- Email: [email protected]
Restriction fragment length polymorphism analysis of multiple genome regions of Korean isolates of infectious laryngotracheitis virus collected from chickens
Restriction fragment length polymorphism analysis of multiple genome regions of Korean isolates of infectious laryngotracheitis virus collected from chickens Hye-Ryoung Kim, Min-Su Kang, Mi-Jin Kim, Hee-Soo Lee, and Yong-Kuk Kwon1 Avian Disease Division, Animal, Plant and Fisheries Quarantine and Inspection Agency, 175 Anyangro Manangu, Anyangsi, Gyeonggido 430-757, South Korea ulent viruses, and the Kr12AD37 isolate was considered an attenuated type according to Han’s RFLP method. These virulent Korean ILT viruses were divided into 3 classes (class I, II, and III). The Kr12AD37 isolate was found to have the same RFLP pattern as the Korean CEO vaccine strain, and both of these strains were different from the 3 foreign vaccine strains. The results suggest that the Korean CEO vaccine strain has been responsible for recent outbreaks, and the characterization of ILT viruses by RFLP was useful for diagnosis by providing epidemiological information.
Key words: herpesvirus, infectious laryngotracheitis virus, PCR-restriction fragment length polymorphism, sequence 2013 Poultry Science 92:2053–2058 http://dx.doi.org/10.3382/ps.2013-03134
INTRODUCTION Avian infectious laryngotracheitis (ILT) is a high contagious, acute respiratory disease in chickens and causes significant economic losses to both the layer and broiler industries (Guy and Bagust, 2003). The causative pathogen (ILTV) is a member of the Alphaherpesvirinae subfamily of the Herpesviridae family and can establish latent infections in the trigeminal ganglion, which makes control of the disease difficult (Williams et al., 1992; Roizman, 1996). Vaccination with live-attenuated vaccines has been widely used to control the spread of the disease in different parts of the world (Guy and Bagust, 2003). However, attenuated vaccines have disadvantages; for example, they can easily revert to virulent strains after bird-to-bird passage, infect unvaccinated birds, or can be reactivated after a period of latency (Guy et al., 1991; Hughes et al., 1991; Kotiw et al., 1995). Therefore, the differentiation of the ILTV involved in severe and mild outbreaks and the discrimination of wild-type and vaccine strains are important for ILT ©2013 Poultry Science Association Inc. Received February 21, 2013. Accepted April 14, 2013. 1 Corresponding author: [email protected]
control. In many studies, field isolates and vaccine strains of ILTV have been compared using RFLP analysis of the PCR products of multiple genes (Chang et al., 1997; Clavijo and Nagy, 1997; Graham et al., 2000; Han and Kim, 2001; Creelan et al., 2006; Kirkpatrick et al., 2006; Ojkic et al., 2006; Oldoni and Garcia, 2007). In South Korea, numerous commercially available vaccine strains of ILTV have been used within the poultry industry to control the rapid dissemination of this disease since the first outbreak of ILT in 1982 (Choi et al., 1985; Han and Kim, 2003). The frequency of ILT outbreaks in South Korea has decreased since 2004, and there was no ILT outbreak from 2006 to 2008. However, ILT outbreaks reoccurred in 2009 and increased sharply in 2010 with cases still being reported to date (Figure 1). We performed multiple PCR-RFLP analysis of 6 viral genome regions to genetically categorize 7 Korean ILTV isolates collected between 1986 and 2012 and 4 vaccine strains that have been approved by the Korean government and used on farms.
MATERIALS AND METHODS Strains, Isolates, and Propagation of ILTV Seven field isolates were collected during outbreaks of ILT in South Korea from 1986 to 2012. Trachea samples
2053
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 10, 2014
ABSTRACT This study was conducted to characterize infectious laryngotracheitis (ILT) viruses isolated from poultry in South Korea using RFLP analysis of PCR products. Seven wild-type Korean isolates from commercial chicken farms collected between 1986 and 2012 were compared with 3 imported commercial vaccine strains [LT Blen (Hudson strain, United States), Laryngo Vac (Cover strain, United States), and Nobilis ILT (Serva strain, France)] and a Korean chicken embryo origin (CEO) vaccine strain [ILT-VAC (Gyeonggi97 strain, Korea)]. Six of the field isolates were highly vir-
2054
Kim et al.
from chickens suspected of being infected with ILT virus were homogenized to yield 10% suspensions in PBS (pH 7.2). The homogenized samples were centrifuged at 3,000 × g for 10 min, and the supernatants were stored at −70°C. Four ILTV vaccine strains were used in this study: 3 imported commercial vaccine strains [LT Blen (Hudson strain, United States), Laryngo Vac (Cover strain, United States), and Nobilis ILT (Serva strain, France)], and a Korean chicken embryo origin (CEO) vaccine strain [ILT-VAC (Gyeonggi97 strain, Korea)]. All viruses were propagated in the chorioallantoic membranes (CAM) of embryonated chicken eggs (Hy-Vac, Redfield, IA). The CAM material was harvested from the eggs 5 d after inoculation.
Viral DNA was extracted from CAM material using the Viral Gene-spin viral DNA/RNA extraction kit (iNtRON Biotechnology, Seongnam, Korea). The field isolates were identified as ILTV using a PCR-based method. The PCR was conducted using the i-star Taq Maxime PCR Premix Kit (iNtRON Biotechnology) with primers that amplified a 588-bp region of the p32 gene, as previously described (Vögtlin et al., 1999). The PCR amplifications were performed under the following conditions in a T-gradient thermal cycler (Biometra, Gottingen, Germany): an initial denaturation step at 94°C for 7 min; 35 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 30 s; and a final extension at 72°C for 7 min.
Primers and PCR All primers used in this study were selected from among previously published primers (Table 1). Each amplification was performed using TaKaRa Ex Taq (TaKaRa, Shiga, Japan) in a 50-µL volume containing 2.5 mM deoxyribonucleotides (dNTP), 10 units of TaKaRa Ex Taq, 5 µL of Ex Taq Buffer, 2 mM MgCl2, 10 pmol of each primer, and 2 µL of template DNA. The PCR conditions for TKOP were 1 cycle of 3 min at 95°C; 30 cycles of 1 min at 94°C, 1.5 min at 59°C, and 1.5 min at 72°C; and a final extension at 72°C for 10 min. The reaction mixture for thymidine kinase (TK) was incubated at 94°C for 1 min, then subjected to 35 cycles of 94°C for 15 s, 60°C for 45 s, and 72°C for 60 s, followed by a final extension at 72°C for 3 min. The reaction mixtures for infected cell potential (ICP)4, ICP18.5, and open reading frame (ORF)B-TK were incubated at 94°C for 1 min and then subjected to 35 cycles of 94°C for 1 min and 68°C for 7 min, followed by incubation at 68°C for 10 min. The PCR conditions for UL47glycoprotein G (gG) were 1 cycle of 1 min at 94°C; 35 cycles of 1 min at 94°C, 1 min at 58°C, and 3 min at 68°C; and a final extension at 68°C for 7 min. The PCR products were electrophoresed on a 1% agarose gel at 100 V for 30 min and stained with ethidium
RFLP Analysis Ten microliters of each PCR product was digested separately with restriction endonucleases at 37°C for 2 h as described previously (Kirkpatrick et al., 2006). The restriction endonuclease (RE) HaeIII was used for the TKOP, ICP4, and UL47gG amplicons; MspI was used for the TK and UL47gG amplicons; and FokI was used for the ORFB-TK amplicon. After digestion, the DNA fragments were separated in an 8% polyacrylamide gel and visualized by staining with ethidium bromide. The gels were observed under UV light, and the differences in the pattern for each RE were classified.
Sequencing Analysis The amplified DNA fragments of the TK gene were extracted and purified using the QIAquick gel extraction kit (Qiagen), and the PCR products were sequenced at COSMO (Seoul, South Korea) with an ABI 3730 XL DNA sequencer (Applied Biosystems). The sequences of the strains were aligned and edited with Vector NTI (Invitrogen, Carlsbad, CA) and BioEdit (http://www.mbio.ncsu.edu/bioedit/bioedit.html).
RESULTS AND DISCUSSION The TK genes of the 7 field isolates and 4 vaccine strains were examined to assess the molecular determinants of virulence based on the previously described RFLP patterns (Han and Kim, 2001). One field isolate (Kr12AD37) and all vaccine strains had RFLP patterns indicative of low virulence, whereas the other 6 field isolates had patterns indicative of high virulence (Supplemental Figure 1; available online at http:// ps.fass.org/). This result was similar to that for the digestion of the TK gene using MspI according to the method of Kirkpatrick et al. (Table 2, Figure 2a). The ICP4 amplicons were digested with HaeIII and produced 3 different RFLP patterns (A, B, and C). The 6 field isolates with high virulence all had pattern A, but the Korean CEO vaccine strain and one field strain (Kr12AD37), which had pattern B, were differentiated from the imported vaccine strains, which had pattern C. Pattern B contains an additional fragment of approximately 400 bp (Figure 2b). In the case of the RFLP patterns for the ICP18.5 gene, all vaccine strains had identical patterns, and the 6 field viruses with high virulence were divided into 2 groups (Table 2, Figure 2c). The RFLP analysis of the ORF of the B-TK gene using FokI gave 2 different patterns that were not associated with virulence, and only the Kr04172 virus among the high-virulence strains had the same pattern as the low-virulence strains (Table 2, Figure 2d). The RFLP analysis of the UL47/gG using HaeIII and MspI
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 10, 2014
Extraction and Detection of Viral DNA
bromide. The PCR products were visualized by exposure to UV light.
2055
RESEARCH NOTE
was performed to discriminate low-virulence strains from vaccine strains, and this RFLP analysis yielded 3 patterns for these 2 different groups. Based on the patterns for UL47/gG generated with HaeIII, the Korean strains could be differentiated from the foreign vaccine strains, and the Hudson strain could be differentiated from the 2 other foreign vaccine strains based on the patterns for UL47/gG generated with MspI (Table 2, Figure 2e and 2f). The classification of the ILTV based on the RFLP patterns generated from the TK, ICP4, ICP18.5, ORFB-TK, and UL47/gG genes revealed that the ILTV isolates fell into 6 different classes: I, II, III, IV, V, and VI. The field ILT isolates obtained from 1986 to 2004 were highly virulent and were divided into 3 classes, I to III. Both 2012 isolate and the Gyeonggi97 strain were class IV and could not be differentiated by
RFLP. The Serva and Cover strains were class V, but Hudson was classified into class VI because of the different pattern for UL47/gG when digested with MspI. To compare the nucleotide and amino acid sequences of the TK gene, the nucleotide sequences of the virulent strains (Kr86RB, Kr88337, Kr91B1, Kr03345, Kr04172), the low-virulence strains (Kr12AD37) and the 4 vaccine strains were aligned. All sequences exhibited a high level of homology (>99%). The amino acids at positions in the TK gene alignment that were found to be variable in a previous study were compared between the Korean field isolates and the vaccine strains (Han and Kim, 2001). The amino acids at positions 26, 101 to 103, 138, 218, and 245 were F, R-R-V, P, A, and Q, respectively, and these amino acids were the same in all field and vaccine strains. However, the amino acid at 252 was methionine (ATG) in virulent strains
Table 1. Primers and genome regions used in PCR-RFLP analysis Primer1 TKOP F TKOP R TK F TK R ICP4 F ICP4 R ICP18.5 F ICP18.5 R ORF B-TK F ORF B-TK R UL47gG F UL47gG R 1F
Target gene2 TK TK ICP4 ICP18.5 ORF B-TK UL47gG
Size (kbp)
Target gene sequence (59–39) CGGGATCCATCGTATAGGCCAGCCTT GCTCTAGACCACGCTCTCTCGAGTAA CTGGGCTAAATCATCCAAGACATCA GCTCTCTCGAGTAAGAATGAGTACA AAACCTGTAGAGACAGTACCGTGAC ATTACTACGTGACCTACATTGAGCC TCGCTTGCAAGGTCTTCTGATGG AGAAGATGTTAATTCACACGGACAC TCTGCGATCTTCGCAGTGGTCAG TGACGAGGAGAGCGAACTTTAATCC TCTTGAATGACCTTGCCCCAT ACTCTCGGGTGGCTACTGCTG
1.3 2.24 4.98 5.89 4.68 2.93
= forward; R = reverse. = thymidine kinase; ICP = infected cell protein; ORF = open reading frame; gG = glycoprotein G.
2TK
Reference Han and Kim (2001) Kirkpatrick et al. (2006)
Oldoni and Garcia (2007)
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 10, 2014
Figure 1. Number of chickens infected with infectious laryngotracheitis (ILT) in South Korea between 2000 and 2012. This graph was obtained from the Korea Animal Health Integrated System developed and operated by the Animal, Plant and Fisheries Quarantine and Inspection Agency.
2056
I I I II II III IV IV V VI V AAAA AAAA AAAA AABA AABA AAAB BBBBBA BBBBBA BCBBAB BCBBAA BCBBAB = not done; vir: virulent; att: attenuated. 1—
Vaccine strain
Field isolate
Kr86RB Kr88337 Kr91B1 Kr92B1 Kr03345 Kr04172 Kr12AD37 Gyeonggi97 Serva Hudson Cover
vir vir vir vir vir vir att att att att att
A A A A A A B B B B B
A A A A A A B B C C C
A A A B B A B B B B B
A A A A A B B B B B B
— — — — — — B B A A A
— — — — — — A A B A B
Class Pattern combination UL47/gG MspI UL47/gG HaeIII ORFB-TK FokI ICP18.5 HaeIII ICP4 HaeIII TK MspI TK HaeIII Isolate/ strain Group
RFLP pattern (PCR product/restriction enzyme)
and threonine (ACG) in the other strains. The comparison of TK gene revealed no difference between the low-virulence field virus (Kr12AD37) and the Gyeonggi97 strain (Supplemental Table 1; available online at http://ps.fass.org/). The RFLP-PCR analysis based on the TK and gG genes of ILTV was able to discriminate several field ILTV isolated in Korea from 1982 to 1998 by virulence, and the field isolates with high virulence were classified into 2 groups. However, this method did not differentiate low- virulence strains and vaccine strains (Han and Kim, 2001). We genetically characterized the ILTV isolates collected between 1986 and 2012 in South Korea and the 4 vaccine strains. Six RFLP pattern combinations were produced by the digestion of 5 genome regions with 3 RE. The 6 high-virulence field isolates were separated into 3 groups (I, II, and III) based on the RE patterns of the ICP18.5 and ORFB-TK genes, and the 5 ILTV that were low-virulence or vaccine strains were categorized into 3 groups (IV, V, and VI) based on the RE patterns of ICP4 and UL47/gG genes. The ICP4/HaeIII digestion pattern could distinguish between the Korean vaccine strain (Gyeonggi97) and the foreign vaccine strains (Serva, Hudson, and Cover). However, the low-virulence field isolate (Kr12AD37) and the Gyeonggi97 strain were not different, and sequence analysis of the TK gene did not allow the differentiation of these 2 viruses. It is not known if the Kr12AD37 isolate was originated from a vaccine strain that lost attenuation or has continually persisted in the field. However, there was no ILT outbreak between 2006 and 2008 in South Korea, and this Kr12AD37 isolate was responsible for the recent ILT outbreaks. This pattern is closely analogous to recent ILT outbreaks in Northern Ireland, Taiwan, the United States, and Australia that were caused by field isolates that originated from various vaccine strains (Chang et al., 1997; Graham et al., 2000; Oldoni and Garcia, 2007; Blacker et al., 2011). In addition, new virulent field viruses recently emerged in Australia that appeared to have arisen due to recombination between attenuated vaccine strains of Australian-origin vaccine strains (SA 2 and A20) and imported the Serva vaccine strain (Intervet, Nobilis ILT; Lee et al., 2012). In South Korea, the diverse vaccine strains (Gyeonggi97, Serva, Hudson, and Cover) used in the poultry industry each had an RFLP pattern different from that of the Australian vaccine strains, and they were not derived from field isolates with high virulence. However, the use of multiple live ILT vaccine strains concerns us. It is possible that various strains that have lost attenuation could cause economic losses and that new viruses generated by recombination among co-circulating viruses could emerge (Blacker et al., 2011; Lee et al., 2012). In summary, this study undertook the genetic characterization of ILT viruses isolated in South Korea from 1986 to 2012 along with vaccine strains using PCRRFLP of multiple genome regions. Field isolates col-
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 10, 2014
Table 2. Comparison of patterns generated by PCR-RFLP of selected regions from different infectious laryngotracheitis virus isolates and strains1
Kim et al.
2057
RESEARCH NOTE
lected between 1986 and 2004 were virulent ILTV, and all viruses, including vaccine strains, used in this study were divided into 6 distinct genotype groups based on the RFLP patterns. However, the low-virulence isolate collected in 2012 and the Korean CEO vaccine strain could not be differentiated by RFLP patterns or sequence analysis. This result suggests that this vaccine strain could be responsible for the recent field outbreak in South Korea. Consequentially, this report is useful for the differentiation of ILTV field isolates and vaccine strains, and for the development of vaccination strategies to control ILT in South Korea. Further studies are
required to monitor clinical isolates of ILTV for signs that they originated from vaccine strains.
ACKNOWLEDGMENTS The authors thank Hyuk-Man Kwon (Avian Disease Division, Animal, Plant and Fisheries Quarantine and Inspection Agency) for excellent technical assistance. This work was supported by a grant from the National Animal Disease Control Project of the Ministry of Food, Agriculture, Forest and Fisheries of Korea.
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 10, 2014
Figure 2. Polyacrylamide gel electrophoresis of DNA fragments generated by restriction endonuclease digestion. a) TK digested with MspI; b) ICP4 digested with HaeIII; c) ICP18.5 digested with HaeIII; d) ORFB TK digested with FokI; e) UL47/gG digested with HaeIII; f) UL47/ gG digested with MspI. MW is the molecular weight marker. The scales to the left or right of the gel indicate the size in kilobase pairs. A, B, and C indicate the different pattern of RFLP.
2058
Kim et al.
REFERENCES
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 10, 2014
Blacker, H., N. Kirkpatrick, A. Rubite, D. O’Rourke, and A. Noormohammadi. 2011. Epidemiology of recent outbreaks of infectious laryngotracheitis in poultry in Australia. Aust. Vet. J. 89:89–94. Chang, P. C., Y. L. Lee, J. H. Shien, and H. K. Shieh. 1997. Rapid differentiation of vaccine strains and field isolates of infectious laryngotracheitis virus by restriction fragment length polymorphism of PCR products. J. Virol. Methods 66:179–186. Choi, C. O., J. H. Kim, and J. H. Kwon. 1985. Outbreaks of infectious laryngotracheitis in Korea. Pages 355–356 in Veterinary Viral Disease: Their Significance in South-East Asia and the Western Pacific. A. J. Della-Porta, ed. Academic Press, North Ryde, Australia. Clavijo, A., and É. Nagy. 1997. Differentiation of infectious laryngotracheitis virus strains by polymerase chain reaction. Avian Dis. 41:241–246. Creelan, J. L., V. M. Calvert, D. A. Graham, and S. J. McCullough. 2006. Rapid detection and characterization from field cases of infectious laryngotracheitis virus by real-time polymerase chain reaction and restriction fragment length polymorphism. Avian Pathol. 35:173–179. Graham, D., I. McLaren, V. Calvert, D. Torrens, and B. Meehan. 2000. RFLP analysis of recent Northern Ireland isolates of infectious laryngotracheitis virus: Comparison with vaccine virus and field isolates from England, Scotland and the Republic of Ireland. Avian Pathol. 29:57–62. Guy, J. S., and T. J. Bagust. 2003. Laryngotracheitis. Pages 121–134 in Diseases of Poultry. Y. M. Saif, H. J. Barnes, J. R. Glisom, A. M. Fadly, L. R. McDougald, and D. E. Swayne, ed. Iowa State University Press, Ames. Guy, J. S., H. J. Barnes, and L. Smith. 1991. Increased virulence of modified-live infectious laryngotracheitis vaccine virus following bird-to-bird passage. Avian Dis. 35:348–355. Han, M. G., and S. J. Kim. 2001. Analysis of Korean strains of infectious laryngotracheitis virus by nucleotide sequences and restriction fragment length polymorphism. Vet. Microbiol. 83:321–331.
Han, M. G., and S. J. Kim. 2003. Efficacy of live virus vaccines against infectious laryngotracheitis assessed by polymerase chain reaction-restriction fragment length polymorphism. Avian Dis. 47:261–271. Hughes, C., R. Williams, R. Gaskell, F. Jordan, J. Bradbury, M. Bennett, and R. Jones. 1991. Latency and reactivation of infectious laryngotracheitis vaccine virus. Arch. Virol. 121:213–218. Kirkpatrick, N. C., A. Mahmoudian, D. O’Rourke, and A. H. Noormohammadi. 2006. Differentiation of infectious laryngotracheitis virus isolates by restriction fragment length polymorphic analysis of polymerase chain reaction products amplified from multiple genes. Avian Dis. 50:28–34. Kotiw, M., C. Wilks, and J. May. 1995. The effect of serial in vivo passage on the expression of virulence and DNA stability of an infectious laryngotracheitis virus strain of low virulence. Vet. Microbiol. 45:71–80. Lee, S. W., P. F. Markham, M. J. C. Coppo, A. R. Legione, J. F. Markham, A. H. Noormohammadi, G. F. Browning, N. Ficorilli, C. A. Hartley, and J. M. Devlin. 2012. Attenuated vaccines can recombine to form virulent field viruses. Science 337:188. Ojkic, D., J. Swinton, M. Vallieres, E. Martin, J. Shapiro, B. Sanei, and B. Binnington. 2006. Characterization of field isolates of infectious laryngotracheitis virus from Ontario. Avian Pathol. 35:286–292. Oldoni, I., and M. Garcia. 2007. Characterization of infectious laryngotracheitis virus isolates from the US by polymerase chain reaction and restriction fragment length polymorphism of multiple genome regions. Avian Pathol. 36:167–176. Roizman, B. 1996. Herpesviridae. Pages 2221–2230 in Virology. 3rd ed. B. N. Fields, D. M. Knipe, and P. M. Howley, ed. LippincottRaven, Philadelphia, PA. Vögtlin, A., L. Bruckner, and H. P. Ottiger. 1999. Use of polymerase chain reaction (PCR) for the detection of vaccine contamination by infectious laryngotracheitis virus. Vaccine 17:2501–2506. Williams, R., M. Bennett, J. Bradbury, R. Gaskell, R. Jones, and F. Jordan. 1992. Demonstration of sites of latency of infectious laryngotracheitis virus using the polymerase chain reaction. J. Gen. Virol. 73:2415–2520.
Key words: herpesvirus, infectious laryngotracheitis virus, PCR-restriction fragment length polymorphism, sequence 2013 Poultry Science 92:2053–2058 http://dx.doi.org/10.3382/ps.2013-03134
INTRODUCTION Avian infectious laryngotracheitis (ILT) is a high contagious, acute respiratory disease in chickens and causes significant economic losses to both the layer and broiler industries (Guy and Bagust, 2003). The causative pathogen (ILTV) is a member of the Alphaherpesvirinae subfamily of the Herpesviridae family and can establish latent infections in the trigeminal ganglion, which makes control of the disease difficult (Williams et al., 1992; Roizman, 1996). Vaccination with live-attenuated vaccines has been widely used to control the spread of the disease in different parts of the world (Guy and Bagust, 2003). However, attenuated vaccines have disadvantages; for example, they can easily revert to virulent strains after bird-to-bird passage, infect unvaccinated birds, or can be reactivated after a period of latency (Guy et al., 1991; Hughes et al., 1991; Kotiw et al., 1995). Therefore, the differentiation of the ILTV involved in severe and mild outbreaks and the discrimination of wild-type and vaccine strains are important for ILT ©2013 Poultry Science Association Inc. Received February 21, 2013. Accepted April 14, 2013. 1 Corresponding author: [email protected]
control. In many studies, field isolates and vaccine strains of ILTV have been compared using RFLP analysis of the PCR products of multiple genes (Chang et al., 1997; Clavijo and Nagy, 1997; Graham et al., 2000; Han and Kim, 2001; Creelan et al., 2006; Kirkpatrick et al., 2006; Ojkic et al., 2006; Oldoni and Garcia, 2007). In South Korea, numerous commercially available vaccine strains of ILTV have been used within the poultry industry to control the rapid dissemination of this disease since the first outbreak of ILT in 1982 (Choi et al., 1985; Han and Kim, 2003). The frequency of ILT outbreaks in South Korea has decreased since 2004, and there was no ILT outbreak from 2006 to 2008. However, ILT outbreaks reoccurred in 2009 and increased sharply in 2010 with cases still being reported to date (Figure 1). We performed multiple PCR-RFLP analysis of 6 viral genome regions to genetically categorize 7 Korean ILTV isolates collected between 1986 and 2012 and 4 vaccine strains that have been approved by the Korean government and used on farms.
MATERIALS AND METHODS Strains, Isolates, and Propagation of ILTV Seven field isolates were collected during outbreaks of ILT in South Korea from 1986 to 2012. Trachea samples
2053
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 10, 2014
ABSTRACT This study was conducted to characterize infectious laryngotracheitis (ILT) viruses isolated from poultry in South Korea using RFLP analysis of PCR products. Seven wild-type Korean isolates from commercial chicken farms collected between 1986 and 2012 were compared with 3 imported commercial vaccine strains [LT Blen (Hudson strain, United States), Laryngo Vac (Cover strain, United States), and Nobilis ILT (Serva strain, France)] and a Korean chicken embryo origin (CEO) vaccine strain [ILT-VAC (Gyeonggi97 strain, Korea)]. Six of the field isolates were highly vir-
2054
Kim et al.
from chickens suspected of being infected with ILT virus were homogenized to yield 10% suspensions in PBS (pH 7.2). The homogenized samples were centrifuged at 3,000 × g for 10 min, and the supernatants were stored at −70°C. Four ILTV vaccine strains were used in this study: 3 imported commercial vaccine strains [LT Blen (Hudson strain, United States), Laryngo Vac (Cover strain, United States), and Nobilis ILT (Serva strain, France)], and a Korean chicken embryo origin (CEO) vaccine strain [ILT-VAC (Gyeonggi97 strain, Korea)]. All viruses were propagated in the chorioallantoic membranes (CAM) of embryonated chicken eggs (Hy-Vac, Redfield, IA). The CAM material was harvested from the eggs 5 d after inoculation.
Viral DNA was extracted from CAM material using the Viral Gene-spin viral DNA/RNA extraction kit (iNtRON Biotechnology, Seongnam, Korea). The field isolates were identified as ILTV using a PCR-based method. The PCR was conducted using the i-star Taq Maxime PCR Premix Kit (iNtRON Biotechnology) with primers that amplified a 588-bp region of the p32 gene, as previously described (Vögtlin et al., 1999). The PCR amplifications were performed under the following conditions in a T-gradient thermal cycler (Biometra, Gottingen, Germany): an initial denaturation step at 94°C for 7 min; 35 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 30 s; and a final extension at 72°C for 7 min.
Primers and PCR All primers used in this study were selected from among previously published primers (Table 1). Each amplification was performed using TaKaRa Ex Taq (TaKaRa, Shiga, Japan) in a 50-µL volume containing 2.5 mM deoxyribonucleotides (dNTP), 10 units of TaKaRa Ex Taq, 5 µL of Ex Taq Buffer, 2 mM MgCl2, 10 pmol of each primer, and 2 µL of template DNA. The PCR conditions for TKOP were 1 cycle of 3 min at 95°C; 30 cycles of 1 min at 94°C, 1.5 min at 59°C, and 1.5 min at 72°C; and a final extension at 72°C for 10 min. The reaction mixture for thymidine kinase (TK) was incubated at 94°C for 1 min, then subjected to 35 cycles of 94°C for 15 s, 60°C for 45 s, and 72°C for 60 s, followed by a final extension at 72°C for 3 min. The reaction mixtures for infected cell potential (ICP)4, ICP18.5, and open reading frame (ORF)B-TK were incubated at 94°C for 1 min and then subjected to 35 cycles of 94°C for 1 min and 68°C for 7 min, followed by incubation at 68°C for 10 min. The PCR conditions for UL47glycoprotein G (gG) were 1 cycle of 1 min at 94°C; 35 cycles of 1 min at 94°C, 1 min at 58°C, and 3 min at 68°C; and a final extension at 68°C for 7 min. The PCR products were electrophoresed on a 1% agarose gel at 100 V for 30 min and stained with ethidium
RFLP Analysis Ten microliters of each PCR product was digested separately with restriction endonucleases at 37°C for 2 h as described previously (Kirkpatrick et al., 2006). The restriction endonuclease (RE) HaeIII was used for the TKOP, ICP4, and UL47gG amplicons; MspI was used for the TK and UL47gG amplicons; and FokI was used for the ORFB-TK amplicon. After digestion, the DNA fragments were separated in an 8% polyacrylamide gel and visualized by staining with ethidium bromide. The gels were observed under UV light, and the differences in the pattern for each RE were classified.
Sequencing Analysis The amplified DNA fragments of the TK gene were extracted and purified using the QIAquick gel extraction kit (Qiagen), and the PCR products were sequenced at COSMO (Seoul, South Korea) with an ABI 3730 XL DNA sequencer (Applied Biosystems). The sequences of the strains were aligned and edited with Vector NTI (Invitrogen, Carlsbad, CA) and BioEdit (http://www.mbio.ncsu.edu/bioedit/bioedit.html).
RESULTS AND DISCUSSION The TK genes of the 7 field isolates and 4 vaccine strains were examined to assess the molecular determinants of virulence based on the previously described RFLP patterns (Han and Kim, 2001). One field isolate (Kr12AD37) and all vaccine strains had RFLP patterns indicative of low virulence, whereas the other 6 field isolates had patterns indicative of high virulence (Supplemental Figure 1; available online at http:// ps.fass.org/). This result was similar to that for the digestion of the TK gene using MspI according to the method of Kirkpatrick et al. (Table 2, Figure 2a). The ICP4 amplicons were digested with HaeIII and produced 3 different RFLP patterns (A, B, and C). The 6 field isolates with high virulence all had pattern A, but the Korean CEO vaccine strain and one field strain (Kr12AD37), which had pattern B, were differentiated from the imported vaccine strains, which had pattern C. Pattern B contains an additional fragment of approximately 400 bp (Figure 2b). In the case of the RFLP patterns for the ICP18.5 gene, all vaccine strains had identical patterns, and the 6 field viruses with high virulence were divided into 2 groups (Table 2, Figure 2c). The RFLP analysis of the ORF of the B-TK gene using FokI gave 2 different patterns that were not associated with virulence, and only the Kr04172 virus among the high-virulence strains had the same pattern as the low-virulence strains (Table 2, Figure 2d). The RFLP analysis of the UL47/gG using HaeIII and MspI
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 10, 2014
Extraction and Detection of Viral DNA
bromide. The PCR products were visualized by exposure to UV light.
2055
RESEARCH NOTE
was performed to discriminate low-virulence strains from vaccine strains, and this RFLP analysis yielded 3 patterns for these 2 different groups. Based on the patterns for UL47/gG generated with HaeIII, the Korean strains could be differentiated from the foreign vaccine strains, and the Hudson strain could be differentiated from the 2 other foreign vaccine strains based on the patterns for UL47/gG generated with MspI (Table 2, Figure 2e and 2f). The classification of the ILTV based on the RFLP patterns generated from the TK, ICP4, ICP18.5, ORFB-TK, and UL47/gG genes revealed that the ILTV isolates fell into 6 different classes: I, II, III, IV, V, and VI. The field ILT isolates obtained from 1986 to 2004 were highly virulent and were divided into 3 classes, I to III. Both 2012 isolate and the Gyeonggi97 strain were class IV and could not be differentiated by
RFLP. The Serva and Cover strains were class V, but Hudson was classified into class VI because of the different pattern for UL47/gG when digested with MspI. To compare the nucleotide and amino acid sequences of the TK gene, the nucleotide sequences of the virulent strains (Kr86RB, Kr88337, Kr91B1, Kr03345, Kr04172), the low-virulence strains (Kr12AD37) and the 4 vaccine strains were aligned. All sequences exhibited a high level of homology (>99%). The amino acids at positions in the TK gene alignment that were found to be variable in a previous study were compared between the Korean field isolates and the vaccine strains (Han and Kim, 2001). The amino acids at positions 26, 101 to 103, 138, 218, and 245 were F, R-R-V, P, A, and Q, respectively, and these amino acids were the same in all field and vaccine strains. However, the amino acid at 252 was methionine (ATG) in virulent strains
Table 1. Primers and genome regions used in PCR-RFLP analysis Primer1 TKOP F TKOP R TK F TK R ICP4 F ICP4 R ICP18.5 F ICP18.5 R ORF B-TK F ORF B-TK R UL47gG F UL47gG R 1F
Target gene2 TK TK ICP4 ICP18.5 ORF B-TK UL47gG
Size (kbp)
Target gene sequence (59–39) CGGGATCCATCGTATAGGCCAGCCTT GCTCTAGACCACGCTCTCTCGAGTAA CTGGGCTAAATCATCCAAGACATCA GCTCTCTCGAGTAAGAATGAGTACA AAACCTGTAGAGACAGTACCGTGAC ATTACTACGTGACCTACATTGAGCC TCGCTTGCAAGGTCTTCTGATGG AGAAGATGTTAATTCACACGGACAC TCTGCGATCTTCGCAGTGGTCAG TGACGAGGAGAGCGAACTTTAATCC TCTTGAATGACCTTGCCCCAT ACTCTCGGGTGGCTACTGCTG
1.3 2.24 4.98 5.89 4.68 2.93
= forward; R = reverse. = thymidine kinase; ICP = infected cell protein; ORF = open reading frame; gG = glycoprotein G.
2TK
Reference Han and Kim (2001) Kirkpatrick et al. (2006)
Oldoni and Garcia (2007)
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 10, 2014
Figure 1. Number of chickens infected with infectious laryngotracheitis (ILT) in South Korea between 2000 and 2012. This graph was obtained from the Korea Animal Health Integrated System developed and operated by the Animal, Plant and Fisheries Quarantine and Inspection Agency.
2056
I I I II II III IV IV V VI V AAAA AAAA AAAA AABA AABA AAAB BBBBBA BBBBBA BCBBAB BCBBAA BCBBAB = not done; vir: virulent; att: attenuated. 1—
Vaccine strain
Field isolate
Kr86RB Kr88337 Kr91B1 Kr92B1 Kr03345 Kr04172 Kr12AD37 Gyeonggi97 Serva Hudson Cover
vir vir vir vir vir vir att att att att att
A A A A A A B B B B B
A A A A A A B B C C C
A A A B B A B B B B B
A A A A A B B B B B B
— — — — — — B B A A A
— — — — — — A A B A B
Class Pattern combination UL47/gG MspI UL47/gG HaeIII ORFB-TK FokI ICP18.5 HaeIII ICP4 HaeIII TK MspI TK HaeIII Isolate/ strain Group
RFLP pattern (PCR product/restriction enzyme)
and threonine (ACG) in the other strains. The comparison of TK gene revealed no difference between the low-virulence field virus (Kr12AD37) and the Gyeonggi97 strain (Supplemental Table 1; available online at http://ps.fass.org/). The RFLP-PCR analysis based on the TK and gG genes of ILTV was able to discriminate several field ILTV isolated in Korea from 1982 to 1998 by virulence, and the field isolates with high virulence were classified into 2 groups. However, this method did not differentiate low- virulence strains and vaccine strains (Han and Kim, 2001). We genetically characterized the ILTV isolates collected between 1986 and 2012 in South Korea and the 4 vaccine strains. Six RFLP pattern combinations were produced by the digestion of 5 genome regions with 3 RE. The 6 high-virulence field isolates were separated into 3 groups (I, II, and III) based on the RE patterns of the ICP18.5 and ORFB-TK genes, and the 5 ILTV that were low-virulence or vaccine strains were categorized into 3 groups (IV, V, and VI) based on the RE patterns of ICP4 and UL47/gG genes. The ICP4/HaeIII digestion pattern could distinguish between the Korean vaccine strain (Gyeonggi97) and the foreign vaccine strains (Serva, Hudson, and Cover). However, the low-virulence field isolate (Kr12AD37) and the Gyeonggi97 strain were not different, and sequence analysis of the TK gene did not allow the differentiation of these 2 viruses. It is not known if the Kr12AD37 isolate was originated from a vaccine strain that lost attenuation or has continually persisted in the field. However, there was no ILT outbreak between 2006 and 2008 in South Korea, and this Kr12AD37 isolate was responsible for the recent ILT outbreaks. This pattern is closely analogous to recent ILT outbreaks in Northern Ireland, Taiwan, the United States, and Australia that were caused by field isolates that originated from various vaccine strains (Chang et al., 1997; Graham et al., 2000; Oldoni and Garcia, 2007; Blacker et al., 2011). In addition, new virulent field viruses recently emerged in Australia that appeared to have arisen due to recombination between attenuated vaccine strains of Australian-origin vaccine strains (SA 2 and A20) and imported the Serva vaccine strain (Intervet, Nobilis ILT; Lee et al., 2012). In South Korea, the diverse vaccine strains (Gyeonggi97, Serva, Hudson, and Cover) used in the poultry industry each had an RFLP pattern different from that of the Australian vaccine strains, and they were not derived from field isolates with high virulence. However, the use of multiple live ILT vaccine strains concerns us. It is possible that various strains that have lost attenuation could cause economic losses and that new viruses generated by recombination among co-circulating viruses could emerge (Blacker et al., 2011; Lee et al., 2012). In summary, this study undertook the genetic characterization of ILT viruses isolated in South Korea from 1986 to 2012 along with vaccine strains using PCRRFLP of multiple genome regions. Field isolates col-
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 10, 2014
Table 2. Comparison of patterns generated by PCR-RFLP of selected regions from different infectious laryngotracheitis virus isolates and strains1
Kim et al.
2057
RESEARCH NOTE
lected between 1986 and 2004 were virulent ILTV, and all viruses, including vaccine strains, used in this study were divided into 6 distinct genotype groups based on the RFLP patterns. However, the low-virulence isolate collected in 2012 and the Korean CEO vaccine strain could not be differentiated by RFLP patterns or sequence analysis. This result suggests that this vaccine strain could be responsible for the recent field outbreak in South Korea. Consequentially, this report is useful for the differentiation of ILTV field isolates and vaccine strains, and for the development of vaccination strategies to control ILT in South Korea. Further studies are
required to monitor clinical isolates of ILTV for signs that they originated from vaccine strains.
ACKNOWLEDGMENTS The authors thank Hyuk-Man Kwon (Avian Disease Division, Animal, Plant and Fisheries Quarantine and Inspection Agency) for excellent technical assistance. This work was supported by a grant from the National Animal Disease Control Project of the Ministry of Food, Agriculture, Forest and Fisheries of Korea.
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 10, 2014
Figure 2. Polyacrylamide gel electrophoresis of DNA fragments generated by restriction endonuclease digestion. a) TK digested with MspI; b) ICP4 digested with HaeIII; c) ICP18.5 digested with HaeIII; d) ORFB TK digested with FokI; e) UL47/gG digested with HaeIII; f) UL47/ gG digested with MspI. MW is the molecular weight marker. The scales to the left or right of the gel indicate the size in kilobase pairs. A, B, and C indicate the different pattern of RFLP.
2058
Kim et al.
REFERENCES
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 10, 2014
Blacker, H., N. Kirkpatrick, A. Rubite, D. O’Rourke, and A. Noormohammadi. 2011. Epidemiology of recent outbreaks of infectious laryngotracheitis in poultry in Australia. Aust. Vet. J. 89:89–94. Chang, P. C., Y. L. Lee, J. H. Shien, and H. K. Shieh. 1997. Rapid differentiation of vaccine strains and field isolates of infectious laryngotracheitis virus by restriction fragment length polymorphism of PCR products. J. Virol. Methods 66:179–186. Choi, C. O., J. H. Kim, and J. H. Kwon. 1985. Outbreaks of infectious laryngotracheitis in Korea. Pages 355–356 in Veterinary Viral Disease: Their Significance in South-East Asia and the Western Pacific. A. J. Della-Porta, ed. Academic Press, North Ryde, Australia. Clavijo, A., and É. Nagy. 1997. Differentiation of infectious laryngotracheitis virus strains by polymerase chain reaction. Avian Dis. 41:241–246. Creelan, J. L., V. M. Calvert, D. A. Graham, and S. J. McCullough. 2006. Rapid detection and characterization from field cases of infectious laryngotracheitis virus by real-time polymerase chain reaction and restriction fragment length polymorphism. Avian Pathol. 35:173–179. Graham, D., I. McLaren, V. Calvert, D. Torrens, and B. Meehan. 2000. RFLP analysis of recent Northern Ireland isolates of infectious laryngotracheitis virus: Comparison with vaccine virus and field isolates from England, Scotland and the Republic of Ireland. Avian Pathol. 29:57–62. Guy, J. S., and T. J. Bagust. 2003. Laryngotracheitis. Pages 121–134 in Diseases of Poultry. Y. M. Saif, H. J. Barnes, J. R. Glisom, A. M. Fadly, L. R. McDougald, and D. E. Swayne, ed. Iowa State University Press, Ames. Guy, J. S., H. J. Barnes, and L. Smith. 1991. Increased virulence of modified-live infectious laryngotracheitis vaccine virus following bird-to-bird passage. Avian Dis. 35:348–355. Han, M. G., and S. J. Kim. 2001. Analysis of Korean strains of infectious laryngotracheitis virus by nucleotide sequences and restriction fragment length polymorphism. Vet. Microbiol. 83:321–331.
Han, M. G., and S. J. Kim. 2003. Efficacy of live virus vaccines against infectious laryngotracheitis assessed by polymerase chain reaction-restriction fragment length polymorphism. Avian Dis. 47:261–271. Hughes, C., R. Williams, R. Gaskell, F. Jordan, J. Bradbury, M. Bennett, and R. Jones. 1991. Latency and reactivation of infectious laryngotracheitis vaccine virus. Arch. Virol. 121:213–218. Kirkpatrick, N. C., A. Mahmoudian, D. O’Rourke, and A. H. Noormohammadi. 2006. Differentiation of infectious laryngotracheitis virus isolates by restriction fragment length polymorphic analysis of polymerase chain reaction products amplified from multiple genes. Avian Dis. 50:28–34. Kotiw, M., C. Wilks, and J. May. 1995. The effect of serial in vivo passage on the expression of virulence and DNA stability of an infectious laryngotracheitis virus strain of low virulence. Vet. Microbiol. 45:71–80. Lee, S. W., P. F. Markham, M. J. C. Coppo, A. R. Legione, J. F. Markham, A. H. Noormohammadi, G. F. Browning, N. Ficorilli, C. A. Hartley, and J. M. Devlin. 2012. Attenuated vaccines can recombine to form virulent field viruses. Science 337:188. Ojkic, D., J. Swinton, M. Vallieres, E. Martin, J. Shapiro, B. Sanei, and B. Binnington. 2006. Characterization of field isolates of infectious laryngotracheitis virus from Ontario. Avian Pathol. 35:286–292. Oldoni, I., and M. Garcia. 2007. Characterization of infectious laryngotracheitis virus isolates from the US by polymerase chain reaction and restriction fragment length polymorphism of multiple genome regions. Avian Pathol. 36:167–176. Roizman, B. 1996. Herpesviridae. Pages 2221–2230 in Virology. 3rd ed. B. N. Fields, D. M. Knipe, and P. M. Howley, ed. LippincottRaven, Philadelphia, PA. Vögtlin, A., L. Bruckner, and H. P. Ottiger. 1999. Use of polymerase chain reaction (PCR) for the detection of vaccine contamination by infectious laryngotracheitis virus. Vaccine 17:2501–2506. Williams, R., M. Bennett, J. Bradbury, R. Gaskell, R. Jones, and F. Jordan. 1992. Demonstration of sites of latency of infectious laryngotracheitis virus using the polymerase chain reaction. J. Gen. Virol. 73:2415–2520.