Responses of hemocyanin and energy metabolism to acute nitrite stress in juveniles of the shrimp Litopenaeus vannamei

Ecotoxicology and Environmental Safety 186 (2019) 109753

Contents lists available at ScienceDirect

Ecotoxicology and Environmental Safety journal homepage: www.elsevier.com/locate/ecoenv

Responses of hemocyanin and energy metabolism to acute nitrite stress in juveniles of the shrimp Litopenaeus vannamei

T

Z.S. Li, S. Ma, H.W. Shan∗, T. Wang, W. Xiao The Key Laboratory of Mariculture (Ocean University of China), Ministry of Education, Qingdao, 266003, China

A R T I C LE I N FO

A B S T R A C T

Keywords: Litopenaeus vannamei Nitrite stress Hemocyanin Tissue hypoxia Energy metabolism

Nitrite is a common toxic substance in culture systems of Litopenaeus vannamei, and the stress may disturb hemocyanin synthesis and energy metabolism and result in shrimp death. In the present study, nitrite at concentrations of 0 (control), 3.3 (46.2 NO2–N mg/L), 6.6 (92.4) and 9.9 mM (138.6) was used to evaluate the responses of hemocyanin level and energy metabolism in L. vannamei (5.80 ± 0.44 cm, 1.88 ± 0.38 g) for 96 h. The mortality rate at 96 h increased with nitrite concentration (50% at 9.9 mM, 40% at 6.6 mM, 30% at 3.3 mM, and 10% at 0 mM). In general, HIF-1α and hemocyanin mRNA expression in the nitrite stress groups was upregulated from 6 to 12 h and downregulated from 24 to 96 h. In the hemolymph, nitrite levels were significantly elevated in a dose-dependent manner, and exposure to nitrite stress significantly decreased the oxyhemocyanin content from 24 to 96 h. The glucose and lactate levels in the hemolymph in the nitrite stress groups were higher than those in the control group from 12 to 96 h. Compared with the control group, the shrimp in the nitrite stress groups exhibited decreased glycogen concentrations in the hepatopancreas. The triglyceride (TG) levels in the nitrite stress groups were all higher than those in the control group from 48 to 96 h. The hexokinase (HK) activity in the hepatopancreas and muscle increased in the nitrite stress groups from 48 to 96 h. In general, nitrite stress enhanced the activities of pyruvate kinase (PK), phosphofructokinase (PFK) and lactate dehydrogenase (LDH) in muscle from 24 to 96 h. In addition, nitrite stress decreased the activities of succinate dehydrogenase (SDH) and fatty acid synthase (FAS) from 24 to 96 h in the hepatopancreas and muscle. This study indicates that exposure to nitrite stress can enhance the accumulation of nitrite in the hemolymph and then reduce oxygenation and hemocyanin synthesis, leading to tissue hypoxia and thereby resulting in accelerated anaerobic metabolism and the inhibition of aerobic metabolism. The effects of nitrite stress on hemocyanin synthesis and energy metabolism may be one of the reasons for the mortality of L. vannamei in culture systems.

1. Introduction

promoting high nitrite concentrations (Pérez Farfante and Kensley, 1997; Lin and Chen, 2003). In such high-nitrite environments, nitrite accumulates in the hemolymph of shrimp (Chen and Chen, 1992; Jensen, 1996), which can perturb multiple physiological functions (e.g., respiratory activity, ion regulation, and immune function) (Liao et al., 2012; Cheng et al., 2013; de Campos et al., 2014; Ramírez-Rochin et al., 2017). When nitrite exposure is prolonged, histological effects can result (Fregoso-López et al., 2017, 2018) and result in high mortality. Therefore, for the sustainable development of L. vannamei culture, studies on the toxicity of nitrite and the underlying mechanisms are needed. Hemocyanin is a respiratory pigment that is present in the hemolymph of shrimp (Zhang et al., 2009). As a multifunctional protein, hemocyanin is involved in several physiological processes, including protein storage, immune defense, and ecdysone transport (Jaenicke et al., 1999; Adachi et al., 2005; Jiang et al., 2007).

Nitrite is widely present as a common toxic substance in aquatic systems and is not only a toxic intermediate produced during ammonia nitrification but also a product of denitrification of nitrate by bacteria during nitrogen cycling (Tomasso, 2012). Nitrite concentrations in coastal seawater are approximately 10–15 nM (0.14–0.21 NO2–N μg/L) (Kieber and Seaton, 1995); however, in middle- or late-stage cultures, the nitrite concentration can reach 1.43 mM (20 NO2–N mg/L) and seriously affect the health of farmed animals (Tacon et al., 2002). Litopenaeus vannamei is one of the most important aquaculture species in the world due its high adaptability to different salinities and high output rates (Liao and Chien, 2011). Intensive shrimp cultivation has rapidly developed, and the high stocking densities associated with this cultivation lead to the accumulation of residual bait feces,

∗

Corresponding author. E-mail addresses: [email protected] (Z.S. Li), [email protected] (H.W. Shan).

https://doi.org/10.1016/j.ecoenv.2019.109753 Received 1 March 2019; Received in revised form 21 May 2019; Accepted 1 October 2019 Available online 08 October 2019 0147-6513/ © 2019 Elsevier Inc. All rights reserved.

Ecotoxicology and Environmental Safety 186 (2019) 109753

Z.S. Li, et al.

was then diluted with seawater based on the group concentration. A pre-experimental test (static with renewal and no feeding) showed that the nitrite median lethal concentration (LC50) for shrimp was 9.9 mM (138.6 NO2–N mg/L) in 96 h. Because LC50 is typically used as a stress concentration to study the effects of toxic substances, four test solutions at nitrite concentrations of 0 (control), 3.3 (46.2 NO2–N mg/L), 6.6 (92.4) and 9.9 mM (138.6) were used in the present study. Each test solution was applied to three replicates of 30 shrimp to calculate cumulative mortality and to three replicates of 120 shrimp for sample collection. During exposure, the water in each test solution tank was renewed with water of the corresponding nitrite concentration every two days. From each treatment group, 12 shrimp were randomly sampled at each time point (i.e., after 0, 6, 12, 24, 48, and 96 h of exposure to nitrite (no feeding): six of these shrimp were used for biochemical analysis, and the other six were used for mRNA expression analysis. Hemolymph samples were drawn from the ventral sinus using 1-mL disposable syringes containing precooled (4 °C) anticoagulant (containing 0.45 mol/L NaCl, 0.01 mol/L KCl, 0.01 mol/L EDTA-Na2 (ethylenediaminetetraacetic acid disodium salt), and 0.01 mol/L HEPES (N-2-hydroxyethylpiperazine-N-2′-ethanesulfonic acid); pH of 7.45) at a ratio of 1:3 (hemolymph: anticoagulant). The mixture was centrifuged at 1531×g for 10 min at 4 °C, and the supernatant was collected and stored at −80 °C. Hepatopancreas and muscle tissue were placed in liquid nitrogen and stored at −80 °C until further analysis.

Hemocyanin is sensitive to external abiotic factors, such as pH, temperature and salinity (Boone and Schoffeniels, 1979; Whiteley et al., 1997). A previous study suggests that oxyhemocyanin, an oxygenated form of hemocyanin, is associated with nitrite stress (Chen and Cheng, 1995). Therefore, the regulatory mechanism of hemocyanin is important in the response of shrimp to nitrite stress. Aquatic animals are highly susceptible to environmental stimulants and adapt to the external environment via regulation of energy metabolism (Ciji et al., 2012; Jia et al., 2015; Xu et al., 2015; Shan et al., 2018). In crustaceans, energy metabolism under stress has been shown to be associated with environmental factors such as ammonia, temperature, dissolved oxygen and salinity (Racotta and HernándezHerrera, 2000; Dai et al., 2013; Dupont-Prinet et al., 2013; Chen et al., 2014). A study on the freshwater prawn Macrobrachium nipponense indicated that nitrite stress could elevate the activities of lactate dehydrogenase (LDH) and aspartate aminotransferase (Jiang et al., 2014). However, systematic studies on the energy metabolism of shrimp under nitrite stress remain scarce, and the response pattern of energy metabolism needs to be clarified. In view of the importance of hemocyanin and energy metabolism in the adaptation of crustaceans to the external environment, we speculate that nitrite stress may disturb hemocyanin synthesis and energy metabolism, resulting in shrimp death. In the present study, to determine the responses of hemocyanin and energy metabolism in L. vannamei to different concentrations of nitrite, we analyzed the changes in nitrite, oxyhemocyanin, glucose and lactate levels in the hemolymph; hypoxiainducible factor 1α (HIF-1α), hemocyanin mRNA, glycogen, triglyceride (TG), and total cholesterol (T-CHO) levels and fatty acid synthase (FAS) activity in the hepatopancreas; and hexokinase (HK), phosphofructokinase (PFK), pyruvate kinase (PK), succinate dehydrogenase (SDH) and LDH activities in the hepatopancreas and muscle of shrimp. The results will improve the understanding of the response of hemocyanin and energy metabolism to acute nitrite stress in shrimp.

2.3. mRNA expression analyses

L. vannamei shrimp (5.80 ± 0.44 cm, 1.88 ± 0.38 g) were obtained from a farm (salinity, 24‰) in Weihai City, Shandong Province, China, and exhibited normal body color and vitality. Before the experiment, the shrimp were placed in an indoor culture circulation system that was equipped with tanks (50 × 35 × 50 cm), a sand filter, a UV sterilizer, and a foam separator and maintained in aerated seawater (temperature, 24–25 °C; dissolved oxygen, ≥5 mg/L; pH, 8.1–8.2) to acclimate for 2 weeks. The salinity in the tanks was gradually increased to 30‰ in the first week and maintained at 30‰ thereafter. During the acclimation period, the shrimp were fed a commercial diet (crude protein: 44%) four times per day. Feeding was terminated 24 h before the experiment.

Total RNA was extracted from the hepatopancreas using the UNIQ10 Column TRIzol Kit (SK 1321). The RNA concentration and integrity were assessed using a DYY-6C-type steady current electrophoresis instrument (Beijing, Liuyi, China) and an H6-1 microelectrophoresis tank (Shanghai, China). For normalization, the samples were diluted to the same concentration with DEPC (diethylpyrocarbonate)-treated water. The reverse transcription reaction (Thermo Scientific™ EP 0733) to obtain cDNA was carried out according to the instructions for the kit. The primers designed for amplification and gene expression analysis using Primer Premier 5.0 and Oligo software are presented in Table 1. Real-time quantitative PCR (polymerase chain reaction) (qRT-PCR) was performed using a LightCycler 480 II (Roche) PCR machine. Amplification was performed in a reaction volume of 20 μL comprising the following components: 2 μL of cDNA template (diluted ten-fold), 10 μL of SYBR (Synergy Brands) Green qPCR master mix, 0.4 μL of primer F (forward) (10 μM), 0.4 μL of primer R (reverse) (10 μM) and 7.2 μL of ddH2O. The reaction program was as follows: 95 °C for 3 min, followed by 45 cycles at 95 °C for 3 s and at 60 °C for 30 s. The precision and accuracy of the specific amplification were confirmed by a melting curve (coefficient of variation < 5%). Relative gene expression levels were evaluated using the 2−ΔΔCT method (Livak and Schmittgen, 2001), and the standard was the control group at 0 h.

2.2. Nitrite exposure and sampling

2.4. Biochemical assays

The nitrite stock solution was prepared by dissolving NaNO2 in 1 L of distilled water to obtain a 714.3 mM (10 NO2–N g/L) solution, which

The levels of oxyhemocyanin in the hemolymph were measured according to a previously described method (Nickerson and Van Holde,

2. Materials and methods 2.1. Experimental shrimp

Table 1 Primers utilized for gene expression analyses by qRT-PCR. Genes

Sequence (5′-3′)

Amplicon size (bp)

Gen bank

Species

18s rRNA

F:CTACCCAAGAAGCAGCATCAG R:GAGTTGAACAGGAACAGAGAGATG F: ACTACGCCCAGATACCCATTT R: GGACTGTTGCCAATGCTGTTAT F: GCCTCATAAAGACAACAACGGA R: ATTCCGTGGACTTGCGTTC

143

AF463509.1

Litopenaeus vannamei

178

FJ807918.1

Litopenaeus vannamei

128

KY695246.1

Litopenaeus vannamei

HIF1-α Hemocyanin

2

Ecotoxicology and Environmental Safety 186 (2019) 109753

Z.S. Li, et al.

in the nitrite stress groups died from 84 h to 96 h of nitrite exposure. At the end of the nitrite stress period, the cumulative mortality rates were 50% in the 9.9 mM nitrite group, 40% in the 6.6 mM nitrite group, 30% in the 3.3 mM nitrite group, and 10% in the 0 mM nitrite group.

1971). The concentrations of lactate and nitrite in the hemolymph were measured using commercially available kits (Jiancheng Institute of Biotechnology, Nanjing, China). The hepatopancreas and muscle samples were weighed out to obtain 0.1–0.2-g samples, which were then homogenized with 9 times (w/v) as much physiological saline and centrifuged at 598×g for 10 min. The supernatant was collected for examination of biochemical indicators. The glycogen, TG, T-CHO, and protein levels and HK, PFK, PK, SDH, and LDH activities in the hepatopancreas and muscle were determined using commercial kits following the manufacturer's protocols. FAS activity in the hepatopancreas was determined using an ELISA kit (Cordino, Wuhan, China). All enzyme activities were expressed in grams per gram or milligram of protein.

3.2. Expression levels of HIF-1α and hemocyanin in the hepatopancreas during nitrite exposure The mRNA expression levels of HIF-1α and hemocyanin are shown in Fig. 2. In general, increased expression levels of HIF-1α relative the levels in the control group were observed in the nitrite stress groups from 6 to 12 h (Fig. 2A); 9.9 mM nitrite induced significant upregulation at 12 and 48 h relative to the expression in the control group (P < 0.05). Marked downregulation of HIF-1α gene expression was observed after exposure to 6.6 and 9.9 mM nitrite at 24 h and in all the nitrite stress groups at 96 h (P < 0.05). The expression of the hemocyanin gene was enhanced from 6 to 12 h of exposure to 6.6 and 9.9 mM nitrite but became progressively lower than that in the control group from 24 to 96 h (P < 0.05, Fig. 2B). Hemocyanin mRNA expression was significantly higher under 3.3 mM nitrite stress at 6 and 48 h than in the control but was significantly lower at 12, 24 and 96 h (P < 0.05).

2.5. Statistical analysis The data from the experiments were expressed as the means ± standard deviations (means ± SDs). The LC50 of shrimp was calculated by the linear interpolation between successive concentrations (Buccafusco et al., 1981). The differences in data from different groups at the same time point were analyzed by one-way ANOVA. The data were tested for normality of distribution (Shapiro-Wilk test) and homogeneity of variance (Levene's test) prior to analysis. The data that did not meet the normality and homoscedasticity thresholds were logtransformed and then analyzed by one-way ANOVA or using a nonparametric test (Kruskal-Wallis test). If significant differences were observed at the 0.05 level, Tukey's multiple comparison tests were used to determine the differences between means. P < 0.05 was considered statistically significant, and all statistical analyses were performed using SPSS 25.0 software.

3.3. Nitrite, oxyhemocyanin, glucose and lactate levels in the hemolymph during nitrite exposure The nitrite, oxyhemocyanin, glucose and lactate levels in the shrimp hemolymph are shown in Fig. 3. The nitrite concentrations in all the nitrite stress groups were significantly higher than those in the control from 6 to 96 h (P < 0.05, Fig. 3A) and were similar to the corresponding exposure nitrite concentrations. Relative to control treatment, exposure to 3.3 or 6.6 mM nitrite caused an increase in oxyhemocyanin level in hemolymph at 12 h (Fig. 3B), and a significant reduction was observed from 48 to 96 h (P < 0.05). However, the oxyhemocyanin levels in the group exposed to 9.9 mM nitrite decreased from 12 h onwards and were lower than those in control group from 12 h to 96 h. The glucose levels in the 3.3 and 6.6 mM nitrite groups were significantly higher than those in the control group from 24 to 48 h (P < 0.05, Fig. 3C). The glucose levels in the 9.9 mM nitrite group increased over time, becoming significantly higher than those in the control group between 48 and 96 h (P < 0.05). The lactate levels in the hemolymph showed a similar increase with increasing concentrations of nitrite in a time-dependent manner (Fig. 3D). Exposure to 6.6 and

3. Results 3.1. Cumulative mortality rate under nitrite exposure The cumulative mortality rates are shown in Fig. 1. Shrimp mortality in the group subjected to 9.9 mM nitrite for 96 h was significantly higher than that in the control group (P < 0.05). In addition, shrimp mortality in the groups subjected to 3.3 mM and 9.9 mM nitrite increased slowly during nitrite exposure from 0 h to 84 h, whereas shrimp mortality in the group subjected to 6.6 mM nitrite increased rapidly from 12 h to 24 h of exposure and then decreased, with almost no deaths occurring from 24 h to 84 h. However, large numbers of shrimp

Fig. 1. Changes in the cumulative mortality rate of L. vannamei in different groups during nitrite exposure. Means indicated with different letters are significantly different (P < 0.05) among treatments after 96 h. The values are expressed as the means ± SD. 3

Ecotoxicology and Environmental Safety 186 (2019) 109753

Z.S. Li, et al.

Fig. 2. Variations in the mRNA expression levels of hypoxia-inducible factor 1α (HIF-1α, A) and hemocyanin (B) in the hepatopancreas of shrimp in different groups. At each time point, means with different letters are significantly different (P < 0.05) among treatments. The values were normalized to control values at 0 h and are expressed as the means ± SD.

(P < 0.05, Fig. 5A and a). The PFK activity in the hepatopancreas under exposure to 6.6 or 9.9 mM nitrite at 12 or 96 h was significantly higher than that in the control group (P < 0.05, Fig. 5B), but there were no significant differences in muscle PFK activity between any of the nitrite stress groups and the control group (P > 0.05, Fig. 5b). PK activity in the hepatopancreas under exposure to 6.6 or 9.9 mM nitrite first increased, reaching a peak at 12 h, and then decreased until the end of nitrite exposure (Fig. 5C), whereas PK activity in muscle under exposure to 6.6 or 9.9 mM show the opposite trend (Fig. 5c). The SDH and LDH activities in the shrimp hepatopancreas and muscle and the FAS activity in the shrimp hepatopancreas are shown in Fig. 6. Compared with the control group, the SDH activity in the nitrite stress groups decreased significantly in the hepatopancreas and muscle from 24 to 96 h (P < 0.05, Fig. 6A and a), and shrimp exposed to 3.3 mM nitrite showed higher SDH activity in the muscle than those in other groups from 6 to 12 h. Under a nitrite concentration of 9.9 mM, at 12 and 96 h, the LDH activities in hepatopancreas were significantly higher than those in the control group (P < 0.05, Fig. 6B). However, the LDH activities in muscle under nitrite exposure increased gradually over time, becoming higher than those in the control group (Fig. 6b). Hepatopancreas FAS activity was lower in each of the nitrite groups than in the control group and was significant lower from 24 to 96 h (P < 0.05, Fig. 6C).

9.9 mM nitrite caused marked improvement in lactate levels, which were significantly higher than those in the control group from 12 to 96 h (P < 0.05). 3.4. Glycogen, TG and T-CHO levels in the hepatopancreas during nitrite exposure The glycogen, TG and T-CHO levels in the shrimp hepatopancreas are shown in Fig. 4. With the prolongation of stress time, the glycogen levels in nitrite stress groups showed marked downward trends, with stronger declines observed at higher nitrite concentrations (Fig. 4A). The TG and T-CHO levels in all the groups showed a decreasing trend after nitrite exposure (Fig. 4B and C). However, relative to control treatment, exposure to 6.6 or 9.9 mM nitrite caused a significant increase in TG level from 48 to 96 h (P < 0.05). There were no significant differences in T-CHO levels among the groups (P > 0.05). 3.5. Energy metabolism-related enzyme activities in the hepatopancreas and muscle during nitrite exposure The HK, PFK and PK activities in the shrimp hepatopancreas and muscle are shown in Fig. 5. Although HK activity in each of the nitrite stress groups was lower than that in the control from 0 to 12 h, under exposure to 9.9 mM nitrite, HK activity was significantly elevated in the hepatopancreas from 48 to 96 h and in the muscle from 24 to 48 h 4

Ecotoxicology and Environmental Safety 186 (2019) 109753

Z.S. Li, et al.

Fig. 3. Variations in nitrite (A), oxyhemocyanin (B), glucose (C) and lactate (D) levels in the hemolymph of shrimp in different groups. At each time point, means with different letters are significantly different (P < 0.05) among treatments. The values are expressed as the means ± SD.

5

Ecotoxicology and Environmental Safety 186 (2019) 109753

Z.S. Li, et al.

Fig. 4. Variations in glycogen (A), triglyceride (TG, B) and total cholesterol (T-CHO, C) levels in the hepatopancreas of shrimp in different groups. At each time point, means with different letters are significantly different (P < 0.05) among treatments. The values are expressed as the means ± SD.

4. Discussion

were observed in the hemolymph of L. vannamei exposed to nitrite. Additionally, the levels of biochemical substances and the activities of enzymes involved in energy metabolism were influenced by nitrite stress. These results increase our understanding of the responses of hemocyanin and energy metabolism to acute nitrite stress in L. vannamei.

Nitrite is generally toxic to aquatic animals such as shrimp and may even cause moderate or severe mortality (Tomasso, 2012). In the present study, high nitrite concentrations caused the mass mortality of L. vannamei juveniles. Nitrite accumulation and fluctuations in oxyhemocyanin level and mRNA expression level of hemocyanin and HIF-1α 6

Ecotoxicology and Environmental Safety 186 (2019) 109753

Z.S. Li, et al.

Fig. 5. Variations in hexokinase (HK, A), phosphofructokinase (PFK, B), and pyruvate kinase (PK, C) activities in the hepatopancreas and HK (a), PFK (b), and PK (c) activities in the muscle of shrimp in different groups. At each time point, means with different letters are significantly different (P < 0.05) among treatments. The values are expressed as the means ± SD.

shrimp at salinity levels of 15, 25 and 35‰ was 5.46 (76.44 NO2–N mg/L), 12.74 (178.36), and 22.98 mM (321.72), respectively (Lin and Chen, 2003). Another study on Litopenaeus schmitti (15 ± 0.4 cm) showed that the 96-h LC50 at a salinity level of 35‰ was 2.78 mM (38.92 NO2–N mg/L) (Barbieri et al., 2016). In addition, Wang et al. (2006) and Ramírez-Rochin et al. (2017) found that in L. vannamei (using individuals of 0.06 g and 4.4 g) at salinities of 3.0 and 1.0‰, the LC50 was 3.57 (49.98) and 0.5 mM (7.00 NO2–N mg/L), respectively.

4.1. Effects of nitrite exposure on 96 h LC50 and the cumulative mortality rate In the present study, at 30‰ salinity, the 96-h LC50 value of nitrite for L. vannamei juveniles was 9.9 mM, and the significant increase in shrimp mortality with increasing nitrite concentration indicated a positive correlation between mortality and nitrite stress level. A previous study on L. vannamei (5.6 ± 0.96 cm) showed that the 96-h LC50 of 7

Ecotoxicology and Environmental Safety 186 (2019) 109753

Z.S. Li, et al.

Fig. 5. (continued)

These results suggest that differences in nitrite LC50 values are associated with differences in the size, species, salinity, variety and other characteristics of shrimp.

stress levels. A previous study on Penaeus monodon found that nitrite could pass through the gills and be enriched in the hemolymph; shrimp exposed to 1.43 mM nitrite (20.00 NO2–N mg/L) exhibited accumulation of up to 1.79 mM (25.06 NO2–N mg/L) nitrite in the hemolymph (Chen and Chen, 1992). Our results also showed that the nitrite level in the hemolymph was approximately equal to the external level. In a fish (the shortnose sturgeon), nitrite concentrations in the blood plasma may be more than 60 times higher than the experimental nitrite

4.2. Effects of nitrite exposure on nitrite accumulation and hemocyanin In the present study, nitrite levels in the hemolymph were higher under nitrite exposure than in the control group and were affected by 8

Ecotoxicology and Environmental Safety 186 (2019) 109753

Z.S. Li, et al.

Fig. 6. Variations in succinate dehydrogenase (SDH, A), lactate dehydrogenase (LDH, B), and fatty acid synthase (FAS, C) activities in the hepatopancreas and SDH (a) and LDH (b) activities in the muscle of shrimp in different groups. At each time point, means with different letters are significantly different (P < 0.05) among treatments. The values are expressed as the means ± SD.

carrier, and hemocyanin is sensitive to changes in environmental factors (Hong et al., 2009). These results suggested that nitrite could reduce the oxygenation of hemocyanin and eventually cause tissue hypoxia, which is also one of the major toxic effects of nitrite on shrimp. In addition, our present results corroborate the results of studies on Marsupenaeus japonicus in which a significant reduction in

concentrations (Fontenot et al., 1999). Differences among species may be due to different levels of nitrite accumulation in the blood because of diversity in gill Cl− absorption rates and relative affinities for nitrite. In general, a significant decrease in oxyhemocyanin concentration in the shrimp hemolymph over time was observed in each of the nitrite stress groups. Most crustaceans rely on hemocyanin as an oxygen

9

Ecotoxicology and Environmental Safety 186 (2019) 109753

Z.S. Li, et al.

Fig. 6. (continued)

4.3. Effects of nitrite exposure on the levels of energy metabolism-related biochemical substances

oxyhemocyanin level was observed under nitrite stress (Cheng and Chen, 2002; Cheng et al., 2013). Increases in oxyhemocyanin level under 3.3 and 6.6 mM nitrite were observed at 12 h. In addition, increases in HIF-1α and hemocyanin mRNA expression were observed in the 3.3 and 6.6 mM nitrite groups from 6 to 12 h. HIF-1α mediates the expression of some genes in the hypoxic environment and can be used as an indicator of tissue hypoxia (Pascual et al., 2006). Therefore, these findings indicated that hypoxic stress occurred when nitrite began to affect hemocyanin. The transient increase in oxyhemocyanin levels and upregulation of hemocyanin mRNA expression may be mechanisms of self-regulation. However, at a high nitrite concentration of 9.9 mM, the regulation of oxyhemocyanin may be accelerated or enhanced from 6 to 12 h, but this hypothesis requires further experimental verification. The significant decreases in hemocyanin mRNA expression in the 6.6 and 9.9 mM nitrite stress groups from 24 to 96 h suggested that nitrite not only reduced oxygenation but also inhibited hemocyanin synthesis. In contrast, there was no trend in hemocyanin mRNA expression in the 3.3 mM nitrite stress group, which may be associated with the low dose of nitrite used. However, studies of common hypoxia in Callinectes sapidus (Mangum, 1997) and Palaemonetes pugio (Brouwer et al., 2007) showed that hypoxia caused extensive expression of hemocyanin mRNA. Therefore, crustaceans may vary in their mechanisms to address nitrite stress and environmental anoxic stress and exhibit low adaptability to environmental nitrite exposure.

In the present study, exposure of L. vannamei to ambient nitrite caused a significant decrease in glycogen level in the hepatopancreas and an increase in glucose level in the hemolymph from 12 to 96 h. Glycogen is one of the parameters that reflects the carbohydrate reserve and energy status of an organism, which is considered to be an effective biomarker of stress (Ansaldo et al., 2006). Glucose levels can directly reflect the utilization of glycogen for carbohydrate metabolism in crustaceans (Xuan et al., 2011). The results indicated that carbohydrate metabolism plays an important role in the response of shrimp to nitrite stress, which is consistent with the effect of nitrite exposure in Eriocheir sinensis (Hong et al., 2009). Lactate is the final product of anaerobic metabolism and is produced by LDH-catalyzed conversion of pyruvate to lactate (Xuan et al., 2011). The elevated lactate levels in the present study demonstrate that nitrite increases the capacity for anaerobic metabolism. Based on a report on the effect of ammonia exposure on L. vannamei, the shrimp could meet the metabolic demand for lipids, and the TG and T-CHO levels can reflect the level of lipid metabolism (Racotta and Hernández-Herrera, 2000). In this study, decreased TG and T-CHO levels in the hepatopancreas were observed in all the shrimp during the experiment, and TG levels were higher in the stress groups than in the control from 48 to 96 h. Therefore, we inferred that due to interference by tissue hypoxia, the β-oxidation of lipids was inhibited, leading to the retardation of lipid mobilization. Additionally, because β-oxidation of lipids is one of the main ways of contributing to the energy supply, nitrite stress disturbed the normal energy supply in L. vannamei. 10

Ecotoxicology and Environmental Safety 186 (2019) 109753

Z.S. Li, et al.

References

4.4. 4.4 Effects of nitrite exposure on the activities of energy metabolismrelated enzymes

Adachi, K., Wakamatsu, K., Ito, S., Miyamoto, N., Kokubo, T., Nishioka, T., Hirata, T., 2005. An oxygen transporter hemocyanin can act on the late pathway of melanin synthesis. Pigment Cell Res. 18, 214–219. Adinarayana, D., Kishore, S., 2014. Alterations in the carbohydrate metabolism during deltamethrin induced toxicity in ciprinus carpio. Int. J. Pharm. Life Sci. 5, 3311–3317. Ansaldo, M., Nahabedian, D.E., Holmes-Brown, E., Agote, M., Ansay, C.V., Guerrero, N.R.V., Wider, E.A., 2006. Potential use of glycogen level as biomarker of chemical stress in Biomphalaria glabrata. Toxicology 224, 119–127. Bao, J., Li, X., Yu, H., Jiang, H., 2018. Respiratory metabolism responses of Chinese mitten crab, Eriocheir sinensis and Chinese grass shrimp, Palaemonetes sinensis, subjected to environmental hypoxia stress. Front. Physiol. 9, 1559. Barbieri, E., Bondioli, A.C.V., de Melo, C.B., Henriques, M.B., 2016. Nitrite toxicity to Litopenaeus schmitti (Burkenroad, 1936, Crustacea) at different salinity levels. Aquacult. Res. 47, 1260–1268. Boone, W.R., Schoffeniels, E., 1979. Hemocyanin synthesis during hypo-osmotic stress in the shore crab Carcinus maenas (L.). Comp. Biochem. Physiol. Part B: Comp. Biochem. 63, 207–214. Brouwer, M., Brown-Peterson, N.J., Larkin, P., Patel, V., Denslow, N., Manning, S., Brouwer, T.H., 2007. Molecular and whole animal responses of grass shrimp, Palaemonetes pugio, exposed to chronic hypoxia. J. Exp. Mar. Biol. Ecol. 341, 16–31. Buccafusco, R.J., Ells, S.J., LeBlanc, G.A., 1981. Acute toxicity of priority pollutants to bluegill (Lepomis macrochirus). Bull. Environ. Contam. Toxicol. 26, 446–452. Chen, J.C., Chen, S.F., 1992. Accumulation of nitrite in the haemolymph of Penaeus monodon exposed to ambient nitrite. Comp. Biochem. Physiol. C Comp. Pharmacol. 103, 477–481. Chen, J.C., Cheng, S.Y., 1995. Changes of oxyhemocyanin and protein levels in the hemolymph of Penaeus japonicus exposed to ambient nitrite. Aquat. Toxicol. 33, 215–226. Chen, K., Li, E., Gan, L., Wang, X., Xu, C., Lin, H., Qin, J.G., Chen, L., 2014. Growth and lipid metabolism of the pacific white shrimp Litopenaeus vannamei at different salinities. J. Shellfish Res. 33, 825–832. Cheng, S.Y., Chen, J.C., 2002. Study on the oxyhemocyanin, deoxyhemocyanin, oxygen affinity and acid–base balance of Marsupenaeus japonicus following exposure to combined elevated nitrite and nitrate. Aquat. Toxicol. 61, 181–193. Cheng, S.Y., Shieh, L.W., Chen, J.C., 2013. Changes in hemolymph oxyhemocyanin, acidbase balance, and electrolytes in Marsupenaeus japonicus under combined ammonia and nitrite stress. Aquat. Toxicol. 130, 132–138. Ciji, A., Sahu, N.P., Pal, A.K., Dasgupta, S., Akhtar, M.S., 2012. Alterations in serum electrolytes, antioxidative enzymes and haematological parameters of Labeo rohita on short-term exposure to sublethal dose of nitrite. Fish Physiol. Biochem. 38, 1355–1365. Dai, C., Wang, F., Fang, Z., Dong, S., 2013. Effects of temperature on energy metabolic enzymes of swimming crab (Portunus trituberculatus) in the post-molt stage. J. Fish. China 37, 1334–1341. Das, P.C., Ayyappan, S., Jena, J.K., Das, B.K., 2004. Nitrite toxicity in Cirrhinus mrigala (Ham.): acute toxicity and sub-lethal effect on selected haematological parameters. Aquaculture 235, 633–644. de Campos, B.R., Furtado, P.S., D'Incao, F., Poersch, L.H., Wasielesky Jr., W., 2014. The effect of ammonia, nitrite, and nitrate on the oxygen consumption of juvenile pink shrimp Farfantepenaeus brasiliensis (Latreille, 1817) (Crustacea: Decapoda). J. Appl. Aquac. 26, 94–101. Dupont-Prinet, A., Pillet, M., Chabot, D., Hansen, T., Tremblay, R., Audet, C., 2013. Northern shrimp (Pandalus borealis) oxygen consumption and metabolic enzyme activities are severely constrained by hypoxia in the Estuary and Gulf of St. Lawrence. J. Exp. Mar. Biol. Ecol. 448, 298–307. Fontenot, Q.C., Isely, J.J., Tomasso, J.R., 1999. Characterization and inhibition of nitrite uptake in shortnose sturgeon fingerlings. J. Aquat. Anim. Health 11, 76–80. Fregoso-López, M.G., Morales-Covarrubias, M.S., Franco-Nava, M.A., Ramírez-Rochín, J., Fierro-Sañudo, J.F., Ponce-Palafox, J.T., Páez-Osuna, F., 2017. Histological alterations in gills of shrimp Litopenaeus vannamei in low salinity waters under different stocking densities: potential relationship with the nitrogen compounds. Aquacult. Res. 48, 5854–5863. Fregoso-López, M.G., Morales-Covarrubias, M.S., Franco-Nava, M.A., Ponce-Palafox, J.T., Fierro-Sañudo, J.F., Ramírez-Rochin, J., Páez-Osuna, F., 2018. Effect of nitrogen compounds on shrimp Litopenaeus vannamei: histological alteration of the antennal gland. Bull. Environ. Contam. Toxicol. 100, 772–777. Gupta, V., Bamezai, R.N., 2010. Human pyruvate kinase M2: a multifunctional protein. Protein Sci. 19, 2031–2044. Havird, J.C., Vaught, R.C., Weeks, J.R., Fujita, Y., Hidaka, M., Santos, S.R., Henry, R.P., 2014. Taking their breath away: metabolic responses to low-oxygen levels in anchialine shrimps (Crustacea: Atyidae and Alpheidae). Comp. Biochem. Physiol. Mol. Integr. Physiol. 178, 109–120. Hong, M., Chen, L., Qin, J.G., Sun, X., Li, E., Gu, S., Yu, N., 2009. Acute tolerance and metabolic responses of Chinese mitten crab (Eriocheir sinensis) juveniles to ambient nitrite. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 149, 419–426. Jaenicke, E., Föll, R., Decker, H., 1999. Spider hemocyanin binds ecdysone and 20-OHecdysone. J. Biol. Chem. 274, 34267–34271. Jensen, F.B., 1996. Uptake, elimination and effects of nitrite and nitrate in freshwater crayfish (Astacus astacus). Aquat. Toxicol. 34, 95–104. Jia, R., Han, C., Lei, J.L., Liu, B.L., Huang, B., Huo, H.H., Yin, S.T., 2015. Effects of nitrite exposure on haematological parameters, oxidative stress and apoptosis in juvenile turbot (Scophthalmus maximus). Aquat. Toxicol. 169, 1–9. Jiang, N., Tan, N.S., Ho, B., Ding, J.L., 2007. Respiratory protein-generated reactive

Nitrite stress increased the HK and PFK activities in the hepatopancreas and muscle from 48 to 96 h and PK activity in the muscle to varying degrees. The glycolysis pathway is a crucial carbohydrate metabolic pathway (Romano and Conway, 1996). HK, PFK and PK are three key enzymes that restrict the first pivotal step of glycolysis and control the rate and direction of glucose metabolism (Robey and Hay, 2006; Gupta and Bamezai, 2010). Therefore, the increased activities of these three major enzymes indicated substantial enhancement of the glycolytic pathway under nitrite conditions, which is also a manifestation of accelerated carbohydrate metabolism. In the present study, SDH activity in each of the nitrite stress groups showed a downward trend and was lower than that in the control group. SDH activity can directly reflect the level of aerobic metabolism (Oyedotun and Lemire, 2004). Several studies have demonstrated that tissue hypoxia can affect normal respiratory metabolism, converting aerobiosis to anaerobiosis to provide increased energy for survival (Das et al., 2004; Hong et al., 2009). Here, the significant decreases in SDH activity indicated that nitrite can inhibit aerobic respiration, which is consistent with studies on M. nipponense (Sun et al., 2018) and Palaemonetes sinensis (Bao et al., 2018) subjected to environmental hypoxia stress. In contrast to SDH activity, LDH activity was higher in the nitrite groups than in the control group. LDH plays an important role in glycolysis and is a key enzyme in the anaerobic glycolytic pathway (Adinarayana and Kishore, 2014). In this study, the elevated LDH activity in the nitrite groups demonstrated that nitrite increases the capacity for anaerobic metabolism. In addition, the significant change in enzyme activity in the early stage indicated a rapid response of muscle to nitrite stress. Similarly, previous studies have shown that tissue hypoxia caused by environmental hypoxia or other factors could also accelerate anaerobic metabolism with increased accumulation of lactate (Maciel et al., 2008; Xuan et al., 2011; Havird et al., 2014; Bao et al., 2018). Significantly lower FAS activity in the hepatopancreas was observed in the nitrite stress groups than in the control group. The activity of FAS, as a multienzyme complex, can be used as an indicator of lipid metabolism in animals (Smith et al., 2003). Therefore, the present results indicated that the use of lipids in shrimp decreases upon exposure to nitrite, a finding consistent with the TG results. However, the specific underlying mechanism needs to be further explored. 5. Conclusion In this study, we studied the toxic effects of nitrite exposure on the muscle, hemolymph and hepatopancreas of L. vannamei. We demonstrated that exposure to high nitrite concentrations caused nitrite accumulation in hemolymph and subsequent tissue hypoxia in L. vannamei. The findings suggest that anaerobic metabolism is promoted and that aerobic metabolism is inhibited in L. vannamei subjected to nitrite stress. The resulting lack of energy supply for the stress response might be an important cause of shrimp death. Acknowledgements This work is supported by The Key Laboratory of Mariculture of Ministry of Education, Ocean University of China, No. KLM 2018010. The authors are grateful to the referees for their helpful comments on the manuscript. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.ecoenv.2019.109753. 11

Ecotoxicology and Environmental Safety 186 (2019) 109753

Z.S. Li, et al.

Ramírez-Rochin, J., Frías-Espericueta, M.G., Fierro-Sañudo, J.F., Alarcón-Silvas, S.G., Fregoso-López, M.G., Páez-Osuna, F., 2017. Acute toxicity of nitrite on white shrimp Litopenaeus vannamei (Boone) juveniles in low-salinity water. Aquacult. Res. 48, 2337–2343. Robey, R.B., Hay, N., 2006. Mitochondrial hexokinases, novel mediators of the antiapoptotic effects of growth factors and Akt. Oncogene 25, 4683–4696. Romano, A., Conway, T., 1996. Evolution of carbohydrate metabolic pathways. Res. Microbiol. 147, 448–455. Shan, H.W., Dong, Y., Ma, S., Zhou, Y.G., Ma, Z.Y., 2018. Effects of dietary supplementation with freeze-dried powder of Ampithoe sp. on the growth performance, energy metabolism, and ammonia-nitrogen tolerance of the Pacific white shrimp, Litopenaeus vannamei. Aquacult. Res. 49, 2633–2643. Smith, S., Witkowski, A., Joshi, A.K., 2003. Structural and functional organization of the animal fatty acid synthase. Prog. Lipid Res. 42, 289–317. Sun, S., Guo, Z., Fu, H., Ge, X., Zhu, J., Gu, Z., 2018. Based on the metabolomic approach the energy metabolism responses of oriental river prawn Macrobrachium nipponense hepatopancreas to acute hypoxia and reoxygenation. Front. Physiol. 9, 76. Tacon, A.G.J., Cody, J.J., Conquest, L.D., Divakaran, S., Forster, I.P., Decamp, O.E., 2002. Effect of culture system on the nutrition and growth performance of Pacific white shrimp Litopenaeus vannamei (Boone) fed different diets. Aquacult. Nutr. 8, 121–137. Tomasso, J., 2012. Environmental nitrite and aquaculture: a perspective. Aquacult. Int. 20, 1107–1116. Wang, W.N., Wang, A.L., Zhang, Y.J., 2006. Effect of dietary higher level of selenium and nitrite concentration on the cellular defense response of Penaeus vannamei. Aquaculture 256, 558–563. Whiteley, N.M., Taylor, E.W., El Haj, A.J., 1997. Seasonal and latitudinal adaptation to temperature in crustaceans. J. Therm. Biol. 22, 419–427. Xu, Z., Gan, L., Li, T., Xu, C., Chen, K., Wang, X., Qin, J.G., Chen, L., Li, E., 2015. Transcriptome profiling and molecular pathway analysis of genes in association with salinity adaptation in nile tilapia Oreochromis niloticus. PLoS One 10 e0136506. Xuan, R., Wang, L., Sun, M., Ren, G., Jiang, M., 2011. Effects of cadmium on carbohydrate and protein metabolisms in the freshwater crab Sinopotamon yangtsekiense. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 154, 268–274. Zhang, Y., Yan, F., Hu, Z., Zhao, X., Min, S., Du, Z., Zhao, S., Ye, X., Li, Y., 2009. Hemocyanin from shrimp Litopenaeus vannamei shows hemolytic activity. Fish Shellfish Immunol. 27, 330–335.

oxygen species as an antimicrobial strategy. Nat. Immunol. 8, 1114–1122. Jiang, Q., Dilixiati, A., Zhang, W., Li, W., Wang, Q., Zhao, Y., Yang, J., Li, Z., 2014. Effect of nitrite exposure on metabolic response in the freshwater prawn Macrobrachium nipponense. Cent. Eur. J. Biol. 9, 86–91. Kieber, R.J., Seaton, P.J., 1995. Determination of subnanomolar concentrations of nitrite in natural waters. Anal. Chem. 67, 3261–3264. Liao, I.C., Chien, Y.H., 2011. The Pacific white shrimp, Litopenaeus vannamei, in Asia: the world's most widely cultured alien crustacean. In: In: Galil, B.S. (Ed.), In the Wrong Place - Alien Marine Crustaceans: Distribution, Biology and Impacts, vol. 6. Invading Nature -Springer Series in Invasion Ecology, pp. 489–519. Liao, S., Li, Q., Wang, A., Xian, J., Chen, X., Gou, N., Zhang, S., Wang, L., Xu, X., 2012. Effect of nitrite on immunity of the white shrimp Litopenaeus vannamei at low temperture and low salinity. Ecotoxicology 21, 1603–1608. Lin, Y.C., Chen, J.C., 2003. Acute toxicity of nitrite on Litopenaeus vannamei (Boone) juveniles at different salinity levels. Aquaculture 224, 193–201. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2− ΔΔCT method. Methods 25, 402–408. Maciel, J.E.S., Souza, F., Valle, S., Kucharski, L.C., da Silva, R.S.M., 2008. Lactate metabolism in the muscle of the crab Chasmagnathus granulatus during hypoxia and posthypoxia recovery. Comp. Biochem. Physiol. Mol. Integr. Physiol. 151, 61–65. Mangum, C.P., 1997. Adaptation of the oxygen transport system to hypoxia in the blue crab, Callinectes sapidus. Am. Zool. 37, 604–611. Nickerson, K.W., Van Holde, K.E., 1971. A comparison of molluscan and arthropod hemocyanin-I. Circular dichroism and absorption spectra. Comp. Biochem. Physiol. Part B: Biochem. 39, 855–872. Oyedotun, K.S., Lemire, B.D., 2004. The quaternary structure of the Saccharomyces cerevisiae succinate dehydrogenase homology modeling, cofactor docking, and molecular dynamics simulation studies. J. Biol. Chem. 279, 9424–9431. Pascual, C., Sánchez, A., Zenteno, E., Cuzon, G., Gabriela, G., Brito, R., Gelabert, R., Hidalgo, E., Rosas, C., 2006. Biochemical, physiological, and immunological changes during starvation in juveniles of Litopenaeus vannamei. Aquaculture 251, 416–429. Pérez Farfante, I., Kensley, B., 1997. Penaeoid and Sergestoid Shrimps and Prawns of the World (Keys and Diagnoses for the Families and Genera). Muséum National d'Histoire Naturelle, Paris, pp. 233. Racotta, I.S., Hernández-Herrera, R., 2000. Metabolic responses of the white shrimp, Penaeus vannamei, to ambient ammonia. Comp. Biochem. Physiol. Mol. Integr. Physiol. 125, 437–443.

12