, and L proteins and pTV-Ind/CAT encoding the minigenome of Ind/CAT. Minigenomic RNAs are synthesized by T7 RNA polymerase and encapsidated by nucleocapsid protein (N). The RNA /N protein complex is equivalent to the negative sense genomic RNA of VSV containing the antisense gene of CAT [TAC (/)]. From the encapsidated negative sense genomic RNA of Ind/CAT, CAT mRNAs are transcribed by the functional P and L protein complex and CAT protein is expressed. (B) CAT activities from cells infected with vTF7-3 and cotransfected with plasmids encoding VSVInd N, P, and L proteins (pBKS-IN, -IP, pGem4-IL) and pTV-Ind/CAT or plasmids encoding VSVNJ-Haz or VSVNJ-Ogd N, P, and L proteins [pBKS-H(O)N /H(O)P, -H(O)L] and pTV-Ind/CAT. As negative controls, transfection was performed by omitting pBKS-HL, pBKSOL, or pTV-Ind/CAT. At 30 h posttransfection, cytoplasmic extracts were prepared and CAT activities in the cell lysates were measured by LSC.
360
G.N. Kim et al. / Virus Research 90 (2002) 347 /364
Fig. 5. Intracellular replication of chimeric VSVNJ DI-l RNAs using recombinant VSVNJ L proteins. (A) Schematic representation of pTV-HDI-l(/) and pTV-ODI-l(/). pTV-HDI-l(/) transcribes HDI-l RNA containing 227 nucleotides at the 5? terminus and 188 nucleotides at the 3? terminus of the positive-sense HDI genome plus 2332 nucleotides of bacteriophage l sequences in the middle. The size of the HDI-l(/) transcript is 2737 bases. pTV-ODI-l(/) transcribes ODI-l RNA containing 99 nucleotides at the 5? terminus and 230 nucleotides at the 3? terminus of the positive-sense ODI genome plus 2332 nucleotides of bacteriophage l sequences in the middle. The size of the ODI-l transcript is 2651 bases. (B) Synthesis of chimeric HDI-l and ODI-l RNAs. BHK-21 cells were infected with vTF7-3, cotransfected with plasmids in the combination of pBKS-HN, -HP, -HL, and pTV-HDI-l(/) or pBKS-ON, -OP, -OL, and pTV-ODI-l (/). Transfections without pBKS-HL or pBKS-OL (lanes 4 and 8) were performed as negative controls. The isolated RNAs from transfected cells were detected by Northern blot analysis using l sequence specific riboprobes (l-E/E1 and l-E/E2). RNAs synthesized by T7 RNA polymerase and encapsidated by the N protein were detected with riboprobe l-E/E1 (lanes 1, 2, 5, and 6). RNAs synthesized by VSVNJ polymerase complex (P and L) and encapsidated by N proteins were detected with riboprobe, l-E/E2 (lanes 3, 4, 7, and 8).
of VSVNJ-Haz and VSVNJ-Ogd supported the intracellular replication of HDI-l(/) and ODIl(/) RNAs.
4. Discussion Complete nucleotide sequence analyses of VSVNJ-Haz L and VSVNJ-Ogd L ORFs were carried out using newly generated cDNA clones. The nucleotide sequences of these new VSVNJ L gene cDNA clones were compared with the published sequences of VSVNJ L genes from VSVNJ-Mis and VSVNJ-Ogd. We have compared deduced amino acid sequences from these data. There were
nucleotide differences scattered throughout the L gene with some amino acid changes. Overall, amino acid sequences were highly conserved with a similarity of 96% in VSVNJ-Mis L and VSVNJ-Haz L, and 98.7% in two VSVNJ-Ogd L sequences. There were 65 amino acid differences between the previously published amino acid sequence of VSVNJ-Mis and our new VSVNJ-Haz L sequences (Fig. 2). Thirty-two amino acid differences were found in our previously published sequences of VSVNJ-Ogd L and our new VSVNJ-Ogd L proteins (Fig. 2). We have used reverse transcription followed by PCR (RT-PCR) for the cloning of VSVNJ L genes while the published sequences of VSVNJ L were obtained through direct RNA
G.N. Kim et al. / Virus Research 90 (2002) 347 /364
sequencing using reverse transcriptase without PCR. Therefore, nucleotide sequence differences could have resulted from reverse transcriptase and/ or PCR error during the cloning of the new cDNAs of the VSVNJ L genes or reverse transcriptase error during direct RNA sequencing of the VSVNJ L genes. It has been found that the sequence of the VSVInd L gene varies among cDNA clones from the same VSVInd isolate (Schubert et al., 1984). Like reverse transcriptase, VSV RNA-dependent RNA polymerase itself lacks 3?/5? exonuclease proof-reading activity (Steinhauer et al., 1992). Therefore, it is possible that the VSV RNA polymerase itself, considering the size of the L gene ORF (which is 6330 nucleotides long and covers about 60% of genome) may be responsible for nucleotide differences in L gene sequences. Four blocks (Block A /D) of highly conserved amino acids in the VSV L proteins had been identified after amino acid comparisons between VSV L proteins and L proteins from other negative sense RNA viruses (Barik et al., 1990; Poch et al., 1989). Amino acids located in the four domains were examined to see whether or not any substitutions were present in these regions. There were four amino acid differences in blocks C and D between the published and the new VSVNJ-Haz L sequences. One of the different amino acids in the three positions were the same as the amino acid in the same position of VSVNJ-Ogd L. Therefore, only one of the four amino acids was different from that of VSVNJ-Ogd L and each other. No amino acid changes were found in the four domains of VSVNJ-Ogd L. The GDN motif in block B of the L protein was defined as a conserved and essential motif in VSV L proteins and other RNA dependent RNA polymerases for their polymerase activity (Kamer and Argos, 1984; Sleat and Banerjee, 1993). The GDN motif was intact in the amino acid sequences of our VSVNJ L proteins. We believe that most of the amino acid differences between the published VSVNJ L sequences and our new VSVNJ L sequences are conservative substitutions of amino acids, which may not affect the catalytic function of the L protein. Regardless of some sequence diversity, we believe that sequences presented in this paper must be reasonably faithful
361
representations of the sequences present in the genomic RNAs, since the cloned L genes are functional. Labelling with [35S]methionine and immunoprecipitation of recombinant L proteins of VSVNJ-Haz and VSVNJ-Ogd using a monospecific polyclonal antibody against the VSVNJ L protein confirmed that the cDNA clones expressed L proteins of the expected size compared with what can be detected in infected cells (Thomas et al., 1985). We used antibodies raised against a peptide containing 18 amino acids, which were deduced from the cDNA sequence of the new VSVNJ L gene, and are located close to the carboxy terminus of both the VSVNJ-Haz and VSVNJ-Ogd L proteins. Therefore, the results showing the detection of VSVNJ L proteins expressed from the cDNA (Fig. 3B, lanes 3 and 4) and L proteins synthesized from VSVNJHaz and VSVNJ-Ogd standard virus infections indicate that the L proteins expressed from the cDNA are the same as the L proteins expressed from the standard virus. We used a well-controlled system of VSV transcription in which the expression of L protein was optimized by adjusting the amount of plasmid encoding L protein that is transfected into cells. Several studies on the cis -acting signals involved in VSV transcription used a plasmid minireplicon, which encodes a smaller version of the VSV genome containing 3? and 5? genomic termini of negative sense genomic RNA of VSV and a portion of the VSV genome or foreign genes such as GFP or CAT (Barr et al., 1997; Stillman and Whitt, 1999; Whelan and Wertz, 1999). To examine whether or not the recombinant VSVNJ L proteins were functional for the transcription of VSV, we used a minigenome containing the 3? genomic promoter sequences of VSVInd, transcription initiation sequences of the N gene, the CAT gene as a reporter, the untranslated region of the L gene with poly(A) signals, and the 5? trailer region of VSVInd. Intracellular CAT activity was measured as an indicator of VSVNJ L function. Although we used the promoter sequences of the minigenome from VSVInd, recombinant L proteins from both VSVNJ-Haz and VSVNJ-Ogd supported the transcription efficiently when co-expressed with VSVNJ N and P proteins (Fig. 4). The
362
G.N. Kim et al. / Virus Research 90 (2002) 347 /364
possibility that RNA polymerases from the host cell or recombinant vaccinia virus transcribe CAT mRNA from the transfected minigenome was ruled out by measuring the CAT activity in cells transfected with all plasmids except pBKS-HL, pBKS-OL or pTV-Ind/CAT. The results clearly demonstrated that CAT activity was dependent upon the expression of the recombinant VSVNJ L proteins. The transcription of mRNAs of VSVInd by VSVNJ polymerase was indirectly demonstrated previously after coinfecting cells with transcribing DI particle of VSVInd DI-LT and the standard virus of VSVNJ (Chow et al., 1977). Therefore, these results confirm that VSVNJ polymerase complexes can utilize promoter sequences of VSVInd for transcription initiation. In addition to the transcriptional activity, L proteins replicate both positive sense antigenomic and negative sense genomic RNAs of VSV (Testa et al., 1980). The synthesis of negative sense genomic RNA from the positive sense antigenomic RNA is initiated by the polymerase complex (P and L) through the promoter sequences located at the 3? terminus of positive sense antigenomic RNA. The same promoter sequences can be found in the genomic termini of panhandle type DI particles. Therefore, the panhandle type VSV DI particle genome is a good model to study the replication of VSV and related cis - and trans acting signals (Das et al., 1997; Hwang et al., 1999; Li and Pattnaik, 1997; Pattnaik et al., 1997). In our experiments using the HDI-l(/) and ODIl(/), genomic RNAs replicated only in the combined presence of recombinant VSVNJ L protein, N protein, and P protein (Fig. 5), confirming that recombinant VSVNJ L proteins are also functional for the replication of VSVNJ DI particle RNA and possibly that of VSVNJ standard virus. Since chimeric VSVNJ DI-l RNAs containing internal sequences of non-VSV origin replicate well, the DI-l RNA will be a good tool to study the 3? promoter sequences in the positive sense genomic RNA of VSVNJ, which is not yet well characterized. Although much of the information on transcription, replication, and assembly of VSV has been obtained by using cDNA clones of VSVInd, there are still unanswered questions regarding protein interactions between the RNA-
N protein and polymerase complexes and the specificity of promoter usage by the heterotypic polymerase complex during heterotypic viral interference mediated by VSV DI particles. The cDNA clones of VSVNJ-Haz L and VSVNJ-Ogd L will be very useful for these studies.
Acknowledgements We thank Dr Tomas Dobransky and Elizabeth Banasikowska for helping us to generate an antibody against VSVNJ L epitope. We thank Chad Michalski, Jason Kinkartz, and Jailal Ablack for reading the manuscript. This work was supported by grants from the Medical Research Council of Canada (Canadian Institute of Health Research).
References Barik, S., Rud, E.W., Luk, D., Banerjee, A.K., Kang, C.Y., 1990. Nucleotide sequence analysis of the L gene of vesicular stomatitis virus (New Jersey serotype): identification of conserved domains in L proteins of nonsegmented negative-strand RNA viruses. Virology 1751, 332 /337. Barr, J.N., Whelan, S.P., Wertz, G.W., 1997. cis-Acting signals involved in termination of vesicular stomatitis virus mRNA synthesis include the conserved AUAC and the U7 signal for polyadenylation. J. Virol. 7111, 8718 /8725. Blumberg, B.M., Kolakofsky, D., 1981. Intracellular vesicular stomatitis virus leader RNAs are found in nucleocapsid structures. J. Virol. 402, 568 /576. Cartwright, B., Brown, F., 1972. Serological relationships between different strains of vesicular stomatis virus. J. Gen. Virol. 163, 391 /398. Choi, W.Y., 1997. Molecular biological characterization of defective interfering particles of Vesicular stomatitis virus. Ph.D. thesis, University of Ottawa. Chow, J.M., Schnitzlein, W.M., Reichmann, M.E., 1977. Expression of genetic information contained in the RNA of a defective interfering particle of vesicular stomatitis virus. Virology 772, 579 /588. Cullen, B.R., 1987. Use of eukaryotic expression technology in the functional analysis of cloned genes. Methods Enzymol. 152, 684 /704. Das, T., Pattnaik, A.K., Takacs, A.M., Li, T., Hwang, L.N., Banerjee, A.K., 1997. Basic amino acid residues at the carboxy-terminal eleven amino acid region of the phosphoprotein (P) are required for transcription but not for replication of vesicular stomatitis virus genome RNA. Virology 2381, 103 /114.
G.N. Kim et al. / Virus Research 90 (2002) 347 /364 Emerson, S.U., Wagner, R.R., 1973. L protein requirement for in vitro RNA synthesis by vesicular stomatitis virus. J. Virol. 126, 1325 /1335. Emerson, S.U., Yu, Y., 1975. Both NS and L proteins are required for in vitro RNA synthesis by vesicular stomatitis virus. J. Virol. 156, 1348 /1356. Feldhaus, A.L., Lesnaw, J.A., 1988. Nucleotide sequence of the L gene of vesicular stomatitis virus (New Jersey): identification of conserved domains in the New Jersey and Indiana L proteins. Virology 1632, 359 /368. Fuerst, T.R., Niles, E.G., Studier, F.W., Moss, B., 1986. Eukaryotic transient-expression system based on recombinant vaccinia virus that synthesizes bacteriophage T7 RNA polymerase. Proc. Natl. Acad. Sci. USA 8321, 8122 /8126. Herman, R.C., Schubert, M., Keene, J.D., Lazzarini, R.A., 1980. Polycistronic vesicular stomatitis virus RNA transcripts. Proc. Natl. Acad. Sci. USA 778, 4662 /4665. Horikami, S.M., Moyer, S.A., 1982. Host range mutants of vesicular stomatitis virus defective in in vitro RNA methylation. Proc. Natl. Acad. Sci. USA 7924, 7694 /7698. Horikami, S.M., De Ferra, F., Moyer, S.A., 1984. Characterization of the infections of permissive and nonpermissive cells by host range mutants of vesicular stomatitis virus defective in RNA methylation. Virology 1381, 1 /15. Hwang, L.N., Englund, N., Das, T., Banerjee, A.K., Pattnaik, A.K., 1999. Optimal replication activity of vesicular stomatitis virus RNA polymerase requires phosphorylation of a residue(s) at carboxy-terminal domain II of its accessory subunit, phosphoprotein P. J. Virol. 737, 5613 /5620. Kamer, G., Argos, P., 1984. Primary structural comparison of RNA-dependent polymerases from plant, animal and bacterial viruses. Nucleic Acids Res. 1218, 7269 /7282. Kang, C.Y., Prevec, L., 1969. Proteins of vesicular stomatitis virus. I. Polyacrylamide gel analysis of viral antigens. J. Virol. 34, 404 /413. Khan, S.R., Lazzarini, R.A., 1977. The relationship between autointerference and the replication of defective interfering particle. Virology 771, 189 /201. Kolakofsky, D., 1982. Isolation of vesicular stomatitis virus defective interfering genomes with different amounts of 5?terminal complementarity. J. Virol. 412, 566 /574. Li, T., Pattnaik, A.K., 1997. Replication signals in the genome of vesicular stomatitis virus and its defective interfering particles: identification of a sequence element that enhances DI RNA replication. Virology 2322, 248 /259. Mackett, M., Yilma, T., Rose, J.K., Moss, B., 1985. Vaccinia virus recombinants: expression of VSV genes and protective immunization of mice and cattle. Science 227, 433 /435. Melton, D.A., Krieg, P.A., Rebagliati, M.R., Maniatis, T., Zinn, K., Green, M.R., 1984. Efficient in vitro synthesis of biologically active RNA and RNA hybridization probes from plasmids containing a bacteriophage SP6 promoter. Nucleic Acids Res. 1218, 7035 /7056. Moyer, S.A., Banerjee, A.K., 1975. Messenger RNA species synthesized in vitro by the virion-associated RNA polymerase of vesicular stomatitis virus. Cell 41, 37 /43.
363
Pattnaik, A.K., Ball, L.A., LeGrone, A., Wertz, G.W., 1995. The termini of VSV DI particle RNAs are sufficient to signal RNA encapsidation, replication, and budding to generate infectious particles. Virology 2061, 760 /764. Pattnaik, A.K., Hwang, L., Li, T., Englund, N., Mathur, M., Das, T., Banerjee, A.K., 1997. Phosphorylation within the amino-terminal acidic domain I of the phosphoprotein of vesicular stomatitis virus is required for transcription but not for replication. J. Virol. 7111, 8167 /8175. Perrault, J., 1976. Cross-linked double-stranded RNA from a defective vesicular stomatitis virus particle. Virology 702, 360 /371. Poch, O., Sauvaget, I., Delarue, M., Tordo, N., 1989. Identification of four conserved motifs among the RNA-dependent polymerase encoding elements. EMBO J. 812, 3867 / 3874. Prevec, L., Kang, C.Y., 1970. Homotypic and heterotypic interference by defective particles of vesicular stomatitis virus. Nature 228, 25 /27. Reichmann, M.E., Schnitzlein, W.M., Bishop, D.H., Lazzerini, R.A., Beatrice, S.T., Wagner, R.R., 1978. Classification of the New Jersey serotype of vesicular stomatitis virus into two subtypes. J. Virol. 251, 446 /449. Rhim, J.S., Cho, H.Y., Huebner, R.J., 1975. Non-producer human cells induced by murine sarcoma virus. Int. J. Cancer 151, 23 /29. Schubert, M., Lazzarini, R.A., 1981. In vivo transcription of the 5?-terminal extracistronic region of vesicular stomatitis virus RNA. J. Virol. 381, 256 /262. Schubert, M., Harmison, G.G., Meier, E., 1984. Primary structure of the vesicular stomatitis virus polymerase (L) gene: evidence for a high frequency of mutations. J. Virol. 512, 505 /514. Schubert, M., Harmison, G., Richardson, C., Meier, E., 1985. Expression of a cDNA encoding a functional 241-kDa vesicular stomatitis virus RNA polymerase. Proc. Natl. Acad. Sci. USA 8223, 7984 /7988. Sleat, D.E., Banerjee, A.K., 1993. Transcriptional activity and mutational analysis of recombinant vesicular stomatitis virus RNA polymerase. J. Virol. 673, 1334 /1339. Steinhauer, D.A., Domingo, E., Holland, J.J., 1992. Lack of evidence for proofreading mechanisms associated with an RNA virus polymerase. Gene 1222, 281 /288. Stillman, E.A., Whitt, M.A., 1999. Transcript initiation and 5?end modifications are separable events during vesicular stomatitis virus transcription. J. Virol. 739, 7199 /7209. Testa, D., Banerjee, A.K., 1977. Two methyltransferase activities in the purified virions of vesicular stomatitis virus. J. Virol. 243, 786 /793. Testa, D., Chanda, P.K., Banerjee, A.K., 1980. In vitro synthesis of the full-length complement of the negativestrand genome RNA of vesicular stomatitis virus. Proc. Natl. Acad. Sci. USA 771, 294 /298. Thomas, D., Newcomb, W.W., Brown, J.C., Wall, J.S., Hainfeld, J.F., Trus, B.L., Steven, A.C., 1985. Mass and molecular composition of vesicular stomatitis virus: a
364
G.N. Kim et al. / Virus Research 90 (2002) 347 /364
scanning transmission electron microscopy analysis. J. Virol. 542, 598 /607. Wagner, R.R., Schnaitman, T.C., Snyder, R.M., Schnaitman, C.A., 1969. Protein composition of the structural components of vesicular stomatitis virus. J. Virol. 36, 611 /618.
Whelan, S.P., Wertz, G.W., 1999. Regulation of RNA synthesis by the genomic termini of vesicular stomatitis virus: identification of distinct sequences essential for transcription but not replication. J. Virol. 731, 297 /306.