- Email: [email protected]
Replication of mouse adenovirus strain FL DNA
VIROLOGY
109,
l-12
(1981)
Replication M. TEMPLE, /t!sfitut,f’ur
G. ANTOINE, Bioch~mie.
Gniuersitdt
*EMBL,
of Mouse Adenovirus H. DELIUS,” Mtincken,
Posffach
S. STAHL,
Strain
ANDERNST-L.
Karlstrasse 29, D-8000 Miincherl 10.2209, 6.9 Heidelberg. West Germa’ny
Accepted
July
FL DNA WINNACKER
2, West Gwmany,
axd
22. 1980
tion map presented in the present paper. Its orientation according to accepted conventions leads to an alignment of the restriction enzyme maps identical to that originally proposed by Larsen and Nathans (1977) but opposite to their later proposal (Larsen et al., 1979).
INTRODUCTION
Mouse adenovirus strain FL (Ad FL) was originally isolated by Hartley and Rowe (1960) and defined as a typical adenovirus on the basis of its biological properties. This conclusion was confirmed both by Wigand (197’7) and Larsen and Nathans (1977) studying virion architecture as well as certain structural features of its linear DNA molecule. Larsen et al. (1979) also established the molecular basis for the cross-reactivity of Ad FL with sera from guinea pigs infected with human adenovirus type 2 by identifying regions of homology in Ad FL and human Ad 2 DNA. Our interest in the biology of this virus stems from our preoccupation with adenovirus DNA replication (Winnacker, 1978) as well as from its potential use as a eukaryotic vector system (Philipson, 1977). The replication pattern of Ad FL DNA was thus determined using techniques previously employed in the human adenovirus systems. In analyzing the distribution of pulse label along the viral genome as well as in separated strands of terminal restriction enzyme fragments, the asymmetric pattern of displacement and complementary strand synthesis typical and characteristic for human adenoviruses (Lechner and Kelly, 1977) could be established for Ad FL DNA. The particular role of the molecular termini as origins and termini for viral DNA replication (Winnacker, 1978) prompted us to determine their primary DNA sequence. The inverted terminal repetition of 93 base pairs contains striking homologies both to the human adenoviruses as well as to polyoma virus. Our studies relied heavily on previous restriction enzyme maps by Larsen et al. (1977, 1979) as well as on a partial denatura-
MATERIALS
AND
METHODS
Cells. Mouse 3T3 cells (ATTC CCL 163; Flow Laboratories) were grown in monolayers in Dulbecco’s medium supplemented with 10% newborn calf serum (Flow). Mouse L cells (LS cells; Flow Laboratories Cat. Nr. 03-449) were grown in suspension culture in spinner medium containing 10% new born calf serum. All cells were grown in an atmosphere consisting of air and 5% CO,. Virus. The virus is mouse adenovirus strain FL originally isolated by Hartley and Rowe (1960). Our original stock was kindly provided by Dr. D. Nathans. This stock had been plaque purified from virus obtained from Microbiology Associates, Bethesda, Maryland (Larsen and Nathans, 1977). The virus used in our studies was grown from a single plaque obtained after plating the original stock on mouse 3T3 cells. For virus production on 3T3 cells, subconfluent monolayers were washed once with a mixture of one part of Dulbecco’s medium and one part of Tris-buffered saline (Winocour, 1963). The virus, diluted appropriately in the same buffer, was added in 5% of the volume of medium to be added later for growth. The virus was permitted to adsorb for approximately 1 hr and medium consisting of Dulbecco’s medium supplemented with 2% newborn calf serum was then added to the cultures. For growth of the virus on L cells, cells were pelleted from suspension cultures 1
00456822/81/030001-12$02.00/O Copyright All nyhts
C 1981 t,y Academic Press, Inc. of reproductmn in any form resenwl.
2
TEMPLE ETAL
by centrifugation at 800 g, resuspended in pipet and recentrifuged at least once more 5% of the original volume of medium suppleto equilibrium. The band was collected and mented with 2% fetal calf serum, and dialyzed for at least 6 hr against 1000 infected with the appropriate amount of volumes of buffer containing 10 mM Trisvirus. The suspension was stirred for 1 hr at hydrochloride, pH 8.0, 0.25 M sodium 37”, diluted to the original volume, and chloride, 1 mM EDTA, and 10 n-&f magstirred for 7 days at 37”. In order to deternesium chloride. mine virus titers, 3T3 cells were infected Isolation of viral DNA. Dialyzed virus with appropriate dilutions of virus as particles were treated for 2 hr at 37” with described above. Following an adsorption proteinase K (100 lgiml) in the presence of period of 1 hr at 37”, an overlay consisting of 0.5% SDS. Protein was removed with TE Dulbecco’s medium, 5% fetal calf serum, (10 m&f Tris-hydrochloride pH 7.8, 1 m&f and 0.8% agarose (Sigma Nr. A 6877) was EDTA) saturated phenol essentially as applied. Incubation followed at 37” for 4-6 described by Thomas and Abelson (1966). days. A second overlay of the same composiViral DNA was dialyzed extensively against tion as above except for the addition of 20 mJ4 Tris-hydrochloride pH 8.0, 50 mZb’ 0.02% neutral red was added at that time. sodium chloride, and 1 mJ4 EDTA. Isolation Plaques were counted approximately 15 hr of viral DNA from infected cell monolayers later. Human adenoviruses types 2 and 5 was accomplished essentially according to were grown and labeled as described by Schilling et al. (1978). Completed, doubleWeingarnter et al. (1976). stranded molecules were separated from the PuriJication of virus particles. The first replication forms by chromatography on step in virus isolation was essentially as benzoylated, naphthoylated DEAE-celludescribed by Larsen and Nathans (1977). lose (Schilling et al., 1975). As a final step the The medium from infected cells was dis- DNA was precipitated with two volumes of carded and replaced with 2 ml Dulbecco’s isopropanol in the presence of 0.3 M sodium medium per 75 cm* flask. Cells were frozen, acetate and then dialyzed into DNA buffer. thawed, and loo-ml portions were sonicated Alkaline or neutral sucrose gradients were for 30 see with a Branson sonifier (model carried out in 4.6-ml tubes essentially as B-12 A) set for maximum output. The soni- described by Winnacker (1975). In both cate was then centrifuged for 10 min at 3000 cases, the samples were layered onto the rounds/min in the SS 34 rotor to remove cell gradients in the presence of 1 mgiml heparin debris. Approximately 30 ml of cell extract (Sigma Nr. H-0880) according to Walters was layered on a step gradient of 3 ml of and Hildebrand (1975). Molecular weight determirmtioxs. For cesium chloride of a density of 1.5 g/cm” and 5 ml cesium chloride of a density of 1.2 g/cm”. electron microscopy length measurements, The cesium chloride solutions were made in the DNA was spread with cytochrome c 0.02 M Tris-hydrochloride pH 8.7. The using the formamide spreading technique relatively high pH is critical due to the acid- described by Davis et al. (1971). The DNA was spread from a hyperphase containing ity of the 3T3 cell extract. Centrifugation followed at 4” for 90 min at 24,000 rounds/ 30% formamide, 0.1 M Tris-hydrochloride, min in a AH-627 rotor (Dupont/Sorvall). The pH 8.5, and 1 m&f EDTA onto a hypophase containing 10% formamide, 10 mM Trisresulting band which appeared at the interhydrochloride, pH 8.7, and 1 mM EDTA. face between the medium and the cesium Samples were picked up on parlodionchloride layers was collected from the bottom with a Pasteur pipet after removing covered copper grids, stained with uranyl and discarding the bottom-most 2-4 ml of acetate, and rotary shadowed with platicesium chloride. The collected material was num. Relaxed circular PM 2 DNA was used as internal length reference (MW: 6.64 distributed into DupontiSorvallO3127 tubes and centrifuged to equilibrium for at least 3 x 10”; Sttibner and Bujard, 1977). For the circularization of the single-stranded DNA, hr in a Dupont/Sorvall TV 865 vertical rotor. The major band appeared at a density of a sample of DNA was completely denatured by heating a glass tube containing 50 ~1 Ad 1.34 g/cm”. It was collected with a Pasteur
REPLICATION
OF MOUSE
FL DNA (5 pgiml) in 60% formamide, 10 mM sodium phosphate, pH 7.0,l n-J4 EDTA for 90 set in boiling water. After addition of sodium perchlorate to a final concentration of 0.2 M, the sample was incubated for 5 min at 37”. An aliquot of the sample was prepared for electron microscopic analysis by the formamide spreading procedure. Partial denaturation mapping. The partial denaturation mapping was performed as described by Delius and Clements (1976). Fine mapping and DNA sequencing. Sequence analysis was carried out according to the procedure of Maxam and Gilbert (1977) except that the 0.5 mm gels were run at 600 V and warmed to 50” with circulation water. Restriction enzyme fragments were labeled at the 5’ end under the conditions for labeling protruding 5’ ends (Maxam and Gilbert, personal communication). The y-labeled [B2P]ATP used in this procedure was purchased from Amersham (5000 Ci/ mmol). The position of restriction sites was determined by the method of Smith and Birnstiel(l976). The length of the fragments was determined by electrophoresis on 5% polyacrylamide in the presence of fragments of known length from an Alu 1 digest of plasmid pBR 322 DNA (Sutcliffe, 1978). Conditions for gel electrophoresis on polyacrylamide gels were taken from Maxam and Gilbert (personal communication). RESULTS
Determination
of’ the Size cf AD FL DNA
Length measurements of Ad FL DNA were performed by electron microscopy on single-stranded Ad FL DNA as compared to a double-stranded PM 2 marker DNA (Fig. 1). By taking the molecular weight of PM 2 DNA to be 6.64 x 10’ (Sttibner and Bujard, 1977), we arrive at a molecular weight of 20.68 x 10fi for Ad FL DNA. The Ad FL DNA molecule shown in Fig. 1 is in a circular form. Since it forms singlestranded circles upon renaturation of denatured double-stranded DNA we may conclude that it carries an inverted terminal repetition as was observed previously for Ad FL DNA (Larsen and Nathans, 1977) as well as for the DNA from other adeno-
ADENOVIRUS
STRAIN
3
FL
viruses (Garon et al., Dressler, 1972).
1973; Wolfson
Denaturation
of Ad FL DNA
Mapping
and
As a prerequisite for our studies on the replication of Ad FL DNA, we determined a partial denaturation map with respect to the three EcoRI fragments (Fig. 2). In agreement with the convention of defining the most AT-rich end of the DNA as the right end (Doerfler and Kleinschmidt, 1970; Mulder et al., 1974) and in keeping with the recently adopted proposal for orienting the physical maps of adenoviruses (Adenovirus Strand Nomenclature: A Proposal; J. Viral. 22, 830-831 (1977)) we have retained the orientation of the map originally published by Larsen and Nathans (1977). Of all the criteria listed in this proposal, the distribution of AT-residues is the only one applicable at the present time to Ad FL DNA. Map positions of restriction enzyme fragments as used in this study are thus based on the orientation identified through this denaturation map. Growth,
?f’Ad
FL ill Permissive
Cells
The kinetics of growth of Ad FL on 3T3 cells was analyzed both as a function of the multiplicity of infection and as a function of time. In these experiments, the extent of viral DNA synthesis was determined following lysis of the cells on top of alkaline sucrose gradients and subsequent centrifugation in the presence of human adenovirus DNA as a marker. As shown in Table 1, the time of the first appearance of newly synthesized viral DNA depends on the multiplicity of infection (m.0.i.). With multiplicities even lower than 0.10 PFUicell DNA synthesis may not occur until 100 hr after infection. Our studies show that 35 hr is the minimum time required for the appearance of viral DNA synthesis. No earlier synthesis was observed even with multiplicities of up to 800 PFUicell. In these experiments, viral DNA was labeled for 2 hr with [“Hlthymidine for various hours postinfection (pi). The viral DNA when analyzed by alkaline sucrose gradient centrifugation sediments as a single peak and coincides with ‘s2P-labeled human ade-
TEMPLE
ET AL.
FIG. 1. Electron micrograph of single-stranded Ad FL DNA as compared marker DNA molecule. The Ad FL molecule in the lower left recircularized the presence of the inverted repetition.
novirus type 2 marker DNA (not shown). In addition, there is little or no faster sedimenting material in these gradients. This is an indication that host cell DNA synthesis
to a double-stranded upon renaturation
PM 2 due to
is shut off after infection similar to the situation in the human adenoviruses (Philipson and Lindberg, 1974). At early times after infection between 12 and 30 hr pi, the radio-
REPLICATION
OF MOUSE
activity from [“Hlthymidine is incorporated exclusively into fast sedimenting material which disappears concomitantly with the appearance of the viral DNA. Although the DNA synthesized in infected cells sediments as a single peak and appears in a manner typical of adenovirus DNA it was necessary to prove its viral origin. Intracellular viral DNA synthesized in infected 3T3 cells at the time of maximal DNA synthesis was isolated following a 12 hr pulse with [3H]thymidine between 50 and 62 hr pi. Viral DNA was extracted from the infected cells by a modified Hirt procedure @chilling et al., 1975) and purified through phenol extraction and chromatography on BND-cellulose. Restriction enzyme digest patterns were determined subsequently by electrophoresis of the respective digests with various restriction enzymes. The observed patterns (not shown) were found to be identical to those observed previously with the DNA isolated from virions (Larsen and Natzans, 1977). The DNA produced in infected cells is thus indistinguishable on the basis of these cleavage patterns to that in virus particles. Replication Cells
of AD FL DNA
in Permissive
The replication of Ad FL DNA was studied employing techniques similar to those previously used in the human systems (Winnacker, 1978). In particular, we determined the approximate length of time required for one round of viral DNA replication as well as the location of origins and termini of DNA synthesis. Viral DNA was lolal
1
DNA
I
I
B
A EcoRl
I C
fragments
FIG. 2. Partial denaturation map of Ad FL DNA. The map is the result of an analysis on 17 intact DNA molecules. The EcoRI fragments were positioned with maximal overlap to the intact molecule. According to accepted conventions, the AT-rich end represents the right-hand end of the DNA molecule.
ADENOVIRUS
STRAW
FL TABLE
DEPENDENCE ON THE
OF THE ONSET
MULTIPLICITY
OF Ad
FL
DNA
OF INFECTION SYNTHESIS”
Time of appearance of Ad FL DNA (hours pi)
PFUicell 0.1 0.3 0.8 1.4 3.0 14.0 800.0 This kinetic centrifugation
1
60 60 60 47 36 38 35 analysis on alkaline
was performed by gradient sucrose gradients (see text).
pulse labeled with [3H]thymidine for a pulse period shorter than the time necessary for one round of DNA replication. Then, if only completed molecules are analyzed, there will be relatively more label at the termini of replication as compared to the rest of the molecule. Experimentally, this is determined by comparing the distribution of radioactivity along the viral genome in pulse-labeled viral DNA to that of uniformly labeled DNA molecules. The results of these experiments are shown in Fig. 3. Viral DNA in infected cells was labeled for 5 and 20 min with C”H]thymidine, isolated as described, and treated with the restriction enzymes HpaI (5-min pulse) or BamHI (20min pulse). In the case of the mature DNA labeled for 5 min, there is relatively more label in the terminal fragments, HpaI-C and HpaI-F, as compared to the internal fragments. Depending on the size of the terminal fragments, the increases in relative activity (Fig. 4) varied between 6 and 9 with a greater increase in specific activity found for the smaller fragment. However, after 20 min of labeling, there is little if any more label in the terminal fragments (BarnHI-D and BamHI-F). These results demonstrate that the termini of replication are located at or close to both molecular ends of the viral genome and that the time required for completion of one round of DNA synthesis is less than 20 min. The method used to separate the double-stranded, completed molecules from the single-stranded replication
6
TEMPLE
1
5 _-
_
_
_ _
_ _
_
_ _ _
_ _
_ _ _
_ -
_ _
_
_
_
_
_ _ _
_ _ -5
-
D’
E
I
A
’
C
‘E’-
Born
Hl
FIG. 3. Distribution of radioactivity in completed molecules of pulse-labeled Ad FL DNA. Infected ST3 cells were pulse-labeled with [,‘H]thymidine (100 &i.’ ml) for 5 or 20 min at 69 hr pi. In order to obtain uniformly labeled DNA, cells were labeled for 17 hi between 60 and 77 hr pi with (“C]thymidine (10 FCi/ ml). Mature viral DNA was extracted and digested with the restriction endonucleases Bant HI and HpnI (see text). The digests were analyzed on composite polyacrylamideiagarose gels. The amount and ratios of label in the pulse-labeled fragments Lvere computed and normalized relative to the fragment \vith the lowest specific activity. (O), HpnI digest (3 min pulse); (01, Barr/ HI digest (20.min pulse!.
forms was chromatography on BND-cellulose. This permitted isolation not only of the double-stranded but also the singlestranded forms of the viral DNA and of a study of their possible role in viral DNA replication. Shown in Table 2 is the distribution of label in single-stranded and doublestranded material eluted from BND-cellulose as a function of pulse time. For very short pulses (5 mins) there is approximately 4-5 times as much single-stranded as double-stranded material. However, as the pulse time increases, the ratio between these two forms decreases indicating the
ET AL.
expected accumulation of completed DNA molecules. After a 2-hr pulse, more than two-thirds of the radioactivity exists in the double-stranded form. While these experiments establish the location of termini of replication they do not permit conclusions as to the sites of origins of DNA replication. In order to answer this question we examined the distribution of label in separated strands of terminal restriction enzyme fragments of pulselabeled Ad FL DNA. Viral DNA was pulselabeled for 15 min with [“Hlthymidine, isolated, and subjected to restriction enzyme digestion. Terminal fragments were analvzed for the distribution of pulse-label in their complementary strands by gel electrophoresis. The results are summarized in Table 3. There is relatively more label in the fast-moving strands of both the Eco RI-B and C fragments in the case of uniformly labeled viral DNA. However, in pulse-labeled DNA there is more label in the slow-moving strands of both terminal fragments. After correction for the asymmetric distribution of label in uniformly labeled DNA as discussed above, there is approximately five times more label in the slow-moving strands of both fragments. This asymmetric mode of the distribution of pulse-label certainly is compatible with the conclusion that the sites of origin of DNA replication are located close to the molecular termini of the viral DNA. Furthermore, it has been possible to label the free (internal) 5’ end of the EcoRI-B fragment with [:“P]phosphate using polynucleotide kinase and to identify this label in the slow-moving strand of this fragment. Our results thus agree with a mechanism of replication in which initiation occurs at the end of the DNA and proceeds in the 3’ direction.
The Primary Termini
Sequence oj’ the Molecular qf’AD FL DNA
The primary sequence of the molecular termini of Ad FL DNA was interesting in terms of the extent and structure of the terminal repetition. From the work of Tolun et al. (1979) it was apparent that there is considerable homology in the terminal repeats of several human adenovirus sero-
REPLICATION
OF MOUSE
ADENOVIRUS
STRAIN
7
FL
Hindlll
I I :Hpan ,smai: 1 I I I I I I 8 I I I
I :I
Alu i4p.n I
-1__
npa
II
I
HP0 II Smo I __--
--._ *--
Hha
1
FIG. Ad FL Nathana ments depict ANI I,
Aval AvaI Hae Ill Hpa lI
I6 : I
AvaI
,I I I I
__--
8 Small 8 I
I I I I I
__*-
I I 1 I
8 i
Ava 1 HqeIU Hha
1
4. Sequence strategy for the determination of the primary sequence of the molecular termini of DNA. The map positions of the terminal RanzHI fragments were taken from Larsen and (1977). These fragments were 5’ end-labeled and the order of HaeIII, HpnII, and AvaI fragdetermined according to Birnstiel and Smith (1976). The arrows in the lower part of the figure the sequenced strands which had been end-labeled, as indicated, at their respective HneIII, or HpnII 5’ termini.
types as well as that of simian adenovirus type 7. We first determined a series of restriction enzyme sites yielding fragments located close to the ends of the viral DNA. Their map positions were identified using the technique of Smith and Birnstiel(19’76). The final locations of various cleavage sites as well as an outline of the adopted sequencing strategy are depicted in Fig. 4. The strategy relies mainly on the AvaIIHaeIII site at position 67. This protocol permitted us to sequence across the SmaI sites at position 90 which terminates the inverted repetitions. There is thus no doubt about the location of the transition point from the repeat to unique sequences on either end. In the course of these studies it was observed that it is impossible to label the 5’ ends of intact Ad FL DNA in the T4 polynucleotide kinase catalyzed reaction with -y-32P-labeled ATP.
This had been previously observed with DNA from human adenoviruses (Carusi, 1977) and was believed to be due to a few TABLE BND-CELLULOSE
CHROMATOGRAPHY
PULSE-LABELED
Pulse time (min) 5 10
20 60 120
2
WITH
OF Ad FL
DNA
[3H]T~~~~~~~~”
Doublestranded DNA (ds)
Singlestranded DNA (4
ss/ds
42,300 58,700 67,500 466,600 656,850
204,000 184,700 234,150 468,900 319,400
4.52 3.15 3.47 1.01 0.64
a Two 35-mm petri dishes were and labeled for the indicated 100 &i/ml.
used per time point time periods with
TEMPLE TABLE
3
DISTRIBUTION OF RADIOACTIVITY IN THE SEPARATED STRANDS OF THE TERMINAL FRAGMENTS EcoRI-B AND EcoRI-C OF Ad FL DNA AS A FUNCTION OF PULSE TIME Uniformly labeled DNA Fragment
Pulse-labeled DNA
cw
Ratio
w
Ratio
Ratio”
EcoRI-B Slow Fast
586 1149
0.51
1241 513
2.4
4.7
EcoRI-C Slow Fast
870 1408
0.62
666 206
3.2
5.2
(’ This value is corrected for the relative thymidine content in the separated strands as determined from the radioactivity in uniformly labeled DNA.
remaining amino acid residues from the terminal protein blocking the 5’ ends of the viral DNA. We thus conclude that Ad FL DNA also carries a protein (Larsen and Nathans, 1977) linked to the 5’ ends of the viral DNA. Figure 5 shows a sequencing gel of both molecular termini of Ad FL DNA using the 5-labeled terminal AvaI fragments. The sequence ladders which can be read up to a terminal G-residue thus identify regions preceding the 3’ termini of the viral DNA. We have also identified the primary sequence of the opposite strands using a 67 base pair terminal Hoe111 fragment labeled at its internal 3’ end with [oz-“~P]CTP incorporated in vitro in the presence of terminal transferase (Roychoudhury et al., 1976). There is no indication that either of the two sequence ladders reaches further than the indicated sequences. The sequence of the molecular termini of Ad FL DNA which extend beyond the terminal repetition up to position 190 are shown in Fig. 6. They are compared in Fig. 7 to terminal sequences from other adenoviruses as presented by Tolun et al. (1979). DISCUSSION
This study describes a variety of parameters which establish mouse adenovirus strain FL as a typical adenovirus. Larsen
ET AL.
and Nathans (1977) have measured the length of double-stranded Ad FL DNA by electron microscopy with respect to a form II SV 40 DNA standard in order to arrive at a value of 20 x 10” for its molecular weight. However, when they determined the length electrophoretically or averaged the electron microscopic measurements, the value they obtained was 19.5 x 10”. They ascribe this descrepancy to the pesence of broken or shorter molecules in the total population. Using single-stranded Ad FL DNA circles and a relaxed, double-stranded PM 2 DNA standard, we arrive at a value of 20.7 x 10”. All these results agree well with each other and show that Ad FL DNA is smaller than human adenovirus DNA. LEFT
RIGHT
-30
A A A
-A0
P‘IG. 5. Sequencing gels of the molecular termini of Ad DL DKA. The two terminal ,4/w I fragments from the left and right molecular end Lvere 5’ em-labrlc(l using y-“P-labeled ATF’ and polynucleotidr kinaar. Only the internal ,i’ entle arr labeled since the external 5’ ends are blocked for the kinase-catalyzetl reaction. Following base specific fragmentation the digest:: 11cw analyzed on 1.X polyacrylamidt~ gels (Masam and Gilbert, 1977). The four tracks from c%ch terminal fragment represent G. G/A, V./T. and (’ specific frapmentations, respectively. The sequences when read from the bottom to the top, as indicated. define thr stranda ending with the molecular 5’ termini.
REPLICATION RIGHT
OF MOUSE
ADENOVIRUS
STRAIN
9
FL
END
5'-tATCATUATAATATACAGTTAGCAAAAAATGGCGCCTCG 3'-GTAGTAGTTA~ATATGTCAATCG~~ACCGCMjAAAGTGC LEFT
END
5'-CATCATCAATAATATACG~AGC~TGGCGCCTTTGT~GGC~TGTTCC~CTG~~TG~CCCGAGTTGGGT~CGT~CCCGGG~TGACG 3'-GTAGTAGTTATTATATGTCAATCG~ACCGCGGAAACTGC 10
RIGHT
20
30
10
50
60
70
80
90
100
END
TGGTGCGTCAGGTCATG~GAG~ATAUIT(jT1CGTGTGTG~TGTGCTTGTGTAAAtGAG~GG~~~CTTtTT-----ACCACGUIGTCCACTACAACTCAAAAATATGTACAAAtACCGCTGTGCTGT-----LEFT
END
TGT6AAAAGU;TCTffitAACTmGAtACTGTACCAACTGTGTTGTACCGTG~~GGTGTACG~~~TG~CTGTCGT~T~G~CC--ACACTmCCCAGACCCTTGAGT~A~TGG~GA~~CACGG--110
120
Frc. 6. The primarv _ “_sequence tion is 93 base pairs long.
130
1.0
of the molecular
150
160
termini
incorporated into this length of doublestranded DNA molecule are several features typical for adenoviruses. There is evidence for a protein linked to the 5’ ends as well as for an inverted terminal repetition. Larsen and Nathans (1977) provided the first evidence for a terminal protein when they observed reduced electrophoretie mobility of the terminal restriction fragments of DNA prepared under conditions which preserve the terminal protein (Robinson et al., 1973) and that protease treatment of these fragments eliminated this effect. By virtue of our unsuccessful attempts to label the 5’ termini in the T4 polynucleotide kinase catalyzed reaction with [Y-~~P]ATP we provide additional indirect evidence for the presence of the terminal protein and to its exact location on the viral DNA. Because denatured Ad FL DNA forms singlestranded circles, Larsen and Nathans (1977) concluded that there must be an inverted terminal repetition at the termini. We have confirmed this observation and, in addition, provided direct evidence by determining the primary sequence of both molecular ends of Ad FL DNA. The partial denaturation map of Ad FL DNA (Fig. 2) clearly shows that the AT distribution is asymmetric, thus allowing us to arrange the map according to one of the criteria adopted by Sharp and others for
170
of Ad FL DNA.
180
The inverted
190
terminal
repeti-
adenovirus physical map orientations which defines the most AT-rich end as the righthand end. An orientation was important because we relied heavily on the restriction enzyme maps previously determined by Nathans and co-workers (Larsen and Nathans, 1977; Larsen et al., 1979). The orientation according to accepted conventions leads to an alignment of the restriction maps identical to that originally proposed by Larsen and Nathans (1977) but opposite to the one recently proposed by Larsen et aI. (1979). A final settlement of this question will have to await the elucidation of transcription maps. The SmaI site at position 90 from the left as well as from the right molecular end coincides with the end of the terminal repeat which is 93 base pairs long. This is shorter than the repeats of Ad 2 and Ad 5 DNA (102 bp), Ad 3 (136 bp), SA 7 (120 bp) and Ad 12 (>160 bp) (Tolun et al., 1979). The first 17 base pairs are identical to the first 17 positions in Ad 2 and Ad 5 DNA, and the base pairs located in positions 9-17 of Ad FL DNA are common to all known adenovirus termini (Fig. 7). However, the internally located regions of homology observed by Tolun et al. (1979) between human adenoviruses serotypes 2, 3, 5, and 12 as well as simian adenovirus type 7 are absent in Ad FL DNA. If there is a universal adenovirus origin
lo
io 40
50
TTATAGATGGMTGGTGCCAACATGTAAATGAGGTAATTT 60
Go
Ho
AAAAAAGTGCGCGCTGTGTGTGATTGGCTGCGCG ;0
“, ,,.,
.,
FIG. 7. A comparison of the primary sequences of the molecular termini of different adenoviruses. The data for SA 7, Ad 12, Ad 2, and Ad 3 are taken from Tolun et CC/. (1979). The dashed lines at the termini of SA 7, Ad 12. and Ad 3 represent positions which have not been determined. The box indicates the sequence common to all adenovirus termini. The sequence above the Ad FL DNA sequence are polyoma virus DNA sequences, taken from Soeda et al. (1980). The upper-most line represents polyoma DNA sequences which are not homologous with Ad FL DNA but which are continuous with the polyoma DNA sequence between positions 72 and 109, numbered according to Soedacf al. (1980). The sequence labeled lo-16 is part of the polyoma origin of DNA replication.
i0
--CTCTA
5'
Ad
3
CATCATC
5'
Ad 2
TTATTTTGGATTGAAGCCAATATGATAATGAGGGGGTGGAGTTTGTGACGTGCGGGGCG
TTATACTGGACTAGTGCCAATATTMAATGAATGGGCGTATTTGATTGGGTGGAGGTGTGGCTTTG
-----TA
5'
10 16 TGGCCCG
12
CATCATC
Ad
5' TTATTTGGGAACGGTGCCAATATGCTAATGAGGTGGGCGCTGGGCGGAGTAGG
GGG 1 1 109 GCT TG CCA
G /\
5’----ATC
\
SA 7
GGAGGC
Ad FL
CAGGAC
”
REPLICATION
OF MOUSE ADENOVIRUS
sequence, the most likely candidate in terms of the greatest degree of sequence homology would be the base pairs in position 9- 17, 5’ATAATATAC-3’. It is interesting to note in this context that Ad FL DNA can be replicated efficiently in an in vitro system derived from nuclear extracts of HeLa cells infected with human Ad 2 DNA (Th. Reiter and E. L. Winnacker, unpublished). The observed nonpermissivity of human cells for Ad FL thus appears not to be based on a restriction for viral DNA replication. In addition to the homologies between the different adenoviruses, Tolun et al. (1979) were able to point out and to discuss homologies between the genomes of the adenoviruses and the papova virus SV40. In Ad FL DNA, a region of 7 base pairs, 5’-TGGCCCG-3’, at positions 65-71 is homologous to a sequence at positions lo-16 within the origin of polyoma DNA replication (Soeda et ul., 1980). Since Ad FL and polyoma virus have nothing more in common than their respective host, the mouse, it is suggestive to point out that this region represents binding and/or recognition sites for host enzymes necessary for viral DNA replication. Whether this region is really essential and host-specific remains to be determined by functional studies. The observed homology region of 7 base pairs between the terminal repeat of Ad FL DNA and in the origin region of polyoma virus is not identical but related to a sequence (5’-TGGGCGGAGTT-3’) which is shared by simian adenovirus type 7 and SV40 DNA (Subramanian and Shenk, 1978) in their origin regions and which has also been observed in BK-virus DNA in its origin of DNA replication (Seif et al., 1979). A total of 22 base pairs in stretches of 2,3, 5, and even 9 base pairs in the inverted repeat of Ad FL DNA as indicated in Fig. 7 are homologous to regions close to but somewhat outside the proposed origin of polyoma DNA replication (Soeda et al., 1980). The significance of these extended homologies remains unknown at the present time. Their location, however, suggests, that they might represent part of a cellular origin of DNA replication.
STRAIN
FL
11
ACKNOWLEDGMENTS The authors are indebted to Dr. Nathans and Larsen for the original strain of adenovirus FL. We gratefully acknowledge the excellent technical assistance of Ilse Pfitzinger and Alois Moosbauer. This work was supported by the Deutsche Forschungsgemeinschaft, grants Wi 31915 and 31916. REFERENCES ALLET, B., JEPPESON, P. G. N., KATAGIRI, K. J.. and DELIUS, H. (1973). Mapping the DNA fragments produced by cleavage of lambda DNA with endonuclease RI. Nature (London) 241, 120-123. CARUSI, E. A. (1977). Evidence for blocked termini in human adenovirus DNA. Virology 76, 380-394. DAVIS, R. W., SIMON, M., and DAVIDSON, N. (1971). Electron microscope heteroduplex methods for mapping regions of base sequence homologies in nucleic acids. In “Methods in Enzymology” (L. Grossman, and K. Moldave, eds.), Vol. 21, pp. 413-428. Academic Press, New York. DAVIDSON, N., and SZYBALSKI, W. (1971). Physical and chemical characterization of Lambda DNA. 111 “The Bacteriophage Lambda” (A. D. Hershey, ed.), pp. 45-82. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. DELIUS, H., and CLEMENTS, J. B. (1976). A partial denaturation map of Herpes simplex virus type 1 DNA. Evidence for inversions of the unique DNA regions. J. Gen. Viral. 33, 125-133. DOERFLER, W.. and KLEINSCHMIDT, A. K. (19’70). Denaturation pattern of Adenovirus type 2 as determined by electron microscopy. J. Mol. Biol. 50, 579-593. GARON, C. F., BERRY, K., and ROSE, J. (1972). A unique terminal redundancy in adenovirus DNA molecules. Proc. Nat. Acad. Sci USA 69,2391-2395. HARTLEY, J. S., and ROWE, W. P. (1960). A new mouse virus apparently related to the adenovirus group. Virology 11, 645-647. LARSEN, S. H., and NATHANS, D. (1977). Mouse adenovirus: Growth of plaque-purified FL virus in cell lines and characterization of viral DNA. Virology 82, 182-195. LARSEN, S. H., MARGOLSKEE, R. F., and NATHANS, D. (1979). Alignment of the restriction map of mouse adenovirus FL with that of human adenovirus 2. Virology 97, 406-414. LECHNER, R. L., and KELLY, T. J. (1977). The structure of replicating adenovirus type 2 DNA molecules. Cell 12, 1007-1020. MAXAM, A., and GILBERT, W. (1977). A new method for sequencing DNA. Proc. Nat. Acad. SO. liSA 74, 560-564. MULDER, C., ARRAND, J. R., DELIUS, H., KELLER.
TEMPLE W., PETTERSSON. U., ROBERTS, R. J., and SHARP, P. A. (1974). Cleavage maps of DNA from adenovirus types 2 and .5 by restriction endonucleases Eco RI and Hpa I. Cold .S’pril/g Harhw Symp. Qxnut. Bid. 39, 397-400. PHILIPSOK, L., and LINDBERG, U. (1974). Reproduction of adenoviruses. I?( “Comprehensive Virology.” Vol. 3, pp. 143-227. Plenum Press, New York. PHILIPSON, L. (197i). In vitro recombinant DNA research in mammalian cells facts and speculation. In “Pancreatic Beta Cell Culture,” pp. 173-179. Excerpta Medica. Amsterdam-Osford. PINA, M., and GREEN, M. (1965). Biochemical studies on adenovirus multiplication. IX. Chemical and base composition analysis of 28 human adenoviruses. Proc. ‘Vat. Acad. Sci. l:SA 54, 547-551. ROYCH~~DHURY, R., .JAY. E.. and WV, R. (19i6). Terminal labelling and addition of homopolymer tracts to duplex DNA fragments by terminal deoxynucleotidyl transferase. Njrcluic Acid Rrs. 3, 863-878. SEIF, I., KHOURY. G., and DHAK, R. (1979). The genome of human papovavirus BKV. Ccl/ 18, 963-977. S~HTH, H. O., and BIRNSTIEL, M. L. (1976). A simple method for DNA restriction site mapping. A;/cclelc Acid Res. 3, 2387-2398. SOEDA, E., ARRAND, d. R., SMOLAR, N., WALSH, .J. E., and GRIFFIN. B. E. (1980). Coding potential and regulatory signals of the polyoma virus genome. Nature (Lortdoni 283, 449-453. SUBRAMANIAN, K. N., and SHENK, T. (197X). Definition of the boundaries of the origin of DNA replication in simian virus 40. NJtcleic Acid Res. 5, 3635-3642. SUTCLIFFE, J. G. (1978). Complete nucleotide seyuence
ET AL. of the Escherichia Coli plasmid pBR 322. (‘old Spriicg Harbor Syrnp. Q/m/f. Bid. 43, 77-90. STOBNER. D.. and BUJARD, H. (1977). Electron microscopy of DNA: Determination of absolute molecular \veights and linear density. MO/~. (;P)/. Gvm+ics 154, 299-303. THOMIIAS, C. A.. and ABELSON, J. (1966). The isolation and characterization of DNA from bacteriophage. Iti “Procedures in Nucleic Acid Research” (Cantoni and Davis. eds.), Vol. 1, pp. 5.53-561. TOLUN. A., ALESTROM, P., and PETTERSSON, U. (1979). Sequence of inverted terminal repetitions from different adenoviruses. Demonstration of conserved sequences and homology between SA 7 termini and SV 40 DNA. Call 17, 705-713. WALTERS, R. A.. and HILDEBRAND. C. E. (1975). A procedure for the rapid lgsis of mammalian cells priot to alkaline sucrose gradient centrifugation. Bioc//iw. Riol-‘l/ys. ilcfn 407, 120-124. WEIKGBRTNER, B., WINNACKER, E. I,.. TOLUN. A., and PETTERSSON. IT. (1976). Two complementary strand-specific termination sites for adenovirus DNA4 replication. C’ell 9, 259-268. WIGAND. R.. GELDERBLOM, H., and OZEL, M. (1977). Biological and bioyhysical characteristics of mouse adenovirus strain FL. Arch. Vid. 54, 13-142. WIK‘NACKER, E. L. (1975). Adenovirus type 2 DNA replication. I. Evidence for discontinuous DNA synthesis. J. V/im/. 15, 744-756. WINNACKER, E. I,. (1978). Adenovirus DNA: Structure and function of a novel replicon. Cc/l l-t, 761-773. ~~Ir;o~OUR, E. (1963). Purification of polyoma virus. Virology 19, 15X- 168. WOLFSON, .J., and DRESSLER, D. (1972). Aclenovirus tgpe 2 DNA contains an inverted terminal repetition. Proc. ,2Tat. Acad. Sci. CS’A 69, 3054-3057.
109,
l-12
(1981)
Replication M. TEMPLE, /t!sfitut,f’ur
G. ANTOINE, Bioch~mie.
Gniuersitdt
*EMBL,
of Mouse Adenovirus H. DELIUS,” Mtincken,
Posffach
S. STAHL,
Strain
ANDERNST-L.
Karlstrasse 29, D-8000 Miincherl 10.2209, 6.9 Heidelberg. West Germa’ny
Accepted
July
FL DNA WINNACKER
2, West Gwmany,
axd
22. 1980
tion map presented in the present paper. Its orientation according to accepted conventions leads to an alignment of the restriction enzyme maps identical to that originally proposed by Larsen and Nathans (1977) but opposite to their later proposal (Larsen et al., 1979).
INTRODUCTION
Mouse adenovirus strain FL (Ad FL) was originally isolated by Hartley and Rowe (1960) and defined as a typical adenovirus on the basis of its biological properties. This conclusion was confirmed both by Wigand (197’7) and Larsen and Nathans (1977) studying virion architecture as well as certain structural features of its linear DNA molecule. Larsen et al. (1979) also established the molecular basis for the cross-reactivity of Ad FL with sera from guinea pigs infected with human adenovirus type 2 by identifying regions of homology in Ad FL and human Ad 2 DNA. Our interest in the biology of this virus stems from our preoccupation with adenovirus DNA replication (Winnacker, 1978) as well as from its potential use as a eukaryotic vector system (Philipson, 1977). The replication pattern of Ad FL DNA was thus determined using techniques previously employed in the human adenovirus systems. In analyzing the distribution of pulse label along the viral genome as well as in separated strands of terminal restriction enzyme fragments, the asymmetric pattern of displacement and complementary strand synthesis typical and characteristic for human adenoviruses (Lechner and Kelly, 1977) could be established for Ad FL DNA. The particular role of the molecular termini as origins and termini for viral DNA replication (Winnacker, 1978) prompted us to determine their primary DNA sequence. The inverted terminal repetition of 93 base pairs contains striking homologies both to the human adenoviruses as well as to polyoma virus. Our studies relied heavily on previous restriction enzyme maps by Larsen et al. (1977, 1979) as well as on a partial denatura-
MATERIALS
AND
METHODS
Cells. Mouse 3T3 cells (ATTC CCL 163; Flow Laboratories) were grown in monolayers in Dulbecco’s medium supplemented with 10% newborn calf serum (Flow). Mouse L cells (LS cells; Flow Laboratories Cat. Nr. 03-449) were grown in suspension culture in spinner medium containing 10% new born calf serum. All cells were grown in an atmosphere consisting of air and 5% CO,. Virus. The virus is mouse adenovirus strain FL originally isolated by Hartley and Rowe (1960). Our original stock was kindly provided by Dr. D. Nathans. This stock had been plaque purified from virus obtained from Microbiology Associates, Bethesda, Maryland (Larsen and Nathans, 1977). The virus used in our studies was grown from a single plaque obtained after plating the original stock on mouse 3T3 cells. For virus production on 3T3 cells, subconfluent monolayers were washed once with a mixture of one part of Dulbecco’s medium and one part of Tris-buffered saline (Winocour, 1963). The virus, diluted appropriately in the same buffer, was added in 5% of the volume of medium to be added later for growth. The virus was permitted to adsorb for approximately 1 hr and medium consisting of Dulbecco’s medium supplemented with 2% newborn calf serum was then added to the cultures. For growth of the virus on L cells, cells were pelleted from suspension cultures 1
00456822/81/030001-12$02.00/O Copyright All nyhts
C 1981 t,y Academic Press, Inc. of reproductmn in any form resenwl.
2
TEMPLE ETAL
by centrifugation at 800 g, resuspended in pipet and recentrifuged at least once more 5% of the original volume of medium suppleto equilibrium. The band was collected and mented with 2% fetal calf serum, and dialyzed for at least 6 hr against 1000 infected with the appropriate amount of volumes of buffer containing 10 mM Trisvirus. The suspension was stirred for 1 hr at hydrochloride, pH 8.0, 0.25 M sodium 37”, diluted to the original volume, and chloride, 1 mM EDTA, and 10 n-&f magstirred for 7 days at 37”. In order to deternesium chloride. mine virus titers, 3T3 cells were infected Isolation of viral DNA. Dialyzed virus with appropriate dilutions of virus as particles were treated for 2 hr at 37” with described above. Following an adsorption proteinase K (100 lgiml) in the presence of period of 1 hr at 37”, an overlay consisting of 0.5% SDS. Protein was removed with TE Dulbecco’s medium, 5% fetal calf serum, (10 m&f Tris-hydrochloride pH 7.8, 1 m&f and 0.8% agarose (Sigma Nr. A 6877) was EDTA) saturated phenol essentially as applied. Incubation followed at 37” for 4-6 described by Thomas and Abelson (1966). days. A second overlay of the same composiViral DNA was dialyzed extensively against tion as above except for the addition of 20 mJ4 Tris-hydrochloride pH 8.0, 50 mZb’ 0.02% neutral red was added at that time. sodium chloride, and 1 mJ4 EDTA. Isolation Plaques were counted approximately 15 hr of viral DNA from infected cell monolayers later. Human adenoviruses types 2 and 5 was accomplished essentially according to were grown and labeled as described by Schilling et al. (1978). Completed, doubleWeingarnter et al. (1976). stranded molecules were separated from the PuriJication of virus particles. The first replication forms by chromatography on step in virus isolation was essentially as benzoylated, naphthoylated DEAE-celludescribed by Larsen and Nathans (1977). lose (Schilling et al., 1975). As a final step the The medium from infected cells was dis- DNA was precipitated with two volumes of carded and replaced with 2 ml Dulbecco’s isopropanol in the presence of 0.3 M sodium medium per 75 cm* flask. Cells were frozen, acetate and then dialyzed into DNA buffer. thawed, and loo-ml portions were sonicated Alkaline or neutral sucrose gradients were for 30 see with a Branson sonifier (model carried out in 4.6-ml tubes essentially as B-12 A) set for maximum output. The soni- described by Winnacker (1975). In both cate was then centrifuged for 10 min at 3000 cases, the samples were layered onto the rounds/min in the SS 34 rotor to remove cell gradients in the presence of 1 mgiml heparin debris. Approximately 30 ml of cell extract (Sigma Nr. H-0880) according to Walters was layered on a step gradient of 3 ml of and Hildebrand (1975). Molecular weight determirmtioxs. For cesium chloride of a density of 1.5 g/cm” and 5 ml cesium chloride of a density of 1.2 g/cm”. electron microscopy length measurements, The cesium chloride solutions were made in the DNA was spread with cytochrome c 0.02 M Tris-hydrochloride pH 8.7. The using the formamide spreading technique relatively high pH is critical due to the acid- described by Davis et al. (1971). The DNA was spread from a hyperphase containing ity of the 3T3 cell extract. Centrifugation followed at 4” for 90 min at 24,000 rounds/ 30% formamide, 0.1 M Tris-hydrochloride, min in a AH-627 rotor (Dupont/Sorvall). The pH 8.5, and 1 m&f EDTA onto a hypophase containing 10% formamide, 10 mM Trisresulting band which appeared at the interhydrochloride, pH 8.7, and 1 mM EDTA. face between the medium and the cesium Samples were picked up on parlodionchloride layers was collected from the bottom with a Pasteur pipet after removing covered copper grids, stained with uranyl and discarding the bottom-most 2-4 ml of acetate, and rotary shadowed with platicesium chloride. The collected material was num. Relaxed circular PM 2 DNA was used as internal length reference (MW: 6.64 distributed into DupontiSorvallO3127 tubes and centrifuged to equilibrium for at least 3 x 10”; Sttibner and Bujard, 1977). For the circularization of the single-stranded DNA, hr in a Dupont/Sorvall TV 865 vertical rotor. The major band appeared at a density of a sample of DNA was completely denatured by heating a glass tube containing 50 ~1 Ad 1.34 g/cm”. It was collected with a Pasteur
REPLICATION
OF MOUSE
FL DNA (5 pgiml) in 60% formamide, 10 mM sodium phosphate, pH 7.0,l n-J4 EDTA for 90 set in boiling water. After addition of sodium perchlorate to a final concentration of 0.2 M, the sample was incubated for 5 min at 37”. An aliquot of the sample was prepared for electron microscopic analysis by the formamide spreading procedure. Partial denaturation mapping. The partial denaturation mapping was performed as described by Delius and Clements (1976). Fine mapping and DNA sequencing. Sequence analysis was carried out according to the procedure of Maxam and Gilbert (1977) except that the 0.5 mm gels were run at 600 V and warmed to 50” with circulation water. Restriction enzyme fragments were labeled at the 5’ end under the conditions for labeling protruding 5’ ends (Maxam and Gilbert, personal communication). The y-labeled [B2P]ATP used in this procedure was purchased from Amersham (5000 Ci/ mmol). The position of restriction sites was determined by the method of Smith and Birnstiel(l976). The length of the fragments was determined by electrophoresis on 5% polyacrylamide in the presence of fragments of known length from an Alu 1 digest of plasmid pBR 322 DNA (Sutcliffe, 1978). Conditions for gel electrophoresis on polyacrylamide gels were taken from Maxam and Gilbert (personal communication). RESULTS
Determination
of’ the Size cf AD FL DNA
Length measurements of Ad FL DNA were performed by electron microscopy on single-stranded Ad FL DNA as compared to a double-stranded PM 2 marker DNA (Fig. 1). By taking the molecular weight of PM 2 DNA to be 6.64 x 10’ (Sttibner and Bujard, 1977), we arrive at a molecular weight of 20.68 x 10fi for Ad FL DNA. The Ad FL DNA molecule shown in Fig. 1 is in a circular form. Since it forms singlestranded circles upon renaturation of denatured double-stranded DNA we may conclude that it carries an inverted terminal repetition as was observed previously for Ad FL DNA (Larsen and Nathans, 1977) as well as for the DNA from other adeno-
ADENOVIRUS
STRAIN
3
FL
viruses (Garon et al., Dressler, 1972).
1973; Wolfson
Denaturation
of Ad FL DNA
Mapping
and
As a prerequisite for our studies on the replication of Ad FL DNA, we determined a partial denaturation map with respect to the three EcoRI fragments (Fig. 2). In agreement with the convention of defining the most AT-rich end of the DNA as the right end (Doerfler and Kleinschmidt, 1970; Mulder et al., 1974) and in keeping with the recently adopted proposal for orienting the physical maps of adenoviruses (Adenovirus Strand Nomenclature: A Proposal; J. Viral. 22, 830-831 (1977)) we have retained the orientation of the map originally published by Larsen and Nathans (1977). Of all the criteria listed in this proposal, the distribution of AT-residues is the only one applicable at the present time to Ad FL DNA. Map positions of restriction enzyme fragments as used in this study are thus based on the orientation identified through this denaturation map. Growth,
?f’Ad
FL ill Permissive
Cells
The kinetics of growth of Ad FL on 3T3 cells was analyzed both as a function of the multiplicity of infection and as a function of time. In these experiments, the extent of viral DNA synthesis was determined following lysis of the cells on top of alkaline sucrose gradients and subsequent centrifugation in the presence of human adenovirus DNA as a marker. As shown in Table 1, the time of the first appearance of newly synthesized viral DNA depends on the multiplicity of infection (m.0.i.). With multiplicities even lower than 0.10 PFUicell DNA synthesis may not occur until 100 hr after infection. Our studies show that 35 hr is the minimum time required for the appearance of viral DNA synthesis. No earlier synthesis was observed even with multiplicities of up to 800 PFUicell. In these experiments, viral DNA was labeled for 2 hr with [“Hlthymidine for various hours postinfection (pi). The viral DNA when analyzed by alkaline sucrose gradient centrifugation sediments as a single peak and coincides with ‘s2P-labeled human ade-
TEMPLE
ET AL.
FIG. 1. Electron micrograph of single-stranded Ad FL DNA as compared marker DNA molecule. The Ad FL molecule in the lower left recircularized the presence of the inverted repetition.
novirus type 2 marker DNA (not shown). In addition, there is little or no faster sedimenting material in these gradients. This is an indication that host cell DNA synthesis
to a double-stranded upon renaturation
PM 2 due to
is shut off after infection similar to the situation in the human adenoviruses (Philipson and Lindberg, 1974). At early times after infection between 12 and 30 hr pi, the radio-
REPLICATION
OF MOUSE
activity from [“Hlthymidine is incorporated exclusively into fast sedimenting material which disappears concomitantly with the appearance of the viral DNA. Although the DNA synthesized in infected cells sediments as a single peak and appears in a manner typical of adenovirus DNA it was necessary to prove its viral origin. Intracellular viral DNA synthesized in infected 3T3 cells at the time of maximal DNA synthesis was isolated following a 12 hr pulse with [3H]thymidine between 50 and 62 hr pi. Viral DNA was extracted from the infected cells by a modified Hirt procedure @chilling et al., 1975) and purified through phenol extraction and chromatography on BND-cellulose. Restriction enzyme digest patterns were determined subsequently by electrophoresis of the respective digests with various restriction enzymes. The observed patterns (not shown) were found to be identical to those observed previously with the DNA isolated from virions (Larsen and Natzans, 1977). The DNA produced in infected cells is thus indistinguishable on the basis of these cleavage patterns to that in virus particles. Replication Cells
of AD FL DNA
in Permissive
The replication of Ad FL DNA was studied employing techniques similar to those previously used in the human systems (Winnacker, 1978). In particular, we determined the approximate length of time required for one round of viral DNA replication as well as the location of origins and termini of DNA synthesis. Viral DNA was lolal
1
DNA
I
I
B
A EcoRl
I C
fragments
FIG. 2. Partial denaturation map of Ad FL DNA. The map is the result of an analysis on 17 intact DNA molecules. The EcoRI fragments were positioned with maximal overlap to the intact molecule. According to accepted conventions, the AT-rich end represents the right-hand end of the DNA molecule.
ADENOVIRUS
STRAW
FL TABLE
DEPENDENCE ON THE
OF THE ONSET
MULTIPLICITY
OF Ad
FL
DNA
OF INFECTION SYNTHESIS”
Time of appearance of Ad FL DNA (hours pi)
PFUicell 0.1 0.3 0.8 1.4 3.0 14.0 800.0 This kinetic centrifugation
1
60 60 60 47 36 38 35 analysis on alkaline
was performed by gradient sucrose gradients (see text).
pulse labeled with [3H]thymidine for a pulse period shorter than the time necessary for one round of DNA replication. Then, if only completed molecules are analyzed, there will be relatively more label at the termini of replication as compared to the rest of the molecule. Experimentally, this is determined by comparing the distribution of radioactivity along the viral genome in pulse-labeled viral DNA to that of uniformly labeled DNA molecules. The results of these experiments are shown in Fig. 3. Viral DNA in infected cells was labeled for 5 and 20 min with C”H]thymidine, isolated as described, and treated with the restriction enzymes HpaI (5-min pulse) or BamHI (20min pulse). In the case of the mature DNA labeled for 5 min, there is relatively more label in the terminal fragments, HpaI-C and HpaI-F, as compared to the internal fragments. Depending on the size of the terminal fragments, the increases in relative activity (Fig. 4) varied between 6 and 9 with a greater increase in specific activity found for the smaller fragment. However, after 20 min of labeling, there is little if any more label in the terminal fragments (BarnHI-D and BamHI-F). These results demonstrate that the termini of replication are located at or close to both molecular ends of the viral genome and that the time required for completion of one round of DNA synthesis is less than 20 min. The method used to separate the double-stranded, completed molecules from the single-stranded replication
6
TEMPLE
1
5 _-
_
_
_ _
_ _
_
_ _ _
_ _
_ _ _
_ -
_ _
_
_
_
_
_ _ _
_ _ -5
-
D’
E
I
A
’
C
‘E’-
Born
Hl
FIG. 3. Distribution of radioactivity in completed molecules of pulse-labeled Ad FL DNA. Infected ST3 cells were pulse-labeled with [,‘H]thymidine (100 &i.’ ml) for 5 or 20 min at 69 hr pi. In order to obtain uniformly labeled DNA, cells were labeled for 17 hi between 60 and 77 hr pi with (“C]thymidine (10 FCi/ ml). Mature viral DNA was extracted and digested with the restriction endonucleases Bant HI and HpnI (see text). The digests were analyzed on composite polyacrylamideiagarose gels. The amount and ratios of label in the pulse-labeled fragments Lvere computed and normalized relative to the fragment \vith the lowest specific activity. (O), HpnI digest (3 min pulse); (01, Barr/ HI digest (20.min pulse!.
forms was chromatography on BND-cellulose. This permitted isolation not only of the double-stranded but also the singlestranded forms of the viral DNA and of a study of their possible role in viral DNA replication. Shown in Table 2 is the distribution of label in single-stranded and doublestranded material eluted from BND-cellulose as a function of pulse time. For very short pulses (5 mins) there is approximately 4-5 times as much single-stranded as double-stranded material. However, as the pulse time increases, the ratio between these two forms decreases indicating the
ET AL.
expected accumulation of completed DNA molecules. After a 2-hr pulse, more than two-thirds of the radioactivity exists in the double-stranded form. While these experiments establish the location of termini of replication they do not permit conclusions as to the sites of origins of DNA replication. In order to answer this question we examined the distribution of label in separated strands of terminal restriction enzyme fragments of pulselabeled Ad FL DNA. Viral DNA was pulselabeled for 15 min with [“Hlthymidine, isolated, and subjected to restriction enzyme digestion. Terminal fragments were analvzed for the distribution of pulse-label in their complementary strands by gel electrophoresis. The results are summarized in Table 3. There is relatively more label in the fast-moving strands of both the Eco RI-B and C fragments in the case of uniformly labeled viral DNA. However, in pulse-labeled DNA there is more label in the slow-moving strands of both terminal fragments. After correction for the asymmetric distribution of label in uniformly labeled DNA as discussed above, there is approximately five times more label in the slow-moving strands of both fragments. This asymmetric mode of the distribution of pulse-label certainly is compatible with the conclusion that the sites of origin of DNA replication are located close to the molecular termini of the viral DNA. Furthermore, it has been possible to label the free (internal) 5’ end of the EcoRI-B fragment with [:“P]phosphate using polynucleotide kinase and to identify this label in the slow-moving strand of this fragment. Our results thus agree with a mechanism of replication in which initiation occurs at the end of the DNA and proceeds in the 3’ direction.
The Primary Termini
Sequence oj’ the Molecular qf’AD FL DNA
The primary sequence of the molecular termini of Ad FL DNA was interesting in terms of the extent and structure of the terminal repetition. From the work of Tolun et al. (1979) it was apparent that there is considerable homology in the terminal repeats of several human adenovirus sero-
REPLICATION
OF MOUSE
ADENOVIRUS
STRAIN
7
FL
Hindlll
I I :Hpan ,smai: 1 I I I I I I 8 I I I
I :I
Alu i4p.n I
-1__
npa
II
I
HP0 II Smo I __--
--._ *--
Hha
1
FIG. Ad FL Nathana ments depict ANI I,
Aval AvaI Hae Ill Hpa lI
I6 : I
AvaI
,I I I I
__--
8 Small 8 I
I I I I I
__*-
I I 1 I
8 i
Ava 1 HqeIU Hha
1
4. Sequence strategy for the determination of the primary sequence of the molecular termini of DNA. The map positions of the terminal RanzHI fragments were taken from Larsen and (1977). These fragments were 5’ end-labeled and the order of HaeIII, HpnII, and AvaI fragdetermined according to Birnstiel and Smith (1976). The arrows in the lower part of the figure the sequenced strands which had been end-labeled, as indicated, at their respective HneIII, or HpnII 5’ termini.
types as well as that of simian adenovirus type 7. We first determined a series of restriction enzyme sites yielding fragments located close to the ends of the viral DNA. Their map positions were identified using the technique of Smith and Birnstiel(19’76). The final locations of various cleavage sites as well as an outline of the adopted sequencing strategy are depicted in Fig. 4. The strategy relies mainly on the AvaIIHaeIII site at position 67. This protocol permitted us to sequence across the SmaI sites at position 90 which terminates the inverted repetitions. There is thus no doubt about the location of the transition point from the repeat to unique sequences on either end. In the course of these studies it was observed that it is impossible to label the 5’ ends of intact Ad FL DNA in the T4 polynucleotide kinase catalyzed reaction with -y-32P-labeled ATP.
This had been previously observed with DNA from human adenoviruses (Carusi, 1977) and was believed to be due to a few TABLE BND-CELLULOSE
CHROMATOGRAPHY
PULSE-LABELED
Pulse time (min) 5 10
20 60 120
2
WITH
OF Ad FL
DNA
[3H]T~~~~~~~~”
Doublestranded DNA (ds)
Singlestranded DNA (4
ss/ds
42,300 58,700 67,500 466,600 656,850
204,000 184,700 234,150 468,900 319,400
4.52 3.15 3.47 1.01 0.64
a Two 35-mm petri dishes were and labeled for the indicated 100 &i/ml.
used per time point time periods with
TEMPLE TABLE
3
DISTRIBUTION OF RADIOACTIVITY IN THE SEPARATED STRANDS OF THE TERMINAL FRAGMENTS EcoRI-B AND EcoRI-C OF Ad FL DNA AS A FUNCTION OF PULSE TIME Uniformly labeled DNA Fragment
Pulse-labeled DNA
cw
Ratio
w
Ratio
Ratio”
EcoRI-B Slow Fast
586 1149
0.51
1241 513
2.4
4.7
EcoRI-C Slow Fast
870 1408
0.62
666 206
3.2
5.2
(’ This value is corrected for the relative thymidine content in the separated strands as determined from the radioactivity in uniformly labeled DNA.
remaining amino acid residues from the terminal protein blocking the 5’ ends of the viral DNA. We thus conclude that Ad FL DNA also carries a protein (Larsen and Nathans, 1977) linked to the 5’ ends of the viral DNA. Figure 5 shows a sequencing gel of both molecular termini of Ad FL DNA using the 5-labeled terminal AvaI fragments. The sequence ladders which can be read up to a terminal G-residue thus identify regions preceding the 3’ termini of the viral DNA. We have also identified the primary sequence of the opposite strands using a 67 base pair terminal Hoe111 fragment labeled at its internal 3’ end with [oz-“~P]CTP incorporated in vitro in the presence of terminal transferase (Roychoudhury et al., 1976). There is no indication that either of the two sequence ladders reaches further than the indicated sequences. The sequence of the molecular termini of Ad FL DNA which extend beyond the terminal repetition up to position 190 are shown in Fig. 6. They are compared in Fig. 7 to terminal sequences from other adenoviruses as presented by Tolun et al. (1979). DISCUSSION
This study describes a variety of parameters which establish mouse adenovirus strain FL as a typical adenovirus. Larsen
ET AL.
and Nathans (1977) have measured the length of double-stranded Ad FL DNA by electron microscopy with respect to a form II SV 40 DNA standard in order to arrive at a value of 20 x 10” for its molecular weight. However, when they determined the length electrophoretically or averaged the electron microscopic measurements, the value they obtained was 19.5 x 10”. They ascribe this descrepancy to the pesence of broken or shorter molecules in the total population. Using single-stranded Ad FL DNA circles and a relaxed, double-stranded PM 2 DNA standard, we arrive at a value of 20.7 x 10”. All these results agree well with each other and show that Ad FL DNA is smaller than human adenovirus DNA. LEFT
RIGHT
-30
A A A
-A0
P‘IG. 5. Sequencing gels of the molecular termini of Ad DL DKA. The two terminal ,4/w I fragments from the left and right molecular end Lvere 5’ em-labrlc(l using y-“P-labeled ATF’ and polynucleotidr kinaar. Only the internal ,i’ entle arr labeled since the external 5’ ends are blocked for the kinase-catalyzetl reaction. Following base specific fragmentation the digest:: 11cw analyzed on 1.X polyacrylamidt~ gels (Masam and Gilbert, 1977). The four tracks from c%ch terminal fragment represent G. G/A, V./T. and (’ specific frapmentations, respectively. The sequences when read from the bottom to the top, as indicated. define thr stranda ending with the molecular 5’ termini.
REPLICATION RIGHT
OF MOUSE
ADENOVIRUS
STRAIN
9
FL
END
5'-tATCATUATAATATACAGTTAGCAAAAAATGGCGCCTCG 3'-GTAGTAGTTA~ATATGTCAATCG~~ACCGCMjAAAGTGC LEFT
END
5'-CATCATCAATAATATACG~AGC~TGGCGCCTTTGT~GGC~TGTTCC~CTG~~TG~CCCGAGTTGGGT~CGT~CCCGGG~TGACG 3'-GTAGTAGTTATTATATGTCAATCG~ACCGCGGAAACTGC 10
RIGHT
20
30
10
50
60
70
80
90
100
END
TGGTGCGTCAGGTCATG~GAG~ATAUIT(jT1CGTGTGTG~TGTGCTTGTGTAAAtGAG~GG~~~CTTtTT-----ACCACGUIGTCCACTACAACTCAAAAATATGTACAAAtACCGCTGTGCTGT-----LEFT
END
TGT6AAAAGU;TCTffitAACTmGAtACTGTACCAACTGTGTTGTACCGTG~~GGTGTACG~~~TG~CTGTCGT~T~G~CC--ACACTmCCCAGACCCTTGAGT~A~TGG~GA~~CACGG--110
120
Frc. 6. The primarv _ “_sequence tion is 93 base pairs long.
130
1.0
of the molecular
150
160
termini
incorporated into this length of doublestranded DNA molecule are several features typical for adenoviruses. There is evidence for a protein linked to the 5’ ends as well as for an inverted terminal repetition. Larsen and Nathans (1977) provided the first evidence for a terminal protein when they observed reduced electrophoretie mobility of the terminal restriction fragments of DNA prepared under conditions which preserve the terminal protein (Robinson et al., 1973) and that protease treatment of these fragments eliminated this effect. By virtue of our unsuccessful attempts to label the 5’ termini in the T4 polynucleotide kinase catalyzed reaction with [Y-~~P]ATP we provide additional indirect evidence for the presence of the terminal protein and to its exact location on the viral DNA. Because denatured Ad FL DNA forms singlestranded circles, Larsen and Nathans (1977) concluded that there must be an inverted terminal repetition at the termini. We have confirmed this observation and, in addition, provided direct evidence by determining the primary sequence of both molecular ends of Ad FL DNA. The partial denaturation map of Ad FL DNA (Fig. 2) clearly shows that the AT distribution is asymmetric, thus allowing us to arrange the map according to one of the criteria adopted by Sharp and others for
170
of Ad FL DNA.
180
The inverted
190
terminal
repeti-
adenovirus physical map orientations which defines the most AT-rich end as the righthand end. An orientation was important because we relied heavily on the restriction enzyme maps previously determined by Nathans and co-workers (Larsen and Nathans, 1977; Larsen et al., 1979). The orientation according to accepted conventions leads to an alignment of the restriction maps identical to that originally proposed by Larsen and Nathans (1977) but opposite to the one recently proposed by Larsen et aI. (1979). A final settlement of this question will have to await the elucidation of transcription maps. The SmaI site at position 90 from the left as well as from the right molecular end coincides with the end of the terminal repeat which is 93 base pairs long. This is shorter than the repeats of Ad 2 and Ad 5 DNA (102 bp), Ad 3 (136 bp), SA 7 (120 bp) and Ad 12 (>160 bp) (Tolun et al., 1979). The first 17 base pairs are identical to the first 17 positions in Ad 2 and Ad 5 DNA, and the base pairs located in positions 9-17 of Ad FL DNA are common to all known adenovirus termini (Fig. 7). However, the internally located regions of homology observed by Tolun et al. (1979) between human adenoviruses serotypes 2, 3, 5, and 12 as well as simian adenovirus type 7 are absent in Ad FL DNA. If there is a universal adenovirus origin
lo
io 40
50
TTATAGATGGMTGGTGCCAACATGTAAATGAGGTAATTT 60
Go
Ho
AAAAAAGTGCGCGCTGTGTGTGATTGGCTGCGCG ;0
“, ,,.,
.,
FIG. 7. A comparison of the primary sequences of the molecular termini of different adenoviruses. The data for SA 7, Ad 12, Ad 2, and Ad 3 are taken from Tolun et CC/. (1979). The dashed lines at the termini of SA 7, Ad 12. and Ad 3 represent positions which have not been determined. The box indicates the sequence common to all adenovirus termini. The sequence above the Ad FL DNA sequence are polyoma virus DNA sequences, taken from Soeda et al. (1980). The upper-most line represents polyoma DNA sequences which are not homologous with Ad FL DNA but which are continuous with the polyoma DNA sequence between positions 72 and 109, numbered according to Soedacf al. (1980). The sequence labeled lo-16 is part of the polyoma origin of DNA replication.
i0
--CTCTA
5'
Ad
3
CATCATC
5'
Ad 2
TTATTTTGGATTGAAGCCAATATGATAATGAGGGGGTGGAGTTTGTGACGTGCGGGGCG
TTATACTGGACTAGTGCCAATATTMAATGAATGGGCGTATTTGATTGGGTGGAGGTGTGGCTTTG
-----TA
5'
10 16 TGGCCCG
12
CATCATC
Ad
5' TTATTTGGGAACGGTGCCAATATGCTAATGAGGTGGGCGCTGGGCGGAGTAGG
GGG 1 1 109 GCT TG CCA
G /\
5’----ATC
\
SA 7
GGAGGC
Ad FL
CAGGAC
”
REPLICATION
OF MOUSE ADENOVIRUS
sequence, the most likely candidate in terms of the greatest degree of sequence homology would be the base pairs in position 9- 17, 5’ATAATATAC-3’. It is interesting to note in this context that Ad FL DNA can be replicated efficiently in an in vitro system derived from nuclear extracts of HeLa cells infected with human Ad 2 DNA (Th. Reiter and E. L. Winnacker, unpublished). The observed nonpermissivity of human cells for Ad FL thus appears not to be based on a restriction for viral DNA replication. In addition to the homologies between the different adenoviruses, Tolun et al. (1979) were able to point out and to discuss homologies between the genomes of the adenoviruses and the papova virus SV40. In Ad FL DNA, a region of 7 base pairs, 5’-TGGCCCG-3’, at positions 65-71 is homologous to a sequence at positions lo-16 within the origin of polyoma DNA replication (Soeda et ul., 1980). Since Ad FL and polyoma virus have nothing more in common than their respective host, the mouse, it is suggestive to point out that this region represents binding and/or recognition sites for host enzymes necessary for viral DNA replication. Whether this region is really essential and host-specific remains to be determined by functional studies. The observed homology region of 7 base pairs between the terminal repeat of Ad FL DNA and in the origin region of polyoma virus is not identical but related to a sequence (5’-TGGGCGGAGTT-3’) which is shared by simian adenovirus type 7 and SV40 DNA (Subramanian and Shenk, 1978) in their origin regions and which has also been observed in BK-virus DNA in its origin of DNA replication (Seif et al., 1979). A total of 22 base pairs in stretches of 2,3, 5, and even 9 base pairs in the inverted repeat of Ad FL DNA as indicated in Fig. 7 are homologous to regions close to but somewhat outside the proposed origin of polyoma DNA replication (Soeda et al., 1980). The significance of these extended homologies remains unknown at the present time. Their location, however, suggests, that they might represent part of a cellular origin of DNA replication.
STRAIN
FL
11
ACKNOWLEDGMENTS The authors are indebted to Dr. Nathans and Larsen for the original strain of adenovirus FL. We gratefully acknowledge the excellent technical assistance of Ilse Pfitzinger and Alois Moosbauer. This work was supported by the Deutsche Forschungsgemeinschaft, grants Wi 31915 and 31916. REFERENCES ALLET, B., JEPPESON, P. G. N., KATAGIRI, K. J.. and DELIUS, H. (1973). Mapping the DNA fragments produced by cleavage of lambda DNA with endonuclease RI. Nature (London) 241, 120-123. CARUSI, E. A. (1977). Evidence for blocked termini in human adenovirus DNA. Virology 76, 380-394. DAVIS, R. W., SIMON, M., and DAVIDSON, N. (1971). Electron microscope heteroduplex methods for mapping regions of base sequence homologies in nucleic acids. In “Methods in Enzymology” (L. Grossman, and K. Moldave, eds.), Vol. 21, pp. 413-428. Academic Press, New York. DAVIDSON, N., and SZYBALSKI, W. (1971). Physical and chemical characterization of Lambda DNA. 111 “The Bacteriophage Lambda” (A. D. Hershey, ed.), pp. 45-82. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. DELIUS, H., and CLEMENTS, J. B. (1976). A partial denaturation map of Herpes simplex virus type 1 DNA. Evidence for inversions of the unique DNA regions. J. Gen. Viral. 33, 125-133. DOERFLER, W.. and KLEINSCHMIDT, A. K. (19’70). Denaturation pattern of Adenovirus type 2 as determined by electron microscopy. J. Mol. Biol. 50, 579-593. GARON, C. F., BERRY, K., and ROSE, J. (1972). A unique terminal redundancy in adenovirus DNA molecules. Proc. Nat. Acad. Sci USA 69,2391-2395. HARTLEY, J. S., and ROWE, W. P. (1960). A new mouse virus apparently related to the adenovirus group. Virology 11, 645-647. LARSEN, S. H., and NATHANS, D. (1977). Mouse adenovirus: Growth of plaque-purified FL virus in cell lines and characterization of viral DNA. Virology 82, 182-195. LARSEN, S. H., MARGOLSKEE, R. F., and NATHANS, D. (1979). Alignment of the restriction map of mouse adenovirus FL with that of human adenovirus 2. Virology 97, 406-414. LECHNER, R. L., and KELLY, T. J. (1977). The structure of replicating adenovirus type 2 DNA molecules. Cell 12, 1007-1020. MAXAM, A., and GILBERT, W. (1977). A new method for sequencing DNA. Proc. Nat. Acad. SO. liSA 74, 560-564. MULDER, C., ARRAND, J. R., DELIUS, H., KELLER.
TEMPLE W., PETTERSSON. U., ROBERTS, R. J., and SHARP, P. A. (1974). Cleavage maps of DNA from adenovirus types 2 and .5 by restriction endonucleases Eco RI and Hpa I. Cold .S’pril/g Harhw Symp. Qxnut. Bid. 39, 397-400. PHILIPSOK, L., and LINDBERG, U. (1974). Reproduction of adenoviruses. I?( “Comprehensive Virology.” Vol. 3, pp. 143-227. Plenum Press, New York. PHILIPSON, L. (197i). In vitro recombinant DNA research in mammalian cells facts and speculation. In “Pancreatic Beta Cell Culture,” pp. 173-179. Excerpta Medica. Amsterdam-Osford. PINA, M., and GREEN, M. (1965). Biochemical studies on adenovirus multiplication. IX. Chemical and base composition analysis of 28 human adenoviruses. Proc. ‘Vat. Acad. Sci. l:SA 54, 547-551. ROYCH~~DHURY, R., .JAY. E.. and WV, R. (19i6). Terminal labelling and addition of homopolymer tracts to duplex DNA fragments by terminal deoxynucleotidyl transferase. Njrcluic Acid Rrs. 3, 863-878. SEIF, I., KHOURY. G., and DHAK, R. (1979). The genome of human papovavirus BKV. Ccl/ 18, 963-977. S~HTH, H. O., and BIRNSTIEL, M. L. (1976). A simple method for DNA restriction site mapping. A;/cclelc Acid Res. 3, 2387-2398. SOEDA, E., ARRAND, d. R., SMOLAR, N., WALSH, .J. E., and GRIFFIN. B. E. (1980). Coding potential and regulatory signals of the polyoma virus genome. Nature (Lortdoni 283, 449-453. SUBRAMANIAN, K. N., and SHENK, T. (197X). Definition of the boundaries of the origin of DNA replication in simian virus 40. NJtcleic Acid Res. 5, 3635-3642. SUTCLIFFE, J. G. (1978). Complete nucleotide seyuence
ET AL. of the Escherichia Coli plasmid pBR 322. (‘old Spriicg Harbor Syrnp. Q/m/f. Bid. 43, 77-90. STOBNER. D.. and BUJARD, H. (1977). Electron microscopy of DNA: Determination of absolute molecular \veights and linear density. MO/~. (;P)/. Gvm+ics 154, 299-303. THOMIIAS, C. A.. and ABELSON, J. (1966). The isolation and characterization of DNA from bacteriophage. Iti “Procedures in Nucleic Acid Research” (Cantoni and Davis. eds.), Vol. 1, pp. 5.53-561. TOLUN. A., ALESTROM, P., and PETTERSSON, U. (1979). Sequence of inverted terminal repetitions from different adenoviruses. Demonstration of conserved sequences and homology between SA 7 termini and SV 40 DNA. Call 17, 705-713. WALTERS, R. A.. and HILDEBRAND. C. E. (1975). A procedure for the rapid lgsis of mammalian cells priot to alkaline sucrose gradient centrifugation. Bioc//iw. Riol-‘l/ys. ilcfn 407, 120-124. WEIKGBRTNER, B., WINNACKER, E. I,.. TOLUN. A., and PETTERSSON. IT. (1976). Two complementary strand-specific termination sites for adenovirus DNA4 replication. C’ell 9, 259-268. WIGAND. R.. GELDERBLOM, H., and OZEL, M. (1977). Biological and bioyhysical characteristics of mouse adenovirus strain FL. Arch. Vid. 54, 13-142. WIK‘NACKER, E. L. (1975). Adenovirus type 2 DNA replication. I. Evidence for discontinuous DNA synthesis. J. V/im/. 15, 744-756. WINNACKER, E. I,. (1978). Adenovirus DNA: Structure and function of a novel replicon. Cc/l l-t, 761-773. ~~Ir;o~OUR, E. (1963). Purification of polyoma virus. Virology 19, 15X- 168. WOLFSON, .J., and DRESSLER, D. (1972). Aclenovirus tgpe 2 DNA contains an inverted terminal repetition. Proc. ,2Tat. Acad. Sci. CS’A 69, 3054-3057.