Requirement for eukaryotic translation initiation factors in cap-independent translation differs between bipartite genomic RNAs of red clover necrotic mosaic virus

Virology 509 (2017) 152–158

Contents lists available at ScienceDirect

Virology journal homepage: www.elsevier.com/locate/yviro

Requirement for eukaryotic translation initiation factors in capindependent translation differs between bipartite genomic RNAs of red clover necrotic mosaic virus

MARK

Yuri Tajimaa,1, Hiro-oki Iwakawab, Kiwamu Hyodoc, Masanori Kaidoa, Kazuyuki Misea, ⁎ Tetsuro Okunoa,d, a

Laboratory of Plant Pathology, Graduate School of Agriculture, Kyoto University, Sakyo-ku, Kyoto 606-8502, Japan Institute of Molecular and Cellular Biosciences, The University of Tokyo, Bunkyo-ku, Tokyo 113-0032, Japan Institute of Plant Science and Resources, Okayama University, Kurashiki, Okayama 710-0046, Japan d Department of Plant Life Science, Faculty of Agriculture, Ryukoku University, Otsu, Shiga 520-2194, Japan b c

A R T I C L E I N F O

A BS T RAC T

Keywords: Cap-independent translation 3′CITE Red clover necrotic mosaic virus Plant RNA virus Eukaryotic translation initiation factor EIF4F EIFiso4F Arabidopsis thaliana

The bipartite genomic RNAs of red clover necrotic mosaic virus (RCNMV) lack a 5′ cap and a 3′ poly(A) tail. RNA1 encodes viral replication proteins, and RNA2 encodes a movement protein (MP). These proteins are translated in a cap-independent manner. We previously identified two cis-acting RNA elements that cooperatively recruit eukaryotic translation initiation factor (eIF) complex eIF4F or eIFiso4F to RNA1. Such cis-acting RNA elements and host factors have not been identified in RNA2. Here we found that translation of RNA1 was significantly compromised in Arabidopsis thaliana carrying eif4f mutation. RNA1 replicated efficiently in eifiso4f1 mutants, suggesting vigorous translation of the replication proteins from RNA1 in the plants. In contrast, MP accumulation was decreased in eifiso4f1 mutants but not in eif4f mutants. Collectively, these results suggest that RCNMV uses different eIF complexes for translation of its bipartite genomic RNAs, which may contribute to fine-tuning viral gene expression during infection.

1. Introduction Eukaryotic mRNAs possess a 5′ cap structure (m7GpppN) and a 3′ poly(A) tail, which work cooperatively during translation to recruit eukaryotic translation initiation factors (eIFs) and ribosomes (Gallie, 1991; Sonenberg and Hinnebusch, 2009). The cap structure is recognized by the eIF4F complex, which is composed of the cap-binding protein eIF4E, the multifunctional scaffold protein eIF4G, and the DEAD-box helicase eIF4A. Poly(A)-binding protein (PABP) binds to the 3′ poly(A) tail and to eIF4G. This binding circularizes the mRNA and facilitates translation by recruiting the 43S ribosomal preinitiation complex (Sonenberg and Hinnebusch, 2009; Jackson et al., 2010). In plants, eIF4F is thought to be a heterodimer of eIF4E and eIF4G, because in wheat germ extract (WGE), eIF4A does not co-purify with eIF4F (Lax et al., 1986; Browning, 1996). In addition to eIF4F, plants have a plant-specific isoform of eIF4F termed eIFiso4F, which is composed of eIFiso4E and eIFiso4G (Browning et al., 1992; Browning, 1996). Although eIFiso4G is smaller than eIF4G, it can interact with eIF4A and PABP and thereby serves as a scaffold protein

⁎

1

during translation initiation (Cheng and Gallie, 2010). The model plant Arabidopsis thaliana has three eIF4E genes: eIF4E (At4g18040, the canonical eIF4E), eIF4E1B (At1g29550, also known as eIF4E3), and eIF4E1C (At1g29590, also known as eIF4E2), and one eIFiso4E gene (At5g35620). eIF4E and eIFiso4E are widely expressed at high levels, whereas eIF4E1B and eIF4E1C do not appear to be expressed or are expressed at very low levels in most tissues (Patrick et al., 2014). A. thaliana has one eIF4G gene (At3g60240) and two eIFiso4G genes, eIFiso4G1 (At5g57870) and eIFiso4G2 (At2g24050). eIFiso4G1 and eIFiso4G2 share only 57% identity and 72% similarity in their amino acid sequences in the conserved domains (Lellis et al., 2010). Although eIFiso4G1 is present throughout the plant kingdom, eIFiso4G2 appears to be present only in Brassicaceae species (Gallie, 2016). Both eIF4F and eIFiso4F have the ability to enhance translation, although eIF4F is more efficient than eIFiso4F for initiating translation from uncapped mRNAs and mRNAs with highly structured 5′ untranslated regions (UTRs) (Gallie and Browning, 2001). This suggests that plant mRNAs have differential preferences for eIF4F or eIFiso4F. Viruses are obligate intracellular parasites that depend on host cells

Corresponding author at: Department of Plant Life Science, Faculty of Agriculture, Ryukoku University, Otsu, Shiga 520–2194, Japan. E-mail address: [email protected] (T. Okuno). Present address: Laboratory of Plant Immunity, Graduate School of Biological Sciences, Nara Institute of Science and Technology, Ikoma, Nara 630-0192, Japan.

http://dx.doi.org/10.1016/j.virol.2017.06.015 Received 6 May 2017; Received in revised form 13 June 2017; Accepted 14 June 2017 0042-6822/ © 2017 Elsevier Inc. All rights reserved.

Virology 509 (2017) 152–158

Y. Tajima et al.

obvious morphological defects were observed in the mutant plants compared with wild-type (Col-0) plants (Fig. 1C). Arabidopsis meso phyll protoplasts isolated from Col-0 and mutant plants were inoculated with in vitro-transcribed RCNMV RNA1 and RNA2, and total RNA was extracted at 24 h post inoculation (hpi). Northern blot analysis showed that the accumulation of RNA1 and RNA2 was significantly lower in 4e and 4g protoplasts compared with that in Col-0, i4e, and i4g1 protoplasts (Fig. 2A and B). Furthermore, the accumulation of RNA1 was slightly but significantly lower in i4g2 protoplasts compared with that in Col-0 (63% of Col-0; P = 0.007, twotailed Student's t-test). These results suggest that eIF4E, eIF4G, and possibly eIFiso4G2 are required to support efficient replication of RCNMV RNA.

for their replication. Positive-strand RNA [(+)RNA] viruses, whose genomes have the same polarity as cellular mRNAs, are the most abundant virus group that infects eukaryotes. To produce sufficient amounts of viral proteins, (+)RNA viruses must compete with host mRNAs and attract ribosomes and/or eIFs to their template. In contrast to canonical cellular mRNAs, many plant (+)RNA viruses lack either a 5′ cap structure or a 3′ poly(A) tail or both. Instead, they have developed special cis-acting RNA or protein elements to recruit ribosomes and/or eIFs, including internal ribosomal entry sites, 3′cap-independent translational enhancer (3′CITE), or a 5′ viral genome-linked protein (Dreher and Miller, 2006; Balvay et al., 2009; Jiang and Laliberté, 2011; Sanfaçon, 2015). Successful viral infection requires compatible interactions between such viral elements and the host translation machinery (Hyodo and Okuno, 2016). Red clover necrotic mosaic virus (RCNMV) is a plant (+)RNA virus, a member of the genus Dianthovirus in the family Tombusviridae (Okuno and Hiruki, 2013). The genome of RCNMV consists of two RNAs, RNA1 and RNA2. RNA1 encodes N-terminally overlapping viral replication proteins, a 27-kDa auxiliary protein (p27) and an 88-kDa RNA-dependent RNA polymerase (p88) that is translated via a programmed –1 frameshifting mechanism (Kim and Lommel, 1998; Tajima et al., 2011). RNA1 also encodes a coat protein (CP) that is translated from subgenomic RNA (CPsgRNA) (Zavriev et al., 1996). The transcription of CPsgRNA requires an intermolecular interaction between RNA1 and RNA2 (Sit et al., 1998; Tatsuta et al., 2005). RNA2 encodes a movement protein (MP) that is required for viral cell-to-cell movement in plants (Kaido et al., 2011; Xiong et al., 1993). Both RNA1 and RNA2 lack a 5′ cap structure and a 3′ poly(A) tail (Mizumoto et al., 2003). Therefore, all RCNMV-encoded proteins are translated in a capindependent manner. RNA1 possesses a 3′CITE named 3′TE-DR1, which is essential for translation of p27 and p88 (Iwakawa et al., 2007; Mizumoto et al., 2003). CPsgRNA is identical to the 3′-terminal 1.5 kb of RNA1 and therefore possesses the same 3′TE-DR1, which is also essential for translation from CPsgRNA (Sarawaneeyaruk et al., 2009). An adenine-rich sequence (ARS) located 60 nucleotides upstream from 3′TE-DR1 in the 3′ UTR is a PABP-binding site and PABP binding to ARS is required for recruitment of eIF4F/eIFiso4F factors to 3′TE-DR1 and of the 40S ribosomal subunit to viral RNA (Iwakawa et al., 2012). In contrast, RNA2 has no such RNA elements and the cap-independent translation of RNA2 is linked to its replication (Mizumoto et al., 2006). In this study, we investigated which components of eIF4F/eIFiso4F are required for cap-independent translation of RNA1 and RNA2 of RCNMV using A. thaliana with mutations in one of the eIF4F/eIFiso4F genes. Viral RNA replication and translation assays in protoplasts using viral RNAs and reporter mRNAs showed that eIF4E and eIF4G are required to promote 3′TE-DR1-mediated translation of RNA1, whereas eIFiso4E and eIFiso4G1 are required to promote translation of RNA2. These results suggest that RCNMV uses different eIF complexes for translation of RNA1 and RNA2.

2.2. eIF4E and eIF4G are required for 3′TE-DR1-mediated capindependent translation of RCNMV RNA1 The reduced accumulation of RCNMV RNAs observed in 4e, 4g, and i4g2 protoplasts could reflect detrimental effects of the mutations at any step in viral RNA replication, including translation of viral proteins. To investigate whether eIF4E, eIF4G, and eIFiso4G2 are required for cap-independent translation of RCNMV RNA1, we used a reporter mRNA (R1-luc-R1) that carries a firefly luciferase (F-luc) open reading frame (ORF) flanking the 5′- and 3′-UTRs of RCNMV RNA1 (Mizumoto et al., 2003; Sarawaneeyaruk et al., 2009; Iwakawa et al., 2012), and evaluated its cap-independent translational activity in Arabidopsis protoplasts. Capped nonviral F-luc mRNA with 60 adenine residues (LucA60) was used as a control, and mRNA carrying a Renilla luciferase (R-Luc) ORF was used as an internal control in the dual luciferase assay. The reporter F-luc mRNAs were inoculated together with R-luc mRNA into Arabidopsis protoplasts, and luciferase activities were measured at 6 hpi. F-luc activity was normalized to R-luc activity and was reported as relative luciferase activity. The relative luciferase activities of R1-luc-R1 were significantly lower in 4e, 4g, and i4g2 protoplasts than those in Col-0, whereas the relative luciferase activities of LucA60 in 4e, 4g, and i4g2 protoplasts were comparable to those in Col-0 (Fig. 3A). These results suggested that eIF4E, eIF4G, and eIFiso4G2 were required for 3′TE-DR1-mediated cap-independent translation of RNA1. However, we noticed that the measured values of the luciferase activities of capped internal control R-Luc mRNA were significantly higher (approximately 2 times) in i4g2 protoplasts compared with those in Col-0 protoplasts, whereas the measured values of the luciferase activities of uncapped R1-luc-R1 did not differ significantly between i4g2 and Col-0 protoplasts (Fig. 3D). The apparent decrease in the relative luciferase activities of R1-luc-R1 in i4g2 protoplasts (Fig. 3A) can be explained by the increase in the luciferase activities of capped internal control R-Luc mRNA (Fig. 3D). It should be noted that the measured values of the luciferase activities of internal control R-Luc mRNA did not differ significantly between 4e, 4g, and Col-0 protoplasts, and that the measured values of the luciferase activities of uncapped R1-luc-R1 in 4e and 4g protoplasts were significantly lower than those in Col-0 (Fig. 3B and C). These results suggest that eIF4E and eIF4G, but not eIFiso4G2, play essential roles in 3′TE-DR1-mediated cap-independent translation of RNA1. It is possible that the increased translation from capped mRNA in i4g2 protoplasts (Fig. 3D) reflects altered basal host translation activity, which might indirectly influence RCNMV RNA1 accumulation (Fig. 2).

2. Results 2.1. eIF4E and eIF4G play an essential role in RCNMV RNA replication First we tested RCNMV replication in protoplasts isolated from Arabidopsis mutants in which one of the component genes of eIF4F/ eIFiso4F was disrupted by insertion of T-DNA or a transposon (Fig. 1A), because the replication of RCNMV depends entirely on viral replication proteins translated from RNA1. The Arabidopsis mutants with a mutation in eIF4E, eIFiso4E, eIF4G, eIFiso4G1, or eIFiso4G2 genes are hereafter referred to as 4e, i4e, 4g, i4g1, and i4g2, respectively. We used western blot analysis and reverse transcription quantitative PCR (RT–qPCR) analysis, respectively, to confirm reduced accumulation of the proteins and mRNAs corresponding to the disrupted genes in the mutants (Fig. 1B and data not shown). No

2.3. eIFiso4E and eIFiso4G1 are required for cap-independent translation of MP from RCNMV RNA2 in protoplasts Next, we investigated which components of eIF4F and eIFiso4F were required for cap-independent translation of RNA2. In contrast to RNA1, RNA2 lacks RNA elements, such as 3′TE-DR1 and ARS, that function to recruit translation factors to promote cap-independent translation in a reporter mRNA. Instead, cap-independent translation 153

Virology 509 (2017) 152–158

Y. Tajima et al.

Fig. 1. Arabidopsis thaliana mutants used in this study. (A) Schematic diagrams of eIF4F/eIFiso4F genes. Black triangles and the white triangle show the insertion position of T-DNA or transposon, respectively. Gray boxes indicate exons and solid lines indicate introns. (B) Accumulation of each eIF4F/eIFiso4F protein in the mutant plants. Total protein was extracted from the leaves of each plant and subjected to 4–12% Nu-PAGE gradient gels followed by western blot analysis using anti-eIF4E, anti-eIFiso4E, anti-eIF4G, anti-eIFiso4G, and anti-PABP antisera, respectively. Coomassie brilliant blue-stained gels were used as a loading control. (C) Growth phenotype of 27-day-old Col-0 and mutant plants grown at 24 °C under the short-day photoperiod (10 h light / 14 h dark) condition. No obvious morphological defects were observed in the mutant plants at this stage.

B

RCNMV 160

Relative accumulation level (%)

i4g2

Mock i4g1

4g

i4e

4e

Col-0

RCNMV

Col-0

A

RNA1

SR1f RNA2 EtBr

140 120 100

*

80 60

*

40

RNA2

*

* *

20 0

RNA1

Col-0

4e

i4e

4g

i4g1

i4g2

Fig. 2. eIF4E and eIF4G are required to support efficient replication of RCNMV RNA. Arabidopsis meso phyll protoplasts isolated from Col-0 and mutant plants (4e, i4e, 4 g, i4g1, and i4g2) were inoculated with in vitro-transcribed RNA1 and RNA2, and incubated at 17 °C for 24 h. (A) Total RNA was analyzed by northern blot. Ethidium bromide (EtBr)-stained rRNAs shown below the northern blots are loading controls. (B) The levels of accumulation of both RNA1 and RNA2 from at least three independent experiments were quantified using the NIH ImageJ program. The accumulation levels in Col-0 protoplasts were defined as 100%. Means + standard error (SE) are plotted in the graphs. *P < 0.01, two-tailed Student's ttest.

154

Virology 509 (2017) 152–158

Y. Tajima et al.

A

B

Col-0 v.s. 4e R1-luc-R1 p = 0.014

120

R-luc mRNA 250

p = 0.820

40

100

200

*

*

60

30

R1-luc-R1 LucA60

R-luc activity

80

F-luc activity

F-luc/R-luc luminescence (%)

140

150

20

100

40 10

*

20 0

50 0

Col-0

4e

C

4g

i4g2

Col-0

D

Col-0 v.s. 4g R1-luc-R1 p = 0.041

200

60

R-luc mRNA

R1-luc-R1

p = 0.982

p = 0.115

150

4e

R-luc mRNA 500

p = 0.012

F-luc activity

R-luc activity

400

R-luc activity

F-luc activity

Col-0

Col-0 v.s. i4g2 60

40

0

4e

40

100

20

300

200

20

50

100

0

0

Col-0

4g

Col-0

4g

Col-0

i4g2

Col-0

i4g2

Fig. 3. eIF4E and eIF4G are required for 3′TE-DR1-mediated cap-independent translation of a reporter luc mRNA. Arabidopsis meso phyll protoplasts from Col-0, 4e, 4g, and i4g2 were inoculated with uncapped reporter mRNA (R1-luc-R1) carrying firefly luciferase (F-luc) or capped F-luc RNA (LucA60) together with capped Renilla luciferase (R-luc) mRNA (internal control). Protoplasts were incubated at 17 °C for 6 h and subjected to a dual luciferase assay. (A) The F-luc/R-luc luminescence of Col-0 was defined as 100%. Means + SE from at least three independent experiments are shown in the graph. *P < 0.05, two-tailed Student's t-test. (B, C and D) Each black dot shows measured luciferase activities used for the calculation of the F-luc/R-luc luminescence in (A). Biological replicate numbers are: n = 7 for (B), n = 10 for (C), and n = 12 for (D), respectively, from at least three independent experiments. P-values by two-tailed Student's t-test are shown above the box plots.

mediated translation of RNA1, whereas eIFiso4E and eIFiso4G1 (eIFiso4F1) are required for efficient translation of MP from RNA2. These findings indicate that the requirements for components of eIF4F/eIFiso4F in efficient cap-independent translation differ between RNA1 and RNA2 of RCNMV. The 3′CITEs of RNA viruses have been classified into six classes based on their sequences and secondary structures (Miller et al., 2007; Nicholson and White, 2011). RCNMV 3′TE-DR1 belongs to the same group as the barley yellow dwarf virus (BYDV) 3′CITE, known as BYDV-like translation element (BTE). BTE shares common characteristics with RCNMV 3′TE-DR1 such as a 17-nucleotide conserved sequence including a stem-loop structure with a GNRNA pentaloop (N is any base, N is any base, R is a purine is a purine) and a multi-helix junction with a central hub (Simon and Miller, 2013). The GNRNA pentaloop is essential for cap-independent translation in at least five plant (+)RNA viruses within the genera of Dianthovirus, Necrovirus, Umbravirus, or Luteovirus (Guo et al., 2000; Iwakawa et al., 2012; Kneller et al., 2006; Kraft et al., 2013; Mizumoto et al., 2003; Wang et al., 2010). eIF4G alone is sufficient to facilitate BTE-mediated translation in cap-binding factor-depleted WGE (Treder et al., 2008), whereas unlike BTE, the maize necrotic streak virus I-shaped 3′CITE requires both eIF4G and eIF4E for efficient translation in WGE (Nicholson et al., 2010). Here, we showed that translation from R1luc-R1 reporter RNA was compromised in both 4e and 4g (Fig. 3), suggesting that an intact eIF4F complex, rather than eIF4G alone, is

of RNA2 is coupled to the replication of RNA2 itself, and requires p27 and p88 encoded by RNA1 (Mizumoto et al., 2006). To distinguish the effects of eIF mutations on the translation of RNA2 from their effects on translation of RNA1, we used plasmids pUBp27 and pUBp88 that express p27 and p88 independently of RNA1 under the control of the cauliflower mosaic virus 35S promoter. RNA2MP-HA, which can replicate well and express C-terminally hemagglutinin (HA)-tagged MP functional for cell-to-cell movement (Kaido et al., 2014), was inoculated into Arabidopsis protoplasts together with pUBp27 and pUBp88. Total RNA and protein were extracted at 24 hpi, and the accumulation of RNA2 and MP-HA was analyzed by northern and western blotting, respectively. The accumulation of MP-HA was significantly lower in i4e and i4g1 protoplasts than in Col-0 protoplasts (Fig. 4). These results suggest that eIFiso4E and eIFiso4G1 are required for efficient translation of RNA2 in Arabidopsis protoplasts. When RNA2MP-HA alone was inoculated, the accumulation of both RNA2 and MP-HA was below detectable levels (Fig. 4A), confirming our previous results (Mizumoto et al., 2006).

3. Discussion In this study, we used Arabidopsis mutants to investigate which components of eIF4F/eIFiso4F were required for cap-independent translation of the bipartite genomic RNAs of RCNMV. The results show that eIF4E and eIF4G (eIF4F) play key roles in 3′TE-DR1155

Virology 509 (2017) 152–158

Y. Tajima et al.

MP-HA CBB

i4g2

i4g1

4g

i4e

Mock

MP 200

Relative accumulation levels normalized by RNA2 (%)

EtBr

RNA2 140

Relative accumulation levels (%)

RNA2

4e

Col-0

RNA2 MP-HA

B

Col-0

pUBp27 + pUBp88 +

Col-0

RNA2 MP-HA

A

120 100 80 60 40 20 0

Col-0

4e

i4e

4g

i4g1

i4g2

180 160

**

140 120 100

*

80

*

60 40 20 0

Col-0

4e

i4e

4g

i4g1

i4g2

Fig. 4. eIFiso4E and eIFiso4G1 are required for cap-independent translation of RCNMV RNA2 in vivo. Arabidopsis protoplasts from Col-0 and mutant plants (4e, i4e, 4g, i4g1, and i4g2) were inoculated with RNA2MP-HA expressing C-terminally hemagglutinin (HA)- tagged MP together with plasmids expressing p27 and p88 under the control of the cauliflower mosaic virus 35S promoter. (A) Accumulation of MP-HA and RNA2 was analyzed by western blotting using anti-HA antibody and by northern blotting, respectively. (B) The accumulation levels of RNA2 from at least three independent experiments were quantified using the NIH ImageJ program. The accumulation levels in Col-0 protoplasts were defined as 100%. Means + SE are shown in the graphs. The accumulation levels of MP-HA were quantified using the ImageJ program and normalized to those of RNA2. The relative accumulation levels of MP-HA in Col-0 protoplasts are defined as 100%. Means + SE are plotted in the graph. *P < 0.05, **P < 0.01, two-tailed Student's t-test.

lead to transcription of CPsgRNA from RNA1 (Sit et al., 1998; Tatsuta et al., 2005). CPsgRNA has the same 3′ UTR as RNA1, and CP is produced by 3′TE-DR1-mediated translation (Sarawaneeyaruk et al., 2009). The use of eIFiso4F, rather than eIF4F, for translation of RNA2 might allow RCNMV to evade the competition for translation initiation factors between 3′TE-DR1-mediated translation of RNA1 and replication-associated translation RNA2.

required for 3′TE-DR1-mediated translation in Arabidopsis protoplasts. Because eIF4E promotes the eIF4G–3′TE-DR1 interaction (Kraft et el., 2013), eIF4E-mediated stabilization of the eIF4G–3′TEDR1 complex may be a prerequisite for efficient 3′TE-DR1-mediated translation in vivo. Further studies are needed to understand the function of eIF4E in 3′TE-DR1-mediated cap-independent translation. Previous studies have suggested that eIF4F is more active than eIFiso4F in promoting translation from uncapped mRNAs containing a structured 5′ leader, whereas eIFiso4F seems to prefer translation of canonical capped mRNAs with an unstructured 5′ leader (Gallie and Browning, 2001). The secondary structures predicted by the Mfold program (Zuker, 2003) suggested that the 5′-UTR of RNA1 is more stable than that of RNA2 (at 17 °C, ΔG = −39.4 kcal/mol for RNA1 and −28.9 kcal/mol for RNA2, respectively Sarawaneeyaruk et al., 2009). Such differences in the secondary structure of the 5′ UTRs could contribute to the preference of eIF4F and eIFiso4F for translation of RNA1 and RNA2, respectively. It is becoming clear that viral RNAs have differential preferences for eIF4F or eIFiso4F for translation. For example, tobacco mosaic virus omega-mediated translation prefers eIF4F to eIFiso4F (Gallie, 2002), and eIF4F is more active than eIFiso4F in stimulating cap-independent translation mediated by BYDV BTE and the Y-shaped 3′CITE of carnation Italian ringspot virus in eIF-depleted WGE (Treder et al., 2008; Nicholson et al., 2013). However, the biological significance of such differential preferences for eIF4F/eIFiso4F between viral RNAs remains unknown. In contrast to 3′TE-DR1-mediated translation, robust cap-independent translation of RNA2 requires eIFiso4E and eIFiso4G1 (eIFiso4F1) (Fig. 4). The differential preferences for eIF4F and eIFiso4F between RCNMV RNA1 and RNA2 (Figs. 3 and 4) might be important for the temporal regulation of viral protein expression, because the proteins encoded in RCNMV genomic RNAs would be required at different stages in the viral infection cycle. Once replication proteins are translated in a 3′TE-DR1-dependent manner, the replication proteins selectively recruit viral RNAs to the endoplasmic reticulum membranes and form viral replication complexes together with host factors to replicate progeny viral RNAs (Hyodo et al., 2013, 2015, 2017; Iwakawa et al., 2011; Kusumanegara et al., 2012; Mine et al., 2010a, 2010b, 2012). Translation of MP from RNA2, which is linked to RNA2 replication, might then be able to start (Mizumoto et al., 2006). At this stage, an intermolecular interaction between RNA1 and RNA2 will

4. Materials and methods 4.1. Plant lines and growth A. thaliana ecotype Columbia (Col-0) was used as the wild-type line. The mutants 4e (SALK_145583), 4g (SALK_112882), i4g1 (SALK_098730), and i4g2 (SALK_076633) have transfer DNA (TDNA) inserted in one of the eIF genes. i4e has a transposon insertion in the eIFiso4E locus (Duprat et al., 2002). The T-DNA insertion and the homozygous state of mutant lines were confirmed by genomic PCR using appropriate primer sets (Table 1). To confirm transposon insertion and the homozygous state of mutation, genomic PCR was carried out using primer sets i4e GenoFw and i4e GenoRv for the wildtype band (776 bp) and primer sets i4e GenoFw and i4e transposon for the insertion band (550 bp), respectively (Table 1). mRNA and protein levels from the mutated genes were determined by RT-qPCR as described below using primer sets corresponding to each eIF gene (data not shown) and by western blot analysis (Fig. 1). The primers used in this study are listed in Table 1. Arabidopsis seeds were sown on rockwool, treated at 4 °C in the dark for 2 days, and grown at 24 °C with a 10-h photoperiod per day in Hoagland medium. Three-to- 4-week-old plants were used for protoplast experiments. 4.2. Plasmid constructions The constructs described previously that were used in this study include the following: pUCR1 (Takeda et al., 2005), pRC2|G (Xiong and Lommel, 1991), pR1-luc-R1 (Sarawaneeyaruk et al., 2009), pUCR2-MP-HA (Kaido et al., 2014), pUBp27 (Takeda et al., 2005), pUBp88 (Takeda et al., 2005), pLucA60 (Sarawaneeyaruk et al., 2009), and pSP64-RLuc (Mizumoto et al., 2003). For the construction of pRLucA60, pSP64-RLuc was digested with 156

Virology 509 (2017) 152–158

Y. Tajima et al.

HindIII and XbaI, and the resulting fragment containing the Renilla luciferase (R-Luc) ORF was replaced with the corresponding region of pLucA60.

Table 1 List of primers and their sequences used in this study.

4.3. RNA preparation Transcripts derived from “pUC”, “pRC”, and “pR1” plasmids were synthesized in vitro from XmaI-digested plasmids using T7 RNA polymerase (Takara). Capped transcripts were synthesized using AmpliCap-MAX T7 High Yield Message Maker Kit (CellScript). Luc mRNA and R-Luc mRNA were transcribed from EcoRI-digested pLucA60 and pRLucA60. All transcripts were purified on a Sephadex-G50 column. RNA concentration was determined spectrophotometrically and its integrity was verified by agarose gel electrophoresis. All transcripts were named for their parent plasmids minus the “pUC” or “p” prefix. 4.4. Protoplast experiments Arabidopsis meso phyll protoplasts were obtained as described previously (Yoo et al., 2007) with some modifications. Briefly, approximately 3 x 105 protoplasts were resuspended in MMg solution (0.4 M mannitol, 15 mM MgCl2, 4 mM MES, pH 5.7), and mixed with inoculum. Immediately, a twofold volume of PEG solution (40% PEG4000 (Fluka), 0.2 M mannitol, and 100 mM Ca(NO3)2) was added, and the mixture was diluted with dilution solution (0.4 M mannitol, 125 mM CaCl2, 5 mM KCl, 5 mM glucose, and 1.5 mM MES, pH 5.7) and incubated on ice for 15 min. The transfected protoplasts were washed with 4 ml of dilution solution and incubated. To assess viral RNA replication, protoplasts were inoculated with RNA transcripts (1.5 μg of RCNMV RNA1 and 0.5 μg of RNA2). To assess the translation of MP from RNA2, protoplasts were inoculated with 0.5 µg of RNA2MP-HA (Kaido et al., 2014) together with plasmids expressing viral replication proteins (10 µg of pUBp27 and 5 µg of pUBp88). Protoplasts were incubated in W5 solution (154 mM NaCl, 125 mM CaCl2, 5 mM KCl, and 2 mM MES, pH 5.7) at 17 °C. Total RNA and protein were extracted and subjected to northern blot analysis and western blot analysis, respectively, as described previously (Iwakawa et al., 2007). For the dual luciferase assay, protoplasts were transfected with 5 pmol of firefly luciferase reporter mRNA together with 3.5 pmol of RLuc mRNA, and incubated in WI solution (0.5 M Mannitol, 20 mM KCl, and 4 mM MES, pH 5.7) at 17 °C for 6 h. Aliquots of cells were lysed with passive lysis buffer (Promega), and protein concentrations were measured using Bradford assays. Equal amounts of total protein were subjected to the dual luciferase assay as described previously (Mizumoto et al., 2003). The luminescence of firefly luciferase was normalized to that of Renilla luciferase and results are shown as F-luc/ R-luc luminescence. In addition, total RNA was extracted from aliquots of cells and subjected to RT-qPCR analysis to confirm the accumulation of luciferase mRNA. Each experiment was repeated at least three times using different batches of protoplasts. Box plots were created using the R software and ggplot2 package (Wickham, 2009).

Primers

Purpose

Seqence

4e GenoFw 4e GenoRv 4g GenoFw 4g GenoRv i4g1 GenoFw i4g1 GenoRv i4g2 GenoFw i4g2 GenoRv SALK_LBa1 i4e GenoFw i4e GenoRv i4e transposon eIF4E Fw eIF4E Rv eIFiso4E Fw eIFiso4E Rv eIF4G Fw eIF4G Rv eIFiso4G1 Fw eIFiso4G1 Rv eIFiso4G2 Fw eIFiso4G2 Rv UBC Fw UBC Rv

genotyping genotyping genotyping genotyping genotyping genotyping genotyping genotyping genotyping genotyping genotyping genotyping qRT-PCR qRT-PCR qRT-PCR qRT-PCR qRT-PCR qRT-PCR qRT-PCR qRT-PCR qRT-PCR qRT-PCR qRT-PCR qRT-PCR

TTCCATTGTTTTCCAATGCTC GAAACAAACCTCTTGGGGAAG GAACGCACCAGAGTGCTTATC AGGTTCATGTTGATCAATGCC TCAAGGGCAAACATATCATCC TTTTGACTTCACGTTTCCGTC AATGCAACAACAAGGTGAACC AAGAAGCTCGTACTTCTCCGG TGGTTCACGTAGTGGGCCATCG TTGACCCAATAGAGTCCAGAAAT CTCTCCAATCAAAGCCATCAACTA GTTTTGGCCGACACTCCTTACC CTGGTTCGATAATCCTGCTGTG CTCGGATGCTTCATGTTGTTGT TCGTAAAGCCTATACTTTCGACACC CTTCCCACTTTGGCTCAACAC CGCAAAGGTCAGTATGTGAGG TCGCCTAGAATCTCCACCAC CATCGACATGCGCTCCA ACCACTAGAAACCATACCCCTTCTC ACCGTGACTGGCATAGTCGTT ACCTCCGCTTTAATCAGCACA CTGCGACTCAGGGAATCTTCTAA TTGTGCCATTGAATTGAACCC

4.6. Antibodies Rabbit anti-p27 antiserum was used as the primary antibody to detect p27 as described previously (Takeda et al., 2005). Horseradish peroxidase (HRP)-conjugated anti-rabbit IgG antibody (Cell Signaling Technology) was used as the secondary antibody. HRP-conjugated anti-HA rat monoclonal antibody (Roche Diagnostics, #11867423001) was used to detect MP-HA. Acknowledgements We thank K. S. Browning (University of Wisconsin-Madison) for antibodies against AteIF4E, AteIFiso4E, AteIF4G, and AteIFiso4G and the transposon insertion line, J-F Laliberté (INRS-Institut ArmandFrappier) for the antibody against AtPABP2, and the Arabidopsis Biological Resource Center for the T-DNA insertion lines. This study was supported by a Japan Society for the Promotion of Science (JSPS) KAKENHI Grants 22248002 and 15H04456 (to T.O.), and a Grant-in-Aid for JSPS Fellows 12J04362 (to Y.T.). References Balvay, L., Soto Rifo, R., Ricci, E.P., Decimo, D., Ohlmann, T., 2009. Structural and functional diversity of viral IRESes. Biochim. Biophys. Acta 1789, 542–557. http:// dx.doi.org/10.1016/j.bbagrm.2009.07.005. Browning, K.S., 1996. The plant translational apparatus. Plant Mol. Biol. 32, 107–144. http://dx.doi.org/10.1007/BF00039380. Browning, K.S., Webster, C., Roberts, J.K., Ravel, J.M., 1992. Identification of an isozyme form of protein synthesis initiation factor 4F in plants. J. Biol. Chem. 267, 10096–10100. Cheng, S., Gallie, D.R., 2010. Competitive and noncompetitive binding of eIF4B, eIF4A, and the poly(A) binding protein to wheat translation initiation factor eIFiso4G. Biochemistry 49, 8251–8265. http://dx.doi.org/10.1021/bi1008529. Dreher, T.W., Miller, W.A., 2006. Translational control in positive strand RNA plant viruses. Virology 344, 185–197. http://dx.doi.org/10.1016/j.virol.2005.09.031. Duprat, A., Caranta, C., Revers, F., Menand, B., Browning, K.S., Robaglia, C., 2002. The Arabidopsis eukaryotic initiation factor (iso)4E is dispensable for plant growth but required for susceptibility to potyviruses. Plant J. 32, 927–934. http://dx.doi.org/ 10.1046/j.1365-313X.2002.01481.x. Gallie, D.R., 1991. The cap and poly(A) tail function synergistically to regulate mRNA translational efficiency. Genes Dev. 5, 2108–2116. http://dx.doi.org/10.1101/ gad.5.11.2108. Gallie, D.R., 2002. The 5′-leader of tobacco mosaic virus promotes translation through enhanced recruitment of eIF4F. Nucleic Acids Res. 30, 3401–3411. http:// dx.doi.org/10.1093/nar/gkf457.

4.5. RT-qPCR analysis Total RNA was extracted using Purelink reagent (Invitrogen), treated with RQ1 RNase-free DNase (Promega), purified by phenolchloroform extraction and precipitated with ethanol. A PrimeScript™ RT reagent kit (Takara) was used to obtain cDNA. RT-qPCR was performed using the primers listed in Table 1. UBC21 (At5g25760) was used as a control for normalizing the level of cDNA. SYBR Premix ExTaq (Takara) was used for all RT-qPCR analyses. Quantitative analysis of each mRNA was performed using a Thermal Cycler Dice Real Time System TP800 (Takara). 157

Virology 509 (2017) 152–158

Y. Tajima et al.

essential role in viral RNA replication and suppression of RNA silencing via the 480kDa viral replicase complex assembly. Virology 407, 213–224. http://dx.doi.org/ 10.1016/j.virol.2010.07.038. Mine, A., Takeda, A., Taniguchi, T., Taniguchi, H., Kaido, M., Mise, K., Okuno, T., 2010b. Identification and characterization of the 480-kilodalton template-specific RNAdependent RNA polymerase complex of red clover necrotic mosaic virus. J. Virol. 84, 6070–6081. http://dx.doi.org/10.1128/JVI.00054-10. Mizumoto, H., Iwakawa, H.-O., Kaido, M., Mise, K., Okuno, T., 2006. Cap-independent translation mechanism of red clover necrotic mosaic virus RNA2 differs from that of RNA1 and is linked to RNA replication. J. Virol. 80, 3781–3791. http://dx.doi.org/ 10.1128/JVI.80.8.3781-3791.2006. Mizumoto, H., Tatsuta, M., Kaido, M., Mise, K., Okuno, T., 2003. Cap-independent translational enhancement by the 3' untranslated region of red clover necrotic mosaic virus RNA1. J. Virol. 77, 12113–12121. http://dx.doi.org/10.1128/ JVI.77.22.12113-12121.2003. Nicholson, B.L., White, K.A., 2011. 3' Cap-independent translation enhancers of positivestrand RNA plant viruses. Curr. Opin. Virol. 1, 373–380. http://dx.doi.org/10.1016/ j.coviro.2011.10.002. Nicholson, B.L., Wu, B., Chevtchenko, I., White, K.A., 2010. Tombusvirus recruitment of host translational machinery via the 3' UTR. RNA 16, 1402–1419. http://dx.doi.org/ 10.1261/rna.2135210. Nicholson, B.L., Zaslaver, O., Mayberry, L.K., Browning, K.S., White, K.A., 2013. Tombusvirus Y-shaped translational enhancer forms a complex with eIF4F and can be functionally replaced by heterologous translational enhancers. J. Virol. 87, 1872–1883. http://dx.doi.org/10.1128/JVI.02711-12. Okuno, T., Hiruki, C., 2013. Molecular biology and epidemiology of dianthoviruses. Adv. Virus Res. 87, 37–74. http://dx.doi.org/10.1016/B978-0-12-407698-3.00002-8. Patrick, R.M., Mayberry, L.K., Choy, G., Woodard, L.E., Liu, J.S., White, A., Mullen, R.A., Tanavin, T.M., Latz, C.A., Browning, K.S., 2014. Two Arabidopsis loci encode novel eukaryotic initiation factor 4E isoforms that are functionally distinct from the conserved plant eukaryotic initiation factor 4E. Plant Physiol. 164, 1820–1830. http://dx.doi.org/10.1104/pp.113.227785. Sanfaçon, H., 2015. Plant translation factors and virus resistance. Viruses 7, 3392–3419. http://dx.doi.org/10.3390/v7072778. Sarawaneeyaruk, S., Iwakawa, H.-O., Mizumoto, H., Murakami, H., Kaido, M., Mise, K., Okuno, T., 2009. Host-dependent roles of the viral 5' untranslated region (UTR) in RNA stabilization and cap-independent translational enhancement mediated by the 3' UTR of Red clover necrotic mosaic virus RNA1. Virology 391, 107–118. http:// dx.doi.org/10.1016/j.virol.2009.05.037. Simon, A.E., Miller, W.A., 2013. 3' cap-independent translation enhancers of plant viruses. Annu. Rev. Microbiol. 67, 21–42. http://dx.doi.org/10.1146/annurevmicro-092412-155609. Sit, T.L., Vaewhongs, A.A., Lommel, S.A., 1998. RNA-mediated trans-activation of transcription from a viral RNA. Science 281, 829–832. http://dx.doi.org/10.1126/ science.281.5378.829. Sonenberg, N., Hinnebusch, A.G., 2009. Regulation of translation initiation in eukaryotes: mechanisms and biological targets. Cell 136, 731–745. http:// dx.doi.org/10.1016/j.cell.2009.01.042. Tajima, Y., Iwakawa, H., Kaido, M., Mise, K., Okuno, T., 2011. A long-distance RNA-RNA interaction plays an important role in programmed -1 ribosomal frameshifting in the translation of p88 replicase protein of Red clover necrotic mosaic virus. Virology 417, 169–178. http://dx.doi.org/10.1016/j.virol.2011.05.012. Takeda, A., Tsukuda, M., Mizumoto, H., Okamoto, K., Kaido, M., Mise, K., Okuno, T., 2005. A plant RNA virus suppresses RNA silencing through viral RNA replication. EMBO J. 24, 3147–3157. http://dx.doi.org/10.1038/sj.emboj.7600776. Tatsuta, M., Mizumoto, H., Kaido, M., Mise, K., Okuno, T., 2005. The red clover necrotic mosaic virus RNA2 trans-activator is also a cis-acting RNA2 replication element. J. Virol. 79, 978–986. http://dx.doi.org/10.1128/JVI.79.2.978-986.2005. Treder, K., Kneller, E.L.P., Allen, E.M., Wang, Z., Browning, K.S., Miller, W.A., 2008. The 3' cap-independent translation element of Barley yellow dwarf virus binds eIF4F via the eIF4G subunit to initiate translation. RNA 14, 134–147. http://dx.doi.org/ 10.1261/rna.777308. Wang, Z., Kraft, J.J., Hui, A.Y., Miller, W.A., 2010. Structural plasticity of Barley yellow dwarf virus-like cap-independent translation elements in four genera of plant viral RNAs. Virology 402, 177–186. http://dx.doi.org/10.1016/j.virol.2010.03.025. Wickham, H., 2009. ggplot2: Elegant Graphics for Data Analysis 1st ed. Springer-Verlag, New York. http://dx.doi.org/10.1007/978-0-387-98141-3. Xiong, Z., Lommel, S.A., 1991. Red clover necrotic mosaic virus infectious transcripts synthesized in vitroVirology 193, 213–221. http://dx.doi.org/10.1016/00426822(91)90687-7. Xiong, Z., Kim, K.H., Giesman-Cookmeyer, D., Lommel, S.A., 1993. The roles of the red clover necrotic mosaic virus capsid and cell-to-cell movement proteins in systemic infectionVirology 192, 27–32. http://dx.doi.org/10.1006/viro.1993.1004. Yoo, S.-D., Cho, Y.-H., Sheen, J., 2007. Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nat. Protoc. 2, 1565–1572. http:// dx.doi.org/10.1038/nprot.2007.199. Zuker, M., 2003. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31, 3406–3415. http://dx.doi.org/10.1093/nar/gkg595. Zavriev, S.K., Hickey, C.M., Lommel, S.A., 1996. Mapping of the red clover necrotic mosaic virus subgenomic RNA. Virology 216, 407–410.

Gallie, D.R., 2016. Eukaryotic Initiation Factor eIFiso4G1 and eIFiso4G2 Are Isoforms Exhibiting Distinct Functional Differences in Supporting Translation in Arabidopsis. J. Biol. Chem. 291, 1501–1513. http://dx.doi.org/10.1074/jbc.M115.692939. Gallie, D.R., Browning, K.S., 2001. eIF4G functionally differs from eIFiso4G in promoting internal initiation, cap-independent translation, and translation of structured mRNAs. J. Biol. Chem. 276, 36951–36960. http://dx.doi.org/10.1074/ jbc.M103869200. Guo, L., Allen, E., Miller, W.A., 2000. Structure and function of a cap-independent translation element that functions in either the 3' or the 5' untranslated region. RNA 6, 1808–1820. Hyodo, K., Hashimoto, K., Kuchitsu, K., Suzuki, N., Okuno, T., 2017. Harnessing host ROS-generating machinery for the robust genome replication of a plant RNA virus. Proc. Natl. Acad. Sci. Usa. 114, E1282–E1290. http://dx.doi.org/10.1073/ pnas.1610212114. Hyodo, K., Mine, A., Taniguchi, T., Kaido, M., Mise, K., Taniguchi, H., Okuno, T., 2013. ADP ribosylation factor 1 plays an essential role in the replication of a plant RNA virus. J. Virol. 87, 163–176. http://dx.doi.org/10.1128/JVI.02383-12. Hyodo, K., Okuno, T., 2016. Pathogenesis mediated by proviral host factors involved in translation and replication of plant positive-strand RNA viruses. Curr. Opin. Virol. 17, 11–18. http://dx.doi.org/10.1016/j.coviro.2015.11.004. Hyodo, K., Taniguchi, T., Manabe, Y., Kaido, M., Mise, K., Sugawara, T., Taniguchi, H., Okuno, T., 2015. Phosphatidic acid produced by phospholipase D promotes RNA replication of a plant RNA virus. PLoS Pathog. 11, e1004909. http://dx.doi.org/ 10.1371/journal.ppat.1004909. Iwakawa, H.-O., Kaido, M., Mise, K., Okuno, T., 2007. cis-Acting core RNA elements required for negative-strand RNA synthesis and cap-independent translation are separated in the 3'-untranslated region of Red clover necrotic mosaic virus RNA1. Virology 369, 168–181. http://dx.doi.org/10.1016/j.virol.2007.07.016. Iwakawa, H.-O., Mine, A., Hyodo, K., An, M., Kaido, M., Mise, K., Okuno, T., 2011. Template recognition mechanisms by replicase proteins differ between bipartite positive-strand genomic RNAs of a plant virus. J. Virol. 85, 497–509. http:// dx.doi.org/10.1128/JVI.01754-10. Iwakawa, H.-O., Tajima, Y., Taniguchi, T., Kaido, M., Mise, K., Tomari, Y., Taniguchi, H., Okuno, T., 2012. Poly(A)-binding protein facilitates translation of an uncapped/ nonpolyadenylated viral RNA by binding to the 3' untranslated region. J. Virol. 86, 7836–7849. http://dx.doi.org/10.1128/JVI.00538-12. Jackson, R.J., Hellen, C.U.T., Pestova, T.V., 2010. The mechanism of eukaryotic translation initiation and principles of its regulation. Nat. Rev. Mol. Cell Biol. 11, 113–127. http://dx.doi.org/10.1038/nrm2838. Jiang, J., Laliberté, J.-F., 2011. The genome-linked protein VPg of plant viruses-a protein with many partners. Curr. Opin. Virol. 1, 347–354. http://dx.doi.org/10.1016/ j.coviro.2011.09.010. Kaido, M., Abe, K., Mine, A., Hyodo, K., Taniguchi, T., Taniguchi, H., Mise, K., Okuno, T., 2014. GAPDH–a recruits a plant virus movement protein to cortical virus replication complexes to facilitate viral cell-to-cell movement. PLoS Pathog. 10, e1004505. http://dx.doi.org/10.1371/journal.ppat.1004505. Kaido, M., Funatsu, N., Tsuno, Y., Mise, K., Okuno, T., 2011. Viral cell-to-cell movement requires formation of cortical punctate structures containing Red clover necrotic mosaic virus movement protein. Virology 413, 205–215. http://dx.doi.org/10.1016/ j.virol.2011.02.008. Kim, K.H., Lommel, S.A., 1998. Sequence element required for efficient -1 ribosomal frameshifting in red clover necrotic mosaic dianthovirus. Virology 250, 50–59. http://dx.doi.org/10.1006/viro.1998.9358. Kneller, E.L.P., Rakotondrafara, A.M., Miller, W.A., 2006. Cap-independent translation of plant viral RNAs. Virus Res. 119, 63–75. http://dx.doi.org/10.1016/ j.virusres.2005.10.010. Kraft, J.J., Treder, K., Peterson, M.S., Miller, W.A., 2013. Cation-dependent folding of 3' cap-independent translation elements facilitates interaction of a 17-nucleotide conserved sequence with eIF4G. Nucleic Acids Res. 41, 3398–3413. http:// dx.doi.org/10.1093/nar/gkt026. Kusumanegara, K., Mine, A., Hyodo, K., Kaido, M., Mise, K., Okuno, T., 2012. Identification of domains in p27 auxiliary replicase protein essential for its association with the endoplasmic reticulum membranes in Red clover necrotic mosaic virus. Virology 433, 131–141. http://dx.doi.org/10.1016/ j.virol.2012.07.017. Lax, S.R., Lauer, S.J., Browning, K.S., Ravel, J.M., 1986. Purification and properties of protein synthesis initiation and elongation factors from wheat germ. Methods Enzymol. 118, 109–128. http://dx.doi.org/10.1016/0076-6879(86)18068-2. Lellis, A.D., Allen, M.L., Aertker, A.W., Tran, J.K., Hillis, D.M., Harbin, C.R., Caldwell, C., Gallie, D.R., Browning, K.S., 2010. Deletion of the eIFiso4G subunit of the Arabidopsis eIFiso4F translation initiation complex impairs health and viability. Plant Mol. Biol. 74, 249–263. http://dx.doi.org/10.1007/s11103-010-9670-z. Miller, W.A., Wang, Z., Treder, K., 2007. The amazing diversity of cap-independent translation elements in the 3'-untranslated regions of plant viral RNAs. Biochem. Soc. Trans. 35, 1629–1633. http://dx.doi.org/10.1042/BST0351629. Mine, A., Hyodo, K., Tajima, Y., Kusumanegara, K., Taniguchi, T., Kaido, M., Mise, K., Taniguchi, H., Okuno, T., 2012. Differential roles of Hsp70 and Hsp90 in the assembly of the replicase complex of a positive-strand RNA plant virus. J. Virol. 86, 12091–12104. http://dx.doi.org/10.1128/JVI.01659-12. Mine, A., Hyodo, K., Takeda, A., Kaido, M., Mise, K., Okuno, T., 2010a. Interactions between p27 and p88 replicase proteins of Red clover necrotic mosaic virus play an

158