- Email: [email protected]
Reproductive hormones influence zinc homeostasis in the bovine cumulus-oocyte complex: Impact on intracellular zinc concentration and transporters gene expression
Journal Pre-proof Reproductive hormones influence zinc homeostasis in the bovine cumulus-oocyte complex: impact on intracellular zinc concentration and transporters gene expression
Ana M. Pascua, Noelia Nikoloff, Ana C. Carranza, Juan P. Anchordoquy, Silvina Quintana, Gisela Barbisán, Silvina Díaz, Juan M. Anchordoquy, Cecilia C. Furnus PII:
S0093-691X(20)30067-4
DOI:
https://doi.org/10.1016/j.theriogenology.2020.01.054
Reference:
THE 15351
To appear in:
Theriogenology
Received Date:
24 July 2019
Accepted Date:
28 January 2020
Please cite this article as: Ana M. Pascua, Noelia Nikoloff, Ana C. Carranza, Juan P. Anchordoquy, Silvina Quintana, Gisela Barbisán, Silvina Díaz, Juan M. Anchordoquy, Cecilia C. Furnus, Reproductive hormones influence zinc homeostasis in the bovine cumulus-oocyte complex: impact on intracellular zinc concentration and transporters gene expression, Theriogenology (2020), https://doi.org/10.1016/j.theriogenology.2020.01.054
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier.
Journal Pre-proof
Reproductive hormones influence zinc homeostasis in the bovine cumulus-oocyte complex: impact on intracellular zinc concentration and transporters gene expression
Ana M. Pascua1, Noelia Nikoloff1, Ana C. Carranza1, Juan P. Anchordoquy1, Silvina Quintana2, Gisela Barbisán1, Silvina Díaz1, Juan M. Anchordoquy1*, Cecilia C. Furnus1,3* *Equal Contribution 1IGEVET
– Instituto de Genética Veterinaria “Ing. Fernando N Dulout”(UNLP-
CONICET LA PLATA), Facultad de Ciencias Veterinarias UNLP, calles 60 y 118, B1904AMA La Plata, Buenos Aires, Argentina. 2CIAS
– Centro de Investigación en Abejas Sociales, Departamento de Biología,
Facultad de Ciencias Exactas y Naturales, Universidad Nacional de Mar del Plata, Funes 3350 (7600), Mar del Plata, Buenos Aires, Argentina 3Cátedra
de Citología, Histología y Embriología “A” Facultad de Ciencias Médicas,
Universidad Nacional de La Plata, calle 60 y 120 s/n, CP 1900, La Plata, Buenos Aires, Argentina
Correspondence Cecilia C. Furnus, Instituto de Genética Veterinaria Prof. Fernando N. Dulout (IGEVET, CCT CONICET LA PLATA - UNLP), Facultad de Ciencias Veterinarias, Universidad Nacional de La Plata Email: [email protected]
1
Journal Pre-proof
Abstract Zinc (Zn) is a vital trace element for the body and its bioavailability influences numerous reproductive events. However, the mechanisms that regulate Zn homeostasis in the cumulus-oocyte complex (COC) are yet to be elucidated. The aim of this study was to investigate the role of estradiol 17-beta (E2), FSH and LH in Zn homeostasis regulation in bovine COC matured in vitro and Zn transporters gene expression. For this purpose, intracellular Zn levels in oocytes and cumulus cells (CC) were assessed using a Zn-specific fluorescent indicator. In addition, gene expression and sequencing of six Zn transporters (Slc39a6, Slc39a8, Slc39a14, Slc30a3, Slc30a7 and Slc30a9) were assessed. Our results demonstrated that the simultaneous presence of E2, FSH, and LH during oocyte maturation altered intracellular zinc levels and transporters expression in both oocytes and CC. Transporter's gene expression was different in oocytes and CC, possibly due to cell-specific changes in Zn levels during maturation. The interaction effects of Zn with hormonal treatments influenced the results. This study emphasizes that Slc39a6 is highly sensitive to hormone induction. Overall, the hormonal modulation of Zn homeostasis in the COC was evidenced. Also, a preponderant role of FSH as a modulator of Zn intracellular levels and transporter gene expression is suggested.
KEYWORDS estradiol 17-beta, LH, FSH, zinc, cumulus-oocyte complex, zinc transporters
2
Journal Pre-proof
1. INTRODUCTION Zinc (Zn) is a trace mineral involved in several cellular processes, such as proliferation, immune function, antioxidant defense, gene expression, and ARN polymerase activity [1–3]. In mammals, Zn homeostasis is essential for optimal metabolic function in reproductive processes. Zinc deficiency results in fetal teratogenesis, long gestation, problematic labor, low birth weight and weak offspring [4,5]. In contrast, Zn availability is beneficial for follicular growth, oocyte maturation, fertilization and embryo development [6,7]. Zinc plays an important role during the oocyte maturation process and on somatic cell viability in the reproductive tract [8,9]. It has been demonstrated that Zn availability regulates exit from meiosis during oocyte maturation [10]. In mammals, Zn dependent mechanisms control first meiotic division completion and metaphase II (MII) oocyte arrest [11,12]. In oocytes, a rapid release of Zn from the oocyte to the external environment facilitates the advance from MII to complete meiosis. This mechanism is known as “zinc sparks” is triggered by fertilization and is critical for cell cycle resumption [13]. Recently, it was informed that bovine oocytes undergo the Zn spark phenomenon in response to parthenogenetic and sperm-induced activation. The similarity of Zn efflux occurrence in murine, non-human primate, human and bovine oocyte suggests a highly conserved event among mammals [14]. Several cellular processes are dependent on adequate Zn levels. In this context, is critical to understand in what manner the expression of Zn transporters expression is regulated [15]. At present, two families of Zn transporters were described in mammals. The ZnT family decreases Zn concentration in the cytoplasm by transporting Zn to the organelles or towards the extracellular space [16]. On the other hand, Zrt-, Irt3
Journal Pre-proof likeprotein (ZIP) family increases the cytoplasmic Zn level by moving Zn in the opposite direction [17]. The transporters ZnT1 to Znt10 belong to the solute carrier family 30A (SLC30A), and ZIP1 to ZIP14 are included in SLC39A family [16, 17, 18,19]. Previous studies have revealed that gene expression of Zn transporters respond to various stimuli including interleukin-6 [20], lipopolysaccharides [21], transcription factors [22–24], oxidative stress [25], hypoxia [26], Zn concentration [27,28] and hormones such as testosterone and estrogen [29,30]. However, information about Zn transport and regulation in the bovine cumulus-oocyte complex (COC) is not currently available. The aim of the present study was to investigate whether estradiol 17-beta (E2), follicle-stimulating (FSH) and luteinizing (LH) hormones influence Zn homeostasis and transporter gene expression during in vitro maturation (IVM) of bovine COC. For this purpose, experiments were designed to evaluate intracellular Zn levels in oocytes and cumulus cells (CC) using a Zn-specific fluorescent indicator. Gene expression and sequencing of six Zn transporters (Slc39a6, Slc39a8, Slc39a14, Slc30a3, Slc30a7, Slc30a9) involved in oocyte and CC Zn homeostasis were also evaluated [31].
2. MATERIALS AND METHODS 2.1 Reagents All reagents for media preparation were purchased from Sigma Chemical Co. (St. Louis, MO, USA), whereas FSH was purchased from Bioniche (Belleville, Ontario, Canada), and standard zinc sulfate (ZnSO4) water solution was procured from Merck (Tokyo, Japan). Medium for IVM consisted of bicarbonate-buffered TCM-199 supplemented with 10% (v/v) fetal calf serum (FCS), 0.2 mM sodium pyruvate, 1 mM glutamine and 50 mg/mL kanamycin.
4
Journal Pre-proof 2.2 Cumulus–oocyte complexes (COCs) Bovine ovaries were obtained from an abattoir and transported to the laboratory in sterile NaCl solution (9 g/L) with antibiotics (streptomycin and penicillin) at 37°C within 3 h after slaughter. Ovaries were pooled, regardless of the stage of the estrous cycle of the donor. Cumulus–oocyte complexes were aspirated from 3 to 8 mm follicles, using an 18-G needle connected to a sterile syringe. Only cumulus-intact complexes with evenly granulated cytoplasm were selected for IVM, using a low-power (20–30X) stereomicroscope (Nikon, Tokyo, Japan).
2.3 In vitro maturation (IVM) Cumulus–oocyte complexes were washed twice in TCM-199 buffered with 15 mM HEPES containing 10% (v/v) FCS and twice in IVM medium. Groups of 10 COCs were transferred into 50 µL of IVM medium under mineral oil (Squibb, Princeton, NJ, USA) pre-equilibrated in a CO2 incubator. The incubations were performed at 39°C in an atmosphere of 5% CO2 in air with saturated humidity for 24 h in IVM medium containing E2 (1µg/mL), FSH (1µg/mL) or LH (10 µg/mL), with or without 1.2 µg/mL Zn (adequate Zn status according to values proposed in the literature) [32]. Treatment groups were as follows: a) Control (neither hormone nor Zn2+); b) Zn (no hormone and Zn); c) E2; d) E2 + Zn; e) FSH; f) FSH + Zn; g) LH; h) LH + Zn; i) E2 + FSH + LH (3H); j) 3H + Zn. Because of FCS use, hormones and Zn concentrations were measured in IVM medium before treatment supplementation. Concentrations of hormones were quantified in a commercial laboratory (Clinical Chemistry Department, IglesiasHaramburu Institute, La Plata, Argentina) by using RIA kits (Siemens Medical Solutions Diagnostics, Los Angeles, CA, USA), while Zn was assessed by means of an atomic absorption spectrophotometer (GBC 902) through an internal quality control
5
Journal Pre-proof (Piper and Higgins 1967; Picco et al. 2012). Results were 5.8 pg/mL of E2, 0.39 pg/mL of FSH and 0.3 µg/mL of Zn (no LH detected). All these concentrations were considered insubstantial when compared to those of the treatments. Three replicates from different days were reserved for gene expression studies, and the other three replicates were reserved for free Zn intracellular level staining analyses.
2.4 Zinc measurements using FluoZin-3 AM indicator dye After IVM, 45 COCs per treatment (15 per replicate) were assessed to determine intracellular Zn levels in oocytes and CC. For this purpose, FluoZin-3 AM dye (InvitroGen, USA), a fluorescent cell-permeable selective indicator of free or loosely bound intracellular Zn concentration was used [33]. Briefly, COCs were washed with phosphate-free HEPES-Buffered Hanks Balanced Salt Solution (HHBSS) to remove IVM medium and incubated separately in 1 µM FluoZin-3 AM (final concentration) for 30 min at room temperature in dark. Then, COCs were rinsed in HHBSS for 15 min to cleave AM ester. After cleavage, COCs were washed in HHBSS to remove excess dye and transferred onto slides, topped with a coverslip and visualized by a Leica TCS-SP5 Confocal Microscope (Leica Microsystems, Wetzlar, Germany) equipped with a 330490 nm excitation filter and 420-520 nm emission filters, at 100X magnification. The intensity of green fluorescence observed in oocytes and CC corresponded to free Zn levels. In each replicate, a fluorescence control (15 COCs matured as Control group) was included and consisted of FluoZin-3 AM staining and subsequent incubation in 10 µM of heavy metal chelator N,N,N’,N’-tetrakis (2-pyridylmethyl) ethane-1,2-diamine (TPEN) for 30 min, followed by re-imaging as before. The fluorescence intensity of each COC was determined with Image J software 1.48 v (Wayne Rasband, National Institute of Health, USA), which allowed to select
6
Journal Pre-proof and evaluate fluorescence intensity in oocyte and CC separately. For this purpose, pixel intensity is divided by the number of pixels for each cell type. Results are expressed as the average of intensity in oocytes and CC [34].
2.5 Isolation of mRNA and Real-time polymerase chain reaction (RT-PCR) A total of 750 COCs were used in three replicates (250 COCs per replicate, 25 COCs per group). At the end of IVM, CC was stripped out from oocytes by repeated pipetting with a narrow-bore pipette. Total RNA was isolated with an RNeasy Micro Kit (Qiagen, Germany) from oocytes and CC according to the manufacturer’s instructions. Then, RNA content and quality in each sample were checked with a spectrophotometer (NanoVue™- GE Healthcare Limited, UK) at 260 nm and 260/280 nm ratio, respectively. The cDNA was synthesized using a reaction mixture containing 1.5 µg of total RNA, random hexamers and M-MLV reverse transcriptase as suggested by the manufacturer (Invitrogen-Life Technologies, USA). Next, RT-PCR was performed on cDNA from oocytes and CC to evaluate the expression of Slc39a6 (ZIP 6), Slc39a8 (ZIP 8), Slc39a14 (ZIP 14), Slc30a3 (Znt 3), Slc30a7 (Znt 7) and Slc30a9 (Znt 9) genes. For this purpose, oligonucleotide primers were designed (Table 1) to span exon-exon junctions to obtain the mature transcripts and to avoid possible genomic DNA amplification, by using the Primer Premier Software (PREMIER Biosoft International, USA). A Rotor-Gene Q thermocycler (Qiagen, Hilden, Germany) was implemented to perform RT-PCR. The reaction mixture (final volume, 20 µL) included 1 X PCR Master Mix (KAPA HRM FAST Master Mix, Biosystems, Woburn, USA), 1 µL cDNA and 1 µL of each primer (0.5 µM final concentration). Cycling conditions consisted of initialization (95°C, 3 min), denaturation (95°C, 15 min), annealing (particular temperatures shown in Table 1, 20 s,
7
Journal Pre-proof 40 cycles) and extension (72°C, 25 s). For each sample, the specificity of the PCR product was checked with a melting curve analysis. Negative controls were included and experiments were always performed in triplicate. RT-PCR efficiency for each gene was determined by a linear regression model, according to the equation E = 10 [−1/slope]. Then, the relative expression analysis of each target gene was performed with the 2-DDCt method using β-actin (ACTB) and cyclophilin-A (PPIA) as normalizers for the oocyte and CC data, respectively. The Control treatment was taken as a reference (relative expression = 1). To assess amplicon quality condition and after finding the mRNA transcript sequences of the transporters in a predicted or provisional NCBI status, PCR products were sent for sequencing to Macrogen, Inc. (Korea). For this purpose, amplicon integrity and size were verified by 2% agarose gel electrophoresis, quantified by spectrophotometry (NanoVue™-NV - GE Healthcare Limited, UK), and then purified and sequenced in both strands using the same oligonucleotide primers. Resulting sequences were aligned and edited using the ProSeq 3.2 (Filatov 2002), and a Basic Local Alignment Search Tool (BLAST, NCBI) search was run to verify the identity of the obtained sequences. Sequences were successfully obtained from the amplified cDNA of transporters Slc39a6, Slc39a8, Slc39a14 and Slc30a9 (Table 2) with 100 % identity and bearing no substitutions, deletions or insertions, therefore providing experimental evidence of the thus far predicted sequences.
2.6 Statistical analysis We used a completely randomized block design with 4 2 x 2 factorial arrangements of main variables (with/without Zn x with/without E2, FSH, LH or 3H). Statistical models included the random effect of the block (day of COCs collection, n =
8
Journal Pre-proof 3 for each essay), the fixed effect of Zn and hormones (E2, FSH, LH, and 3H) and the second-order interaction of the main variables (Zn*E2, Zn*FSH, Zn*LH, and Zn*3H). The effect of Zn and hormones on the response variables (fluorescence intensity and relative mRNA expression) were analyzed with linear regression models by using the MIXED procedure of SAS (SAS Institute, Cary, NC, USA). The effect of cell type (oocyte vs CC) on fluorescence intensity was also evaluated. Results are expressed as least squared means ± SEM. Statistical significance was set at p ≤ 0.05, and p ≤ 0.10 for tendency and interactions.
3 RESULTS 3.1 Intracellular zinc levels in COCs matured in vitro with zinc and hormones After IVM, COCs were staining with FluoZin-3 AM and incubated with TPEN (Figure 1). No fluorescent signal was observed in COCs treated with TPEN indicating that fluorescence is specific to detect intracellular free Zn and does not correspond to dye accumulation [14,35]. FluoZin-3 AM signal intensity (FSI) in oocytes and CC are shown in Figure 2. Significant interactions between Zn with every hormonal treatment (3H, E2, FSH or LH) were observed in oocytes and CC, excepting Zn*3H in CC. Interaction refers to how the effect on the response of one variable (Zn) depends on the level of one other explanatory variable (3H, E2, FSH or LH).
3.1.1 Oocytes In oocytes, intracellular zinc levels expressed by FSI showed interactions between Zn and each hormonal treatment: Zn*3H, Zn*E2, Zn*FSH, and Zn*LH. In Figure 2i (Zn*3H), the FSI was significantly higher in the presence of Zn alone compared to Control, 3H and 3H + Zn. In Figure 2ii (Zn*E2), the FSI in the presence of
9
Journal Pre-proof Zn, E2, and E2 + Zn were similar and higher respect to Control. In Figure 2iii (Zn*FSH), the FSI was significantly higher in FSH compared to Control, however, Zn and FSH + Zn were similar and higher than Control and FSH. In Figure 2iv (Zn*LH), no significant differences among Zn, LH, and LH + Zn were detected, while the lowest FSI value was observed in Control.
3.1.2 Cumulus cells The evaluation of intracellular zinc levels in CC showed significant interactions in Zn*E2, Zn*LH, and Zn*FSH. In Figure 2i (Zn*3H), the FSI was increased in the presence of Zn with or without the addition of 3H. The 3H treatment did not affect intracellular zinc concentrations. In Figure 2ii (Zn*E2), the FSI in Zn, E2 and E2 + Zn was similar and higher than Control. In Figure 2iii (Zn*FSH), the FSI levels were similar in Control and FSH whereas FSH + Zn was higher than Control and similar to FSH and Zn. In Figure 2iv (Zn*LH), the FSI in Zn, LH, and LH + Zn was similar and higher than Control. In all treatments, the FSI values were higher in oocytes compared with CC (p < 0.02; Figure 2).
3.2 Zinc transporter expression in oocytes and CC The expression of zinc transporters in oocytes and CC are shown in Figure 3 and Figure 4. The gene expression of Slc39a6, Slc39a8, Slc39a14, and Slc30a9 was quantified. Even though we found Slc30a3 gene expression in oocytes and CC, it could not be quantified due to low mRNA levels. No Slc30a7 gene expression was detected in either cell type.
3.2.1 Oocytes 10
Journal Pre-proof In oocytes, significant interactions between Zn with every hormonal treatment (3H, E2, FSH or LH) were observed in all transporters studied except for Zn*FSH and Zn*LH in Slc39a14 (Figure 3). In Figure 3A (Zn*3H), Zn treatment showed higher expression in all transporters. The expression of Slc39a6, Slc39a8, and Slc39a14 was similar in the Control and 3H. However, Scl30a9 expression was lower in 3H compared to Control. Besides, the expression Slc39a6 and Scl30a9 were similar in 3H and 3H + Zn, but the expression of Slc39a8 and Slc39a14 was higher in 3H than 3H + Zn. In Figure 3B (Zn*E2), Zn significantly increased the expression of all transporters compared with Control, E2, and E2 + Zn. The expression of Scl39a6 in E2 and E2 + Zn was similar and higher than Control. The expression of Scl39a8 was similar in Control, E2, and E2 + Zn. However, Scl39a8 was highly expressed in E2 compared to E2 + Zn. The Scl39a14 expression in E2 and E2 + Zn was significantly lower than Control. Besides, Scl39a14 expression was higher in E2 than E2 + Zn. The expression of Scl30a9 was similar in Control, E2, and E2 + Zn. In Figure 3C (Zn*FSH), Zn supplementation significantly increased the expression of all transporters respect to Control. The expression of Scl39a6 in FSH was higher than Control, Zn and FSH + Zn. Besides, Scl39a6 expression was similar in Zn and FSH + Zn, and both were higher than Control. The expression of Scl39a8 was similar in Zn and FSH + Zn, and both were higher compared to FSH and Control. The Scl39a14 expression was decreased in the presence of FSH with or without the addition of Zn. The Scl30a9 expression was similar in Control, FSH and FSH + Zn and lower than Zn. In Figure 3D (Zn*LH), Zn supplementation significantly increased the expression of all transporters respect to Control, LH and LH + Zn. The Scl39a6 expression was higher in LH compared to Control and LH + Zn, and LH + Zn was
11
Journal Pre-proof higher than Control. The expression of Scl39a8 was similar in Control, LH and LH + Zn. The Scl39a14 expression was decreased in the presence of LH with or without the addition of Zn. The expression of Scl30a9 was higher in LH compared to Control and LH + Zn, and the latter was the lowest.
3.2.2 Cumulus cells In CC, significant interactions between Zn with every hormonal treatment (3H, E2, FSH or LH) were observed in all transporters studied except Zn*FSH in Slc39a6 and Slc39a8 (Figure 4). In Figure 4A (Zn*3H), Zn and 3H decreased all transporters expression compared with Control. The presence of 3H + Zn increased the expression of Slc39a6, Slc39a8, and Slc30a9. In Figure 4B (Zn*E2), Zn and E2 decreased the expression of all transporters respect to Control, excepting Slc39a6 in Zn. The expression of Slc39a6, Slc39a8, and Slc30a9 was higher in E2 + Zn compared to Zn and E2. The Scl39a14 expression was higher in E2 + Zn respect to E2 but lower than Zn In Figure 4C (Zn*FSH), Zn supplementation decreased the expression of all transporters respect to Control excepting Slc39a6. The Slc39a6 expression was decreased in the presence of FSH with or without the addition of Zn. The Slc39a8 expression was increased in the presence of FSH with or without the addition of Zn. The expression of Scl39a14 was similar in Zn, FSH, and FSH + Zn, and lower than Control. The Scl30a9 expression was similar in FSH and FSH + Zn, and lower than Control. The addition of Zn produced the lowest gene expression of Scl30a9. In Figure 4D (Zn*LH), Zn decreased the expression of all transporters respect to Control, excepting Scl39a6. The expression of Scl39a6 was similar in Control, Zn and LH + Zn. However, expression levels in LH were lower than Control. The expression of Scl39a8 was similar in Control, LH and LH + Zn, but in LH + Zn was higher than Zn.
12
Journal Pre-proof The Scl39a14 expression was higher in Control respect to Zn, LH and LH +Zn. The expression in LH and LH + Zn was similar and lower than Zn. The expression of Scl30a9 was the highest in Control compared to Zn, LH, and LH + Zn. The expression of Scl30a9 in Zn and LH was similar and lower than LH + Zn. A summary of the impact of E2, FSH, LH or 3H on the transporters’ gene expression when added together Zn in the IVM media can be observed in Figure 5, for both oocytes and CC. In all cases, gene response is relative to the Control treatment.
4. DISCUSSION In the last decades, growing evidence has supported the hormonal regulation of both Zn homeostasis and Zn-specific transporter gene expression [29,36]. Prolactin and testosterone regulate Slc39a1 transporter expression in prostate cancer cells [29,37]. The estrogen treatment of cancer cells increases Slc39a6 and Slc39a14 gene expression [38,39]. In croaker ovaries and MDA-MB-468 cells, Slc39a9 expression is up-regulated when incubated with steroid hormones [30]. Moreover, Zn homeostasis in the murine brain and intestine is modulated by androgens and estrogens [40,41]. In this study, we present evidence that oocyte maturation and fertilization-related hormones E2, LH and FSH modulate the concentration of intracytoplasmic Zn and gene expression of Zn transporters (Slc39a6, Slc39a8, Slc39a14and Slc30a9) in the bovine COC. In this study, it has been described that Zn interacts with E2, FSH and LH in bovine oocytes and CC, modifying intracellular free Zn levels and gene expression of Zn transporters. In the present study, we found that the addition of E2, LH, FSH, and Zn during IVM modulate intracellular free Zn levels in oocytes and CC. The FSI responses produced by Zn vs E2 vs E2 + Zn and Zn vs LH vs LH + Zn were similar among each other. On the contrary, the Zn*FSH showed a pattern of FSI response analogous to
13
Journal Pre-proof Zn*3H. This might indicate a predominant role of FSH in the overall effect of 3H on oocytes. Since FSH (with and without Zn supplementation) did not produce a significant change in CC Zn levels, its involvement in this 3H effect results remains unclear. Considering all treatments, FSI levels were higher in oocytes than in CC. It has been demonstrated, that CC lose their capacity to suppress free intracellular Zn in the oocytes after maturation, which is essential for oocytes to raise their total Zn content [33]. The FSI differences observed in oocytes and CC in the present work could reflect the consequences of that change in CC. However, in our study and Lisle et al. [33] free intracellular Zn concentrations were assessed with FluoZin-3 AM, leaving Zn bounded to proteins undetected [42,43]. It has been demonstrated, that Zn transporters were expressed in oocytes and cumulus cells of Bos grunniens [44]. To our knowledge, this is the first time that Slc39a6, Slc39a8, Slc39a14, Slc30a3 and Slc30a9 transporter gene expression is reported in Bos taurus. Regarding oocytes, Slc39a6 and Slc30a9 exhibited the highest response levels. In the majority of cases, Zn generated the highest levels of expression (except for Slc39a6 and Slc39a8 with FSH treatment) probably concerning the rise of total Zn levels during maturation [10]. For interaction responses in oocytes, 3H and 3H + Zn elicited lower relative expression values than Zn in all the evaluated transporters, thus revealing a regulatory effect of 3H. Individually examined hormones E2, FSH and LH induced diverse responses among transporters, with positive or negative interaction with Zn. Nevertheless, each hormonal treatment-induced lower levels of transporter expression in comparison to Zn in all cases, except for the FSH treatments in Slc39a6 and Slc39a8. The behavior of Slc39a6 after FSH stimulus is of special interest given its role in driving the oocyte-to-egg transition [45]. This finding strengthens the hormone-
14
Journal Pre-proof inducible trait of this transporter. In this regard, the especially strong impact of FSH on oocyte and cumulus gene transcription has been recently stated in pigs [46], reporting the relevant role of this hormone in the regulation of genes involved in ovulation of matured oocytes and CC maturation. Nevertheless, the rest of the transporters displayed a similar pattern of behavior under the influence of the different treatments. Regarding transporter interaction responses in CC, the Zn treatment produced an opposite result to that found in oocytes, since they remained lower than the Control. This could be related to the results obtained by Lisle et al., (2013), in which the loss of CC capacity to manage Zn levels in the oocyte after maturation is proposed. Similarly, to that found in the oocytes, 3H treatment kept expression levels in CC low, although, in this case, even behind the Control. Noticeably, the Zn*3H interaction produced a significantly increased expression response in 3H + Zn compared to 3H, another result which reversed to the oocytes. Concerning the individual influence of each hormone, transporter behavior with E2 and LH treatment groups was similar to that of 3H, with Slc39a6 and Slc39a8 reaching the highest response levels, and Slc39a14 and Slc30a9 the lowest. These last two transporters behaved similarly in the FSH treatment group. However, as in oocytes, Slc39a6 and Slc39a8 once again reacted in particular ways to FSH, being the response levels of both transporters notably increased under FSH and FSH + Zn treatments. Overall, Slc39a14 and Slc30a9 showed similar responses to different hormonal conditions.
5. Conclusions These findings shed new light on Zn homeostasis in the bovine COC by indicating hormonal modulation. Differences between oocytes and CC in Zn transporter gene expression were observed, possibly related to the important changes in Zn levels
15
Journal Pre-proof occurring in both cell types during maturation. Considering the three hormones analyzed in this study, an especially prominent role of FSH in the modulation of intracellular Zn levels and transporter gene expression is suggested. Zinc transporter Slc39a6, previously characterized as an estrogen-inducible gene, is now reinforced as being highly sensitive to hormonal regulation. Further research is needed for a better understanding of the mechanisms whereby the analyzed hormones accomplished such regulations.
ACKNOWLEDGMENTS Thanks are due to the staff of Frigorífico Gorina S.A. for providing the bovine ovaries. Thanks are also due to A. Di Maggio for manuscript editing. This work was supported by Agencia Nacional de Promoción Científica y Tecnológica de la República Argentina (BID PICT 2016-2131 and BID PICT 2016-3727)
CONFLICTS OF INTEREST The authors declare that there are no conflicts of interest.
6. REFERENCES [1]
Powell SR. The Antioxidant Properties of Zinc. J Nutr 2000;130:1447S-1454S. doi:10.1093/jn/130.5.1447S.
[2]
Dreosti IE. Zinc and the gene. Mutat Res 2001;475:161–7. doi:10.1016/s00275107(01)00067-7.
[3]
Prasad AS, Kucuk O. Zinc in Cancer Prevention. Cancer Metastasis Rev 2002;21:291–5. doi:10.1023/A:1021215111729.
[4]
Favier AE. The role of zinc in reproduction. Biol Trace Elem Res 1992;32:363–
16
Journal Pre-proof 82. doi:10.1007/BF02784623. [5]
Bedwal RS, Bahuguna A. Zinc, copper and selenium in reproduction. Experientia 1994;50:626–40. doi:10.1007/bf01952862.
[6]
Hostetler CE, Kincaid RL, Mirando M a. The role of essential trace elements in embryonic and fetal development in livestock. Vet J 2003;166:125–39. doi:10.1016/S1090-0233(02)00310-6.
[7]
Falchuk KH. The molecular basis for the role of zinc in developmental biology. Mol. Cell. Eff. Nutr. Dis. Process., Boston, MA: Springer US; 1998, p. 41–8. doi:10.1007/978-1-4615-5763-0_5.
[8]
Picco SJ, Anchordoquy JM, de Matos DG, Anchordoquy JP, Seoane A, Mattioli GA, et al. Effect of increasing zinc sulfate concentration during in vitro maturation
of
bovine
oocytes.
Theriogenology
2010;74:1141–8.
doi:10.1016/J.THERIOGENOLOGY.2010.05.015. [9]
Anchordoquy JM, Picco SJ, Seoane A, Anchordoquy JP, Ponzinibbio M V, Mattioli GA, et al. Analysis of apoptosis and DNA damage in bovine cumulus cells after exposure in vitro to different zinc concentrations. Cell Biol Int 2011;35:593–7. doi:10.1042/CBI20100507.
[10]
Kim AM, Vogt S, O’Halloran T V, Woodruff TK. Zinc availability regulates exit from meiosis in maturing mammalian oocytes. Nat Chem Biol 2010;6:674–81. doi:10.1038/nchembio.419.
[11]
Suzuki T, Yoshida N, Suzuki E, Okuda E, Perry ACF. Full-term mouse development by abolishing Zn2+-dependent metaphase II arrest without Ca2+ release. Development 2010;137:2659–69. doi:10.1242/dev.049791.
[12]
Bernhardt ML, Kong BY, Kim AM, O’Halloran T V., Woodruff TK. A ZincDependent Mechanism Regulates Meiotic Progression in Mammalian Oocytes1.
17
Journal Pre-proof Biol Reprod 2012;86. doi:10.1095/biolreprod.111.097253. [13]
Kim AM, Bernhardt ML, Kong BY, Ahn RW, Vogt S, Woodruff TK, et al. Zinc sparks are triggered by fertilization and facilitate cell cycle resumption in mammalian eggs. ACS Chem Biol 2011;6:716–23. doi:10.1021/cb200084y.
[14]
Que EL, Duncan FE, Lee HC, Hornick JE, Vogt S, Fissore RA, et al. Bovine eggs release zinc in response to parthenogenetic and sperm-induced egg activation.
Theriogenology
2019;127:41–8.
doi:10.1016/j.theriogenology.2018.12.031. [15]
Kambe T, Tsuji T, Hashimoto A, Itsumura N. The Physiological, Biochemical, and Molecular Roles of Zinc Transporters in Zinc Homeostasis and Metabolism. Physiol Rev 2015;95:749–84. doi:10.1152/physrev.00035.2014.
[16]
Palmiter RD, Huang L. Efflux and compartmentalization of zinc by members of the SLC30 family of solute carriers. Pflugers Arch Eur J Physiol 2004;447:744– 51. doi:10.1007/s00424-003-1070-7.
[17]
Guerinot M Lou. The ZIP family of metal transporters. Biochim Biophys Acta Biomembr 2000;1465:190–8. doi:10.1016/S0005-2736(00)00138-3.
[18]
Eide DJ. The SLC39 family of metal ion transporters. Pflugers Arch Eur J Physiol 2004;447:796–800. doi:10.1007/s00424-003-1074-3.
[19]
Jeong J, Eide DJ. The SLC39 family of zinc transporters. Mol Aspects Med 2013;34:612–9. doi:10.1016/j.mam.2012.05.011.
[20]
Liuzzi JP, Lichten LA, Rivera S, Blanchard RK, Aydemir TB, Knutson MD, et al. Interleukin-6 regulates the zinc transporter Zip14 in liver and contributes to the hypozincemia of the acute-phase response. Proc Natl Acad Sci U S A 2005;102:6843–8. doi:10.1073/pnas.0502257102.
[21]
Ishihara K, Yamazaki T, Ishida Y, Suzuki T, Oda K, Nagao M, et al. Zinc
18
Journal Pre-proof Transport Complexes Contribute to the Homeostatic Maintenance of Secretory Pathway Function in Vertebrate Cells. J Biol Chem 2006;281:17743–50. doi:10.1074/jbc.M602470200. [22]
Langmade SJ, Ravindra R, Daniels PJ, Andrews GK. The Transcription Factor MTF-1 Mediates Metal Regulation of the Mouse ZnT1 Gene. J Biol Chem 2000;275:34803–9. doi:10.1074/jbc.M007339200.
[23]
Liu M-J, Bao S, Gálvez-Peralta M, Pyle CJ, Rudawsky AC, Pavlovicz RE, et al. ZIP8 Regulates Host Defense through Zinc-Mediated Inhibition of NF-κB. Cell Rep 2013;3:386–400. doi:10.1016/j.celrep.2013.01.009.
[24]
Miyai T, Hojyo S, Ikawa T, Kawamura M, Irie T, Ogura H, et al. Zinc transporter SLC39A10/ZIP10 facilitates antiapoptotic signaling during early B-cell development.
Proc
Natl
Acad
Sci
2014;111:11780–5.
doi:10.1073/pnas.1323549111. [25]
Homma K, Fujisawa T, Tsuburaya N, Yamaguchi N, Kadowaki H, Takeda K, et al. SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response
under
Zinc
Deficiency.
Mol
Cell
2013;52:75–86.
doi:10.1016/j.molcel.2013.08.038. [26]
Zhao L, Oliver E, Maratou K, Atanur SS, Dubois OD, Cotroneo E, et al. The zinc transporter ZIP12 regulates the pulmonary vascular response to chronic hypoxia. Nature 2015;524:356–60. doi:10.1038/nature14620.
[27]
Ryu M-S, Lichten LA, Liuzzi JP, Cousins RJ. Zinc Transporters ZnT1 (Slc30a1), Zip8 (Slc39a8), and Zip10 (Slc39a10) in Mouse Red Blood Cells Are Differentially Regulated during Erythroid Development and by Dietary Zinc Deficiency. J Nutr 2008;138:2076–83. doi:10.3945/jn.108.093575.
[28]
Guo L, Lichten LA, Ryu M-S, Liuzzi JP, Wang F, Cousins RJ. STAT5-
19
Journal Pre-proof glucocorticoid receptor interaction and MTF-1 regulate the expression of ZnT2 (Slc30a2) in pancreatic acinar cells. Proc Natl Acad Sci 2010;107:2818–23. doi:10.1073/pnas.0914941107. [29]
Cousins RJ, Liuzzi JP, Lichten L a. Mammalian zinc transport, trafficking, and signals. J Biol Chem 2006;281:24085–9. doi:10.1074/jbc.R600011200.
[30]
Thomas P, Pang Y, Dong J, Berg AH. Identification and Characterization of Membrane Androgen Receptors in the ZIP9 Zinc Transporter Subfamily: II. Role of Human ZIP9 in Testosterone-Induced Prostate and Breast Cancer Cell Apoptosis. Endocrinology 2014;155:4250–65. doi:10.1210/en.2014-1201.
[31]
Ménézo Y, Pluntz L, Chouteau J, Gurgan T, Demirol A, Dalleac A, et al. Zinc concentrations in serum and follicular fluid during ovarian stimulation and expression of Zn2+transporters in human oocytes and cumulus cells. Reprod Biomed Online 2011;22:647–52. doi:10.1016/j.rbmo.2011.03.015.
[32]
Kincaid RL. Assessment of trace mineral status of ruminants: A review. J Anim Sci 2000;77:1. doi:10.2527/jas2000.77E-Suppl1x.
[33]
Lisle RS, Anthony K, Randall M a., Diaz FJ. Oocyte-cumulus cell interactions regulate free intracellular zinc in mouse oocytes. Reproduction 2013;145:381–90. doi:10.1530/REP-12-0338.
[34]
Ferreira T, Rasband W. ImageJ User Guide ImageJ User Guide IJ 1.46r. 2012.
[35]
Kim AM, Bernhardt ML, Kong BY, Ahn RW, Vogt S, Woodruff TK, et al. Zinc Sparks Are Triggered by Fertilization and Facilitate Cell Cycle Resumption in Mammalian Eggs. ACS Chem Biol 2011;6:716–23. doi:10.1021/cb200084y.
[36]
El-Tanani MKK, Green CD. Oestrogen-induced genes, pLIV-1 and pS2, respond divergently to other steroid hormones in MCF-7 cells. Mol Cell Endocrinol 1995;111:75–81. doi:10.1016/0303-7207(95)03550-Q.
20
Journal Pre-proof [37]
Costello LC, Liu Y, Zou J, Franklin RB. Evidence for a zinc uptake transporter in human prostate cancer cells which is regulated by prolactin and testosterone. J Biol Chem 1999;274:17499–504. doi:10.1074/JBC.274.25.17499.
[38]
Manning DL, Daly RJ, Lord PG, Kelly KF, Green CD. Effects of oestrogen on the expression of a 4.4 kb mRNA in the ZR-75-1 human breast cancer cell line. Mol Cell Endocrinol 1988;59:205–12. doi:10.1016/0303-7207(88)90105-0.
[39]
Taylor KM, Morgan HE, Smart K, Zahari NM, Pumford S, Ellis IO, et al. The Emerging Role of the LIV-1 Subfamily of Zinc Transporters in Breast Cancer. Mol Med 2007;13:396–406. doi:10.2119/2007.
[40]
Song MK, Kim YY, Heng MC, Adham NF, Ament ME. Prostaglandin interacts with steroid sex hormones in the regulation of intestinal zinc transport. Comp Biochem Physiol Comp Physiol 1992;101:477–81.
[41]
Beltramini M, Zambenedetti P, Wittkowski W, Zatta P. Effects of steroid hormones on the Zn, Cu and MTI/II levels in the mouse brain. Brain Res 2004;1013:134–41. doi:10.1016/J.BRAINRES.2004.04.010.
[42]
Gee KR, Zhou Z-L, Qian W-J, Kennedy R. Detection and Imaging of Zinc Secretion from Pancreatic β-Cells Using a New Fluorescent Zinc Indicator. J Am Chem Soc 2002;124:776–8. doi:10.1021/ja011774y.
[43]
Gee KR, Zhou ZL, Ton-That D, Sensi SL, Weiss JH. Measuring zinc in living cells. A new generation of sensitive and selective fluorescent probes. Cell Calcium 2002;31:245–51. doi:10.1016/S0143-4160(02)00053-2.
[44]
Xiong X, Lan D, Li J, Lin Y, Zi X. Effects of Zinc Supplementation During In Vitro Maturation on Meiotic Maturation of Oocytes and Developmental Capacity in Yak. Biol Trace Elem Res 2018;185:89–97. doi:10.1007/s12011-017-1217-6.
[45]
Kong BY, Duncan FE, Que EL, Kim AM, O’Halloran T V, Woodruff TK.
21
Journal Pre-proof Maternally-derived zinc transporters ZIP6 and ZIP10 drive the mammalian oocyte-to-egg
transition.
Mol
Hum
Reprod
2014;20:1077–89.
doi:10.1093/molehr/gau066. [46]
Blaha M, Nemcova L, Kepkova KV, Vodicka P, Prochazka R. Gene expression analysis of pig cumulus-oocyte complexes stimulated in vitro with follicle stimulating hormone or epidermal growth factor-like peptides. Reprod Biol Endocrinol 2015;13:113. doi:10.1186/s12958-015-0112-2.
22
Journal Pre-proof FIGURE CAPTIONS Figure 1. Representative COC fluorescent and differential interference contrast (DIC) images. The COCs were cultured for 24 h in IVM medium containing E2 (1µg/mL), FSH (1µg/mL), LH (10 µg/mL) or E2 + FSH + LH (3H) with or without 1.2 µg/mL Zn, according to the following treatments: a) Control; b) Zn; c) E2; d) E2 + Zn; e) FSH; f) FSH + Zn; g) LH; h) LH + Zn; i) 3H; and j) 3H + Zn. After maturation, COCs were loaded with 1 µM FluoZin-3 AM and showed green fluorescence. The fluorescent intensity corresponded to the levels of free Zn (pictures a to j).The correspondent DIC image of each fluorescent COC appears below (pictures a’ to j’). COC: cumulus-oocyte complex; IVM: in vitro maturation; Zn: zinc; E2: estradiol 17-beta; FSH: folliclestimulating hormone; LH: luteinizing hormone. A fluorescence control was included, which consisted in the FluoZin-3 AM staining of 15 COCs and its subsequent incubation with 10 µM of heavy metal chelator N,N,N’,N’-tetrakis (2-pyridylmethyl) ethane-1,2-diamine (TPEN) for 30 min. Scale bar = 150 µm. Figure 2. Interaction effects of Zn with E2, FSH or LH on intracellular free Zn concentration in oocytes and CC. A total of 150 COCs (15 per treatment) were matured for 24 h in IVM medium containing E2 (1µg/mL), FSH (1µg/mL), LH (10 µg/mL) or E2 + FSH + LH (3H) with or without 1.2 µg/mL Zn, according to the following treatments: Control; Zn; E2; E2 + Zn; FSH; FSH + Zn; LH; LH + Zn; 3H; and 3H + Zn. i) Zn*3H interactions; ii) Zn*E2 interactions; iii) Zn*FSH interactions; and iv) Zn*LH interactions. Zn: zinc; E2: estradiol 17-beta; FSH: follicle-stimulating hormone; LH: luteinizing hormone; CC: cumulus cells; COC: cumulus-oocyte complex; IVM: in vitro maturation. (a-c) Significant differences, p ≤ 0.05. (*) Indicate significant differences between oocytes and CC in the corresponding IVM treatment, p ≤ 0.05. Results are expressed as least squared means ± SEM. 23
Journal Pre-proof Figure 3. Interaction effects of Zn with E2, FSH or LH on gene expression of Slc39a6, Slc39a8, Slc39a14 and Slc30a9 in oocytes. A total of 750 COCs (75 per treatment) were cultured for 24 h in IVM medium containing E2 (1µg/mL), FSH (1µg/mL), LH (10 µg/mL) or E2 + FSH + LH (3H) with or without 1.2 µg/mL Zn, according to the following treatments: Control; Zn; E2; E2 + Zn; FSH; FSH + Zn; LH; LH + Zn; 3H and 3H + Zn. The relative expression of Slc39a6, Slc39a8, Slc39a14 and Slc30a9 in the oocytes is shown. A): Zn*3H interaction; B): Zn*E2 interaction; C): Zn*FSH interaction; and D): Zn*LH interaction. Zn: zinc; COC: cumulus-oocyte complex; IVM: in vitro maturation E2: estradiol 17-beta; FSH: follicle-stimulating hormone; LH: luteinizing hormone. (a-c) Significant differences, p ≤ 0.05. Results are expressed as least squared means ± SEM. Figure 4. Interaction effects of Zn with E2, FSH or LH on gene expression of Slc39a6, Slc39a8, Slc39a14 and Slc30a9 in CC. A total of 750 COCs (75 per treatment) were cultured for 24 h in IVM medium containing E2 (1µg/mL), FSH (1µg/mL), LH (10 µg/mL) or E2 + FSH + LH (3H), with or without 1.2 µg/mL Zn, according to the following treatments: Control; Zn; E2; E2 + Zn; FSH; FSH + Zn; LH; LH + Zn; 3H; and 3H + Zn. The relative expression of Slc39a6, Slc39a8, Slc39a14 and Slc30a9 in CC is shown. A): Zn*3H interaction; B): Zn*E2 interaction; C): Zn*FSH interaction; and D): Zn*LH interaction. CC: cumulus cells; COC: cumulus-oocyte complex; IVM: in vitro maturation E2: estradiol 17-beta; FSH: follicle-stimulating hormone; LH: luteinizing hormone. (a-c) Significant differences, p ≤ 0.05. Results are expressed as least squared means ± SEM. Figure 5. Representative diagram of a COC. Changes in bovine Zn transporter gene expression after 24-hr IVM with hormones and Zn supplementation are indicated. The inner circle symbolizes the oocyte (OV), while the outside of the black ring (zona 24
Journal Pre-proof pellucida) corresponds to the cumulus cells (CC). IVM media included: E2 (1µg/mL), FSH (1µg/mL), LH (10 µg/mL) or E2 + FSH + LH (3H) with or without 1.2 µg/mL Zn. Arrows and hyphens indicate the responses of the analyzed transporters to said IVM treatments, being: ↑ rise in relative gene expression (RE); ↓ decrease in RE; − no significant change in RE; in all cases, with respect to the Control. Solid arrows refer to transporter gene response to a hormonal treatment without Zn addition, while dotted arrows denote the response to a hormonal treatment plus Zn supplementation. COC: cumulus-oocyte complex; IVM: in vitro maturation; Zn: zinc; E2: estradiol 17-beta; FSH: follicle-stimulating hormone; LH: luteinizing hormone.
25
Journal Pre-proof
Author Contributions
Ana M. Pascua: acquisition of data and drafting the article (PhD student)
Noelia Nikoloff: analysis and interpretation of data
Ana C. Carranza-Martín: analysis and interpretation of data
Juan Patricio Anchordoquy: analysis and interpretation of data
Silvina Quintana: acquisition of data
Barbisán Gisela: analysis and interpretation of data
Silvina Díaz: acquisition of data
Juan Mateo Anchordoquy: the conception and design of the study, revising it critically for important intellectual content
Cecilia C. Furnus: the conception and design of the study, revising it critically for important intellectual content
Journal Pre-proof
Zinc availability is beneficial for follicular growth, oocyte maturation, fertilization, and embryo development. Reproductive hormones affected Zn homeostasis and gene expression of Zn transporters during IVM of bovine COC. The gene expression of Zn transporters in oocytes and cumulus cells were different The role of FSH in the modulation of intracellular Zn levels and transporter gene expression is evident The Zn transporter Slc39a6 is highly sensitive to hormonal regulation.
Journal Pre-proof
Table 1. Primer sequences used for gene expression analysis Gene
Direction
Primer sequence (5’-3’)
Slc39a6
Forward Reverse
CCCTCCAAAGACCTATTC ATCACCACTCAGTGTCCC
Slc39a8
Forward Reverse
GGACTCAGCACCTCCATAGC GCCCACCAAGATGCCAAAAG
Slc39a14
Forward Reverse
GAGTTCCAGGAGTTCTGCCC ACGCAGAGGAGACCGTACC
Slc30a3
Forward Reverse
ACGCAGAGGAGACCGTACC TGATTGCCTCCATCCTCATC
Slc30a7
Forward Reverse
CAAGGTCCCAACATAAAC AATGCAAAGAACTCCTCC
Slc30a9
Forward Reverse
GCTTCGTAGGAGTGCTCG GTGGGTTGCCTGTTATGG
ACTB
Forward Reverse
GGCAGGTCATCACCATCGG CAGCACCGTGTTGGCGTAG
PPIA
Forward Reverse
GGTCATCGGTCTCTTTGGAA TCCTTGATCACACGATGGAA
Fragment size (bp) 175
Annealing temperature (°C) 52
165
55
146
60
170
60
136
52
164
57
164
60
117
58
Journal Pre-proof
Table 2. cDNA sequences of PCR-amplified transporters Slc39a6, Slc39a8, Slc39a14 and Slc30a9.
PCR product sequence
Fragment size (bp)
GenBank Accession Number
Slc39a6
TCCCTCCAAAGACCTATTCTTTACAAA TAGCCTGGGTTGGTGGCTTATAGCCAT TTCCGTCATCAGTTTCCTGTCTTTGCTG GGTGTGATCTTAGTGCCTCTCATGAAT CGAGTGTTTTTCAAGTTTCTTCTGAGTT TCCTTGTGGCATTGGCTGTCGGGACAC TGAGTGGT
173
MK332118
Slc39a8
ACTCAGCACCTCCATAGCCATCCTATG TGAGGAGTTCCCTCATGAATTAGGGGA CTTTGTGATCCTACTCAATGCAGGAAT GAGCACTCGACAAGCCTTGTTATTCAA TTTCCTTTCTGCATGTTCCTGCTATGTT GGGCTAGCTTTTGGCATCTTGGTGGGC
163
MK341547
Slc39a14
GAGTTCCAGGAGTTCTGCCCCACCATC CTCCAGCAGCTGGACTCCAGGGCCTGC TCCTCCGAGAACCAGGAGAATGAGGA GAACGAGCAGACAGAAGAGGGGAGGC CCAGCTCGGTGGAAGTTTGGGGGTACG GTCTCCTCTGCGTA
147
MK482694
Slc30a9
GCTTCGTAGGAGTGCTCGGGCCAAAGG AATGTCATTTTACAAGTATGTAATGGA AAGTCGTGATCCTAGTACAAATGTTAT ATTACTGGAGGATACTGCAGCTGTGTT GGGAGTGACAATAGCAGCCACTTGTAT GGGCCTTACCTCCATAACAGGCAACCC AC
164
MK425690
Gene
Ana M. Pascua, Noelia Nikoloff, Ana C. Carranza, Juan P. Anchordoquy, Silvina Quintana, Gisela Barbisán, Silvina Díaz, Juan M. Anchordoquy, Cecilia C. Furnus PII:
S0093-691X(20)30067-4
DOI:
https://doi.org/10.1016/j.theriogenology.2020.01.054
Reference:
THE 15351
To appear in:
Theriogenology
Received Date:
24 July 2019
Accepted Date:
28 January 2020
Please cite this article as: Ana M. Pascua, Noelia Nikoloff, Ana C. Carranza, Juan P. Anchordoquy, Silvina Quintana, Gisela Barbisán, Silvina Díaz, Juan M. Anchordoquy, Cecilia C. Furnus, Reproductive hormones influence zinc homeostasis in the bovine cumulus-oocyte complex: impact on intracellular zinc concentration and transporters gene expression, Theriogenology (2020), https://doi.org/10.1016/j.theriogenology.2020.01.054
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier.
Journal Pre-proof
Reproductive hormones influence zinc homeostasis in the bovine cumulus-oocyte complex: impact on intracellular zinc concentration and transporters gene expression
Ana M. Pascua1, Noelia Nikoloff1, Ana C. Carranza1, Juan P. Anchordoquy1, Silvina Quintana2, Gisela Barbisán1, Silvina Díaz1, Juan M. Anchordoquy1*, Cecilia C. Furnus1,3* *Equal Contribution 1IGEVET
– Instituto de Genética Veterinaria “Ing. Fernando N Dulout”(UNLP-
CONICET LA PLATA), Facultad de Ciencias Veterinarias UNLP, calles 60 y 118, B1904AMA La Plata, Buenos Aires, Argentina. 2CIAS
– Centro de Investigación en Abejas Sociales, Departamento de Biología,
Facultad de Ciencias Exactas y Naturales, Universidad Nacional de Mar del Plata, Funes 3350 (7600), Mar del Plata, Buenos Aires, Argentina 3Cátedra
de Citología, Histología y Embriología “A” Facultad de Ciencias Médicas,
Universidad Nacional de La Plata, calle 60 y 120 s/n, CP 1900, La Plata, Buenos Aires, Argentina
Correspondence Cecilia C. Furnus, Instituto de Genética Veterinaria Prof. Fernando N. Dulout (IGEVET, CCT CONICET LA PLATA - UNLP), Facultad de Ciencias Veterinarias, Universidad Nacional de La Plata Email: [email protected]
1
Journal Pre-proof
Abstract Zinc (Zn) is a vital trace element for the body and its bioavailability influences numerous reproductive events. However, the mechanisms that regulate Zn homeostasis in the cumulus-oocyte complex (COC) are yet to be elucidated. The aim of this study was to investigate the role of estradiol 17-beta (E2), FSH and LH in Zn homeostasis regulation in bovine COC matured in vitro and Zn transporters gene expression. For this purpose, intracellular Zn levels in oocytes and cumulus cells (CC) were assessed using a Zn-specific fluorescent indicator. In addition, gene expression and sequencing of six Zn transporters (Slc39a6, Slc39a8, Slc39a14, Slc30a3, Slc30a7 and Slc30a9) were assessed. Our results demonstrated that the simultaneous presence of E2, FSH, and LH during oocyte maturation altered intracellular zinc levels and transporters expression in both oocytes and CC. Transporter's gene expression was different in oocytes and CC, possibly due to cell-specific changes in Zn levels during maturation. The interaction effects of Zn with hormonal treatments influenced the results. This study emphasizes that Slc39a6 is highly sensitive to hormone induction. Overall, the hormonal modulation of Zn homeostasis in the COC was evidenced. Also, a preponderant role of FSH as a modulator of Zn intracellular levels and transporter gene expression is suggested.
KEYWORDS estradiol 17-beta, LH, FSH, zinc, cumulus-oocyte complex, zinc transporters
2
Journal Pre-proof
1. INTRODUCTION Zinc (Zn) is a trace mineral involved in several cellular processes, such as proliferation, immune function, antioxidant defense, gene expression, and ARN polymerase activity [1–3]. In mammals, Zn homeostasis is essential for optimal metabolic function in reproductive processes. Zinc deficiency results in fetal teratogenesis, long gestation, problematic labor, low birth weight and weak offspring [4,5]. In contrast, Zn availability is beneficial for follicular growth, oocyte maturation, fertilization and embryo development [6,7]. Zinc plays an important role during the oocyte maturation process and on somatic cell viability in the reproductive tract [8,9]. It has been demonstrated that Zn availability regulates exit from meiosis during oocyte maturation [10]. In mammals, Zn dependent mechanisms control first meiotic division completion and metaphase II (MII) oocyte arrest [11,12]. In oocytes, a rapid release of Zn from the oocyte to the external environment facilitates the advance from MII to complete meiosis. This mechanism is known as “zinc sparks” is triggered by fertilization and is critical for cell cycle resumption [13]. Recently, it was informed that bovine oocytes undergo the Zn spark phenomenon in response to parthenogenetic and sperm-induced activation. The similarity of Zn efflux occurrence in murine, non-human primate, human and bovine oocyte suggests a highly conserved event among mammals [14]. Several cellular processes are dependent on adequate Zn levels. In this context, is critical to understand in what manner the expression of Zn transporters expression is regulated [15]. At present, two families of Zn transporters were described in mammals. The ZnT family decreases Zn concentration in the cytoplasm by transporting Zn to the organelles or towards the extracellular space [16]. On the other hand, Zrt-, Irt3
Journal Pre-proof likeprotein (ZIP) family increases the cytoplasmic Zn level by moving Zn in the opposite direction [17]. The transporters ZnT1 to Znt10 belong to the solute carrier family 30A (SLC30A), and ZIP1 to ZIP14 are included in SLC39A family [16, 17, 18,19]. Previous studies have revealed that gene expression of Zn transporters respond to various stimuli including interleukin-6 [20], lipopolysaccharides [21], transcription factors [22–24], oxidative stress [25], hypoxia [26], Zn concentration [27,28] and hormones such as testosterone and estrogen [29,30]. However, information about Zn transport and regulation in the bovine cumulus-oocyte complex (COC) is not currently available. The aim of the present study was to investigate whether estradiol 17-beta (E2), follicle-stimulating (FSH) and luteinizing (LH) hormones influence Zn homeostasis and transporter gene expression during in vitro maturation (IVM) of bovine COC. For this purpose, experiments were designed to evaluate intracellular Zn levels in oocytes and cumulus cells (CC) using a Zn-specific fluorescent indicator. Gene expression and sequencing of six Zn transporters (Slc39a6, Slc39a8, Slc39a14, Slc30a3, Slc30a7, Slc30a9) involved in oocyte and CC Zn homeostasis were also evaluated [31].
2. MATERIALS AND METHODS 2.1 Reagents All reagents for media preparation were purchased from Sigma Chemical Co. (St. Louis, MO, USA), whereas FSH was purchased from Bioniche (Belleville, Ontario, Canada), and standard zinc sulfate (ZnSO4) water solution was procured from Merck (Tokyo, Japan). Medium for IVM consisted of bicarbonate-buffered TCM-199 supplemented with 10% (v/v) fetal calf serum (FCS), 0.2 mM sodium pyruvate, 1 mM glutamine and 50 mg/mL kanamycin.
4
Journal Pre-proof 2.2 Cumulus–oocyte complexes (COCs) Bovine ovaries were obtained from an abattoir and transported to the laboratory in sterile NaCl solution (9 g/L) with antibiotics (streptomycin and penicillin) at 37°C within 3 h after slaughter. Ovaries were pooled, regardless of the stage of the estrous cycle of the donor. Cumulus–oocyte complexes were aspirated from 3 to 8 mm follicles, using an 18-G needle connected to a sterile syringe. Only cumulus-intact complexes with evenly granulated cytoplasm were selected for IVM, using a low-power (20–30X) stereomicroscope (Nikon, Tokyo, Japan).
2.3 In vitro maturation (IVM) Cumulus–oocyte complexes were washed twice in TCM-199 buffered with 15 mM HEPES containing 10% (v/v) FCS and twice in IVM medium. Groups of 10 COCs were transferred into 50 µL of IVM medium under mineral oil (Squibb, Princeton, NJ, USA) pre-equilibrated in a CO2 incubator. The incubations were performed at 39°C in an atmosphere of 5% CO2 in air with saturated humidity for 24 h in IVM medium containing E2 (1µg/mL), FSH (1µg/mL) or LH (10 µg/mL), with or without 1.2 µg/mL Zn (adequate Zn status according to values proposed in the literature) [32]. Treatment groups were as follows: a) Control (neither hormone nor Zn2+); b) Zn (no hormone and Zn); c) E2; d) E2 + Zn; e) FSH; f) FSH + Zn; g) LH; h) LH + Zn; i) E2 + FSH + LH (3H); j) 3H + Zn. Because of FCS use, hormones and Zn concentrations were measured in IVM medium before treatment supplementation. Concentrations of hormones were quantified in a commercial laboratory (Clinical Chemistry Department, IglesiasHaramburu Institute, La Plata, Argentina) by using RIA kits (Siemens Medical Solutions Diagnostics, Los Angeles, CA, USA), while Zn was assessed by means of an atomic absorption spectrophotometer (GBC 902) through an internal quality control
5
Journal Pre-proof (Piper and Higgins 1967; Picco et al. 2012). Results were 5.8 pg/mL of E2, 0.39 pg/mL of FSH and 0.3 µg/mL of Zn (no LH detected). All these concentrations were considered insubstantial when compared to those of the treatments. Three replicates from different days were reserved for gene expression studies, and the other three replicates were reserved for free Zn intracellular level staining analyses.
2.4 Zinc measurements using FluoZin-3 AM indicator dye After IVM, 45 COCs per treatment (15 per replicate) were assessed to determine intracellular Zn levels in oocytes and CC. For this purpose, FluoZin-3 AM dye (InvitroGen, USA), a fluorescent cell-permeable selective indicator of free or loosely bound intracellular Zn concentration was used [33]. Briefly, COCs were washed with phosphate-free HEPES-Buffered Hanks Balanced Salt Solution (HHBSS) to remove IVM medium and incubated separately in 1 µM FluoZin-3 AM (final concentration) for 30 min at room temperature in dark. Then, COCs were rinsed in HHBSS for 15 min to cleave AM ester. After cleavage, COCs were washed in HHBSS to remove excess dye and transferred onto slides, topped with a coverslip and visualized by a Leica TCS-SP5 Confocal Microscope (Leica Microsystems, Wetzlar, Germany) equipped with a 330490 nm excitation filter and 420-520 nm emission filters, at 100X magnification. The intensity of green fluorescence observed in oocytes and CC corresponded to free Zn levels. In each replicate, a fluorescence control (15 COCs matured as Control group) was included and consisted of FluoZin-3 AM staining and subsequent incubation in 10 µM of heavy metal chelator N,N,N’,N’-tetrakis (2-pyridylmethyl) ethane-1,2-diamine (TPEN) for 30 min, followed by re-imaging as before. The fluorescence intensity of each COC was determined with Image J software 1.48 v (Wayne Rasband, National Institute of Health, USA), which allowed to select
6
Journal Pre-proof and evaluate fluorescence intensity in oocyte and CC separately. For this purpose, pixel intensity is divided by the number of pixels for each cell type. Results are expressed as the average of intensity in oocytes and CC [34].
2.5 Isolation of mRNA and Real-time polymerase chain reaction (RT-PCR) A total of 750 COCs were used in three replicates (250 COCs per replicate, 25 COCs per group). At the end of IVM, CC was stripped out from oocytes by repeated pipetting with a narrow-bore pipette. Total RNA was isolated with an RNeasy Micro Kit (Qiagen, Germany) from oocytes and CC according to the manufacturer’s instructions. Then, RNA content and quality in each sample were checked with a spectrophotometer (NanoVue™- GE Healthcare Limited, UK) at 260 nm and 260/280 nm ratio, respectively. The cDNA was synthesized using a reaction mixture containing 1.5 µg of total RNA, random hexamers and M-MLV reverse transcriptase as suggested by the manufacturer (Invitrogen-Life Technologies, USA). Next, RT-PCR was performed on cDNA from oocytes and CC to evaluate the expression of Slc39a6 (ZIP 6), Slc39a8 (ZIP 8), Slc39a14 (ZIP 14), Slc30a3 (Znt 3), Slc30a7 (Znt 7) and Slc30a9 (Znt 9) genes. For this purpose, oligonucleotide primers were designed (Table 1) to span exon-exon junctions to obtain the mature transcripts and to avoid possible genomic DNA amplification, by using the Primer Premier Software (PREMIER Biosoft International, USA). A Rotor-Gene Q thermocycler (Qiagen, Hilden, Germany) was implemented to perform RT-PCR. The reaction mixture (final volume, 20 µL) included 1 X PCR Master Mix (KAPA HRM FAST Master Mix, Biosystems, Woburn, USA), 1 µL cDNA and 1 µL of each primer (0.5 µM final concentration). Cycling conditions consisted of initialization (95°C, 3 min), denaturation (95°C, 15 min), annealing (particular temperatures shown in Table 1, 20 s,
7
Journal Pre-proof 40 cycles) and extension (72°C, 25 s). For each sample, the specificity of the PCR product was checked with a melting curve analysis. Negative controls were included and experiments were always performed in triplicate. RT-PCR efficiency for each gene was determined by a linear regression model, according to the equation E = 10 [−1/slope]. Then, the relative expression analysis of each target gene was performed with the 2-DDCt method using β-actin (ACTB) and cyclophilin-A (PPIA) as normalizers for the oocyte and CC data, respectively. The Control treatment was taken as a reference (relative expression = 1). To assess amplicon quality condition and after finding the mRNA transcript sequences of the transporters in a predicted or provisional NCBI status, PCR products were sent for sequencing to Macrogen, Inc. (Korea). For this purpose, amplicon integrity and size were verified by 2% agarose gel electrophoresis, quantified by spectrophotometry (NanoVue™-NV - GE Healthcare Limited, UK), and then purified and sequenced in both strands using the same oligonucleotide primers. Resulting sequences were aligned and edited using the ProSeq 3.2 (Filatov 2002), and a Basic Local Alignment Search Tool (BLAST, NCBI) search was run to verify the identity of the obtained sequences. Sequences were successfully obtained from the amplified cDNA of transporters Slc39a6, Slc39a8, Slc39a14 and Slc30a9 (Table 2) with 100 % identity and bearing no substitutions, deletions or insertions, therefore providing experimental evidence of the thus far predicted sequences.
2.6 Statistical analysis We used a completely randomized block design with 4 2 x 2 factorial arrangements of main variables (with/without Zn x with/without E2, FSH, LH or 3H). Statistical models included the random effect of the block (day of COCs collection, n =
8
Journal Pre-proof 3 for each essay), the fixed effect of Zn and hormones (E2, FSH, LH, and 3H) and the second-order interaction of the main variables (Zn*E2, Zn*FSH, Zn*LH, and Zn*3H). The effect of Zn and hormones on the response variables (fluorescence intensity and relative mRNA expression) were analyzed with linear regression models by using the MIXED procedure of SAS (SAS Institute, Cary, NC, USA). The effect of cell type (oocyte vs CC) on fluorescence intensity was also evaluated. Results are expressed as least squared means ± SEM. Statistical significance was set at p ≤ 0.05, and p ≤ 0.10 for tendency and interactions.
3 RESULTS 3.1 Intracellular zinc levels in COCs matured in vitro with zinc and hormones After IVM, COCs were staining with FluoZin-3 AM and incubated with TPEN (Figure 1). No fluorescent signal was observed in COCs treated with TPEN indicating that fluorescence is specific to detect intracellular free Zn and does not correspond to dye accumulation [14,35]. FluoZin-3 AM signal intensity (FSI) in oocytes and CC are shown in Figure 2. Significant interactions between Zn with every hormonal treatment (3H, E2, FSH or LH) were observed in oocytes and CC, excepting Zn*3H in CC. Interaction refers to how the effect on the response of one variable (Zn) depends on the level of one other explanatory variable (3H, E2, FSH or LH).
3.1.1 Oocytes In oocytes, intracellular zinc levels expressed by FSI showed interactions between Zn and each hormonal treatment: Zn*3H, Zn*E2, Zn*FSH, and Zn*LH. In Figure 2i (Zn*3H), the FSI was significantly higher in the presence of Zn alone compared to Control, 3H and 3H + Zn. In Figure 2ii (Zn*E2), the FSI in the presence of
9
Journal Pre-proof Zn, E2, and E2 + Zn were similar and higher respect to Control. In Figure 2iii (Zn*FSH), the FSI was significantly higher in FSH compared to Control, however, Zn and FSH + Zn were similar and higher than Control and FSH. In Figure 2iv (Zn*LH), no significant differences among Zn, LH, and LH + Zn were detected, while the lowest FSI value was observed in Control.
3.1.2 Cumulus cells The evaluation of intracellular zinc levels in CC showed significant interactions in Zn*E2, Zn*LH, and Zn*FSH. In Figure 2i (Zn*3H), the FSI was increased in the presence of Zn with or without the addition of 3H. The 3H treatment did not affect intracellular zinc concentrations. In Figure 2ii (Zn*E2), the FSI in Zn, E2 and E2 + Zn was similar and higher than Control. In Figure 2iii (Zn*FSH), the FSI levels were similar in Control and FSH whereas FSH + Zn was higher than Control and similar to FSH and Zn. In Figure 2iv (Zn*LH), the FSI in Zn, LH, and LH + Zn was similar and higher than Control. In all treatments, the FSI values were higher in oocytes compared with CC (p < 0.02; Figure 2).
3.2 Zinc transporter expression in oocytes and CC The expression of zinc transporters in oocytes and CC are shown in Figure 3 and Figure 4. The gene expression of Slc39a6, Slc39a8, Slc39a14, and Slc30a9 was quantified. Even though we found Slc30a3 gene expression in oocytes and CC, it could not be quantified due to low mRNA levels. No Slc30a7 gene expression was detected in either cell type.
3.2.1 Oocytes 10
Journal Pre-proof In oocytes, significant interactions between Zn with every hormonal treatment (3H, E2, FSH or LH) were observed in all transporters studied except for Zn*FSH and Zn*LH in Slc39a14 (Figure 3). In Figure 3A (Zn*3H), Zn treatment showed higher expression in all transporters. The expression of Slc39a6, Slc39a8, and Slc39a14 was similar in the Control and 3H. However, Scl30a9 expression was lower in 3H compared to Control. Besides, the expression Slc39a6 and Scl30a9 were similar in 3H and 3H + Zn, but the expression of Slc39a8 and Slc39a14 was higher in 3H than 3H + Zn. In Figure 3B (Zn*E2), Zn significantly increased the expression of all transporters compared with Control, E2, and E2 + Zn. The expression of Scl39a6 in E2 and E2 + Zn was similar and higher than Control. The expression of Scl39a8 was similar in Control, E2, and E2 + Zn. However, Scl39a8 was highly expressed in E2 compared to E2 + Zn. The Scl39a14 expression in E2 and E2 + Zn was significantly lower than Control. Besides, Scl39a14 expression was higher in E2 than E2 + Zn. The expression of Scl30a9 was similar in Control, E2, and E2 + Zn. In Figure 3C (Zn*FSH), Zn supplementation significantly increased the expression of all transporters respect to Control. The expression of Scl39a6 in FSH was higher than Control, Zn and FSH + Zn. Besides, Scl39a6 expression was similar in Zn and FSH + Zn, and both were higher than Control. The expression of Scl39a8 was similar in Zn and FSH + Zn, and both were higher compared to FSH and Control. The Scl39a14 expression was decreased in the presence of FSH with or without the addition of Zn. The Scl30a9 expression was similar in Control, FSH and FSH + Zn and lower than Zn. In Figure 3D (Zn*LH), Zn supplementation significantly increased the expression of all transporters respect to Control, LH and LH + Zn. The Scl39a6 expression was higher in LH compared to Control and LH + Zn, and LH + Zn was
11
Journal Pre-proof higher than Control. The expression of Scl39a8 was similar in Control, LH and LH + Zn. The Scl39a14 expression was decreased in the presence of LH with or without the addition of Zn. The expression of Scl30a9 was higher in LH compared to Control and LH + Zn, and the latter was the lowest.
3.2.2 Cumulus cells In CC, significant interactions between Zn with every hormonal treatment (3H, E2, FSH or LH) were observed in all transporters studied except Zn*FSH in Slc39a6 and Slc39a8 (Figure 4). In Figure 4A (Zn*3H), Zn and 3H decreased all transporters expression compared with Control. The presence of 3H + Zn increased the expression of Slc39a6, Slc39a8, and Slc30a9. In Figure 4B (Zn*E2), Zn and E2 decreased the expression of all transporters respect to Control, excepting Slc39a6 in Zn. The expression of Slc39a6, Slc39a8, and Slc30a9 was higher in E2 + Zn compared to Zn and E2. The Scl39a14 expression was higher in E2 + Zn respect to E2 but lower than Zn In Figure 4C (Zn*FSH), Zn supplementation decreased the expression of all transporters respect to Control excepting Slc39a6. The Slc39a6 expression was decreased in the presence of FSH with or without the addition of Zn. The Slc39a8 expression was increased in the presence of FSH with or without the addition of Zn. The expression of Scl39a14 was similar in Zn, FSH, and FSH + Zn, and lower than Control. The Scl30a9 expression was similar in FSH and FSH + Zn, and lower than Control. The addition of Zn produced the lowest gene expression of Scl30a9. In Figure 4D (Zn*LH), Zn decreased the expression of all transporters respect to Control, excepting Scl39a6. The expression of Scl39a6 was similar in Control, Zn and LH + Zn. However, expression levels in LH were lower than Control. The expression of Scl39a8 was similar in Control, LH and LH + Zn, but in LH + Zn was higher than Zn.
12
Journal Pre-proof The Scl39a14 expression was higher in Control respect to Zn, LH and LH +Zn. The expression in LH and LH + Zn was similar and lower than Zn. The expression of Scl30a9 was the highest in Control compared to Zn, LH, and LH + Zn. The expression of Scl30a9 in Zn and LH was similar and lower than LH + Zn. A summary of the impact of E2, FSH, LH or 3H on the transporters’ gene expression when added together Zn in the IVM media can be observed in Figure 5, for both oocytes and CC. In all cases, gene response is relative to the Control treatment.
4. DISCUSSION In the last decades, growing evidence has supported the hormonal regulation of both Zn homeostasis and Zn-specific transporter gene expression [29,36]. Prolactin and testosterone regulate Slc39a1 transporter expression in prostate cancer cells [29,37]. The estrogen treatment of cancer cells increases Slc39a6 and Slc39a14 gene expression [38,39]. In croaker ovaries and MDA-MB-468 cells, Slc39a9 expression is up-regulated when incubated with steroid hormones [30]. Moreover, Zn homeostasis in the murine brain and intestine is modulated by androgens and estrogens [40,41]. In this study, we present evidence that oocyte maturation and fertilization-related hormones E2, LH and FSH modulate the concentration of intracytoplasmic Zn and gene expression of Zn transporters (Slc39a6, Slc39a8, Slc39a14and Slc30a9) in the bovine COC. In this study, it has been described that Zn interacts with E2, FSH and LH in bovine oocytes and CC, modifying intracellular free Zn levels and gene expression of Zn transporters. In the present study, we found that the addition of E2, LH, FSH, and Zn during IVM modulate intracellular free Zn levels in oocytes and CC. The FSI responses produced by Zn vs E2 vs E2 + Zn and Zn vs LH vs LH + Zn were similar among each other. On the contrary, the Zn*FSH showed a pattern of FSI response analogous to
13
Journal Pre-proof Zn*3H. This might indicate a predominant role of FSH in the overall effect of 3H on oocytes. Since FSH (with and without Zn supplementation) did not produce a significant change in CC Zn levels, its involvement in this 3H effect results remains unclear. Considering all treatments, FSI levels were higher in oocytes than in CC. It has been demonstrated, that CC lose their capacity to suppress free intracellular Zn in the oocytes after maturation, which is essential for oocytes to raise their total Zn content [33]. The FSI differences observed in oocytes and CC in the present work could reflect the consequences of that change in CC. However, in our study and Lisle et al. [33] free intracellular Zn concentrations were assessed with FluoZin-3 AM, leaving Zn bounded to proteins undetected [42,43]. It has been demonstrated, that Zn transporters were expressed in oocytes and cumulus cells of Bos grunniens [44]. To our knowledge, this is the first time that Slc39a6, Slc39a8, Slc39a14, Slc30a3 and Slc30a9 transporter gene expression is reported in Bos taurus. Regarding oocytes, Slc39a6 and Slc30a9 exhibited the highest response levels. In the majority of cases, Zn generated the highest levels of expression (except for Slc39a6 and Slc39a8 with FSH treatment) probably concerning the rise of total Zn levels during maturation [10]. For interaction responses in oocytes, 3H and 3H + Zn elicited lower relative expression values than Zn in all the evaluated transporters, thus revealing a regulatory effect of 3H. Individually examined hormones E2, FSH and LH induced diverse responses among transporters, with positive or negative interaction with Zn. Nevertheless, each hormonal treatment-induced lower levels of transporter expression in comparison to Zn in all cases, except for the FSH treatments in Slc39a6 and Slc39a8. The behavior of Slc39a6 after FSH stimulus is of special interest given its role in driving the oocyte-to-egg transition [45]. This finding strengthens the hormone-
14
Journal Pre-proof inducible trait of this transporter. In this regard, the especially strong impact of FSH on oocyte and cumulus gene transcription has been recently stated in pigs [46], reporting the relevant role of this hormone in the regulation of genes involved in ovulation of matured oocytes and CC maturation. Nevertheless, the rest of the transporters displayed a similar pattern of behavior under the influence of the different treatments. Regarding transporter interaction responses in CC, the Zn treatment produced an opposite result to that found in oocytes, since they remained lower than the Control. This could be related to the results obtained by Lisle et al., (2013), in which the loss of CC capacity to manage Zn levels in the oocyte after maturation is proposed. Similarly, to that found in the oocytes, 3H treatment kept expression levels in CC low, although, in this case, even behind the Control. Noticeably, the Zn*3H interaction produced a significantly increased expression response in 3H + Zn compared to 3H, another result which reversed to the oocytes. Concerning the individual influence of each hormone, transporter behavior with E2 and LH treatment groups was similar to that of 3H, with Slc39a6 and Slc39a8 reaching the highest response levels, and Slc39a14 and Slc30a9 the lowest. These last two transporters behaved similarly in the FSH treatment group. However, as in oocytes, Slc39a6 and Slc39a8 once again reacted in particular ways to FSH, being the response levels of both transporters notably increased under FSH and FSH + Zn treatments. Overall, Slc39a14 and Slc30a9 showed similar responses to different hormonal conditions.
5. Conclusions These findings shed new light on Zn homeostasis in the bovine COC by indicating hormonal modulation. Differences between oocytes and CC in Zn transporter gene expression were observed, possibly related to the important changes in Zn levels
15
Journal Pre-proof occurring in both cell types during maturation. Considering the three hormones analyzed in this study, an especially prominent role of FSH in the modulation of intracellular Zn levels and transporter gene expression is suggested. Zinc transporter Slc39a6, previously characterized as an estrogen-inducible gene, is now reinforced as being highly sensitive to hormonal regulation. Further research is needed for a better understanding of the mechanisms whereby the analyzed hormones accomplished such regulations.
ACKNOWLEDGMENTS Thanks are due to the staff of Frigorífico Gorina S.A. for providing the bovine ovaries. Thanks are also due to A. Di Maggio for manuscript editing. This work was supported by Agencia Nacional de Promoción Científica y Tecnológica de la República Argentina (BID PICT 2016-2131 and BID PICT 2016-3727)
CONFLICTS OF INTEREST The authors declare that there are no conflicts of interest.
6. REFERENCES [1]
Powell SR. The Antioxidant Properties of Zinc. J Nutr 2000;130:1447S-1454S. doi:10.1093/jn/130.5.1447S.
[2]
Dreosti IE. Zinc and the gene. Mutat Res 2001;475:161–7. doi:10.1016/s00275107(01)00067-7.
[3]
Prasad AS, Kucuk O. Zinc in Cancer Prevention. Cancer Metastasis Rev 2002;21:291–5. doi:10.1023/A:1021215111729.
[4]
Favier AE. The role of zinc in reproduction. Biol Trace Elem Res 1992;32:363–
16
Journal Pre-proof 82. doi:10.1007/BF02784623. [5]
Bedwal RS, Bahuguna A. Zinc, copper and selenium in reproduction. Experientia 1994;50:626–40. doi:10.1007/bf01952862.
[6]
Hostetler CE, Kincaid RL, Mirando M a. The role of essential trace elements in embryonic and fetal development in livestock. Vet J 2003;166:125–39. doi:10.1016/S1090-0233(02)00310-6.
[7]
Falchuk KH. The molecular basis for the role of zinc in developmental biology. Mol. Cell. Eff. Nutr. Dis. Process., Boston, MA: Springer US; 1998, p. 41–8. doi:10.1007/978-1-4615-5763-0_5.
[8]
Picco SJ, Anchordoquy JM, de Matos DG, Anchordoquy JP, Seoane A, Mattioli GA, et al. Effect of increasing zinc sulfate concentration during in vitro maturation
of
bovine
oocytes.
Theriogenology
2010;74:1141–8.
doi:10.1016/J.THERIOGENOLOGY.2010.05.015. [9]
Anchordoquy JM, Picco SJ, Seoane A, Anchordoquy JP, Ponzinibbio M V, Mattioli GA, et al. Analysis of apoptosis and DNA damage in bovine cumulus cells after exposure in vitro to different zinc concentrations. Cell Biol Int 2011;35:593–7. doi:10.1042/CBI20100507.
[10]
Kim AM, Vogt S, O’Halloran T V, Woodruff TK. Zinc availability regulates exit from meiosis in maturing mammalian oocytes. Nat Chem Biol 2010;6:674–81. doi:10.1038/nchembio.419.
[11]
Suzuki T, Yoshida N, Suzuki E, Okuda E, Perry ACF. Full-term mouse development by abolishing Zn2+-dependent metaphase II arrest without Ca2+ release. Development 2010;137:2659–69. doi:10.1242/dev.049791.
[12]
Bernhardt ML, Kong BY, Kim AM, O’Halloran T V., Woodruff TK. A ZincDependent Mechanism Regulates Meiotic Progression in Mammalian Oocytes1.
17
Journal Pre-proof Biol Reprod 2012;86. doi:10.1095/biolreprod.111.097253. [13]
Kim AM, Bernhardt ML, Kong BY, Ahn RW, Vogt S, Woodruff TK, et al. Zinc sparks are triggered by fertilization and facilitate cell cycle resumption in mammalian eggs. ACS Chem Biol 2011;6:716–23. doi:10.1021/cb200084y.
[14]
Que EL, Duncan FE, Lee HC, Hornick JE, Vogt S, Fissore RA, et al. Bovine eggs release zinc in response to parthenogenetic and sperm-induced egg activation.
Theriogenology
2019;127:41–8.
doi:10.1016/j.theriogenology.2018.12.031. [15]
Kambe T, Tsuji T, Hashimoto A, Itsumura N. The Physiological, Biochemical, and Molecular Roles of Zinc Transporters in Zinc Homeostasis and Metabolism. Physiol Rev 2015;95:749–84. doi:10.1152/physrev.00035.2014.
[16]
Palmiter RD, Huang L. Efflux and compartmentalization of zinc by members of the SLC30 family of solute carriers. Pflugers Arch Eur J Physiol 2004;447:744– 51. doi:10.1007/s00424-003-1070-7.
[17]
Guerinot M Lou. The ZIP family of metal transporters. Biochim Biophys Acta Biomembr 2000;1465:190–8. doi:10.1016/S0005-2736(00)00138-3.
[18]
Eide DJ. The SLC39 family of metal ion transporters. Pflugers Arch Eur J Physiol 2004;447:796–800. doi:10.1007/s00424-003-1074-3.
[19]
Jeong J, Eide DJ. The SLC39 family of zinc transporters. Mol Aspects Med 2013;34:612–9. doi:10.1016/j.mam.2012.05.011.
[20]
Liuzzi JP, Lichten LA, Rivera S, Blanchard RK, Aydemir TB, Knutson MD, et al. Interleukin-6 regulates the zinc transporter Zip14 in liver and contributes to the hypozincemia of the acute-phase response. Proc Natl Acad Sci U S A 2005;102:6843–8. doi:10.1073/pnas.0502257102.
[21]
Ishihara K, Yamazaki T, Ishida Y, Suzuki T, Oda K, Nagao M, et al. Zinc
18
Journal Pre-proof Transport Complexes Contribute to the Homeostatic Maintenance of Secretory Pathway Function in Vertebrate Cells. J Biol Chem 2006;281:17743–50. doi:10.1074/jbc.M602470200. [22]
Langmade SJ, Ravindra R, Daniels PJ, Andrews GK. The Transcription Factor MTF-1 Mediates Metal Regulation of the Mouse ZnT1 Gene. J Biol Chem 2000;275:34803–9. doi:10.1074/jbc.M007339200.
[23]
Liu M-J, Bao S, Gálvez-Peralta M, Pyle CJ, Rudawsky AC, Pavlovicz RE, et al. ZIP8 Regulates Host Defense through Zinc-Mediated Inhibition of NF-κB. Cell Rep 2013;3:386–400. doi:10.1016/j.celrep.2013.01.009.
[24]
Miyai T, Hojyo S, Ikawa T, Kawamura M, Irie T, Ogura H, et al. Zinc transporter SLC39A10/ZIP10 facilitates antiapoptotic signaling during early B-cell development.
Proc
Natl
Acad
Sci
2014;111:11780–5.
doi:10.1073/pnas.1323549111. [25]
Homma K, Fujisawa T, Tsuburaya N, Yamaguchi N, Kadowaki H, Takeda K, et al. SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response
under
Zinc
Deficiency.
Mol
Cell
2013;52:75–86.
doi:10.1016/j.molcel.2013.08.038. [26]
Zhao L, Oliver E, Maratou K, Atanur SS, Dubois OD, Cotroneo E, et al. The zinc transporter ZIP12 regulates the pulmonary vascular response to chronic hypoxia. Nature 2015;524:356–60. doi:10.1038/nature14620.
[27]
Ryu M-S, Lichten LA, Liuzzi JP, Cousins RJ. Zinc Transporters ZnT1 (Slc30a1), Zip8 (Slc39a8), and Zip10 (Slc39a10) in Mouse Red Blood Cells Are Differentially Regulated during Erythroid Development and by Dietary Zinc Deficiency. J Nutr 2008;138:2076–83. doi:10.3945/jn.108.093575.
[28]
Guo L, Lichten LA, Ryu M-S, Liuzzi JP, Wang F, Cousins RJ. STAT5-
19
Journal Pre-proof glucocorticoid receptor interaction and MTF-1 regulate the expression of ZnT2 (Slc30a2) in pancreatic acinar cells. Proc Natl Acad Sci 2010;107:2818–23. doi:10.1073/pnas.0914941107. [29]
Cousins RJ, Liuzzi JP, Lichten L a. Mammalian zinc transport, trafficking, and signals. J Biol Chem 2006;281:24085–9. doi:10.1074/jbc.R600011200.
[30]
Thomas P, Pang Y, Dong J, Berg AH. Identification and Characterization of Membrane Androgen Receptors in the ZIP9 Zinc Transporter Subfamily: II. Role of Human ZIP9 in Testosterone-Induced Prostate and Breast Cancer Cell Apoptosis. Endocrinology 2014;155:4250–65. doi:10.1210/en.2014-1201.
[31]
Ménézo Y, Pluntz L, Chouteau J, Gurgan T, Demirol A, Dalleac A, et al. Zinc concentrations in serum and follicular fluid during ovarian stimulation and expression of Zn2+transporters in human oocytes and cumulus cells. Reprod Biomed Online 2011;22:647–52. doi:10.1016/j.rbmo.2011.03.015.
[32]
Kincaid RL. Assessment of trace mineral status of ruminants: A review. J Anim Sci 2000;77:1. doi:10.2527/jas2000.77E-Suppl1x.
[33]
Lisle RS, Anthony K, Randall M a., Diaz FJ. Oocyte-cumulus cell interactions regulate free intracellular zinc in mouse oocytes. Reproduction 2013;145:381–90. doi:10.1530/REP-12-0338.
[34]
Ferreira T, Rasband W. ImageJ User Guide ImageJ User Guide IJ 1.46r. 2012.
[35]
Kim AM, Bernhardt ML, Kong BY, Ahn RW, Vogt S, Woodruff TK, et al. Zinc Sparks Are Triggered by Fertilization and Facilitate Cell Cycle Resumption in Mammalian Eggs. ACS Chem Biol 2011;6:716–23. doi:10.1021/cb200084y.
[36]
El-Tanani MKK, Green CD. Oestrogen-induced genes, pLIV-1 and pS2, respond divergently to other steroid hormones in MCF-7 cells. Mol Cell Endocrinol 1995;111:75–81. doi:10.1016/0303-7207(95)03550-Q.
20
Journal Pre-proof [37]
Costello LC, Liu Y, Zou J, Franklin RB. Evidence for a zinc uptake transporter in human prostate cancer cells which is regulated by prolactin and testosterone. J Biol Chem 1999;274:17499–504. doi:10.1074/JBC.274.25.17499.
[38]
Manning DL, Daly RJ, Lord PG, Kelly KF, Green CD. Effects of oestrogen on the expression of a 4.4 kb mRNA in the ZR-75-1 human breast cancer cell line. Mol Cell Endocrinol 1988;59:205–12. doi:10.1016/0303-7207(88)90105-0.
[39]
Taylor KM, Morgan HE, Smart K, Zahari NM, Pumford S, Ellis IO, et al. The Emerging Role of the LIV-1 Subfamily of Zinc Transporters in Breast Cancer. Mol Med 2007;13:396–406. doi:10.2119/2007.
[40]
Song MK, Kim YY, Heng MC, Adham NF, Ament ME. Prostaglandin interacts with steroid sex hormones in the regulation of intestinal zinc transport. Comp Biochem Physiol Comp Physiol 1992;101:477–81.
[41]
Beltramini M, Zambenedetti P, Wittkowski W, Zatta P. Effects of steroid hormones on the Zn, Cu and MTI/II levels in the mouse brain. Brain Res 2004;1013:134–41. doi:10.1016/J.BRAINRES.2004.04.010.
[42]
Gee KR, Zhou Z-L, Qian W-J, Kennedy R. Detection and Imaging of Zinc Secretion from Pancreatic β-Cells Using a New Fluorescent Zinc Indicator. J Am Chem Soc 2002;124:776–8. doi:10.1021/ja011774y.
[43]
Gee KR, Zhou ZL, Ton-That D, Sensi SL, Weiss JH. Measuring zinc in living cells. A new generation of sensitive and selective fluorescent probes. Cell Calcium 2002;31:245–51. doi:10.1016/S0143-4160(02)00053-2.
[44]
Xiong X, Lan D, Li J, Lin Y, Zi X. Effects of Zinc Supplementation During In Vitro Maturation on Meiotic Maturation of Oocytes and Developmental Capacity in Yak. Biol Trace Elem Res 2018;185:89–97. doi:10.1007/s12011-017-1217-6.
[45]
Kong BY, Duncan FE, Que EL, Kim AM, O’Halloran T V, Woodruff TK.
21
Journal Pre-proof Maternally-derived zinc transporters ZIP6 and ZIP10 drive the mammalian oocyte-to-egg
transition.
Mol
Hum
Reprod
2014;20:1077–89.
doi:10.1093/molehr/gau066. [46]
Blaha M, Nemcova L, Kepkova KV, Vodicka P, Prochazka R. Gene expression analysis of pig cumulus-oocyte complexes stimulated in vitro with follicle stimulating hormone or epidermal growth factor-like peptides. Reprod Biol Endocrinol 2015;13:113. doi:10.1186/s12958-015-0112-2.
22
Journal Pre-proof FIGURE CAPTIONS Figure 1. Representative COC fluorescent and differential interference contrast (DIC) images. The COCs were cultured for 24 h in IVM medium containing E2 (1µg/mL), FSH (1µg/mL), LH (10 µg/mL) or E2 + FSH + LH (3H) with or without 1.2 µg/mL Zn, according to the following treatments: a) Control; b) Zn; c) E2; d) E2 + Zn; e) FSH; f) FSH + Zn; g) LH; h) LH + Zn; i) 3H; and j) 3H + Zn. After maturation, COCs were loaded with 1 µM FluoZin-3 AM and showed green fluorescence. The fluorescent intensity corresponded to the levels of free Zn (pictures a to j).The correspondent DIC image of each fluorescent COC appears below (pictures a’ to j’). COC: cumulus-oocyte complex; IVM: in vitro maturation; Zn: zinc; E2: estradiol 17-beta; FSH: folliclestimulating hormone; LH: luteinizing hormone. A fluorescence control was included, which consisted in the FluoZin-3 AM staining of 15 COCs and its subsequent incubation with 10 µM of heavy metal chelator N,N,N’,N’-tetrakis (2-pyridylmethyl) ethane-1,2-diamine (TPEN) for 30 min. Scale bar = 150 µm. Figure 2. Interaction effects of Zn with E2, FSH or LH on intracellular free Zn concentration in oocytes and CC. A total of 150 COCs (15 per treatment) were matured for 24 h in IVM medium containing E2 (1µg/mL), FSH (1µg/mL), LH (10 µg/mL) or E2 + FSH + LH (3H) with or without 1.2 µg/mL Zn, according to the following treatments: Control; Zn; E2; E2 + Zn; FSH; FSH + Zn; LH; LH + Zn; 3H; and 3H + Zn. i) Zn*3H interactions; ii) Zn*E2 interactions; iii) Zn*FSH interactions; and iv) Zn*LH interactions. Zn: zinc; E2: estradiol 17-beta; FSH: follicle-stimulating hormone; LH: luteinizing hormone; CC: cumulus cells; COC: cumulus-oocyte complex; IVM: in vitro maturation. (a-c) Significant differences, p ≤ 0.05. (*) Indicate significant differences between oocytes and CC in the corresponding IVM treatment, p ≤ 0.05. Results are expressed as least squared means ± SEM. 23
Journal Pre-proof Figure 3. Interaction effects of Zn with E2, FSH or LH on gene expression of Slc39a6, Slc39a8, Slc39a14 and Slc30a9 in oocytes. A total of 750 COCs (75 per treatment) were cultured for 24 h in IVM medium containing E2 (1µg/mL), FSH (1µg/mL), LH (10 µg/mL) or E2 + FSH + LH (3H) with or without 1.2 µg/mL Zn, according to the following treatments: Control; Zn; E2; E2 + Zn; FSH; FSH + Zn; LH; LH + Zn; 3H and 3H + Zn. The relative expression of Slc39a6, Slc39a8, Slc39a14 and Slc30a9 in the oocytes is shown. A): Zn*3H interaction; B): Zn*E2 interaction; C): Zn*FSH interaction; and D): Zn*LH interaction. Zn: zinc; COC: cumulus-oocyte complex; IVM: in vitro maturation E2: estradiol 17-beta; FSH: follicle-stimulating hormone; LH: luteinizing hormone. (a-c) Significant differences, p ≤ 0.05. Results are expressed as least squared means ± SEM. Figure 4. Interaction effects of Zn with E2, FSH or LH on gene expression of Slc39a6, Slc39a8, Slc39a14 and Slc30a9 in CC. A total of 750 COCs (75 per treatment) were cultured for 24 h in IVM medium containing E2 (1µg/mL), FSH (1µg/mL), LH (10 µg/mL) or E2 + FSH + LH (3H), with or without 1.2 µg/mL Zn, according to the following treatments: Control; Zn; E2; E2 + Zn; FSH; FSH + Zn; LH; LH + Zn; 3H; and 3H + Zn. The relative expression of Slc39a6, Slc39a8, Slc39a14 and Slc30a9 in CC is shown. A): Zn*3H interaction; B): Zn*E2 interaction; C): Zn*FSH interaction; and D): Zn*LH interaction. CC: cumulus cells; COC: cumulus-oocyte complex; IVM: in vitro maturation E2: estradiol 17-beta; FSH: follicle-stimulating hormone; LH: luteinizing hormone. (a-c) Significant differences, p ≤ 0.05. Results are expressed as least squared means ± SEM. Figure 5. Representative diagram of a COC. Changes in bovine Zn transporter gene expression after 24-hr IVM with hormones and Zn supplementation are indicated. The inner circle symbolizes the oocyte (OV), while the outside of the black ring (zona 24
Journal Pre-proof pellucida) corresponds to the cumulus cells (CC). IVM media included: E2 (1µg/mL), FSH (1µg/mL), LH (10 µg/mL) or E2 + FSH + LH (3H) with or without 1.2 µg/mL Zn. Arrows and hyphens indicate the responses of the analyzed transporters to said IVM treatments, being: ↑ rise in relative gene expression (RE); ↓ decrease in RE; − no significant change in RE; in all cases, with respect to the Control. Solid arrows refer to transporter gene response to a hormonal treatment without Zn addition, while dotted arrows denote the response to a hormonal treatment plus Zn supplementation. COC: cumulus-oocyte complex; IVM: in vitro maturation; Zn: zinc; E2: estradiol 17-beta; FSH: follicle-stimulating hormone; LH: luteinizing hormone.
25
Journal Pre-proof
Author Contributions
Ana M. Pascua: acquisition of data and drafting the article (PhD student)
Noelia Nikoloff: analysis and interpretation of data
Ana C. Carranza-Martín: analysis and interpretation of data
Juan Patricio Anchordoquy: analysis and interpretation of data
Silvina Quintana: acquisition of data
Barbisán Gisela: analysis and interpretation of data
Silvina Díaz: acquisition of data
Juan Mateo Anchordoquy: the conception and design of the study, revising it critically for important intellectual content
Cecilia C. Furnus: the conception and design of the study, revising it critically for important intellectual content
Journal Pre-proof
Zinc availability is beneficial for follicular growth, oocyte maturation, fertilization, and embryo development. Reproductive hormones affected Zn homeostasis and gene expression of Zn transporters during IVM of bovine COC. The gene expression of Zn transporters in oocytes and cumulus cells were different The role of FSH in the modulation of intracellular Zn levels and transporter gene expression is evident The Zn transporter Slc39a6 is highly sensitive to hormonal regulation.
Journal Pre-proof
Table 1. Primer sequences used for gene expression analysis Gene
Direction
Primer sequence (5’-3’)
Slc39a6
Forward Reverse
CCCTCCAAAGACCTATTC ATCACCACTCAGTGTCCC
Slc39a8
Forward Reverse
GGACTCAGCACCTCCATAGC GCCCACCAAGATGCCAAAAG
Slc39a14
Forward Reverse
GAGTTCCAGGAGTTCTGCCC ACGCAGAGGAGACCGTACC
Slc30a3
Forward Reverse
ACGCAGAGGAGACCGTACC TGATTGCCTCCATCCTCATC
Slc30a7
Forward Reverse
CAAGGTCCCAACATAAAC AATGCAAAGAACTCCTCC
Slc30a9
Forward Reverse
GCTTCGTAGGAGTGCTCG GTGGGTTGCCTGTTATGG
ACTB
Forward Reverse
GGCAGGTCATCACCATCGG CAGCACCGTGTTGGCGTAG
PPIA
Forward Reverse
GGTCATCGGTCTCTTTGGAA TCCTTGATCACACGATGGAA
Fragment size (bp) 175
Annealing temperature (°C) 52
165
55
146
60
170
60
136
52
164
57
164
60
117
58
Journal Pre-proof
Table 2. cDNA sequences of PCR-amplified transporters Slc39a6, Slc39a8, Slc39a14 and Slc30a9.
PCR product sequence
Fragment size (bp)
GenBank Accession Number
Slc39a6
TCCCTCCAAAGACCTATTCTTTACAAA TAGCCTGGGTTGGTGGCTTATAGCCAT TTCCGTCATCAGTTTCCTGTCTTTGCTG GGTGTGATCTTAGTGCCTCTCATGAAT CGAGTGTTTTTCAAGTTTCTTCTGAGTT TCCTTGTGGCATTGGCTGTCGGGACAC TGAGTGGT
173
MK332118
Slc39a8
ACTCAGCACCTCCATAGCCATCCTATG TGAGGAGTTCCCTCATGAATTAGGGGA CTTTGTGATCCTACTCAATGCAGGAAT GAGCACTCGACAAGCCTTGTTATTCAA TTTCCTTTCTGCATGTTCCTGCTATGTT GGGCTAGCTTTTGGCATCTTGGTGGGC
163
MK341547
Slc39a14
GAGTTCCAGGAGTTCTGCCCCACCATC CTCCAGCAGCTGGACTCCAGGGCCTGC TCCTCCGAGAACCAGGAGAATGAGGA GAACGAGCAGACAGAAGAGGGGAGGC CCAGCTCGGTGGAAGTTTGGGGGTACG GTCTCCTCTGCGTA
147
MK482694
Slc30a9
GCTTCGTAGGAGTGCTCGGGCCAAAGG AATGTCATTTTACAAGTATGTAATGGA AAGTCGTGATCCTAGTACAAATGTTAT ATTACTGGAGGATACTGCAGCTGTGTT GGGAGTGACAATAGCAGCCACTTGTAT GGGCCTTACCTCCATAACAGGCAACCC AC
164
MK425690
Gene