Respiratory syncytial virus nucleocapsid protein (N) expressed in insect cells forms nucleocapsid-like structures

Virus ELSEVIER

Virus Research 31 (1994) 187-201

Research

Respiratory syncytial virus nucleocapsid protein (N) expressed in insect cells forms nucleocapsid-like structures Claude M&ic

‘y*, DanZle

Spehner

2, VCronique

Mazarin

’

.%rums et Vaccim, 1541 Avenue Marcel M&ieux~69280 Marcy L ‘Etoile,France 2 ~~raio~re de Virologk_ Unite’IBSEN lJ74, 3 rue l&be&, ~~~0 Strasbourg, France

’ Pasteur M&w

(Received 7 July 1993; revision received and accepted 13 October 1993)

Abstract The gene coding for the N protein of RSV strain Long has been cloned and sequenced. It was introduced behind the polyhedrin promoter of the shuttle vector pVL941 and baculo~ruses containing the N gene were constructed by homologous r~ombination. Infection of ~~dopiera frugiperdu 9 cells resulted in the production of large amounts of a protein similar in size and antigenicity to the authentic N protein. The baculovirus expressed N protein was concentrated in the cytoplasm of the insect cells and could be extracted at low salt concentration. Nucleocapsid structures similar to those purified from RSV-infected cells could be observed by electron microscopy after negative staining of cellular extracts. Key words: Respiratory Expression

syncytial virus; Baculovirus;

Nucleoprotein;

Electron

microscopy;

1. Introduction Respiratory syncytial virus is a widespread Pneumovirus which is the cause of a severe respiratory tract disease in infants and young children (Stott and Taylor,

1985). Early clinical trials in the mid-1960s with a vaccine constituted by formaldehyde-inactivated virus failed to demonstrate protection and led to an enhancement of the disease in many RSV-infected vaccinees (Stott and TayIor, 1985). A large amount of work has been done since then to develop live-attenuated and subunit vaccines but none is yet available. The two major viral glycoproteins, G and F, appear to be the only polypeptides

* ~~esponding

author. Fax: ( + 33) 78 87 36 39.

0168-1702/94/$07.~ 0 1994 Elsevier Science B.V. AI1 rights reserved SSM 0168-1702(93)E0086-D

188

C. M&ic et al. / Virus Research 31 (1994) 187-201

responsible for the induction of neutralizing antibodies. In contrast to F, only a small proportion of G monoclonal antibodies neutralizes RSV (McIntosh and Chanock, 19901. F is also a major target for cytotoxic T-lymphocytes. When injected into mice or cotton rats, both proteins independently fully protect the animals against RSV challenge (McIntosh and Chanock, 1990). Besides surface glycoproteins, the role of internal viral proteins and especially nucleocapsid proteins (N) in cellular immunity as target antigens for cytotoxic T-lymphocytes has been emphasized for various negative strand RNA viruses such as influenza virus (Yewdell et al., 19851, respiratory syncytial virus (Bangham et al., 1986) and rabies virus (Ertl et al., 1989). These proteins are generally highly conserved among various serotypes and can therefore be expected to broaden the range of immunity. It is thus of interest to evaluate the role of internal proteins in the protection against RSV. A recombinant vaccinia virus expressing the RSV N protein has been tested by King et al. to evaluate its role in protection against RSV infection in the mouse model. The results indicate that vaccinia N is able to elicit a significant but only partial protective immune response (King et al., 1987). A recent study has shown that the resistance to RSV induced by the N and the 22K proteins peaked early after infection and then decreased, an observation consistent with a MHC class I-restricted CTL response (Connors et al., 1991). In order to investigate in animal models the possible applications of the N protein as a constituent of a vaccine against RSV, we decided to produce it in large quantities by genetic engineering. We have therefore cloned and sequenced the N gene of the Long strain of RSV and we have expressed it using a baculovirus vector system. The recombinant N protein produced in insect cells was characterized immunologically and biochemically with respect to solubility, cellular location and assembly of nucleocapsid-like structures.

2. Materials

and methods

2.1. Mruses and ceils Autographa califomica nuclear polyhedrosis virus (AcNPV) and Spodoptera frugberda 9 insect cells (Sf9) were obtained from Dr. M.D. Summers. AcNPV and

recombinant virus stocks were grown and assayed in TNM-FH medium containing 10% (v/v) fetal calf serum according to the procedures described by Summers and Smith (1987). Respiratory syncytial virus, strain Long, was obtained from the ATCC and was used to prepare a master seed stock and a working seed stock. 2.2. Antibodies

Hybridoma supernatants and monoclonal antibodies directed against RSV N protein from the Long strain were provided by J.-M. Chapsal from Pasteur Merieux S&rum et Vaccins. Their specificity for RSV N was determined by Western blotting analysis and radioimmunoprecipitation assays of protein extracts

C. M&ic et al. / Mrus Research 31 (1994) 187-201

189

obtained from HEp-2 cells infected by RSV. The polyclonal antibody 50-4-S9 was prepared in rabbits with immunopurified RSV N protein. 2.3. cDNA cloning and sequencing N-specific cDNA was amplified by polymerase chain reaction (PCR) starting from polyadenylated mRNA extracted from RSV-infected HEp-2 cells. The sequences of the synthetic primers used were deduced from the published nucleotide sequence of the N gene of RSV strain A2 (Collins et al., 1985). The primers were 5’BN (S’GGGGATCCCCATGGCTCTTAGCAAAGTCAAGTTGAATGATAC 3’), which corresponds to the 5’ end of the gene combined with additional BamHI and NcoI restriction sites and 3’HE (S’GAAGCTTGAATTCTTITITATTAACTCAAAGCTCTACATCATTATC 3’1, which corresponds to the 3’ end of the gene combined with additional Hind111 and EcoRI restriction sites. The NcoI restriction site contained in the 5’ primer corresponds to the coding start site of the N gene. The amplified product was cloned into plasmid pSK(-) (Stratagene, Paris, France) and subcloned into the phage M13. Sequence analysis was performed by the dideoxy chain termination sequencing technique on sequentially deleted clones. The sequences were compiled using the BISANCE programs (Dessen et al., 1990). 2.4. Transfection and selection of recombinant virus AcNPV The recombinant transfer vector, pVL941NP-16 was introduced with AcNPV DNA into S. fmgiperda cells in the presence of Lipofectin (Gibco-BRL, Cergy Pontoise, France). Recombinant viruses were plaque-purified three times and clone #211 was further characterized. 2.5. Protein analysis

To express the N protein, S. frugiperda cells were grown in suspension and infected as described (Summers and Smith, 1987). The proteins of S. frugiperda cells were separated by polyacrylamide gel electrophoresis in the presence of SDS and stained with Coomassie blue R250. 2.6. Immunoblotting analysis

Proteins were separated by polyacrylamide gel electrophoresis in the presence of SDS and were electro-transfered to nitrocellulose following standard techniques. Five percent (v/v> foal serum in PBS was used as a blocking agent and anti-RSV N monoclonal antibody 6OA53 and a peroxydase-conjugated goat antimouse immunoglobulin were used to reveal the proteins. 2.7. Protein labelling and immunoprecipitation of [3sS]methionine-labelled proteins To label the proteins expressed during the late phase of baculovirus replication, Sf9 cells infected with AcNPV-RSV N were incubated in methionine-free Grace

190

C. M&ic et al. / Virus Research 31 (1994) 187-201

medium for 1 h and labelled during 5 h with 200 PCi of [35S] methionine in 5 ml of methionine-free Grace medium. The cells were harvested, washed three times with Grace medium and stored at - 20°C. [35S] methionine-labelled cells infected with AcNPV-RSV N (see above) were lysed with 1% DOC, 1% NP40 in PBS (RIPA buffer). Cell debris were removed by centrifugation and aliquots of 50 ~1 of supernatant were mixed with 5 mg of protein A Sepharose and 250 ~1 of hybridoma supernatant in 500 ~1 of RIPA buffer. Immunoprecipitations were performed for 1 h at room temperature; immunocomplexes were washed three times with RIPA buffer and eluted from protein A Sepharose with Laemmli sample buffer before analysis by SDS-polyacrylamide gel electrophoresis. 2.8. Extraction of cytoplasmic RSV N protein Infected cells were harvested by low speed centrifugation, rinsed with phosphate-buffered saline (PBS, 137 mM NaCl, 2.7 mM KCl, 6.5 mM Na,HPO,, 1.5 mM KH,PO,) and stored at -70°C. The cell pellet was resuspended in TE (10 mM Tris-HCI, 1 mM EDTA, pH 8.0) at a density of 4.5 X lo6 cells per ml and kept on ice for 10 min. The cells were homogenized and the nuclei and large cell debris pelleted by centrifugation at 1500 X g for 10 min at 4°C. 2.9. Caesium chloride gradients A suspension of 50 ml HEp-2 cells infected with RSV (Long strain) for 72 h was taken up in 6 ml TE and immediately processed to purify the cytoplasmic fraction as described above. The fraction was deposited on a preformed discontinuous CsCl gradient (2 ml of 40% CsCl, 4 ml of 30% CsCl and 2 ml of 20% CsCl) and centrifuged to equilibrium for 18 h at 36,000 rpm in a Beckman SW41 rotor. The visible band appearing above the 40% CsCl was recovered, dialysed against TE and prepared for electron microscopy. 2.10. Negative staining

10 ~1 of each sample was deposited on a formwar-carbon-coated and glow-discharged nickel grid for 1 min and negatively stained with sodium phosphotungstate PTNa (pH 8.0) for 15 s. 2.11. Immunoelectron microscopy Fixation and embedding. Immunoelectron microscopy was performed using the method of Ryter and al. (Whitehouse et al., 1977). Infected cells were fixed with 2.5% paraformaldehyde, 0.1% glutaraldehyde diluted in 0.1 M cacodylate buffer [pH 7.21 2% sucrose, for 1 h at room temperature. The cells were then recovered from the flasks’ by scraping, pelleted and washed twice in cacodylate buffer. Samples were concentrated in 2% agar (Whitehouse et al., 1977) and washed overnight at 4°C in cacodylate buffer. The following day the samples were stained

C. Mtkic et al. / Krus Research 31 (1994) 187-201

191

for 30 min on ice with 2% uranyl acetate diluted in Mickaelis buffer. Dehydration and Lowicryl K4M embedding were carried out as previously described (Whitehouse et al., 1984). Zmmunogold labelling. Lowicryl thin sections were collected on Formwar carbon coated nickel grids and blocked by floating on PBS containing 1% normal goat serum (NGS) for 1 h at room temperature. Grids were incubated overnight with a polyclonal antibody specific for RSV N (50-4-~9) diluted 1 to 2000 in PBS containing 1% NGS. The following day they were washed three times in PBS 1% NGS and further incubated for 3 h with colldidal gold coupled anti mouse antibodies diluted l/20 in PBS 1% NGS. After two washes with PBS, 0.5% NGS and two with PBS, the grids were postfixed with 2.5% glutaraldehyde diluted in PBS. They were then washed twice with water before staining with 1.8% uranyl acetate-0.2% methylcellulose (Roth et al., 1990). Observations were carried out in a Philips EM 410 electron microscope at 80 kV.

3. Results 3.1. Cloning and sequencing of the N gene of the Long strain of RSV

Sequencing of cDNA clones obtained as described in Materials and Methods showed that the N open reading frame from the RSV Long strain is 1176

Table 1 Divergences between the nucleotide sequences of the N genes of the RSV A2 and Long strains Position at the nucleotide sequence * 75

225 284 321 333 471 522 528 540 627 711 783 787 903 975 1117

Identity of the divergent nucleotides

Change in amino acid

A2

Long

C G T T A C T A C C T G T T C C

T T c C G T C G T T C A C A T T

_ Val to Ala _ _ _ _ _ _

* Positions according to the nucleotide sequence published previously for the A2 strain (Collins et al., 1985).

192

C. M&ic et al. / virus Research 31 (1994) 187-201

nucleotides long and encodes a polypeptide of 391 amino acids with a calculated molecular weight of 43,422 Daltons (data not shown). This value is in good agreement with the molecular weight of the N protein as determined by gel electrophoresis (Huang et al., 1985). The cloning and sequencing of the N gene was described previously for the A2 strain (Collins et al., 1985). Comparison of the sequencing data obtained for this strain with the data obtained for the Long strain revealed only 16 nucleotide substitutions and a single amino acid change, Val to Ala (Table 1). However, this difference between both strains was not found by others (Johnson and Collins, 1989) and in order to confirm this result, two cDNA clones derived independently from two separate amplification reactions were sequenced in that region; the same substitution was found in both cases, indicating that the mutation was not due to a random misincorporation by the Taq polymerase or a sequencing error. 3.2. Construction of a recombinant baculovirus expressing RSV N In order to subclone the N gene into the baculovirus transfer vector, a second site was introduced by site-directed mutagenesis (Kunkel, 1985) after the N gene stop codon. The cDNA was then cloned downstream from the polyhedrin promoter in the unique BamHI site of the transfer vector pVL941 (Luckow and Summers, 1989) and the construct was introduced into baculovirus.

BamHI

3.3. Expression of RSV N in S. frugiperda cells Total proteins from Sf9 cells either infected with wild type AcNPV or with putative recombinant viruses were analyzed by SDS-PAGE and Coomassie blue staining. All the recombinant candidates showed an additional band with an apparent molecular weight of approximately 42 kDa (Fig. lA, lane c). This protein was found neither in uninfected cells (Fig. lA, lane a) nor in cells infected by the wild type AcNPV (Fig. lA, lane b). Immunoblotting analysis with monoclonal antibody 6OA53, specific for RSV N, showed that the additional band was indeed RSV N (Fig. lB, lane c) and that it comigrated with N protein extracted from RSV-infected Vero cells (Fig. lB, compare lanes c and d). In insect cells, a few other bands also reacted with the monoclonal antibody specific for N. The most abundant one had an apparent molecular weight of 30 kDa and might correspond to prematurely terminated N protein or to a degradation product (Fig. 1B). Another additional band with an apparent molecular weight of 40 kD could be detected just below the main signal. The same signal was observed with N protein extracted from RSV-infected Vero cells (Fig. lB, compare lanes c and d). This minor polypeptide has been previously identified as a specific proteolytic cleavage fragment of N (Cash et al., 1979). The amount of N protein expressed was estimated after SDS-PAGE and Coomassie blue staining by comparison with a bovine serum albumin standard (data not shown). 2 X lo9 Sf9 cells grown in suspension produced approximately 20 mg of N protein.

C. M&c et al. / Mru.s Research 31 (1994) 187-201

193

3.4. Time course of expression and extraction of RSV N from the cells

To further study the expression of RSV N in insect cells, Sf9 cells infected with AcNPV-RSV N or AcNPV-pgal were harvested after 24, 48 and 72 h. The cells were washed with phosphate-buffered saline and stored at - 70°C prior to analysis. They were lyzed in a hypotonic buffer, homogenized and centrifuged for 10 min at 1500 X g. The pellet was kept aside and the supernatant was centrifuged at 13,000 g for 10 min. All fractions were analyzed by SDS-PAGE followed by Coomassie staining (Fig. 2). The results show that maximum expression was achieved at 48 h with little increase between 48 h and 72 h (Fig. 2, lanes d, g and j); The majority of the N protein was found in the supernatant, indicating that the protein was neither associated with insoluble material nor highly aggregated at low salt concentration

B

A a IllI 200

b

c

d

a

b

c

d

III1

kDa

46

AN

21.5

Fig. 1. Proteins synthesized by the recombinant baculoviruses. Spodoptera frugiperdu cells were either mock-infected, infected with wild type AcNPV or with AcNPV-RSV N. The cells were harvested 48 h after infection and were analyzed by SDS-PAGE followed either by Goomassie staining of the gel (A) or Western blotting using a monoclonal antibody specific for RSV N (6OA53), (B). A lysate of Vero cells infected by RSV was added as a control. Molecular weight markers were also included (Rainbow, Amersham). The positions of the N protein (N) and of a smaller N-related polypeptide (delta-N) are indicated. Lanes: a, mock-infected Sf9 cells; b, cells infected by wild type AcNPV; c, cells infected by AcNPV-RSV N; d, Vero cells infected by RSV.

194

abcdefghijki

97

Fig. 2. Time course of RSV N synthesis in Sf9 cells and solubility. Sf9 cells infected with AcNPV-@gal of AcNPV-RSV N were harvested 24, 48 and 72 h post-infection, lysed by hypotonic shock and were homogenized. The cell debris and nuclei were separated by centrifugation for 10 min at 1.500g and the supernatants were centrifuged further for 10 min at 13 000~ g to separate large aggregates. The fractions were analyzed by SDS-PAGE (10% acryiamide) and Coomassie staining. The same proportion of each fraction (2.5%) was loaded onto the gel. The supernatants were obtained after 13 000X g centrifugation. Lanes: Rainbow molecular weight markers (Amersham); a, AcNPV-@gal, supernatant; b, AcNPV-@gal, 13 000X g peliet; c, AcNPV-fJgal, 1500X g pellet; d, 24 h AcNPV-RSV N, supernatant; e, 24 h AcNPV-RSV N, 13 000X g pellet; f, 24 h AcNPV-RSV N, 1500X g pellet; g, 48 h AcNPV-RSV N, supernatant; h, 48 h AcNPV-RSV N, 13 000x g pellet; i, 48 h AcNPV-RSV N, 1500x g pellet; j, 72 h AcNPV-RSV N, supernatant; k, 72 h AcNPV-RSV N, 13 000X g pellet; 1, 72 h AcNPV-RSV N, 1500X g pellet.

(Fig. 2, compare lanes g, h and 9. Compared to P-galactosidase expression, a larger amount of insoluble material was obtained in the case of RSV N (Fig. 2, compare lane a, b, c and g, h, i), This observation suggests that under our culture and extraction conditions, a small fraction of the N protein expressed in insect cells might exist as aggregates. When high-densi~ infected cell suspensions were lyzed by sonication, RSV N was reproducibly found insoluble at low salt concentration but was extracted from the pellet in 0.3 M NaCl (data not shown). Thus the conditions of extraction can affect the apparent solubility of RSV N, albeit not dramaticatly. 3.5. Cellular location and assembly of RSV nucleocapsid-like structures in infected insect cells

To more preciseIy localize the nucleoprotein intracellularly, immunogold label&g followed by electron microscopic examination was performed on celIs

C. M&c et al. /Virus Research 31 (1994) 187-201

19.5

Fig. 3. Observation by transmission electron microscopy of thin sections of Sf9 cells infected with (A) AcNPV-RSV N or (B) AcNPV-pgal after immunogold labelling of RSV N. Cells were infected either with AcNPV-RSV N or with AcNPV-pgal for 48 h, fixed, dehydrated and embedded in Lowicryl K4M resin. Lowicryl thin sections were treated for immunogold labelling with a polyclonal antibody specific for RSV N and an anti-mouse conjugated colldidal gold. A: portion of a cell infected with the virus expressing N. The gold particles are highly concentrated in the cytoplasm (arrows) while sparse background labelling can be observed in the cell nucleus (Nu) and on an enveloped baculovirus particle (V). B: portion of a cell infected with AcNPV-pgal. Only sparse background labelling can be observed in the cytoplasm and in the nucleus.

196

C. Mkn’c et al. / Virus Research 31 (1994) 187-201

C. Mbit

et al. / Virus Research 31 (1994) 187-201

197

infected either with N-recombinant virus or the p-galactosidase recombinant control virus. The labelling was carried out on ultrathin cell sections using an anti-N mouse polyclonal antibody and anti-mouse conjugated colldidal gold. The 5-nm gold particles were highly concentrated in the cytoplasm of cells infected with the recombinant encoding N and often appeared aligned on dense structures which could correspond to nucleocapsids assembled from the N protein (Fig. 3A). The resolution after embedding in a resin such as Lowicryl is not as sharp as in epon but this procedure conserves the antigenic sites. In the nucleus, sparse background could be noted as well as enveloped baculovirus particles (left part of Fig. 3A). The labelling observed in the control infected cells was also very weak and was located either in the cytoplasm or in the nucleus (Fig. 3B). Clearer proof that the cytoplasmic structures displayed the characteristic features of RSV-like nucleocapsids was obtained by negative staining of crude cytoplasmic fractions from recombinant virus-infected cells (Fig. 4A and B) or, as a control, from CsCl purified RSV nucleocapsids (Fig. 40 Nucleocapsids derived from the recombinant N protein could be observed under the microscope at 48 (Fig. 4A) or 72 (Fig. 4B) h post-infection and appeared as flexible rods, 15 nm in diameter, comparable to the RSV nucleocapsids. At a late stage of infection, baculovirus particles migrate into the cytoplasm. Chains of subunits within the vicinity of the baculovirus particles could be clearly distinguished by their smaller size from the discs which constitute the RSV nucleocapsids. 3.4. Reactivity of monoclonal antibodies specific for viral N protein against the N protein synthesized in the baculovirus system Antigenic reactivity of the N protein synthesized in insect cells was tested by radioimmunoprecipitation with monoclonal antibodies or supernatants from uncloned hybridomas. The results presented in Table 2 showed that the N protein produced in Sf9 cells was recognized by all antibodies tested. All these sera immunoprecipitated the 42 kDa protein but the additional bands mentioned above (principally the 30 kDa protein, see Fig. lB, lane c) were not recognized by three of them which have been previously characterized as recognizing conformational epitopes according to the results obtained by Western blot analysis performed under native or denaturing conditions (J.-M. Chapsal, personal communication). t Fig. 4. Electron microscopy of negatively stained nucleocapsids from Sf9 cells infected with AcNPV-RSV N (A and B) or HEp-2 cells infected with RSV (0. AcNPV-RSV N infected cells were harvested 48 and 72 h post-infection, washed, resuspended in TE buffer and lysed with a dounce homogeniser. The nuclei were removed by centrifugation and 10 ~1 of each cytoplasmic fraction were negatively stained with PTNa for electron microscopic observations. The cytoplasmic fraction from RSV-infected cells (48 h post-infection) was purified on a discontinuous CsCl gradient to separate nucleocapsids according to their density. 10 ~1 of the visible band was stained with PTNa and observed under the electron microscope. A and B: crude extracts from 39 cells infected with AcNP-RSV N 48 (A) or 72 (B) h post-infection. Nucleocapsids (filled arrows) and discs (open arrows) are visible in the cytoplasmic extracts at an early stage (A) as well as a day later (B) when baculovirus particles (V) can be observed. C: Control nucleocapsid purified from RSV-infected HEp-2 cells.

C. M&ic et al. /Virus Research 31 (1994) 187-201

198 Table 2 Antigenic analysis N with monoclonal

of the N protein expressed in insect cells; reactivity antibodies specific for RSV-N Monoclonal

Band detected: 42 kDa Other band ’

antibodies

Hybridoma

of N protein

from AcNPV-RSV

supernatants

60AS3 L”

62192 L

96F83 ?

20B86 L

2OC4 ChL

2OE96

21C19 L

21F56 L

21G13 c

21134 c

21141 L

+ +

+ +

+ ?

+ +

+ _

+ +

+ +

+ +

+ _

+

+ +

” Probably recognizing a linear epitope (L) of the N protein expressed by RSV-infected cells. h Probably recognizing a conformational epitope (C) of the N protein expressed by RSV-infected cells. ’ Other band of lower molecular weight that reacted with Mab 60A53 upon Western blotting; see Fig. 2.

This result indicates that the 30-kDa polypeptide is either denatured or that the conformational epitope recognized by the antibodies which were tested are not located on that fragment or that the fragment contributes to conformational epitopes with the rest of N. The fact that all tested monoclonal antibodies were able to immunoprecipitate the 42-kDa protein is a good indication that the N protein synthesized in Sf9 cells displays the same immunological properties as the N protein produced in cells infected by RSV. 4. Discussion This paper describes the cloning, sequencing and expression in insect cells of the N gene of the RSV Long strain. Upon sequencing, one amino acid change was observed relative to the sequence published previously for the A2 (Collins et al., 1985) and Long strains (Johnson and Collins, 1989). This mutation is unlikely to be the result of a misincorporation by the Tuq DNA polymerase since it was observed in two independent amplification reactions. The conservative nature of the change, valine to alanine, suggests rather that it is an example of strain microheterogeneity. The estimated yield of RSV N expression in insect cells 48 h post-infection, approximately 20 mg of protein per 2 x lo9 cells, is similar to those published in the literature for other non-glycosylated viral antigens (PrChaud et al., 1990). We have demonstrated by cell fractionation, indirect immunofluorescence (data not shown) and immunoelectron microscopy that the baculovirus expressed N protein is concentrated in the cytoplasm. This is consistent with the natural location of the RSV N protein. Both cytoplasmic and nuclear localization have been described for the N protein of some paramyxoviruses (Huber et al., 1991; Oyanagi et al., 1971). The solubility of the protein at low salt concentration indicates that RSV N does not form inclusion bodies like influenza N expressed in insect cells (Rota et al., 1990) or VSV N expressed in COS cells (Sprague et al., 1983). From this point of view, our RSV N appears similar to rabies N produced in insect cells (Prehaud

C. MtGic et al. /Virus Research 31 (1994) 187-201

199

et al., 1990) and to measles N expressed in vaccinia virus (Spehner et al., 1991) or baculovirus (Fooks et al., 1993) infected cells. The salt-dependent solubility of RSV N which we observed in some experiments was probably due, at least in part, to high protein concentration during cell lysis. The results published by Samal et al. describing the expression in insect cells of bovine RSV N also suggest that a high intracellular concentration of the expressed protein and the extraction conditions can cause aspecific aggregation (Samal et al., 1993). Based on electrophoretic mobility, RSV N expressed in insect cells is indistinguishable from the protein produced in mammalian cells infected by RSV; differences are only visible at the level of minor N-related proteins of smaller size which are either prematurely terminated polypeptides or degradation fragments. Furthermore, our inability to detect any immunological difference between N protein extracted from RSV-infected mammalian cells and N protein produced in insect cells suggests that both have a similar conformation. We have also demonstrated that RSV N expressed in insect cells is able to assemble into nucleocapsid-like structures in the absence of other RSV proteins. In vivo assembly of nucleocapsid-like structures has already been described for other negative strand viruses like measles (Spehner et al., 1991; Fooks et al., 19931, whereas in vitro assembly has been observed after mixing influenza nucleoprotein with RNA (Kingsbury et al., 1987). One of the most interesting questions at this point concerns the role of RNA in the assembly of the nucleocapsid structures. Results obtained by Blumberg et al. (1983) with VSV N suggest that RNA could be necessary since purified VSV N protein was only able to form disks. However, if the assembly of the nucleocapsid in baculovirus-infected insect cells is RNA driven, it must be non-specific since no authentic RSV genomic RNA is present in the infected insect cells. Non-specific binding would also be compatible with the results of Masters and Banerjee (1988) who have shown that in cells infected by VSV, the nucleoprotein is either found associated with viral RNA or complexed with NS, the VSV equivalent of RSV P. It has been proposed that one of the functions of NS is to prevent N from binding non-specifically to RNA. Preliminary experiments indicate a tight association of [3H]uridine-labelled RNA with RSV N expressed in insect cells but the relationship between RNA binding and the observed nucleocapsid-like structures has not yet been investigated. Besides its value in the production of large amounts of RSV nucleoprotein for immunological studies and vaccine development, the system described here should be useful to study the structure-function relationship of the N protein, the role of RNA in the assembly of the nucleocapsid and more generally the interactions between all RSV proteins.

Acknowledgements

We thank Laurence Desmurger and Fleury Pizzetta for excellent technical assistance, Jean-Michel Chapsal and Fabienne Vaux-Peretz for stimulating discus-

200

C. M&c et al. /Virus Research 31 (1994) 187-201

sions and Bernard Meignier without whom the project would not have been possible. We also thank Robert Drillien, Marie-Paule Kieny, and Michel Klein for critical reading of the manuscript.

References Bangham, C.R.M., Openshaw, P.J.M., Ball, L.A., King, A.M.Q., Wertz, G.W. and Askonas, B.A. (1986) Human and murine cytotoxic T-cells specific to respiratory syncytial virus recognize the viral nucleoprotein N but not the major glycoprotein G expressed by Vaccinia virus recombinants. J. Immunol. 137, 3973-3977. Blumberg, B.M., Giorgi, C. and Kolakofsky, D. (1983) N protein of vesicular stomatitis virus selectively encapsidates leader RNA in vitro. Cell. 32, 559-567. Cash, P., Pringle, C.R. and Preston, C.M. (1979) The polypeptide of human respiratory syncytial virus: products of cell-free proteins synthesis and post-translational modifications. Virology 92, 375-384. Collins, P.L., Anderson, K., Langer, S.J. and Wertz, G.W. (198.5) Correct sequence for the major nucleocapsid protein mRNA of respiratory syncytial virus. Virology 146, 69-77. Connors, M., Collins, P.L., Firestone, C.-Y. and Murphy, B.R. (1991) Respiratory syncytial virus (RSV) F, G, M2 (22K), and N proteins each induce resistance to RSV challenge, but resistance induced by M2 and N proteins is relatively short-lived. J. Virol. 65, 1634-1637. Dessen, P., Fondrat, C., Valencien, C. and Mugnier, C. (1990) A French service for access to biomolecular sequence databases. Comp. Appl. in Biosci. 6, 355-356. Ertl, H., Dietzschold, B., Gore, B., Otvos, M., Larson, L., Wunner, J. and Koprowski, H. (1989) Induction of rabies virus specific T-helper cell by synthetic peptides that carry dominant T-helper cell epitopes of the viral ribonucleoprotein. J. Virol. 63, 2885-2892. Fooks, A.R., Stephenson, J.R., Warnes, A., Dowsett, A.B., Rima, B.K., and Wilkinson, G.W.G. (1993) Measles virus nucleocapsid protein expressed in insect cells assembles into nucleocapsid-like structures. J. General Virol. 74, 1439-1444. Huang, Y.T., Collins, P.L. and Wertz, G.W. (1985) Characterization of the ten proteins of human respiratory syncytial virus: identification of a fourth envelope-associated protein. Virus Res. 2, 157-173. Huber, M., Cattaneo, R., Spielhofer, P., Orvell, C., Norrby, E., Messerli, M., Perriard, J.C. and Billeter, M.A. (1991) Measles virus phosphoprotein retains the nucleocapsid protein in the cytoplasm. Virology 185, 299-308. Johnson, P.R. and Collins, P.L. (1989) The 1B (NS2) and N proteins of human respiratory syncytial virus (RSV) of antigenic subgroups A and B: sequence conservation and divergence within RSV genomic RNA. J. Gen. Virol. 70, 1539-1547. King, A.M.Q., Stott, E.J., Langer, S.J., Young, K.K.Y., Ball, L.A. and Wertz, G.W. (1987) Recombinant vaccinia virus carrying the N gene of human Respiratory Syncytial Virus: studies of gene expression in cell culture and immune response in mice. J. Virol. 61, 2885-2890. Kingsbury, D.W., Jones, I.M. and Murti, K.G. (1987) Assembly of influenza ribonucleoprotein in vitro using recombinant nucleoprotein. Virology 156, 396-403. Kunkel, T.A. (1985) Rapid and efficient site-specific mutagenesis without phenotypic selection. Proc. Natl. Acad. Sci. USA 82, 488-492. Luckow, V.A. and Summers, M.D. (1989) High level expression of nonfused foreign genes with Autographa californica nuclear polyhedrosis virus expression vectors. Virology 170, 31-39. Masters, P.S. and Banerjee, A.K. (1988) Complex formation with vesicular stomatitis virus phosphoprotein NS prevents binding of nucleocapsid protein N to nonspecific RNA. J. Virol. 62, 2658-2664. McIntosh, K. and Chanock, R.M. (1990) Respiratory syncytial virus. In B.N. Fields and D.N. Knipe (Eds.), Virology, New York, Raven Press, pp. 1045-1072. Oyanagi, S., Ter Meulen, V., Katz, M. and Koprowski, H. (1971) Comparison of subacute sclerosing panencephalitis and measles virus: an electron microscope study. J. Virol. 7, 176-182.

C. Nric

et al. / l’irus Research 31 (1994) 187-201

201

Prbhaud, C., Harris, R.D., Fulop, V., Koh, C.-L., Wong, J., Flamand, A. and Bishop, D.H.L. (19901 Expression, characterization, and purification of a phosphorylated Rabies nucleoprotein synthesized in insect cells by baculovirus vectors. Virology 178, 486-497. Rota, P.A., Black, R.A., De, B.K., Harmon, M.W. and Kendal, A.P. (19901 Expression of influenza A and B virus nucleoprotein antigens in baculovirus. J. Gen. Virol. 71, 1545-1554. Roth, J., Taatjes, D.J. and Tokuyasu, T. (1990) Contrasting of Lowicryl K4M thin sections. Histochemistry 95, 123-136. Samal, SK., Pastey, M.K., McPhillips, T.H. and Mohanty, S.B. (1993) Bovine respiratory syncytial virus nucleocapsid protein expressed in insect cells specifically interacts with the phosphoprotein and the M2 protein. Virology 193, 470-473. Spehner, D., Kirn, A. and Drillien, R. (1991) Assembly of nucleocapsidlike structures in animal cells infected with a vaccinia virus recombinant encoding the measles virus nucleoprotein. J. Virol. 65, 6296-300. Sprague, J., Condra, J.H., Arnheiter, H. and Lazzarini, R.A. (19831 Expression of a recombinant DNA gene coding for the vesicular stomatitis virus nucleocapsid protein. J. Virol. 45, 773-781. Stott, E.J. and Taylor, G. (1985) Respiratory syncytial virus: brief review. Arch. Virol. 84, l-52. Summers, M.D. and Smith, G.E. (1987). A manual of methods for baculovirus vectors and insect cell culture procedures. College Station, Texas: Texas Agricultural Experiment Station. Whitehouse, R.S., Benichou, J.C., Couture-Tosi, E., Schenkman, S. and Ryter, A. (1984) Immunolabelling of lambda receptor protein (lam Bl on thin sections of E. coli embedded in Lowicryl. Biol. Cell. 51, 389-394. Whitehouse, R.S., Benichou, J.C. and Ryter, A. (1977) Procedure for longitudinal orientation of rod shaped bacteria and the production of a high cell density of procaryotic and eucaryotic cells in thin sections for electron microscopy. Biol. Cell. 30, 155-158. Yewdell, J.W., Bennink, J.R., Smith, G.L. and Moss, B. (1985) Influenza A virus nucleoprotein is a major target antigen for cross-reactive anti-influenza A virus cytotoxicity T lymphocytes. Proc. Natl. Acad. Sci. USA 82, 1785-1789.