- Email: [email protected]
Restriction enzymes cleave DNA immobilized on micron-sized diamond crystallites
Diamond & Related Materials 52 (2015) 18–24
Contents lists available at ScienceDirect
Diamond & Related Materials journal homepage: www.elsevier.com/locate/diamond
Restriction enzymes cleave DNA immobilized on micron-sized diamond crystallites Ozlem Yaren, Steven A. Benner ⁎ Foundation for Applied Molecular Evolution, 720 SW 2nd Avenue Suite 201, Gainesville, FL 32601, United States
a r t i c l e
i n f o
Article history: Received 28 July 2014 Received in revised form 26 November 2014 Accepted 28 November 2014 Available online 6 December 2014 Keywords: DNA immobilization Restriction endonucleases Diamond Solid–solution interface Transmission electron microscopy DNA targeted diagnostics
a b s t r a c t Because diamonds have strongly bonded networks of carbon atoms, they offer the potential to support DNAtargeted analysis in architectures that require very stable DNA immobilization with very low DNA leakage. Further, their non-porous structures should allow diamond-immobilized DNA to easily gain access to enzymes in bulk solution. As part of our work to develop a molecular biology tool kit to transform immobilized DNA, we asked whether diamond-immobilized DNA could be cleaved by sequence-specific restriction endonucleases, despite the large sizes of those enzymes, the potential for “steric” obstruction from the diamond surface, and the possibility that the diamond surface might inactivate those enzymes. We report here that both standard and “nicking” restriction endonucleases cut diamond-immobilized single-stranded DNA, after it forms a duplex with a complementary strand of DNA delivered from solution. As a somewhat surprising result, we also discovered that restriction enzymes could cleave a fraction of the immobilized duplex DNA even if the complementary strand came not from solution, but rather from a separate diamond crystallite. This cleavage did not result from a failure of the attachment linkage that allowed the diffusion of leaked DNA through bulk solvent. Rather, the cleavage required physical proximity between crystallites, as confirmed by transmission electron microscopy. These results add to the tools that can use diamond-immobilized DNA, as well as define practical constraints on assay architectures where diamond-immobilized DNA is presumed to be isolated from other diamondimmobilized DNA particles. © 2014 Elsevier B.V. All rights reserved.
1. Introduction Immobilization of DNA on solid supports is a useful first step for bioconjugate chemistry. Immobilized DNA supports DNA sequencing [1], the analysis of DNA–protein interactions [2], biosensing [3–5], and molecular diagnostics [4,6–8], among others. This immobilization has been done on surfaces ranging in size from the macroscale [9] to the nanoscale [10]. The supports and linkers used to immobilize DNA are often chosen simply because they are easy to synthesize. Accordingly, biotinylated DNA (commercially available) is often immobilized to supports that carry streptavidin (also commercially available) [11]. On silicate surfaces, DNA is frequently immobilized via a linker that exploits the ready formation of multiple silicon–oxygen bonds in reagents such as aminopropyltriethoxysilane [1]. On gold, immobilization is often achieved by placing a thiol group on the DNA, exploiting the extraordinarily tight thiol–gold interaction [8,12]. For many applications, however, such linkages are not entirely satisfactory. This is especially true when the bioconjugate must serve as part of a device to detect xNA (either DNA or RNA). Many of these classical ⁎ Corresponding author. E-mail address: [email protected] (S.A. Benner).
http://dx.doi.org/10.1016/j.diamond.2014.11.013 0925-9635/© 2014 Elsevier B.V. All rights reserved.
linkages “leak” single molecules of DNA, a leakage that can defeat a highly sensitive detection architecture [13,14]. This leakage can come from direct cleavage (often hydrolytic) of the immobilizing bond or the surface. For example, the silicon–oxygen bonds that hold DNA to glass surfaces are cleaved by hydroxide and trace fluoride [15,16]. Leakage can also arise via exchange. Thus, biotinylated DNA can be displaced from surface streptavidin by a second biotinylated DNA molecule [17]. In an effort to avoid these issues, thin diamond films or diamond crystallites have been suggested as substrates for immobilized DNA [18,19]. As networks of strongly bonded carbon atoms, the diamond crystal is itself quite robust. Further, diamond has well understood derivatization chemistry [20–24]. Mild oxidation of the diamond surface creates carboxyl groups, which form amide linkages with amine-tagged DNA; such linkages have hydrolytic half-lives of ~1011 s in aqueous solutions at pH 7 and room temperature [25–27]. Accordingly, multiple examples exist in the literature where DNA has been immobilized on diamond [6,28–33]. One report suggests that the specificity of hybridization is higher with DNA immobilized on diamond than DNA immobilized on silicon [34]. Here, we seek to take the next step, to get diamond-immobilized single stranded DNA to first hybridize to a complementary strand from the bulk solution, and then be cleaved by restriction endonucleases at specific sites in the resulting duplex. We reasoned that the non-porous
O. Yaren, S.A. Benner / Diamond & Related Materials 52 (2015) 18–24
19
Fig. 1. Schematic showing the attachment of a target sequence to a diamond crystallite. The violet segment (italic) is a sequence recognized by the Nt.BbvCI nicking endonuclease. The green segment (underlined) is a sequence recognized by EcoRV restriction endonuclease. Radiolabel is introduced by tagging at the 3′-end with radiolabeled cordycepin triphosphate and terminal transferase. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
features of diamond crystallites (averaging 500 nm, judging by TEM, in a sample sold by Sigma-Aldrich as “1 μm” sized) would make DNA immobilized on their surfaces uniformly accessible to restriction enzymes (typically 25,000–40,000 Da) that are freely diffusing in solution. We report here the development of a system that allows DNA immobilized to micron-sized diamond crystallites to interact with restriction enzymes, both standard and nicking, in solution. Further, we show that the length of the oligonucleotide separating the site from the surface determines whether cleavage occurs. Finally, as we analyzed the data, we discovered that complementary DNA strands affixed to different DNA crystallites could form inter-crystallite hybrids, which themselves could be substrates for restriction endonucleases. 2. Results To prepare their surfaces to immobilize DNA, diamond crystallites (average diameter 500 nm) were treated with nitric acid in sulfuric acid (150 °C, 20 h). This transformed the C–H and C–OH groups on their surfaces to carbonyl (C_O) and carboxyl (–COOH) groups [21,35]. The carboxyl groups were then activated with 1-ethyl-3-(3dimethylaminopropyl)-carbodiimide (EDC) for reaction with 5′-amino tagged DNA to yield DNA immobilized via an amide linkage (Fig. 1). Prior to immobilization, the synthetic DNA was 3′-radiolabeled by treatment with alpha-32P-cordycepin triphosphate and terminal deoxynucleotide transferase (TdT). This resulting judging diamonds typically carried 100 ± 10 pmole of single stranded DNA per milligram of diamond (approximately 10,000 molecules of DNA per particle, assuming 5 × 1011 particles per gram of bulk diamond), from the amount of bound radiolabel. The uncertainty in this measurement arose only because of a small amount of non-covalently adsorbed DNA, which was largely removed by washing with salt solutions. We then asked whether DNA strands attached to diamond surfaces are accessible to restriction enzymes that might cleave surface-bound
DNA after it hybridizes to its complementary strand. To this end, a series of DNA molecules was designed that had recognition sequences for various restriction endonucleases (the recognition sites in color or underlined) placed at various positions within the strand (Table 1). After being 3′-32P-labeled (cordycepin), these molecules were then attached via their 5′-amino-termini to diamond crystallites (an example is shown in Fig. 1). A slurry of diamonds was then gently agitated in a solution containing the complementary DNA and the endonucleases in a hybridization buffer. The amount of radiolabel released by restriction digestion after 1 h was measured. The results (Fig. 2) showed that all restriction endonucleases could more easily digest at their cleavage sites when these sites were farther from the surface of the diamond, as estimated by the number of nucleotides separating the surface from the site. Further, this effect appeared to be more pronounced with the larger enzymes (for example, HindIII and EcoRI, with 600 and 554 amino acids, respectively) than with smaller enzymes. The best enzymes were the Nt.BbvCI nicking restriction endonucleases (which cleaves only one strand) and EcoRV-HF. Based on these results, a two-diamond positive feedback architecture was designed with these two enzymes allowing “back and forth” analysis where an analyte might first complete the duplex restriction site by hybridization, allowing DNA molecules released from one surface to diffuse to the other crystallite, where they might re-hybridize to a different strand to create a second restriction site, which would then lead to the release of more DNA from the first crystallite. Here, a first set of diamond crystallites carried a single stranded, 3′-labeled, DNA molecule containing a Nt.BbvCI site. A second set of diamond crystallites carried a single stranded, 3′-labeled, DNA molecule containing EcoRV site (Fig. 3). As control experiments; in the absence of both restriction endonucleases but in the presence of both diamond immobilized DNA strands 1 and 2 (Fig. 4, plot A), or in the absence of one of the diamond immobilized DNA strands [1,2] but in the presence of both enzymes (Fig. 4, plots B and C), negligible amounts of radiolabel were released.
Table 1 Restriction endonucleases recognition sequences placed at various positions on the immobilized strand. Enzyme
Recognition site
Dimer
# of amino acids
NEB buffer used
HindIII EcoRI-HF EcoRV-HF BamHI Nt.BbvCI
AAGCTT GAATCC GATATC GGATCC CCTCAGC
Homodimer Homodimer Homodimer Homodimer
600 554 490 426 285
2.1 Cutsmart Cutsmart Cutsmart Cutsmart
20
O. Yaren, S.A. Benner / Diamond & Related Materials 52 (2015) 18–24
HindIII (600 AA) EcoRI (554 AA) EcoRV (490 AA) BamHI (426 AA) Nt.BbvCI (285 AA)
45
Cleavage (%)
40
35
30
25
20
5
10
15
20
25
30
35
40
45
distance from diamond surface (nt) Fig. 2. Amount of label released is shown after 1 h upon incubation of various diamonds with various. Enzymes are indicated together (in parentheses) with the number of amino acids in their subunits. Distance from the surface is estimated under a model where the duplexes form standard B-double helices.
This shows that simple agitation of the diamonds by itself does not cause substantial failure in the attachment linkage. However, and somewhat surprisingly, in the presence of only EcoRV or only Nt.BbvCI (or both enzymes together), substantial amounts of label were released even in the absence of the short complementary analyte (non-immobilized) (Fig. 4, plots D, E and F, respectively). This result suggests that single stranded DNA immobilized on the diamond
crystallites had evidently found its complement that is bound to another diamond, allowing hybridization to form a duplex and restriction enzymes to act. To explain this result, we considered first the possibility that some of the complement had broken free from the diamond, perhaps via failure of the covalent linkage, and diffused through solution to find its partner attached to the other diamond particle, hybridized, and thereby created the double helical substrate for the endonuclease. To rule this out, the same experiment was run without agitation (Table 2, row A). Here, considerably less radiolabel was released (5%). When only one of the DNA–diamond conjugates (ON-1) was incubated with a short complementary analyte (non-immobilized) together with nicking enzyme (Nt.BbvCI) without agitation, about 32% of the radiolabel was released (Table 2, row B). Lower radiolabel release of the prior experiment (Table 2, row A) is consistent with the hypothesis that immobilized DNA molecules can interact with other immobilized DNA molecules, where agitation allows different surfaces of the diamond crystallites to interact at different times. This also suggested that the results are not due to a failure of a covalent bond releasing one complementary strand to solution, allowing it to hybridize to an immobilized strand to complete the restriction site. To confirm this interpretation, the two sets of diamonds were placed in the same reaction volume, but physically separated by a porous filter paper barrier (Table 2, row C). Any freed oligonucleotides could, in principle, diffuse from one diamond to another through the barrier, which would not allow direct hybridization between two diamond-bound complements. Again, no cleavage was seen, even though control experiments showed that DNA could pass in solution through the barrier (Table 2, row D). Thus, physical separation of the crystallites under conditions that allowed the diffusion of released species between the two crystallites generated no cleavage. One last control experiment was performed to assess the stability of the amide bond between NH2–DNA and COOH-functionalized diamond surface. Two sets of diamond–DNA conjugates (ON-1 and ON-2) were shaken separately. The supernatant fluids from both were
Fig. 3. A “back and forth” amplification architecture (cascade assay) involving two complementary DNA strands separately immobilized on two separate diamond crystallites. When both complementary strands, one from each diamond, hybridize, the double stranded DNA is a substrate for the restriction endonuclease. Release of label is a way to detect the hybridization of DNA from two solid phases. DNAs attached to diamond-1 and diamond-2 are ON-1 and ON-2, respectively. The violet segment (italic) is a sequence recognized by the Nt.BbvCI nicking endonuclease. The green segment (underlined) is a sequence recognized by EcoRV restriction endonuclease. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
O. Yaren, S.A. Benner / Diamond & Related Materials 52 (2015) 18–24
21
1 mg diamond-template/ time point no enzyme (A) only diamond 2 with both enzymes (B) only diamond 1 with both enzymes (C) only EcoRV with diamond 1 and 2 (D) only Nt.BbvCI with both diamond 1 and 2 (E) both diamond 1 and 2 with both enzymes (F)
35
30
Cleavage (%)
25
20
15
10
5
0
0
50
100
150
200
250
300
350
400
time (min) Fig. 4. Time course for the release of 32P-labeled immobilized DNA from a support under different control conditions. The labeled DNA has a sequence corresponding to one strand of the recognition sequence of the indicated enzyme. Diamond 1 carries the 3′-labeled single stranded DNA: D-CONH-C6-TTTTTTTTTCAAGCTTAGTCTGGACCTCAGCATTGCTACT TCTGATATC GTAACATAT-32P-cordycepin. Diamond 2 carries the 3′-labeled single stranded DNA: D-CONH-C6-TTTTTTTTCATATGTTACGATATCAGAAGTAGCAATTAGCAATGCTGAGGTC CAGACGA -32P-cordycepin. Nt.BbvCI site is double underlined; the EcoRV site is single underlined.
then retrieved and mixed, followed by addition of the endonucleases and incubation without shaking. Only around 3% of the total radiolabel that was released suggests that amide bond between DNA and diamond surface is not labile (Table 2, row E). This result is also consistent with the hypothesis mentioned. Solid supports like silica, quartz glass or polystyrene are known to denature proteins. To rule this out for diamond, two sets of reactions were placed. In one set, at chosen time points indicated by blue arrows in Fig. 5 (solid line), more of each enzyme was added and in the other set (Fig. 5, dashed line); in control experiments, no additional enzymes were added. These experiments showed that the total label released did not plateau due to inactivation of the endonucleases. This is also consistent with the view that immobilized DNA molecules can interact with other immobilized DNA molecules, but only if they are “exposed” on promontories on the diamond surface, not in the valleys.
Table 2 Summary of the control experiment using diamond–DNA conjugates. Samples
Amount of diamond–DNAa
Timeb
A
0.5 mg
16 h
5% ±1
B C
0.5 mg 0.5 mg
16 h 5h
32% ±1 2% ±1
D
1.0 mg
5h
8% ±1
E
1.0 mg
5h
4% ±1
a
Radiolabel release
Detailsc d-ON1 and d-ON2 conjugates, no agitation d-ON1 with analyte, no agitation Cellulose barrier between d-ON1 and d-ON2 Cellulose barrier between d-ON1 and analyte Stability Testd
Amount corresponds to mg diamond/100 pmole DNA immobilized. b Single time points were taken. c d-ON1 stands for diamond-ON1 conjugate and likewise for d-ON2. d To test the stability of amide bond linkage between immobilized DNA and diamond surface.
Fig. 5. Restriction endonucleases cleave DNA duplex DNA when sense and antisense strands are bound to separate diamonds. Arrows indicate where additional enzyme is added, as a control that ensures that active enzyme is present throughout the time course of the reaction. The curve shows the simplest model that might describe the progress curve, a first order exponential (y = F(1 − exp[−kt])); this model assumes that all sites on the diamond have the same bulk solvent accessibilities. The fact that the curve does not fit the late data points (it rises too fast) is grounds for concluding that not all sites have the same accessibility. (For interpretation of the references to color in this figure, the reader is referred to the web version of this article.)
As shown by these experiments, physical proximity between diamond crystallites was sufficient for the separately bound complementary oligonucleotides to hybridize. Even more unexpected, the restriction endonuclease sites in the inter-diamond hybrids were accessible to the restriction endonuclease enzymes themselves, despite the large size (40,000 Da) of those enzymes. Perhaps naively, one might think that such large enzymes would not be able to diffuse between two diamond particles held together by a short duplex, even though that duplex contained their recognition sequences. This proximity was then examined by microscopy. Fig. 6 (A and B) shows a dispersion of the diamond crystallites, which does not carry complementary DNA oligonucleotides across a carbon-coated copper grid stained with uranyl acetate (aq. 2%) visualized by transmission electron microscopy. In contrast, mixed diamond crystallites carrying complementary DNA oligonucleotides formed clumps (Fig. 6C) and, in isolate cases (Fig. 6D and E) pairs. These images provide a visual correlate to the results obtained by restriction digestion. 3. Discussion These experiments provide a semi-quantitative estimate of the steric hindrance that arises from the surface of a diamond particle, as restriction enzymes attempt to interact with diamond-immobilized DNA. Steric interference from the diamond surface is indeed felt more by larger restriction enzymes than smaller enzymes. Further, that interference is minimized as the point of contact between the enzyme and the diamond-immobilized DNA is moved in the sequence farther away from the point of attachment of the surface. Also important, it appears as if the residual hydrophobic surface of the diamond does not inactivate the restriction enzymes. Diamonds are well known to absorb proteins non-specifically, and considerable
22
O. Yaren, S.A. Benner / Diamond & Related Materials 52 (2015) 18–24
Fig. 6. TEM analysis of the diamond–DNA conjugates. (A and B) non-complementary diamond–DNA conjugates and (C, D and E) fully complementary diamond–DNA conjugates.
effort has been devoted to preventing such non-specific absorption [36]. This may not be the case for more complex proteins that interact with DNA, such as DNA polymerases (Yaren and Benner, unpublished). Interestingly, although these enzymes in solution “felt” the hindrance from the diamond surface and were repelled by it, the hindrance was not entirely adequate to prevent complementary DNA molecules on separate diamonds from inter-crystallite interactions. Indeed, if their diamond supports were allowed to come into physical contact,
complementary DNA strands on separate particles could hybridize. Further, for up to ~ 25% of the sites, inter-diamond hybrids could be accessed by restriction endonuclease enzymes in solution, despite their large size (40,000 Da). Perhaps naively, one might have thought that such large enzymes would not be able to diffuse between two diamond particles held together by short duplexes, even though those duplexes contained their recognition sequences. However, if the DNA joining the diamonds is fully extended perpendicular to the diamond
O. Yaren, S.A. Benner / Diamond & Related Materials 52 (2015) 18–24
surface, enzymes should be able to gain access to their sites from bulk solution. This result has implications for the design of ultra-sensitive feedback assays based on separation of DNA strands through immobilization. These assays include the “cascade” assay described here. Now that the demands for isolation are better understood, work can now proceed to develop such assays. 4. Experimental section Monocrystalline diamond particles (1 μm as advertised by the manufacturer, see Fig. 6 for images showing the actual size range) and ethyl-3-(3-dimethylaminopropyl)-N′-carbodiimide hydrochloride (EDC) were purchased from Sigma-Aldrich. Oligonucleotides were ordered (HPLC purified) from IDT. Restriction endonuclease EcoRV, the nicking endonuclease Nt.BbvCI, and the 10× reaction buffer (Cutsmart) were all purchased from New England Biolabs (NEB). Their recognition sites and cleavage products are shown in Fig. 1. The amount of DNA immobilized on diamond crystallites was estimated by radiolabeling in solution the 5′-amino modified DNA with alpha-32P-cordycepin triphosphate (PerkinElmer) using terminal transferase prior to immobilization. The amount of label on washed and modified diamond crystallites was estimated by Cerenkov counting in water on a Liquid Scintillation Analyzer (PerkinElmer, Tri-Carb 2800 TR). 4.1. Oligonucleotides The following oligonucleotides were used, with various restriction sites underlined. Note that only one strand was nicked by the nicking enzyme; the complementary strand is left intact. ON-1 5′-NH2-C6-TTTTTTTTTCAAGCTTAGTCTGGACCTCAGCATTGCTA CTTCTGATATC GTAACATAT-3′ ON-2 5′-NH2-C6-TTTTTTTTCATATGTTAC GATATC AGAAGTAGCAAT TAGCAAT GCTGAGG TCCAGACGA Analyte 3′-ATCAGACCTGGAGTCGTAACGATGA-5′ 4.2. Oxidation of diamond crystallites Diamond crystallites (5 g, Sigma, 0.5 μm by transmission electron microscopy) were stirred in H2SO4: HNO3 mixture (both concentrated, ratio 3:1) at 150 °C for 20 h. The suspension was washed with H2O several times until the pH was N5. The diamond crystallites were then treated with 0.1 M NaOH at 90 °C for 2 h, washed with H2O several times until the pH was N5 and then washed with 0.1 M HCl (90 °C, 2 h). Crystallites are washed extensively with water until the pH was neutral and dried at room temperature under vacuum. 4.3. Immobilization of DNA on diamond crystallites 3′-32P labeling of DNA: DNA (50 pmole), 32P-cordycepinTP (2 pmole), CoCl2 (25 mM, 5 μL) and terminal deoxynucleotide transferase (TdT, New England Biolabs, 20 units) were incubated in TdT buffer (50 mM potassium acetate, 20 mM Tris –acetate, 10 mM magnesium acetate pH 7.9 at 25 °C, 50 μL) for 1 h at 37 °C. The 3′-radiolabeled DNA is then recovered using a QIAquick Nucleotide Removal Kit (Qiagen, Inc.), with elution in nuclease-free H2O (50 μL). Amine-modified DNA (200 pmole per mg of diamond crystallites) with a trace amount of 32P-labeled DNA (2 μL) was attached to diamond crystallites (1 mg). Reactions were performed in MES buffer (25 mM, pH 6.0 in 100 μL). After incubation at RT for 30 min, EDC (15 mg/300 μL) has been added to the mixture and the mixture was incubated at 25 °C for 1 h. Derivatized diamonds were then washed three times with 50 mM Tris–HCl pH 7.5 and twice with H2O containing 0.1% Triton X-100.
23
The washes were collected and scintillation counted to determine the amount of DNA immobilized on diamond crystallites. In general, 100 ± 10 pmole of DNA was immobilized/mg. 4.4. Negative controls using ON-1 and ON-2 To determine whether complementary DNA strands separately immobilized on two diamonds could find each other with geometry suitable for hybridization and restriction cleavage, several experiments were tried. These including experiments with no restriction enzyme (a), just one template (b), just one restriction enzyme (c), experiments without physical shaking of the suspension of diamonds in water (d), deliberate delivery of complementary short DNA strand (analyte) into the solution (e), and with the crystallites physically separated by cellulose (f) as well as testing the stability of the covalent bond between oligonucleotide and diamond crystallites (g). (a) Diamond–DNA conjugates (1 mg each) in Cutsmart reaction buffer (50 mM potassium acetate, 20 mM Tris–acetate, 10 mM magnesium acetate, 100 μg/mL BSA pH 7.9 at 25 °C, NEB) were used without the enzymes. The mixture was heated first to 95 °C for 5 min, then slowly cooled down to RT and finally incubated at 37 °C with shaking. Four time points were taken (30 min, 1 h, 2 h, 6 h). After each incubation, the diamond crystallites were washed several times with H2O, and the radioactivity present on the crystallites and in the washes was measured. (b) One of the diamond–DNA conjugates (1 mg, ON-1 or ON-2), EcoRV (20 U, 1 μL) and Nt.BbvCI (10 U, 1 μL) in Cutsmart reaction buffer (50 mM potassium acetate, 20 mM Tris–acetate, 10 mM magnesium acetate, 100 μg/mL BSA pH 7.9 at 25 °C, NEB) were used. The mixture was heated first to 95 °C for 5 min, then slowly cooled down to RT and finally incubated at 37 °C with shaking. Four time points were taken (30 min, 1 h, 2 h, 6 h). After each incubation, the diamond crystallites were washed several times with H2O, and the radioactivity present on the crystallites and in the washes was measured. (c) Diamond–DNA conjugates (1 mg each) with just one of the enzymes (EcoRV (20 U, 1 μL) or Nt.BbvCI (10 U, 1 μL)) in Cutsmart reaction buffer (50 mM potassium acetate, 20 mM Tris–acetate, 10 mM magnesium acetate, 100 μg/mL BSA pH 7.9 at 25 °C, NEB) were used. The mixture was heated first to 95 °C for 5 min, then slowly cooled down to RT and finally incubated at 37 °C with shaking. Four time points were taken (30 min, 1 h, 2 h, 6 h). After each incubation, the diamond crystallites were washed several times with H2O, and the radioactivity present on the crystallites and in the washes was measured. (d) Diamond–DNA conjugates (1 mg each), EcoRV (20 U, 1 μL) and/ or Nt.BbvCI (10 U, 1 μL) in Cutsmart reaction buffer (50 mM potassium acetate, 20 mM Tris–acetate, 10 mM magnesium acetate, 100 μg/mL BSA pH 7.9 at 25 °C, NEB) were used. The mixture was heated first to 95 °C for 5 min, then slowly cooled down to RT and finally incubated at 37 °C without any shaking/rocking for 16 h. Diamond crystallites were washed several times with H2O, and the radioactivity present on the diamonds and in the washes was measured. (e) For reactions where the hybridizing analyte was delivered from solution, diamond–DNA (ON-1, 0.5 mg) was incubated with Nt.BbvCI (20 U, 2 μL) in Cutsmart reaction buffer (NEB, 1×), at 37 °C without shaking/rocking for 16 h. The effect of hybridization prior to addition of the enzyme was also tested. (f) To demonstrate that physical proximity was required between diamonds carrying complementary DNA strands, contact was prevented with a barrier that was porous to any DNA that was released by leakage from the diamond. Here, diamond –DNA conjugates (ON-1, 1 mg in 1× Cutsmart buffer) and Nt.BbvCI
24
O. Yaren, S.A. Benner / Diamond & Related Materials 52 (2015) 18–24
(50 U, 5 μL) were placed on the bottom layer of the cellulose barrier in a small Petri dish. On the top of the cellulose barrier, the analyte (500 pmole, 5 μL) was placed, a short DNA strand that was complementary to the nicking site of the DNA strand immobilized on diamond. The reaction is incubated still at 37 °C for 5 h. After the incubation, the diamond crystallites were washed several times with H2O, and their radioactivity was measured. Same conditions were also applied to two diamond–DNA conjugates. One of the diamond–DNA was placed on top of the filter with the enzymes in reaction buffer; other diamond–DNA was placed under the filter in the same manner. (g) To test the stability of covalent bond between diamond surface and amino-modified DNA, two sets of diamond–DNA conjugates (ON-1 and ON-2, 1 mg each) were shaken separately in 1× Cutsmart buffer for 2 h at 37 °C. Then both solutions were mixed, EcoRV (100 U, 5 μL) and/or Nt.BbvCI (50 U, 5 μL) were added and incubated at 37 °C for 5 h without shaking. After the incubation, the diamond crystallites were washed several times with H2O, and their radioactivity was measured. 4.5. Inactivation of enzyme by diamond and availability of sites Diamond crystallites carrying DNA (d-ON1 and d-ON2, 2 mg) were incubated at 95 °C for 5 min and then slowly cooled to RT prior to addition of the enzyme. Nt.BbvCI (20 U) and EcoRV (40 U) were added and the mixture was incubated at 37 °C for 2 h. After incubation, the second portions of the enzymes are added, and the mixture was incubated at 37 °C for another 3 h. Finally the third portions of the enzymes are added, and the mixture was incubated at 37 °C for another 11 h giving a total of 16 h incubation. Each set of crystallites was washed several times with H2O, and the remaining radioactivity was quantitated to assess the extent of cleavage. 4.6. Restriction digests reactions in the presence of diamonds 1 and 2 Diamond-bound ON-1 (d-ON1 5 mg) and diamond-bound ON-2 (d-ON2, 5 mg) were incubated at 95 °C for 5 min. The mixture was then slowly cooled to RT. Enzymes (10 U of Nt.BbvCI, 20 U of EcoRV) were added, and the mixture was incubated by shaking at 37 °C. Five time points were taken (15 min, 45 min, 1 h, 2 h, 6 h). Each reaction is washed several times with H2O. Prime novelty This provides the first semi-quantitative statement about the steric hindrance created by a diamond surface with respect to immobilized DNA, as felt by restriction endonucleases, adding these endonucleases to the tool kit of enzymes that remain active in the presence of diamond surfaces and can transform DNA bound to those. It also provides a somewhat surprising result, showing that complementary DNA strands can productively interact even when they are bound to different diamond nanocrystallites. Acknowledgments We are indebted to support from the Defense Threat Reduction Agency (DTRA HDTRA1-13-1-0004) for their support of the basic science behind this work, as well as Firebird Biomolecular Sciences LLC (through a project funded by the Office of the Secretary of Defense W911NF-12-C-0059). References [1] S.L. Beaucage, Strategies in the preparation of DNA oligonucleotide arrays for diagnostic applications, Curr. Med. Chem. 8 (2001) 1213–1244.
[2] C. Stavis, et al., Surface functionalization of thin-film diamond for highly stable and selective biological interfaces, Proc. Natl. Acad. Sci. U. S. A. 108 (2011) 983–988. [3] M. Beier, J.D. Hoheisel, Versatile derivatisation of solid support media for covalent bonding on DNA-microchips, Nucleic Acids Res. 27 (1999) 1970–1977. [4] H.B. Man, D. Ho, Diamond as a nanomedical agent for versatile applications in drug delivery, imaging, and sensing, Phys. Status Solidi A 209 (2012) 1609–1618. [5] A. Sassolas, L.J. Blum, B.D. Leca-Bouvier, Immobilization strategies to develop enzymatic biosensors, Biotechnol. Adv. 30 (2012) 489–511. [6] J.-H. Yang, Y. Nakano, Y. Murakami, K.-S. Song, H. Kawarada, Functionalization of ultradispersed diamond for DNA detection, J. Nanopart. Res. 10 (2008) 69–75. [7] A. Carmon, T.J. Vision, S.E. Mitchell, T.W. Thannhauser, U. Muller, S. Kresovich, Solidphase PCR in microwells: effects of linker length and composition on tethering, hybridization, and extension, Biotechniques 32 (2002) 410–420. [8] Y.-C. Yeh, B. Creran, V.M. Rotello, Gold nanoparticles: preparation, properties, and applications in bionanotechnology, Nanoscale 4 (2012) 1871–1880. [9] V. Singh, M. Zharnikov, A. Gulino, T. Gupta, DNA immobilization, delivery and cleavage on solid supports, J. Mater. Chem. 21 (2011) 10602–10618. [10] J. Meinkoth, G. Wahl, Hybridization of nucleic acids immobilized on solid supports, Anal. Biochem. 138 (1984) 267–284. [11] R. Ohara, O. Ohara, A new solid-phase chemical DNA sequencing method which uses streptavidin-coated magnetic beads, DNA Res. 2 (1995) 123–128. [12] Y.-W. Lin, C.-W. Liu, H.-T. Chang, DNA functionalized gold nanoparticles for bioanalysis, Anal. Methods 1 (2009) 14–24. [13] S.A.J. van der Meulen, M.E. Leunissen, Solid colloids with surface-mobile DNA linkers, J. Am. Chem. Soc. 135 (2013) 15129–15134. [14] H.S. Kim, Y.S. Kye, D.S. Hage, Development and evaluation of N-hydroxysuccinimideactivated silica for immobilizing human serum albumin in liquid chromatography columns, J. Chromatogr. A 1049 (2004) 51–61. [15] M. Lu, T. Knickerbocker, W. Cai, W. Yang, R.J. Hamers, L.M. Smith, Invasive cleavage reactions on DNA-modified diamond surfaces, Biopolymers 73 (2004) 606–613. [16] J.E. Butler, Solid supports in enzyme-linked immunosorbent assay and other solidphase immunoassays, Methods 22 (2000) 4–23. [17] C.M. Niemeyer, M. Adler, S. Gao, L. Chi, Supramolecular DNA–streptavidin nanocircles with a covalently attached oligonucleotide moiety, J. Biomol. Struct. Dyn. 2 (2002) 223–230. [18] A. Haertl, et al., Protein-modified nanocrystalline diamond thin films for biosensor applications, Nat. Mater. 3 (2004) 736–742. [19] W. Yang, O. Auciello, et al., DNA-modified nanocrystalline diamond thin-films as stable, biologically active substrates, Nat. Mater. 1 (2002) 253–257. [20] I.P. Chang, K.C. Hwang, J.-a.A. Ho, C.-C. Lin, R.J.R. Hwu, J.-C. Horng, Facile surface functionalization of nanodiamonds, Langmuir 26 (2009) 3685–3689. [21] K. Ushizawa, Y. Sato, T. Mitsumori, T. Machinami, T. Ueda, T. Ando, Covalent immobilization of DNA on diamond and its verification by diffuse reflectance infrared spectroscopy, Chem. Phys. Lett. 351 (2002) 105–108. [22] T. Knickerbocker, T. Strother, M.P. Schwartz, J.N. Russell Jr., J. Butler, L.M. Smith, R.J. Hamers, DNA-modified diamond surfaces, Langmuir 19 (2003) 1938–1942. [23] S. Wenmackers, et al., Head-on immobilization of DNA fragments on CVD-diamond layers, Mater. Sci. Forum 492 (2005) 267–272. [24] P. Christiaens, et al., EDC-mediated DNA attachment to nanocrystalline CVD diamond films, Biosens. Bioelectron. 22 (2006) 170–177. [25] R.M. Smith, D.E. Hansen, The pH-rate profile for the hydrolysis of a peptide bond, J. Am. Chem. Soc. 120 (1998) 8910–8913. [26] R.A.R. Bryant, D.E. Hansen, Direct measurement of the uncatalyzed rate of hydrolysis of a peptide bond, J. Am. Chem. Soc. 118 (1996) 5498–5499. [27] A. Radzicka, R. Wolfenden, Rates of uncatalyzed peptide bond hydrolysis in neutral solution and the transition state affinities of proteases, J. Am. Chem. Soc. 118 (1996) 6105–6109. [28] J.-H. Yang, K.-S. Song, G.-J. Zhang, M. Degawa, Y. Sasaki, I. Ohdomari, H. Kawarada, Characterization of DNA hybridization on partially aminated diamond by aromatic compounds, Langmuir 22 (2006) 11245–11250. [29] V. Vermeeren, et al., Towards a real-time, label-free. Diamond-based DNA sensor, Langmuir 23 (2007) 13193–13202. [30] V. Vermeeren, S. Wenmackers, P. Wagner, L. Michiels, DNA sensors with diamond as a promising alternative transducer material, Sensors 9 (2009) 5600–5636. [31] S. Wenmackers, V. Vermeeren, V.M. vande, M. Ameloot, N. Bijnens, K. Haenen, L. Michiels, P. Wagner, Diamond-based DNA sensors: surface functionalization and read-out strategies, Phys. Status Solidi A 206 (2009) 391–408. [32] X. Wang, Y. Ishii, A.R. Ruslinda, M. Hasegawa, H. Kawarada, Effective surface functionalization of nanocrystalline diamond films by direct carboxylation for PDGF detection via aptasensor, ACS Appl. Mater. Interfaces 4 (2012) 3526–3534. [33] A. Rahim Ruslinda, K. Tanabe, S. Ibori, X. Wang, H. Kawarada, Effects of diamondFET-based RNA aptamer sensing for detection of real sample of HIV-1 Tat protein, Biosens. Bioelectron. 40 (2013) 277–282. [34] G.-J. Zhang, K.-S. Song, Y. Nakamura, T. Ueno, T. Funatsu, I. Ohdomari, H. Kawarada, DNA micropatterning on polycrystalline diamond via one-step direct amination, Langmuir 22 (2006) 3728–3734. [35] S. Wenmackers, K. Haenen, M. Nesládek, P. Wagner, L. Michiels, M. van de Ven, M. Ameloot, Covalent immobilization of DNA on CVD diamond films, Phys. Status Solidi A 199 (2003) 44–48. [36] T.L. Lasseter, B.H. Clare, N.L. Abbott, R.J. Hamers, Covalently modified silicon and diamond surfaces: resistance to nonspecific protein adsorption and optimization for biosensing, J. Am. Chem. Soc. 126 (2004) 10220–10221.
Contents lists available at ScienceDirect
Diamond & Related Materials journal homepage: www.elsevier.com/locate/diamond
Restriction enzymes cleave DNA immobilized on micron-sized diamond crystallites Ozlem Yaren, Steven A. Benner ⁎ Foundation for Applied Molecular Evolution, 720 SW 2nd Avenue Suite 201, Gainesville, FL 32601, United States
a r t i c l e
i n f o
Article history: Received 28 July 2014 Received in revised form 26 November 2014 Accepted 28 November 2014 Available online 6 December 2014 Keywords: DNA immobilization Restriction endonucleases Diamond Solid–solution interface Transmission electron microscopy DNA targeted diagnostics
a b s t r a c t Because diamonds have strongly bonded networks of carbon atoms, they offer the potential to support DNAtargeted analysis in architectures that require very stable DNA immobilization with very low DNA leakage. Further, their non-porous structures should allow diamond-immobilized DNA to easily gain access to enzymes in bulk solution. As part of our work to develop a molecular biology tool kit to transform immobilized DNA, we asked whether diamond-immobilized DNA could be cleaved by sequence-specific restriction endonucleases, despite the large sizes of those enzymes, the potential for “steric” obstruction from the diamond surface, and the possibility that the diamond surface might inactivate those enzymes. We report here that both standard and “nicking” restriction endonucleases cut diamond-immobilized single-stranded DNA, after it forms a duplex with a complementary strand of DNA delivered from solution. As a somewhat surprising result, we also discovered that restriction enzymes could cleave a fraction of the immobilized duplex DNA even if the complementary strand came not from solution, but rather from a separate diamond crystallite. This cleavage did not result from a failure of the attachment linkage that allowed the diffusion of leaked DNA through bulk solvent. Rather, the cleavage required physical proximity between crystallites, as confirmed by transmission electron microscopy. These results add to the tools that can use diamond-immobilized DNA, as well as define practical constraints on assay architectures where diamond-immobilized DNA is presumed to be isolated from other diamondimmobilized DNA particles. © 2014 Elsevier B.V. All rights reserved.
1. Introduction Immobilization of DNA on solid supports is a useful first step for bioconjugate chemistry. Immobilized DNA supports DNA sequencing [1], the analysis of DNA–protein interactions [2], biosensing [3–5], and molecular diagnostics [4,6–8], among others. This immobilization has been done on surfaces ranging in size from the macroscale [9] to the nanoscale [10]. The supports and linkers used to immobilize DNA are often chosen simply because they are easy to synthesize. Accordingly, biotinylated DNA (commercially available) is often immobilized to supports that carry streptavidin (also commercially available) [11]. On silicate surfaces, DNA is frequently immobilized via a linker that exploits the ready formation of multiple silicon–oxygen bonds in reagents such as aminopropyltriethoxysilane [1]. On gold, immobilization is often achieved by placing a thiol group on the DNA, exploiting the extraordinarily tight thiol–gold interaction [8,12]. For many applications, however, such linkages are not entirely satisfactory. This is especially true when the bioconjugate must serve as part of a device to detect xNA (either DNA or RNA). Many of these classical ⁎ Corresponding author. E-mail address: [email protected] (S.A. Benner).
http://dx.doi.org/10.1016/j.diamond.2014.11.013 0925-9635/© 2014 Elsevier B.V. All rights reserved.
linkages “leak” single molecules of DNA, a leakage that can defeat a highly sensitive detection architecture [13,14]. This leakage can come from direct cleavage (often hydrolytic) of the immobilizing bond or the surface. For example, the silicon–oxygen bonds that hold DNA to glass surfaces are cleaved by hydroxide and trace fluoride [15,16]. Leakage can also arise via exchange. Thus, biotinylated DNA can be displaced from surface streptavidin by a second biotinylated DNA molecule [17]. In an effort to avoid these issues, thin diamond films or diamond crystallites have been suggested as substrates for immobilized DNA [18,19]. As networks of strongly bonded carbon atoms, the diamond crystal is itself quite robust. Further, diamond has well understood derivatization chemistry [20–24]. Mild oxidation of the diamond surface creates carboxyl groups, which form amide linkages with amine-tagged DNA; such linkages have hydrolytic half-lives of ~1011 s in aqueous solutions at pH 7 and room temperature [25–27]. Accordingly, multiple examples exist in the literature where DNA has been immobilized on diamond [6,28–33]. One report suggests that the specificity of hybridization is higher with DNA immobilized on diamond than DNA immobilized on silicon [34]. Here, we seek to take the next step, to get diamond-immobilized single stranded DNA to first hybridize to a complementary strand from the bulk solution, and then be cleaved by restriction endonucleases at specific sites in the resulting duplex. We reasoned that the non-porous
O. Yaren, S.A. Benner / Diamond & Related Materials 52 (2015) 18–24
19
Fig. 1. Schematic showing the attachment of a target sequence to a diamond crystallite. The violet segment (italic) is a sequence recognized by the Nt.BbvCI nicking endonuclease. The green segment (underlined) is a sequence recognized by EcoRV restriction endonuclease. Radiolabel is introduced by tagging at the 3′-end with radiolabeled cordycepin triphosphate and terminal transferase. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
features of diamond crystallites (averaging 500 nm, judging by TEM, in a sample sold by Sigma-Aldrich as “1 μm” sized) would make DNA immobilized on their surfaces uniformly accessible to restriction enzymes (typically 25,000–40,000 Da) that are freely diffusing in solution. We report here the development of a system that allows DNA immobilized to micron-sized diamond crystallites to interact with restriction enzymes, both standard and nicking, in solution. Further, we show that the length of the oligonucleotide separating the site from the surface determines whether cleavage occurs. Finally, as we analyzed the data, we discovered that complementary DNA strands affixed to different DNA crystallites could form inter-crystallite hybrids, which themselves could be substrates for restriction endonucleases. 2. Results To prepare their surfaces to immobilize DNA, diamond crystallites (average diameter 500 nm) were treated with nitric acid in sulfuric acid (150 °C, 20 h). This transformed the C–H and C–OH groups on their surfaces to carbonyl (C_O) and carboxyl (–COOH) groups [21,35]. The carboxyl groups were then activated with 1-ethyl-3-(3dimethylaminopropyl)-carbodiimide (EDC) for reaction with 5′-amino tagged DNA to yield DNA immobilized via an amide linkage (Fig. 1). Prior to immobilization, the synthetic DNA was 3′-radiolabeled by treatment with alpha-32P-cordycepin triphosphate and terminal deoxynucleotide transferase (TdT). This resulting judging diamonds typically carried 100 ± 10 pmole of single stranded DNA per milligram of diamond (approximately 10,000 molecules of DNA per particle, assuming 5 × 1011 particles per gram of bulk diamond), from the amount of bound radiolabel. The uncertainty in this measurement arose only because of a small amount of non-covalently adsorbed DNA, which was largely removed by washing with salt solutions. We then asked whether DNA strands attached to diamond surfaces are accessible to restriction enzymes that might cleave surface-bound
DNA after it hybridizes to its complementary strand. To this end, a series of DNA molecules was designed that had recognition sequences for various restriction endonucleases (the recognition sites in color or underlined) placed at various positions within the strand (Table 1). After being 3′-32P-labeled (cordycepin), these molecules were then attached via their 5′-amino-termini to diamond crystallites (an example is shown in Fig. 1). A slurry of diamonds was then gently agitated in a solution containing the complementary DNA and the endonucleases in a hybridization buffer. The amount of radiolabel released by restriction digestion after 1 h was measured. The results (Fig. 2) showed that all restriction endonucleases could more easily digest at their cleavage sites when these sites were farther from the surface of the diamond, as estimated by the number of nucleotides separating the surface from the site. Further, this effect appeared to be more pronounced with the larger enzymes (for example, HindIII and EcoRI, with 600 and 554 amino acids, respectively) than with smaller enzymes. The best enzymes were the Nt.BbvCI nicking restriction endonucleases (which cleaves only one strand) and EcoRV-HF. Based on these results, a two-diamond positive feedback architecture was designed with these two enzymes allowing “back and forth” analysis where an analyte might first complete the duplex restriction site by hybridization, allowing DNA molecules released from one surface to diffuse to the other crystallite, where they might re-hybridize to a different strand to create a second restriction site, which would then lead to the release of more DNA from the first crystallite. Here, a first set of diamond crystallites carried a single stranded, 3′-labeled, DNA molecule containing a Nt.BbvCI site. A second set of diamond crystallites carried a single stranded, 3′-labeled, DNA molecule containing EcoRV site (Fig. 3). As control experiments; in the absence of both restriction endonucleases but in the presence of both diamond immobilized DNA strands 1 and 2 (Fig. 4, plot A), or in the absence of one of the diamond immobilized DNA strands [1,2] but in the presence of both enzymes (Fig. 4, plots B and C), negligible amounts of radiolabel were released.
Table 1 Restriction endonucleases recognition sequences placed at various positions on the immobilized strand. Enzyme
Recognition site
Dimer
# of amino acids
NEB buffer used
HindIII EcoRI-HF EcoRV-HF BamHI Nt.BbvCI
AAGCTT GAATCC GATATC GGATCC CCTCAGC
Homodimer Homodimer Homodimer Homodimer
600 554 490 426 285
2.1 Cutsmart Cutsmart Cutsmart Cutsmart
20
O. Yaren, S.A. Benner / Diamond & Related Materials 52 (2015) 18–24
HindIII (600 AA) EcoRI (554 AA) EcoRV (490 AA) BamHI (426 AA) Nt.BbvCI (285 AA)
45
Cleavage (%)
40
35
30
25
20
5
10
15
20
25
30
35
40
45
distance from diamond surface (nt) Fig. 2. Amount of label released is shown after 1 h upon incubation of various diamonds with various. Enzymes are indicated together (in parentheses) with the number of amino acids in their subunits. Distance from the surface is estimated under a model where the duplexes form standard B-double helices.
This shows that simple agitation of the diamonds by itself does not cause substantial failure in the attachment linkage. However, and somewhat surprisingly, in the presence of only EcoRV or only Nt.BbvCI (or both enzymes together), substantial amounts of label were released even in the absence of the short complementary analyte (non-immobilized) (Fig. 4, plots D, E and F, respectively). This result suggests that single stranded DNA immobilized on the diamond
crystallites had evidently found its complement that is bound to another diamond, allowing hybridization to form a duplex and restriction enzymes to act. To explain this result, we considered first the possibility that some of the complement had broken free from the diamond, perhaps via failure of the covalent linkage, and diffused through solution to find its partner attached to the other diamond particle, hybridized, and thereby created the double helical substrate for the endonuclease. To rule this out, the same experiment was run without agitation (Table 2, row A). Here, considerably less radiolabel was released (5%). When only one of the DNA–diamond conjugates (ON-1) was incubated with a short complementary analyte (non-immobilized) together with nicking enzyme (Nt.BbvCI) without agitation, about 32% of the radiolabel was released (Table 2, row B). Lower radiolabel release of the prior experiment (Table 2, row A) is consistent with the hypothesis that immobilized DNA molecules can interact with other immobilized DNA molecules, where agitation allows different surfaces of the diamond crystallites to interact at different times. This also suggested that the results are not due to a failure of a covalent bond releasing one complementary strand to solution, allowing it to hybridize to an immobilized strand to complete the restriction site. To confirm this interpretation, the two sets of diamonds were placed in the same reaction volume, but physically separated by a porous filter paper barrier (Table 2, row C). Any freed oligonucleotides could, in principle, diffuse from one diamond to another through the barrier, which would not allow direct hybridization between two diamond-bound complements. Again, no cleavage was seen, even though control experiments showed that DNA could pass in solution through the barrier (Table 2, row D). Thus, physical separation of the crystallites under conditions that allowed the diffusion of released species between the two crystallites generated no cleavage. One last control experiment was performed to assess the stability of the amide bond between NH2–DNA and COOH-functionalized diamond surface. Two sets of diamond–DNA conjugates (ON-1 and ON-2) were shaken separately. The supernatant fluids from both were
Fig. 3. A “back and forth” amplification architecture (cascade assay) involving two complementary DNA strands separately immobilized on two separate diamond crystallites. When both complementary strands, one from each diamond, hybridize, the double stranded DNA is a substrate for the restriction endonuclease. Release of label is a way to detect the hybridization of DNA from two solid phases. DNAs attached to diamond-1 and diamond-2 are ON-1 and ON-2, respectively. The violet segment (italic) is a sequence recognized by the Nt.BbvCI nicking endonuclease. The green segment (underlined) is a sequence recognized by EcoRV restriction endonuclease. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
O. Yaren, S.A. Benner / Diamond & Related Materials 52 (2015) 18–24
21
1 mg diamond-template/ time point no enzyme (A) only diamond 2 with both enzymes (B) only diamond 1 with both enzymes (C) only EcoRV with diamond 1 and 2 (D) only Nt.BbvCI with both diamond 1 and 2 (E) both diamond 1 and 2 with both enzymes (F)
35
30
Cleavage (%)
25
20
15
10
5
0
0
50
100
150
200
250
300
350
400
time (min) Fig. 4. Time course for the release of 32P-labeled immobilized DNA from a support under different control conditions. The labeled DNA has a sequence corresponding to one strand of the recognition sequence of the indicated enzyme. Diamond 1 carries the 3′-labeled single stranded DNA: D-CONH-C6-TTTTTTTTTCAAGCTTAGTCTGGACCTCAGCATTGCTACT TCTGATATC GTAACATAT-32P-cordycepin. Diamond 2 carries the 3′-labeled single stranded DNA: D-CONH-C6-TTTTTTTTCATATGTTACGATATCAGAAGTAGCAATTAGCAATGCTGAGGTC CAGACGA -32P-cordycepin. Nt.BbvCI site is double underlined; the EcoRV site is single underlined.
then retrieved and mixed, followed by addition of the endonucleases and incubation without shaking. Only around 3% of the total radiolabel that was released suggests that amide bond between DNA and diamond surface is not labile (Table 2, row E). This result is also consistent with the hypothesis mentioned. Solid supports like silica, quartz glass or polystyrene are known to denature proteins. To rule this out for diamond, two sets of reactions were placed. In one set, at chosen time points indicated by blue arrows in Fig. 5 (solid line), more of each enzyme was added and in the other set (Fig. 5, dashed line); in control experiments, no additional enzymes were added. These experiments showed that the total label released did not plateau due to inactivation of the endonucleases. This is also consistent with the view that immobilized DNA molecules can interact with other immobilized DNA molecules, but only if they are “exposed” on promontories on the diamond surface, not in the valleys.
Table 2 Summary of the control experiment using diamond–DNA conjugates. Samples
Amount of diamond–DNAa
Timeb
A
0.5 mg
16 h
5% ±1
B C
0.5 mg 0.5 mg
16 h 5h
32% ±1 2% ±1
D
1.0 mg
5h
8% ±1
E
1.0 mg
5h
4% ±1
a
Radiolabel release
Detailsc d-ON1 and d-ON2 conjugates, no agitation d-ON1 with analyte, no agitation Cellulose barrier between d-ON1 and d-ON2 Cellulose barrier between d-ON1 and analyte Stability Testd
Amount corresponds to mg diamond/100 pmole DNA immobilized. b Single time points were taken. c d-ON1 stands for diamond-ON1 conjugate and likewise for d-ON2. d To test the stability of amide bond linkage between immobilized DNA and diamond surface.
Fig. 5. Restriction endonucleases cleave DNA duplex DNA when sense and antisense strands are bound to separate diamonds. Arrows indicate where additional enzyme is added, as a control that ensures that active enzyme is present throughout the time course of the reaction. The curve shows the simplest model that might describe the progress curve, a first order exponential (y = F(1 − exp[−kt])); this model assumes that all sites on the diamond have the same bulk solvent accessibilities. The fact that the curve does not fit the late data points (it rises too fast) is grounds for concluding that not all sites have the same accessibility. (For interpretation of the references to color in this figure, the reader is referred to the web version of this article.)
As shown by these experiments, physical proximity between diamond crystallites was sufficient for the separately bound complementary oligonucleotides to hybridize. Even more unexpected, the restriction endonuclease sites in the inter-diamond hybrids were accessible to the restriction endonuclease enzymes themselves, despite the large size (40,000 Da) of those enzymes. Perhaps naively, one might think that such large enzymes would not be able to diffuse between two diamond particles held together by a short duplex, even though that duplex contained their recognition sequences. This proximity was then examined by microscopy. Fig. 6 (A and B) shows a dispersion of the diamond crystallites, which does not carry complementary DNA oligonucleotides across a carbon-coated copper grid stained with uranyl acetate (aq. 2%) visualized by transmission electron microscopy. In contrast, mixed diamond crystallites carrying complementary DNA oligonucleotides formed clumps (Fig. 6C) and, in isolate cases (Fig. 6D and E) pairs. These images provide a visual correlate to the results obtained by restriction digestion. 3. Discussion These experiments provide a semi-quantitative estimate of the steric hindrance that arises from the surface of a diamond particle, as restriction enzymes attempt to interact with diamond-immobilized DNA. Steric interference from the diamond surface is indeed felt more by larger restriction enzymes than smaller enzymes. Further, that interference is minimized as the point of contact between the enzyme and the diamond-immobilized DNA is moved in the sequence farther away from the point of attachment of the surface. Also important, it appears as if the residual hydrophobic surface of the diamond does not inactivate the restriction enzymes. Diamonds are well known to absorb proteins non-specifically, and considerable
22
O. Yaren, S.A. Benner / Diamond & Related Materials 52 (2015) 18–24
Fig. 6. TEM analysis of the diamond–DNA conjugates. (A and B) non-complementary diamond–DNA conjugates and (C, D and E) fully complementary diamond–DNA conjugates.
effort has been devoted to preventing such non-specific absorption [36]. This may not be the case for more complex proteins that interact with DNA, such as DNA polymerases (Yaren and Benner, unpublished). Interestingly, although these enzymes in solution “felt” the hindrance from the diamond surface and were repelled by it, the hindrance was not entirely adequate to prevent complementary DNA molecules on separate diamonds from inter-crystallite interactions. Indeed, if their diamond supports were allowed to come into physical contact,
complementary DNA strands on separate particles could hybridize. Further, for up to ~ 25% of the sites, inter-diamond hybrids could be accessed by restriction endonuclease enzymes in solution, despite their large size (40,000 Da). Perhaps naively, one might have thought that such large enzymes would not be able to diffuse between two diamond particles held together by short duplexes, even though those duplexes contained their recognition sequences. However, if the DNA joining the diamonds is fully extended perpendicular to the diamond
O. Yaren, S.A. Benner / Diamond & Related Materials 52 (2015) 18–24
surface, enzymes should be able to gain access to their sites from bulk solution. This result has implications for the design of ultra-sensitive feedback assays based on separation of DNA strands through immobilization. These assays include the “cascade” assay described here. Now that the demands for isolation are better understood, work can now proceed to develop such assays. 4. Experimental section Monocrystalline diamond particles (1 μm as advertised by the manufacturer, see Fig. 6 for images showing the actual size range) and ethyl-3-(3-dimethylaminopropyl)-N′-carbodiimide hydrochloride (EDC) were purchased from Sigma-Aldrich. Oligonucleotides were ordered (HPLC purified) from IDT. Restriction endonuclease EcoRV, the nicking endonuclease Nt.BbvCI, and the 10× reaction buffer (Cutsmart) were all purchased from New England Biolabs (NEB). Their recognition sites and cleavage products are shown in Fig. 1. The amount of DNA immobilized on diamond crystallites was estimated by radiolabeling in solution the 5′-amino modified DNA with alpha-32P-cordycepin triphosphate (PerkinElmer) using terminal transferase prior to immobilization. The amount of label on washed and modified diamond crystallites was estimated by Cerenkov counting in water on a Liquid Scintillation Analyzer (PerkinElmer, Tri-Carb 2800 TR). 4.1. Oligonucleotides The following oligonucleotides were used, with various restriction sites underlined. Note that only one strand was nicked by the nicking enzyme; the complementary strand is left intact. ON-1 5′-NH2-C6-TTTTTTTTTCAAGCTTAGTCTGGACCTCAGCATTGCTA CTTCTGATATC GTAACATAT-3′ ON-2 5′-NH2-C6-TTTTTTTTCATATGTTAC GATATC AGAAGTAGCAAT TAGCAAT GCTGAGG TCCAGACGA Analyte 3′-ATCAGACCTGGAGTCGTAACGATGA-5′ 4.2. Oxidation of diamond crystallites Diamond crystallites (5 g, Sigma, 0.5 μm by transmission electron microscopy) were stirred in H2SO4: HNO3 mixture (both concentrated, ratio 3:1) at 150 °C for 20 h. The suspension was washed with H2O several times until the pH was N5. The diamond crystallites were then treated with 0.1 M NaOH at 90 °C for 2 h, washed with H2O several times until the pH was N5 and then washed with 0.1 M HCl (90 °C, 2 h). Crystallites are washed extensively with water until the pH was neutral and dried at room temperature under vacuum. 4.3. Immobilization of DNA on diamond crystallites 3′-32P labeling of DNA: DNA (50 pmole), 32P-cordycepinTP (2 pmole), CoCl2 (25 mM, 5 μL) and terminal deoxynucleotide transferase (TdT, New England Biolabs, 20 units) were incubated in TdT buffer (50 mM potassium acetate, 20 mM Tris –acetate, 10 mM magnesium acetate pH 7.9 at 25 °C, 50 μL) for 1 h at 37 °C. The 3′-radiolabeled DNA is then recovered using a QIAquick Nucleotide Removal Kit (Qiagen, Inc.), with elution in nuclease-free H2O (50 μL). Amine-modified DNA (200 pmole per mg of diamond crystallites) with a trace amount of 32P-labeled DNA (2 μL) was attached to diamond crystallites (1 mg). Reactions were performed in MES buffer (25 mM, pH 6.0 in 100 μL). After incubation at RT for 30 min, EDC (15 mg/300 μL) has been added to the mixture and the mixture was incubated at 25 °C for 1 h. Derivatized diamonds were then washed three times with 50 mM Tris–HCl pH 7.5 and twice with H2O containing 0.1% Triton X-100.
23
The washes were collected and scintillation counted to determine the amount of DNA immobilized on diamond crystallites. In general, 100 ± 10 pmole of DNA was immobilized/mg. 4.4. Negative controls using ON-1 and ON-2 To determine whether complementary DNA strands separately immobilized on two diamonds could find each other with geometry suitable for hybridization and restriction cleavage, several experiments were tried. These including experiments with no restriction enzyme (a), just one template (b), just one restriction enzyme (c), experiments without physical shaking of the suspension of diamonds in water (d), deliberate delivery of complementary short DNA strand (analyte) into the solution (e), and with the crystallites physically separated by cellulose (f) as well as testing the stability of the covalent bond between oligonucleotide and diamond crystallites (g). (a) Diamond–DNA conjugates (1 mg each) in Cutsmart reaction buffer (50 mM potassium acetate, 20 mM Tris–acetate, 10 mM magnesium acetate, 100 μg/mL BSA pH 7.9 at 25 °C, NEB) were used without the enzymes. The mixture was heated first to 95 °C for 5 min, then slowly cooled down to RT and finally incubated at 37 °C with shaking. Four time points were taken (30 min, 1 h, 2 h, 6 h). After each incubation, the diamond crystallites were washed several times with H2O, and the radioactivity present on the crystallites and in the washes was measured. (b) One of the diamond–DNA conjugates (1 mg, ON-1 or ON-2), EcoRV (20 U, 1 μL) and Nt.BbvCI (10 U, 1 μL) in Cutsmart reaction buffer (50 mM potassium acetate, 20 mM Tris–acetate, 10 mM magnesium acetate, 100 μg/mL BSA pH 7.9 at 25 °C, NEB) were used. The mixture was heated first to 95 °C for 5 min, then slowly cooled down to RT and finally incubated at 37 °C with shaking. Four time points were taken (30 min, 1 h, 2 h, 6 h). After each incubation, the diamond crystallites were washed several times with H2O, and the radioactivity present on the crystallites and in the washes was measured. (c) Diamond–DNA conjugates (1 mg each) with just one of the enzymes (EcoRV (20 U, 1 μL) or Nt.BbvCI (10 U, 1 μL)) in Cutsmart reaction buffer (50 mM potassium acetate, 20 mM Tris–acetate, 10 mM magnesium acetate, 100 μg/mL BSA pH 7.9 at 25 °C, NEB) were used. The mixture was heated first to 95 °C for 5 min, then slowly cooled down to RT and finally incubated at 37 °C with shaking. Four time points were taken (30 min, 1 h, 2 h, 6 h). After each incubation, the diamond crystallites were washed several times with H2O, and the radioactivity present on the crystallites and in the washes was measured. (d) Diamond–DNA conjugates (1 mg each), EcoRV (20 U, 1 μL) and/ or Nt.BbvCI (10 U, 1 μL) in Cutsmart reaction buffer (50 mM potassium acetate, 20 mM Tris–acetate, 10 mM magnesium acetate, 100 μg/mL BSA pH 7.9 at 25 °C, NEB) were used. The mixture was heated first to 95 °C for 5 min, then slowly cooled down to RT and finally incubated at 37 °C without any shaking/rocking for 16 h. Diamond crystallites were washed several times with H2O, and the radioactivity present on the diamonds and in the washes was measured. (e) For reactions where the hybridizing analyte was delivered from solution, diamond–DNA (ON-1, 0.5 mg) was incubated with Nt.BbvCI (20 U, 2 μL) in Cutsmart reaction buffer (NEB, 1×), at 37 °C without shaking/rocking for 16 h. The effect of hybridization prior to addition of the enzyme was also tested. (f) To demonstrate that physical proximity was required between diamonds carrying complementary DNA strands, contact was prevented with a barrier that was porous to any DNA that was released by leakage from the diamond. Here, diamond –DNA conjugates (ON-1, 1 mg in 1× Cutsmart buffer) and Nt.BbvCI
24
O. Yaren, S.A. Benner / Diamond & Related Materials 52 (2015) 18–24
(50 U, 5 μL) were placed on the bottom layer of the cellulose barrier in a small Petri dish. On the top of the cellulose barrier, the analyte (500 pmole, 5 μL) was placed, a short DNA strand that was complementary to the nicking site of the DNA strand immobilized on diamond. The reaction is incubated still at 37 °C for 5 h. After the incubation, the diamond crystallites were washed several times with H2O, and their radioactivity was measured. Same conditions were also applied to two diamond–DNA conjugates. One of the diamond–DNA was placed on top of the filter with the enzymes in reaction buffer; other diamond–DNA was placed under the filter in the same manner. (g) To test the stability of covalent bond between diamond surface and amino-modified DNA, two sets of diamond–DNA conjugates (ON-1 and ON-2, 1 mg each) were shaken separately in 1× Cutsmart buffer for 2 h at 37 °C. Then both solutions were mixed, EcoRV (100 U, 5 μL) and/or Nt.BbvCI (50 U, 5 μL) were added and incubated at 37 °C for 5 h without shaking. After the incubation, the diamond crystallites were washed several times with H2O, and their radioactivity was measured. 4.5. Inactivation of enzyme by diamond and availability of sites Diamond crystallites carrying DNA (d-ON1 and d-ON2, 2 mg) were incubated at 95 °C for 5 min and then slowly cooled to RT prior to addition of the enzyme. Nt.BbvCI (20 U) and EcoRV (40 U) were added and the mixture was incubated at 37 °C for 2 h. After incubation, the second portions of the enzymes are added, and the mixture was incubated at 37 °C for another 3 h. Finally the third portions of the enzymes are added, and the mixture was incubated at 37 °C for another 11 h giving a total of 16 h incubation. Each set of crystallites was washed several times with H2O, and the remaining radioactivity was quantitated to assess the extent of cleavage. 4.6. Restriction digests reactions in the presence of diamonds 1 and 2 Diamond-bound ON-1 (d-ON1 5 mg) and diamond-bound ON-2 (d-ON2, 5 mg) were incubated at 95 °C for 5 min. The mixture was then slowly cooled to RT. Enzymes (10 U of Nt.BbvCI, 20 U of EcoRV) were added, and the mixture was incubated by shaking at 37 °C. Five time points were taken (15 min, 45 min, 1 h, 2 h, 6 h). Each reaction is washed several times with H2O. Prime novelty This provides the first semi-quantitative statement about the steric hindrance created by a diamond surface with respect to immobilized DNA, as felt by restriction endonucleases, adding these endonucleases to the tool kit of enzymes that remain active in the presence of diamond surfaces and can transform DNA bound to those. It also provides a somewhat surprising result, showing that complementary DNA strands can productively interact even when they are bound to different diamond nanocrystallites. Acknowledgments We are indebted to support from the Defense Threat Reduction Agency (DTRA HDTRA1-13-1-0004) for their support of the basic science behind this work, as well as Firebird Biomolecular Sciences LLC (through a project funded by the Office of the Secretary of Defense W911NF-12-C-0059). References [1] S.L. Beaucage, Strategies in the preparation of DNA oligonucleotide arrays for diagnostic applications, Curr. Med. Chem. 8 (2001) 1213–1244.
[2] C. Stavis, et al., Surface functionalization of thin-film diamond for highly stable and selective biological interfaces, Proc. Natl. Acad. Sci. U. S. A. 108 (2011) 983–988. [3] M. Beier, J.D. Hoheisel, Versatile derivatisation of solid support media for covalent bonding on DNA-microchips, Nucleic Acids Res. 27 (1999) 1970–1977. [4] H.B. Man, D. Ho, Diamond as a nanomedical agent for versatile applications in drug delivery, imaging, and sensing, Phys. Status Solidi A 209 (2012) 1609–1618. [5] A. Sassolas, L.J. Blum, B.D. Leca-Bouvier, Immobilization strategies to develop enzymatic biosensors, Biotechnol. Adv. 30 (2012) 489–511. [6] J.-H. Yang, Y. Nakano, Y. Murakami, K.-S. Song, H. Kawarada, Functionalization of ultradispersed diamond for DNA detection, J. Nanopart. Res. 10 (2008) 69–75. [7] A. Carmon, T.J. Vision, S.E. Mitchell, T.W. Thannhauser, U. Muller, S. Kresovich, Solidphase PCR in microwells: effects of linker length and composition on tethering, hybridization, and extension, Biotechniques 32 (2002) 410–420. [8] Y.-C. Yeh, B. Creran, V.M. Rotello, Gold nanoparticles: preparation, properties, and applications in bionanotechnology, Nanoscale 4 (2012) 1871–1880. [9] V. Singh, M. Zharnikov, A. Gulino, T. Gupta, DNA immobilization, delivery and cleavage on solid supports, J. Mater. Chem. 21 (2011) 10602–10618. [10] J. Meinkoth, G. Wahl, Hybridization of nucleic acids immobilized on solid supports, Anal. Biochem. 138 (1984) 267–284. [11] R. Ohara, O. Ohara, A new solid-phase chemical DNA sequencing method which uses streptavidin-coated magnetic beads, DNA Res. 2 (1995) 123–128. [12] Y.-W. Lin, C.-W. Liu, H.-T. Chang, DNA functionalized gold nanoparticles for bioanalysis, Anal. Methods 1 (2009) 14–24. [13] S.A.J. van der Meulen, M.E. Leunissen, Solid colloids with surface-mobile DNA linkers, J. Am. Chem. Soc. 135 (2013) 15129–15134. [14] H.S. Kim, Y.S. Kye, D.S. Hage, Development and evaluation of N-hydroxysuccinimideactivated silica for immobilizing human serum albumin in liquid chromatography columns, J. Chromatogr. A 1049 (2004) 51–61. [15] M. Lu, T. Knickerbocker, W. Cai, W. Yang, R.J. Hamers, L.M. Smith, Invasive cleavage reactions on DNA-modified diamond surfaces, Biopolymers 73 (2004) 606–613. [16] J.E. Butler, Solid supports in enzyme-linked immunosorbent assay and other solidphase immunoassays, Methods 22 (2000) 4–23. [17] C.M. Niemeyer, M. Adler, S. Gao, L. Chi, Supramolecular DNA–streptavidin nanocircles with a covalently attached oligonucleotide moiety, J. Biomol. Struct. Dyn. 2 (2002) 223–230. [18] A. Haertl, et al., Protein-modified nanocrystalline diamond thin films for biosensor applications, Nat. Mater. 3 (2004) 736–742. [19] W. Yang, O. Auciello, et al., DNA-modified nanocrystalline diamond thin-films as stable, biologically active substrates, Nat. Mater. 1 (2002) 253–257. [20] I.P. Chang, K.C. Hwang, J.-a.A. Ho, C.-C. Lin, R.J.R. Hwu, J.-C. Horng, Facile surface functionalization of nanodiamonds, Langmuir 26 (2009) 3685–3689. [21] K. Ushizawa, Y. Sato, T. Mitsumori, T. Machinami, T. Ueda, T. Ando, Covalent immobilization of DNA on diamond and its verification by diffuse reflectance infrared spectroscopy, Chem. Phys. Lett. 351 (2002) 105–108. [22] T. Knickerbocker, T. Strother, M.P. Schwartz, J.N. Russell Jr., J. Butler, L.M. Smith, R.J. Hamers, DNA-modified diamond surfaces, Langmuir 19 (2003) 1938–1942. [23] S. Wenmackers, et al., Head-on immobilization of DNA fragments on CVD-diamond layers, Mater. Sci. Forum 492 (2005) 267–272. [24] P. Christiaens, et al., EDC-mediated DNA attachment to nanocrystalline CVD diamond films, Biosens. Bioelectron. 22 (2006) 170–177. [25] R.M. Smith, D.E. Hansen, The pH-rate profile for the hydrolysis of a peptide bond, J. Am. Chem. Soc. 120 (1998) 8910–8913. [26] R.A.R. Bryant, D.E. Hansen, Direct measurement of the uncatalyzed rate of hydrolysis of a peptide bond, J. Am. Chem. Soc. 118 (1996) 5498–5499. [27] A. Radzicka, R. Wolfenden, Rates of uncatalyzed peptide bond hydrolysis in neutral solution and the transition state affinities of proteases, J. Am. Chem. Soc. 118 (1996) 6105–6109. [28] J.-H. Yang, K.-S. Song, G.-J. Zhang, M. Degawa, Y. Sasaki, I. Ohdomari, H. Kawarada, Characterization of DNA hybridization on partially aminated diamond by aromatic compounds, Langmuir 22 (2006) 11245–11250. [29] V. Vermeeren, et al., Towards a real-time, label-free. Diamond-based DNA sensor, Langmuir 23 (2007) 13193–13202. [30] V. Vermeeren, S. Wenmackers, P. Wagner, L. Michiels, DNA sensors with diamond as a promising alternative transducer material, Sensors 9 (2009) 5600–5636. [31] S. Wenmackers, V. Vermeeren, V.M. vande, M. Ameloot, N. Bijnens, K. Haenen, L. Michiels, P. Wagner, Diamond-based DNA sensors: surface functionalization and read-out strategies, Phys. Status Solidi A 206 (2009) 391–408. [32] X. Wang, Y. Ishii, A.R. Ruslinda, M. Hasegawa, H. Kawarada, Effective surface functionalization of nanocrystalline diamond films by direct carboxylation for PDGF detection via aptasensor, ACS Appl. Mater. Interfaces 4 (2012) 3526–3534. [33] A. Rahim Ruslinda, K. Tanabe, S. Ibori, X. Wang, H. Kawarada, Effects of diamondFET-based RNA aptamer sensing for detection of real sample of HIV-1 Tat protein, Biosens. Bioelectron. 40 (2013) 277–282. [34] G.-J. Zhang, K.-S. Song, Y. Nakamura, T. Ueno, T. Funatsu, I. Ohdomari, H. Kawarada, DNA micropatterning on polycrystalline diamond via one-step direct amination, Langmuir 22 (2006) 3728–3734. [35] S. Wenmackers, K. Haenen, M. Nesládek, P. Wagner, L. Michiels, M. van de Ven, M. Ameloot, Covalent immobilization of DNA on CVD diamond films, Phys. Status Solidi A 199 (2003) 44–48. [36] T.L. Lasseter, B.H. Clare, N.L. Abbott, R.J. Hamers, Covalently modified silicon and diamond surfaces: resistance to nonspecific protein adsorption and optimization for biosensing, J. Am. Chem. Soc. 126 (2004) 10220–10221.