- Email: [email protected]
Resistance determinant erm(X) is borne by transposon Tn5432 in Bifidobacterium thermophilum and Bifidobacterium animalis subsp. lactis
International Journal of Antimicrobial Agents 31 (2008) 544–548
Short communication
Resistance determinant erm(X) is borne by transposon Tn5432 in Bifidobacterium thermophilum and Bifidobacterium animalis subsp. lactis Angela H.A.M. van Hoek a,∗ , Sigrid Mayrhofer b , Konrad J. Domig b , Henk J.M. Aarts a a b
RIKILT–Institute of Food Safety, Wageningen UR, Bornsesteeg 45, NL-6708PD Wageningen, The Netherlands BOKU–University of Natural Resources and Applied Life Sciences, Department of Food Science and Technology, Division of Food Microbiology and Hygiene, Gregor Mendel Strasse 33, A-1180 Vienna, Austria Received 23 October 2007; accepted 24 January 2008
Abstract The erm(X) gene from erythromycin- and clindamycin-resistant Bifidobacterium strains was characterised by polymerase chain reaction and sequence analysis, including flanking regions. Results suggest that the resistance determinant was part of transposon Tn5432 that has been described in several opportunistic pathogens such as Corynebacterium striatum and Propionibacterium acnes. © 2008 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved. Keywords: erm(X); Probiotics; tnp1249; tnpCX; Transferable antibiotic resistance genes
1. Introduction Probiotics are defined as living microorganisms that upon ingestion in certain numbers exert health benefits [1]. Lactic acid bacteria and bifidobacteria commonly used as probiotics are ‘Generally Recognised As Safe’ (GRAS). However, they may still cause systemic infections, excessive immune stimulation in susceptible individuals and/or gene transfer [2]. As a consequence, probiotic strains must be characterised before they are legally permitted. Among others things, their antibiotic resistance pattern must be assessed, as microorganisms used for probiotics should not contain any transferable antibiotic resistance genes [2,3]. Presence of the resistance determinant erm(X) was demonstrated in six erythromycin- and clindamycin-resistant Bifidobacterium thermophilum strains during investigation of a large collection of bifidobacteria that could be potential probiotics [4]. Analysis of additional bifidobacteria revealed that
∗ Corresponding author. Present address: P.O. Box 230, NL-6700AE Wageningen, The Netherlands. Tel.: +31 317 480 354; fax: +31 317 417 717. E-mail address: [email protected] (A.H.A.M. van Hoek).
this antibiotic resistance gene was also present in a Bifidobacterium animalis subsp. lactis strain [5]. In this study, the detected erm(X) was analysed in more detail in relation to its potential transmissibility.
2. Materials and methods 2.1. Bacterial strains and antimicrobial susceptibility testing The strains investigated in this study are shown in Table 1. Bifidobacteria were grown in brain–heart infusion broth containing 0.05% cysteine–HCl in an anaerobic chamber at 37 ◦ C for 48 h. Minimal inhibitory concentrations (MICs) of the six B. thermophilum strains were determined by broth microdilution using VetMICTM 96-well microtitre plates (National Veterinary Institute, Uppsala, Sweden) containing serial two-fold dilutions of the dehydrated antimicrobial agents clindamycin (0.12–8 g/mL) and erythromycin (0.12–16 g/mL) [4]. Cultures were streaked on lactic acid bacteria susceptibility test medium supplemented with cys-
0924-8579/$ – see front matter © 2008 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved. doi:10.1016/j.ijantimicag.2008.01.025
A.H.A.M. van Hoek et al. / International Journal of Antimicrobial Agents 31 (2008) 544–548
545
Table 1 Bifidobacterium strains analysed in the study Strain #
B0196 B0213 B0221 B0222 B0225 B0252 B0456
Species
B. thermophilum B. thermophilum B. thermophilum B. thermophilum B. thermophilum B. thermophilum B. animalis subsp. lactis
Origin
Year of isolation
Pig faeces Pig faeces Pig faeces Pig faeces Surface swab of pig carcass Pig faeces Pig faeces
2001 2001 2002 2002 2002 2002 2001
MIC (g/mL)a Erythromycin
Clindamycin
16 >16 >16 >16 16 >16 >256
>8 >8 >8 >8 >8 >8 >256
a Minimal inhibitory concentrations (MICs) were determined by broth microdilution [4] for B. thermophilum and by the Etest method [5] for B. animalis subsp. lactis.
teine (LSM-C) [6] and incubated for 48 h at 37 ◦ C in an anaerobic cabinet (80% N2 , 10% CO2 , 10% H2 ; Scholzen Technik, Kriens, Switzerland). Inocula were prepared by suspending colonies in 5 mL of 0.85% NaCl solution to a turbidity of McFarland standard 1. The inoculated saline suspension was diluted in LSM-C broth at 1:1000. Subsequently, 100 L of the diluted inoculum was added to each well of the VetMIC plates. After incubating plates under anaerobic conditions at 37 ◦ C for 48 h, MIC values were read as the lowest concentration of an antimicrobial agent at which visible growth was inhibited. Antimicrobial susceptibility of the B. animalis subsp. lactis strain was analysed by Etest (AB BIODISK, Solna, Sweden) as described by M¨att¨o et al. [5]. Briefly, the concentration gradient of the tested antimicrobial agents clindamycin and erythromycin on the Etest strips was 0.016–256 g/mL. Bacterial suspensions with a turbidity equivalent to McFarland standard 1 were prepared as indicated above. Within 15 min after adjusting the turbidity of the inoculum, the cultures were swabbed evenly onto LSM-C agar plates using a sterile cotton swab. After drying the surface of the plates for 15 min, Etest strips were applied. The plates were incubated under the same condition as for the broth microdilution method. MICs were read directly from the test strip according to the instructions of the manufacturer. 2.2. DNA isolation and polymerase chain reaction (PCR) Total DNA was isolated using the Wizard Genomic DNA isolation kit according to the manufacturer’s protocol for Gram-positive bacteria (Promega Benelux BV, Leiden, The Netherlands). The B. thermophilum strains were differentiated by the BOX PCR fingerprinting technique as described by Masco et al. [7]. PCR reactions were performed in a total volume of 50 L containing approximately 20 ng of bacterial DNA, 10 pmol of each primer (Table 2), 1× PCR buffer, 3 mM MgCl2 , 0.2 mM of each dNTP and 2.5 U of Taq DNA polymerase recombinant (Invitrogen BV, Breda, The Netherlands). The following PCR program was used: 95 ◦ C for 3 min; 35 cycles of 95 ◦ C
for 30 s, 58 ◦ C or 60 ◦ C for 30 s and 72 ◦ C for 30 s or 60 s; and 72 ◦ C for 10 min. The annealing temperature depended on the melting temperature (Tm ) of the primer pair. The extension time was determined by the expected product length, i.e. fragments shorter than 1400 bp had an extension period of 30 s, whereas longer products had an extension time of 60 s. The obtained PCR fragments were analysed by electrophoresis on a 1–2% agarose gel, depending on the presumed product size, stained with ethidium bromide and visualised with ultraviolet light. 2.3. Inverse PCR Inverse PCR was carried out on isolated DNA of the Bifidobacterium strains according to the principle described by Ochman et al. [8]. In brief, 20 ng of total DNA was used together with 10 U of endonuclease in the buffer specified by the supplier (New England Biolabs) in a total volume Table 2 Primers used in the study Namea
Sequence (5 –3 )
BOXb
CTACGGCAAGGCGACGCTGACG ATGTTGATTTCAGGTACCGC TCTGCATACGGACACGGC CCACAATGACGCAGGGAG GCTCAGTGGTCCCCATGG AGTCACCTGGAAGAGATCG CCGCAACTACCTGTTCCCGC CGCTCGTCTGGCCAAGGC CCGTCAAGGTCGTCTTTCC TTACACCAACGGGCAGAGC ATGTCGAAGAACCAACCACG AGCGTGGTTGGTTCTTCGAC CATCGACGGCGGCCAAGG CCTTGGCCGCCGTCGATG TTGAATGCCGATTGAGTGGG GTGCAGCCTAACGGAAATGT TTAACCCAGATTGCACGCGT CCCTGGACACGCTGATTAAG TCTTAATCAGCGTGTCCAGG
ermX -237F ermX 4F ermX 298Rc ermX 436Fc ermX 766R rplI 87F rplI 165F tetW 62R tetW 1785F tnp1249 31F tnp1249 52R tnp1249 486F tnp1249 503Rc tnp1249 1194R tnpCX 1F tnpCX 573R tRNA-Lys 21F tRNA-Lys 41R
a The number in the primer name indicates the start position of the primer within the specific gene. b See [7]. c Primers used for inverse polymerase chain reaction (PCR).
546
A.H.A.M. van Hoek et al. / International Journal of Antimicrobial Agents 31 (2008) 544–548
of 20 L for the digestion. In total, 10 different restriction enzymes were applied, namely AgeI, AvrII, BamHI, EcoRI, HindIII, NheI, NsiI, SacI, SalI and XbaI. Intramolecular ligation was performed using 5 L of digested DNA, 1× ligation buffer and 200 U of T4 DNA ligase (New England Biolabs) in a total volume of 200 L at 4 ◦ C for at least 16 h. The ligated DNA was precipitated using 0.1 volume of 3 M sodium acetate (pH 5.2) and 2.5 volumes of 96% ethanol, collected by centrifugation, washed with 70% ethanol and dissolved in 100 L of sterile water. Inverse PCR was performed in a total volume of 50 L using 2 L of ligated DNA, 10 pmol of each divergent primer (the primers used are indicated in Table 2), 1× PCR buffer, 3 mM MgCl2 , 0.2 mM of each dNTP and 2.5 U of Taq DNA polymerase recombinant. The following PCR program was used: 95 ◦ C for 3 min; 35 cycles of 95 ◦ C for 30 s, 58 ◦ C for 30 s and 72 ◦ C for 3 min; and 72 ◦ C for 10 min. 2.4. Sequence analysis The various (inverse) PCR fragments were cloned in the pGEM® -T Easy vector (Promega Benelux BV, Leiden, The Netherlands) and transformed into ultracompetent Escherichia coli XL2-blue cells (Stratagene Europe, Amsterdam, The Netherlands). Plasmid DNA was isolated with QIAprep Spin Miniprep Kit (Qiagen Benelux B.V., Venlo, The Netherlands). DNA sequencing was carried out with the GenomeLabTM Methods Development Kit Dye Terminator Cycle Sequencing Chemistry Protocol and determined on a CEQTM 2000 Sequencer (Beckman Coulter (Nederland) B.V., Mijdrecht, The Netherlands). Multiple clones were analysed for each strain and PCR fragment. The SeaView software program [9] was used to align the various sequences (freely available by anonymous FTP at pbil.univ-lyon1.fr). 2.5. Nucleotide sequence accession number The erm(X) DNA sequences and flanking regions of the seven Bifidobacterium strains have been deposited in the EMBL Nucleotide Sequence database under accession numbers AM748797–AM748803.
3. Results and discussion 3.1. Strains The characteristics of the Bifidobacterium strains investigated are described in Table 1. DNA from the six B. thermophilum strains investigated was subjected to BOX PCR [7] to check whether these strains were different isolates or clonal descendants. This genetic fingerprinting, targeting repetitive genomic elements (rep-PCR), revealed that all strains exhibited different profiles, indicating that the B. thermophilum isolates represent different strains (results not shown).
3.2. Sequence analysis of the erm(X) gene The nearly complete erm(X) open-reading frame (ORF) plus part of the flanking sequence was amplified from the Bifidobacterium strains using the primers ermX -237F and ermX 766R, which were based on conserved parts of known erm(X) sequences and their upstream regions including a putative leader peptide. A total of 763 bp of the antibiotic resistance gene sequence was obtained and it showed >98% DNA identity with other known erm(X) determinants [10–15]. In the literature, two variants of erm(X) have been described: an ORF with a length of 762 bp (encoding an Erm(X) protein of 253 amino acids) due to the deletion of a G resulting in a frame shift within codon 216; and a gene that is 855 bp long (encoding an Erm(X) protein of 284 amino acids) [11,13,14]. The erm(X) gene in the Bifidobacterium strains was most similar to the longest type. This was confirmed by additional sequence information obtained during investigation of the flanking regions of erm(X) (see below). In addition to erm(X), the Bifidobacterium strains investigated also possessed the tetracycline resistance gene tet(W) [4]. Since some of the known erm(X) genes are linked with a tetracycline resistance gene [10,14,15], PCR was used to determine whether this was also the case for erm(X) and tet(W). Four PCR tests using different primer combinations specific for erm(X) and tet(W) (Table 2) did not indicate that these genes are localised in close vicinity (results not shown). 3.3. Analysis of the surrounding regions of erm(X) The flanking regions of erm(X) were retrieved by inverse PCR [8], subsequently cloned and sequenced. Total DNA from the Bifidobacterium strains was digested in separate reactions with 10 restriction enzymes (see Section 2.3). The cut DNA was self-ligated and used as a template for inverse PCR with primers ermX 298R and ermX 436F (Table 2). For only four B. thermophilum strains (B0196, B0213, B0221 and B0222) an amplicon of ca. 1.5 kb was obtained when digesting the DNA with EcoRI. Sequence analysis of the PCR fragment of B0213 and B0221 revealed that the transposase gene tnp1249 was present upstream of the antibiotic resistance gene. This tnp1249 gene has also been identified flanking the erm(X) gene in several opportunistic pathogenic Corynebacterium spp., Arcanobacterium pyogenes and the cutaneous Propionibacterium acnes [10,12,14,15]. In these bacteria, the erm(X) was part of the transposon called Tn5432. To check whether the erm gene in the bifidobacteria was also located on a Tn5432-like transposon, several PCR primers were designed directed against the genes flanking erm(X), i.e. tnp1249 and tnpCX (Table 2). PCR analysis using various primer combinations confirmed erm(X) to be present on a Tn5432-like transposon in all seven Bifidobacterium strains investigated. The transposon was similar to the Tn5432 described in corynebacteria, arcanobacteria and propionibacteria [10,12,14,15], containing the genes tnp1249a, erm(X), tnpCX and tnp1249b (Fig. 1).
A.H.A.M. van Hoek et al. / International Journal of Antimicrobial Agents 31 (2008) 544–548
547
Fig. 1. Schematic representation of transposon Tn5432 [12]. The black lines with the strain numbers indicate the DNA parts that have been determined by (inverse) polymerase chain reaction (PCR) and sequence analysis. The dotted lines depict the PCR fragments for the detection of parts of the transposon generated with the following primer pairs: P1, tnp1249 31F and tnp1249 503R; P2, tnp1249 486F and tnp1249 1194R; P3, tnp1249 31F and tnp1249 1194R; P4, tnp1249 31F and ermX 298R; P5, tnpCX 1F and tnpCX 573R; P6, ermX 436F and tnpCX 573R; P7, tnpCX 1F and tnp1249 503R; P8, ermX 436F and tnp1249 1194R; and P9, tnp1249 486F and tnpCX 573R.
Inverse PCR [8] was also used to determine the exact location of the Tn5432 transposon in the bifidobacteria. Unfortunately, only a small part of the upstream region of Tn5432 was retrieved for B. thermophilum B0213, i.e. 332 bp. However, BLAST searches revealed that the first 66 bp obtained corresponded to the 3 end of a rplI gene, which encodes the 50S ribosomal protein L9 and has a chromosomal location in Bifidobacterium longum as well as Bifidobacterium adolescentis. The putative deduced protein sequence (only 21 amino acids) displayed 86% identity with the rplI gene of these two bifidobacteria. Primers were designed based on conserved parts of the bifidobacterial rplI gene, and PCR tests were performed to determine whether the other Bifidobacterium strains examined in this study have a similar insertion site (Table 2: rplI 87F and tnp1249 52R; rplI 165F and tnp1249 52R). Results demonstrated that the Tn5432 transposon appeared to be integrated near the rplI gene only in strain B0213. A close look at the publicly available bifidobacterial genomic sequences revealed that in B. longum the rplI gene is preceded by a tRNALys gene (approximately 200 bp in between). In contrast, in B. adolescentis the tRNA is located at a much further distance, i.e. >3500 bp. These tRNA sequences are known hotspots for integration of prophages and other insertion elements in bifidobacteria [16]. Conserved tRNALys primers were developed (Table 2) and, in combination with primer tnp1249 486F, PCR tests were performed to check whether a tRNALys was present in the vicinity of the Tn5432 transposon integration site in strain B0213. Unfortunately, PCR results were ambiguous (results not shown).
4. Conclusions In conclusion, this work reports the characterisation of the resistance gene erm(X) in different Bifidobacterium strains. The gene was nearly identical to erm(X) determinants present in several opportunistic pathogenic corynebacteria, arcanobacteria and propionibacteria. Furthermore, in the bifidobacteria investigated erm(X) was present on a Tn5432-like transposon, as in several of the above mentioned bacteria. According to European Union legislation, a transposonal location of an antibiotic resistance gene will exclude such strains from being used as probiotics [2,3].
Acknowledgments Franc¸oise Gavini and Matthias Upmann are gratefully acknowledged for providing the bifidobacterial strains isolated in the EU project ‘BIFID’ (CT-2000-00805). Funding: This research was supported by the European Commission under the 6th Framework Program (ACE-ART, project number: CT-2003-506214). Competing interests: None declared. Ethical approval: Not required.
References [1] Guarner F, Schaafsma GJ. Probiotics. Int J Food Microbiol 1998;39:237–8.
548
A.H.A.M. van Hoek et al. / International Journal of Antimicrobial Agents 31 (2008) 544–548
[2] FAO/WHO Working Group. Guidelines for the evaluation of probiotics in food. London, Ontario, Canada: Food and Agriculture Organization of the United Nations/World Health Organization; 2002. Available at: http://www.who.int/foodsafety/fs management/en/probiotic guidelines.pdf [accessed 15 February 2008]. [3] von Wright A. Regulating the safety of probiotics—the European approach. Curr Pharm Des 2005;11:17–23. [4] Mayrhofer S, Domig KJ, Amtmann E, van Hoek AHAM, Peterson A, Mair, et al. Antibiotic susceptibility of Bifidobacterium thermophilum and Bifidobacterium pseudolongum isolates from animal sources. J Food Prot 2007;70:119–24. [5] M¨att¨o J, van Hoek AHAM, Domig KJ, Saarela M, Florez AB, Brockmann E, et al. Susceptibility of human and probiotic Bifidobacterium spp. to selected antibiotics as determined by the Etest method. Int Dairy J 2007;17:1123–31. [6] Klare I, Konstabel C, M¨uller-Bertling S, Reissbrodt R, Huys G, Vancanneyt M, et al. Evaluation of new broth media for microdilution antibiotic susceptibility testing of lactobacilli, pediococci, lactococci, and bifidobacteria. Appl Environ Microbiol 2005;71:8982–6. [7] Masco L, Huys G, Gevers D, Verbrugghen L, Swings J. Identification of Bifidobacterium species using rep-PCR fingerprinting. Syst Appl Microbiol 2003;26:557–63. [8] Ochman H, Gerber AS, Hartl DL. Genetic applications of an inverse polymerase chain reaction. Genetics 1988;120:621–3. [9] Galtier N, Gouy M, Gautier C. SEAVIEW and PHYLO WIN: two graphic tools for sequence alignment and molecular phylogeny. Bioinformatics 1996;12:543–8.
[10] Jost BH, Field AC, Trinh HT, Songer JG, Billington SJ. Tylosin resistance in Arcanobacterium pyogenes is encoded by an Erm X determinant. Antimicrob Agents Chemother 2003;47:3519–24. [11] Rosato AE, Lee BS, Nash KA. Inducible macrolide resistance in Corynebacterium jeikeium. Antimicrob Agents Chemother 2001;45:1982–9. [12] Ross JI, Eady EA, Carnegie E, Cove JH. Detection of transposon Tn5432-mediated macrolide–lincosamide–streptogramin B (MLSB ) resistance in cutaneous propionibacteria from six European cities. J Antimicrob Chemother 2002;49:165–8. [13] Tauch A, Bischoff N, Brune I, Kalinowski J. Insights into the genetic organization of the Corynebacterium diphtheriae erythromycin resistance plasmid pNG2 deduced from its complete nucleotide sequence. Plasmid 2003;49:63–74. [14] Tauch A, Kassing F, Kalinowski J, P¨uhler A. The Corynebacterium xerosis composite transposon Tn5432 consists of two identical insertion sequences, designated IS1249, flanking the erythromycin resistance gene ermCX. Plasmid 1995;34:119–31. [15] Tauch A, Krieft S, Kalinowski J, P¨uhler A. The 51,409-bp R-plasmid pTP10 from the multiresistant clinical isolate Corynebacterium striatum M82B is composed of DNA segments initially identified in soil bacteria and in plant, animal, and human pathogens. Mol Gen Genet 2000;263:1–11. [16] Ventura M, Lee J-H, Canchaya C, Zink R, Leahy S, Moreno-Munoz JA, et al. Prophage-like elements in bifidobacteria: insights from genomics, transcription, integration, distribution, and phylogenetic analysis. Appl Environ Microbiol 2005;71:8692–705.
Short communication
Resistance determinant erm(X) is borne by transposon Tn5432 in Bifidobacterium thermophilum and Bifidobacterium animalis subsp. lactis Angela H.A.M. van Hoek a,∗ , Sigrid Mayrhofer b , Konrad J. Domig b , Henk J.M. Aarts a a b
RIKILT–Institute of Food Safety, Wageningen UR, Bornsesteeg 45, NL-6708PD Wageningen, The Netherlands BOKU–University of Natural Resources and Applied Life Sciences, Department of Food Science and Technology, Division of Food Microbiology and Hygiene, Gregor Mendel Strasse 33, A-1180 Vienna, Austria Received 23 October 2007; accepted 24 January 2008
Abstract The erm(X) gene from erythromycin- and clindamycin-resistant Bifidobacterium strains was characterised by polymerase chain reaction and sequence analysis, including flanking regions. Results suggest that the resistance determinant was part of transposon Tn5432 that has been described in several opportunistic pathogens such as Corynebacterium striatum and Propionibacterium acnes. © 2008 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved. Keywords: erm(X); Probiotics; tnp1249; tnpCX; Transferable antibiotic resistance genes
1. Introduction Probiotics are defined as living microorganisms that upon ingestion in certain numbers exert health benefits [1]. Lactic acid bacteria and bifidobacteria commonly used as probiotics are ‘Generally Recognised As Safe’ (GRAS). However, they may still cause systemic infections, excessive immune stimulation in susceptible individuals and/or gene transfer [2]. As a consequence, probiotic strains must be characterised before they are legally permitted. Among others things, their antibiotic resistance pattern must be assessed, as microorganisms used for probiotics should not contain any transferable antibiotic resistance genes [2,3]. Presence of the resistance determinant erm(X) was demonstrated in six erythromycin- and clindamycin-resistant Bifidobacterium thermophilum strains during investigation of a large collection of bifidobacteria that could be potential probiotics [4]. Analysis of additional bifidobacteria revealed that
∗ Corresponding author. Present address: P.O. Box 230, NL-6700AE Wageningen, The Netherlands. Tel.: +31 317 480 354; fax: +31 317 417 717. E-mail address: [email protected] (A.H.A.M. van Hoek).
this antibiotic resistance gene was also present in a Bifidobacterium animalis subsp. lactis strain [5]. In this study, the detected erm(X) was analysed in more detail in relation to its potential transmissibility.
2. Materials and methods 2.1. Bacterial strains and antimicrobial susceptibility testing The strains investigated in this study are shown in Table 1. Bifidobacteria were grown in brain–heart infusion broth containing 0.05% cysteine–HCl in an anaerobic chamber at 37 ◦ C for 48 h. Minimal inhibitory concentrations (MICs) of the six B. thermophilum strains were determined by broth microdilution using VetMICTM 96-well microtitre plates (National Veterinary Institute, Uppsala, Sweden) containing serial two-fold dilutions of the dehydrated antimicrobial agents clindamycin (0.12–8 g/mL) and erythromycin (0.12–16 g/mL) [4]. Cultures were streaked on lactic acid bacteria susceptibility test medium supplemented with cys-
0924-8579/$ – see front matter © 2008 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved. doi:10.1016/j.ijantimicag.2008.01.025
A.H.A.M. van Hoek et al. / International Journal of Antimicrobial Agents 31 (2008) 544–548
545
Table 1 Bifidobacterium strains analysed in the study Strain #
B0196 B0213 B0221 B0222 B0225 B0252 B0456
Species
B. thermophilum B. thermophilum B. thermophilum B. thermophilum B. thermophilum B. thermophilum B. animalis subsp. lactis
Origin
Year of isolation
Pig faeces Pig faeces Pig faeces Pig faeces Surface swab of pig carcass Pig faeces Pig faeces
2001 2001 2002 2002 2002 2002 2001
MIC (g/mL)a Erythromycin
Clindamycin
16 >16 >16 >16 16 >16 >256
>8 >8 >8 >8 >8 >8 >256
a Minimal inhibitory concentrations (MICs) were determined by broth microdilution [4] for B. thermophilum and by the Etest method [5] for B. animalis subsp. lactis.
teine (LSM-C) [6] and incubated for 48 h at 37 ◦ C in an anaerobic cabinet (80% N2 , 10% CO2 , 10% H2 ; Scholzen Technik, Kriens, Switzerland). Inocula were prepared by suspending colonies in 5 mL of 0.85% NaCl solution to a turbidity of McFarland standard 1. The inoculated saline suspension was diluted in LSM-C broth at 1:1000. Subsequently, 100 L of the diluted inoculum was added to each well of the VetMIC plates. After incubating plates under anaerobic conditions at 37 ◦ C for 48 h, MIC values were read as the lowest concentration of an antimicrobial agent at which visible growth was inhibited. Antimicrobial susceptibility of the B. animalis subsp. lactis strain was analysed by Etest (AB BIODISK, Solna, Sweden) as described by M¨att¨o et al. [5]. Briefly, the concentration gradient of the tested antimicrobial agents clindamycin and erythromycin on the Etest strips was 0.016–256 g/mL. Bacterial suspensions with a turbidity equivalent to McFarland standard 1 were prepared as indicated above. Within 15 min after adjusting the turbidity of the inoculum, the cultures were swabbed evenly onto LSM-C agar plates using a sterile cotton swab. After drying the surface of the plates for 15 min, Etest strips were applied. The plates were incubated under the same condition as for the broth microdilution method. MICs were read directly from the test strip according to the instructions of the manufacturer. 2.2. DNA isolation and polymerase chain reaction (PCR) Total DNA was isolated using the Wizard Genomic DNA isolation kit according to the manufacturer’s protocol for Gram-positive bacteria (Promega Benelux BV, Leiden, The Netherlands). The B. thermophilum strains were differentiated by the BOX PCR fingerprinting technique as described by Masco et al. [7]. PCR reactions were performed in a total volume of 50 L containing approximately 20 ng of bacterial DNA, 10 pmol of each primer (Table 2), 1× PCR buffer, 3 mM MgCl2 , 0.2 mM of each dNTP and 2.5 U of Taq DNA polymerase recombinant (Invitrogen BV, Breda, The Netherlands). The following PCR program was used: 95 ◦ C for 3 min; 35 cycles of 95 ◦ C
for 30 s, 58 ◦ C or 60 ◦ C for 30 s and 72 ◦ C for 30 s or 60 s; and 72 ◦ C for 10 min. The annealing temperature depended on the melting temperature (Tm ) of the primer pair. The extension time was determined by the expected product length, i.e. fragments shorter than 1400 bp had an extension period of 30 s, whereas longer products had an extension time of 60 s. The obtained PCR fragments were analysed by electrophoresis on a 1–2% agarose gel, depending on the presumed product size, stained with ethidium bromide and visualised with ultraviolet light. 2.3. Inverse PCR Inverse PCR was carried out on isolated DNA of the Bifidobacterium strains according to the principle described by Ochman et al. [8]. In brief, 20 ng of total DNA was used together with 10 U of endonuclease in the buffer specified by the supplier (New England Biolabs) in a total volume Table 2 Primers used in the study Namea
Sequence (5 –3 )
BOXb
CTACGGCAAGGCGACGCTGACG ATGTTGATTTCAGGTACCGC TCTGCATACGGACACGGC CCACAATGACGCAGGGAG GCTCAGTGGTCCCCATGG AGTCACCTGGAAGAGATCG CCGCAACTACCTGTTCCCGC CGCTCGTCTGGCCAAGGC CCGTCAAGGTCGTCTTTCC TTACACCAACGGGCAGAGC ATGTCGAAGAACCAACCACG AGCGTGGTTGGTTCTTCGAC CATCGACGGCGGCCAAGG CCTTGGCCGCCGTCGATG TTGAATGCCGATTGAGTGGG GTGCAGCCTAACGGAAATGT TTAACCCAGATTGCACGCGT CCCTGGACACGCTGATTAAG TCTTAATCAGCGTGTCCAGG
ermX -237F ermX 4F ermX 298Rc ermX 436Fc ermX 766R rplI 87F rplI 165F tetW 62R tetW 1785F tnp1249 31F tnp1249 52R tnp1249 486F tnp1249 503Rc tnp1249 1194R tnpCX 1F tnpCX 573R tRNA-Lys 21F tRNA-Lys 41R
a The number in the primer name indicates the start position of the primer within the specific gene. b See [7]. c Primers used for inverse polymerase chain reaction (PCR).
546
A.H.A.M. van Hoek et al. / International Journal of Antimicrobial Agents 31 (2008) 544–548
of 20 L for the digestion. In total, 10 different restriction enzymes were applied, namely AgeI, AvrII, BamHI, EcoRI, HindIII, NheI, NsiI, SacI, SalI and XbaI. Intramolecular ligation was performed using 5 L of digested DNA, 1× ligation buffer and 200 U of T4 DNA ligase (New England Biolabs) in a total volume of 200 L at 4 ◦ C for at least 16 h. The ligated DNA was precipitated using 0.1 volume of 3 M sodium acetate (pH 5.2) and 2.5 volumes of 96% ethanol, collected by centrifugation, washed with 70% ethanol and dissolved in 100 L of sterile water. Inverse PCR was performed in a total volume of 50 L using 2 L of ligated DNA, 10 pmol of each divergent primer (the primers used are indicated in Table 2), 1× PCR buffer, 3 mM MgCl2 , 0.2 mM of each dNTP and 2.5 U of Taq DNA polymerase recombinant. The following PCR program was used: 95 ◦ C for 3 min; 35 cycles of 95 ◦ C for 30 s, 58 ◦ C for 30 s and 72 ◦ C for 3 min; and 72 ◦ C for 10 min. 2.4. Sequence analysis The various (inverse) PCR fragments were cloned in the pGEM® -T Easy vector (Promega Benelux BV, Leiden, The Netherlands) and transformed into ultracompetent Escherichia coli XL2-blue cells (Stratagene Europe, Amsterdam, The Netherlands). Plasmid DNA was isolated with QIAprep Spin Miniprep Kit (Qiagen Benelux B.V., Venlo, The Netherlands). DNA sequencing was carried out with the GenomeLabTM Methods Development Kit Dye Terminator Cycle Sequencing Chemistry Protocol and determined on a CEQTM 2000 Sequencer (Beckman Coulter (Nederland) B.V., Mijdrecht, The Netherlands). Multiple clones were analysed for each strain and PCR fragment. The SeaView software program [9] was used to align the various sequences (freely available by anonymous FTP at pbil.univ-lyon1.fr). 2.5. Nucleotide sequence accession number The erm(X) DNA sequences and flanking regions of the seven Bifidobacterium strains have been deposited in the EMBL Nucleotide Sequence database under accession numbers AM748797–AM748803.
3. Results and discussion 3.1. Strains The characteristics of the Bifidobacterium strains investigated are described in Table 1. DNA from the six B. thermophilum strains investigated was subjected to BOX PCR [7] to check whether these strains were different isolates or clonal descendants. This genetic fingerprinting, targeting repetitive genomic elements (rep-PCR), revealed that all strains exhibited different profiles, indicating that the B. thermophilum isolates represent different strains (results not shown).
3.2. Sequence analysis of the erm(X) gene The nearly complete erm(X) open-reading frame (ORF) plus part of the flanking sequence was amplified from the Bifidobacterium strains using the primers ermX -237F and ermX 766R, which were based on conserved parts of known erm(X) sequences and their upstream regions including a putative leader peptide. A total of 763 bp of the antibiotic resistance gene sequence was obtained and it showed >98% DNA identity with other known erm(X) determinants [10–15]. In the literature, two variants of erm(X) have been described: an ORF with a length of 762 bp (encoding an Erm(X) protein of 253 amino acids) due to the deletion of a G resulting in a frame shift within codon 216; and a gene that is 855 bp long (encoding an Erm(X) protein of 284 amino acids) [11,13,14]. The erm(X) gene in the Bifidobacterium strains was most similar to the longest type. This was confirmed by additional sequence information obtained during investigation of the flanking regions of erm(X) (see below). In addition to erm(X), the Bifidobacterium strains investigated also possessed the tetracycline resistance gene tet(W) [4]. Since some of the known erm(X) genes are linked with a tetracycline resistance gene [10,14,15], PCR was used to determine whether this was also the case for erm(X) and tet(W). Four PCR tests using different primer combinations specific for erm(X) and tet(W) (Table 2) did not indicate that these genes are localised in close vicinity (results not shown). 3.3. Analysis of the surrounding regions of erm(X) The flanking regions of erm(X) were retrieved by inverse PCR [8], subsequently cloned and sequenced. Total DNA from the Bifidobacterium strains was digested in separate reactions with 10 restriction enzymes (see Section 2.3). The cut DNA was self-ligated and used as a template for inverse PCR with primers ermX 298R and ermX 436F (Table 2). For only four B. thermophilum strains (B0196, B0213, B0221 and B0222) an amplicon of ca. 1.5 kb was obtained when digesting the DNA with EcoRI. Sequence analysis of the PCR fragment of B0213 and B0221 revealed that the transposase gene tnp1249 was present upstream of the antibiotic resistance gene. This tnp1249 gene has also been identified flanking the erm(X) gene in several opportunistic pathogenic Corynebacterium spp., Arcanobacterium pyogenes and the cutaneous Propionibacterium acnes [10,12,14,15]. In these bacteria, the erm(X) was part of the transposon called Tn5432. To check whether the erm gene in the bifidobacteria was also located on a Tn5432-like transposon, several PCR primers were designed directed against the genes flanking erm(X), i.e. tnp1249 and tnpCX (Table 2). PCR analysis using various primer combinations confirmed erm(X) to be present on a Tn5432-like transposon in all seven Bifidobacterium strains investigated. The transposon was similar to the Tn5432 described in corynebacteria, arcanobacteria and propionibacteria [10,12,14,15], containing the genes tnp1249a, erm(X), tnpCX and tnp1249b (Fig. 1).
A.H.A.M. van Hoek et al. / International Journal of Antimicrobial Agents 31 (2008) 544–548
547
Fig. 1. Schematic representation of transposon Tn5432 [12]. The black lines with the strain numbers indicate the DNA parts that have been determined by (inverse) polymerase chain reaction (PCR) and sequence analysis. The dotted lines depict the PCR fragments for the detection of parts of the transposon generated with the following primer pairs: P1, tnp1249 31F and tnp1249 503R; P2, tnp1249 486F and tnp1249 1194R; P3, tnp1249 31F and tnp1249 1194R; P4, tnp1249 31F and ermX 298R; P5, tnpCX 1F and tnpCX 573R; P6, ermX 436F and tnpCX 573R; P7, tnpCX 1F and tnp1249 503R; P8, ermX 436F and tnp1249 1194R; and P9, tnp1249 486F and tnpCX 573R.
Inverse PCR [8] was also used to determine the exact location of the Tn5432 transposon in the bifidobacteria. Unfortunately, only a small part of the upstream region of Tn5432 was retrieved for B. thermophilum B0213, i.e. 332 bp. However, BLAST searches revealed that the first 66 bp obtained corresponded to the 3 end of a rplI gene, which encodes the 50S ribosomal protein L9 and has a chromosomal location in Bifidobacterium longum as well as Bifidobacterium adolescentis. The putative deduced protein sequence (only 21 amino acids) displayed 86% identity with the rplI gene of these two bifidobacteria. Primers were designed based on conserved parts of the bifidobacterial rplI gene, and PCR tests were performed to determine whether the other Bifidobacterium strains examined in this study have a similar insertion site (Table 2: rplI 87F and tnp1249 52R; rplI 165F and tnp1249 52R). Results demonstrated that the Tn5432 transposon appeared to be integrated near the rplI gene only in strain B0213. A close look at the publicly available bifidobacterial genomic sequences revealed that in B. longum the rplI gene is preceded by a tRNALys gene (approximately 200 bp in between). In contrast, in B. adolescentis the tRNA is located at a much further distance, i.e. >3500 bp. These tRNA sequences are known hotspots for integration of prophages and other insertion elements in bifidobacteria [16]. Conserved tRNALys primers were developed (Table 2) and, in combination with primer tnp1249 486F, PCR tests were performed to check whether a tRNALys was present in the vicinity of the Tn5432 transposon integration site in strain B0213. Unfortunately, PCR results were ambiguous (results not shown).
4. Conclusions In conclusion, this work reports the characterisation of the resistance gene erm(X) in different Bifidobacterium strains. The gene was nearly identical to erm(X) determinants present in several opportunistic pathogenic corynebacteria, arcanobacteria and propionibacteria. Furthermore, in the bifidobacteria investigated erm(X) was present on a Tn5432-like transposon, as in several of the above mentioned bacteria. According to European Union legislation, a transposonal location of an antibiotic resistance gene will exclude such strains from being used as probiotics [2,3].
Acknowledgments Franc¸oise Gavini and Matthias Upmann are gratefully acknowledged for providing the bifidobacterial strains isolated in the EU project ‘BIFID’ (CT-2000-00805). Funding: This research was supported by the European Commission under the 6th Framework Program (ACE-ART, project number: CT-2003-506214). Competing interests: None declared. Ethical approval: Not required.
References [1] Guarner F, Schaafsma GJ. Probiotics. Int J Food Microbiol 1998;39:237–8.
548
A.H.A.M. van Hoek et al. / International Journal of Antimicrobial Agents 31 (2008) 544–548
[2] FAO/WHO Working Group. Guidelines for the evaluation of probiotics in food. London, Ontario, Canada: Food and Agriculture Organization of the United Nations/World Health Organization; 2002. Available at: http://www.who.int/foodsafety/fs management/en/probiotic guidelines.pdf [accessed 15 February 2008]. [3] von Wright A. Regulating the safety of probiotics—the European approach. Curr Pharm Des 2005;11:17–23. [4] Mayrhofer S, Domig KJ, Amtmann E, van Hoek AHAM, Peterson A, Mair, et al. Antibiotic susceptibility of Bifidobacterium thermophilum and Bifidobacterium pseudolongum isolates from animal sources. J Food Prot 2007;70:119–24. [5] M¨att¨o J, van Hoek AHAM, Domig KJ, Saarela M, Florez AB, Brockmann E, et al. Susceptibility of human and probiotic Bifidobacterium spp. to selected antibiotics as determined by the Etest method. Int Dairy J 2007;17:1123–31. [6] Klare I, Konstabel C, M¨uller-Bertling S, Reissbrodt R, Huys G, Vancanneyt M, et al. Evaluation of new broth media for microdilution antibiotic susceptibility testing of lactobacilli, pediococci, lactococci, and bifidobacteria. Appl Environ Microbiol 2005;71:8982–6. [7] Masco L, Huys G, Gevers D, Verbrugghen L, Swings J. Identification of Bifidobacterium species using rep-PCR fingerprinting. Syst Appl Microbiol 2003;26:557–63. [8] Ochman H, Gerber AS, Hartl DL. Genetic applications of an inverse polymerase chain reaction. Genetics 1988;120:621–3. [9] Galtier N, Gouy M, Gautier C. SEAVIEW and PHYLO WIN: two graphic tools for sequence alignment and molecular phylogeny. Bioinformatics 1996;12:543–8.
[10] Jost BH, Field AC, Trinh HT, Songer JG, Billington SJ. Tylosin resistance in Arcanobacterium pyogenes is encoded by an Erm X determinant. Antimicrob Agents Chemother 2003;47:3519–24. [11] Rosato AE, Lee BS, Nash KA. Inducible macrolide resistance in Corynebacterium jeikeium. Antimicrob Agents Chemother 2001;45:1982–9. [12] Ross JI, Eady EA, Carnegie E, Cove JH. Detection of transposon Tn5432-mediated macrolide–lincosamide–streptogramin B (MLSB ) resistance in cutaneous propionibacteria from six European cities. J Antimicrob Chemother 2002;49:165–8. [13] Tauch A, Bischoff N, Brune I, Kalinowski J. Insights into the genetic organization of the Corynebacterium diphtheriae erythromycin resistance plasmid pNG2 deduced from its complete nucleotide sequence. Plasmid 2003;49:63–74. [14] Tauch A, Kassing F, Kalinowski J, P¨uhler A. The Corynebacterium xerosis composite transposon Tn5432 consists of two identical insertion sequences, designated IS1249, flanking the erythromycin resistance gene ermCX. Plasmid 1995;34:119–31. [15] Tauch A, Krieft S, Kalinowski J, P¨uhler A. The 51,409-bp R-plasmid pTP10 from the multiresistant clinical isolate Corynebacterium striatum M82B is composed of DNA segments initially identified in soil bacteria and in plant, animal, and human pathogens. Mol Gen Genet 2000;263:1–11. [16] Ventura M, Lee J-H, Canchaya C, Zink R, Leahy S, Moreno-Munoz JA, et al. Prophage-like elements in bifidobacteria: insights from genomics, transcription, integration, distribution, and phylogenetic analysis. Appl Environ Microbiol 2005;71:8692–705.