Restriction of the Xenopus DEADSouth mRNA to the primordial germ cells is ensured by multiple mechanisms

MECHANISMS OF DEVELOPMENT

1 3 1 ( 2 0 1 4 ) 1 5 –2 3

Available at www.sciencedirect.com

ScienceDirect journal homepage: www.elsevier.com/locate/modo

Restriction of the Xenopus DEADSouth mRNA to the primordial germ cells is ensured by multiple mechanisms Takeshi Yamaguchi 1, Kensuke Kataoka 2, Kenji Watanabe, Hidefumi Orii

*

Department of Life Science, University of Hyogo, 3-2-1 Koto, Kamigori, Akou-gun, Hyogo 678-1297, Japan

A R T I C L E I N F O

A B S T R A C T

Article history:

DEADSouth mRNA encoding the RNA helicase DDX25 is a component of the germ plasm in

Received 10 April 2013

Xenopus laevis. We investigated the mechanisms underlying its specific mRNA expression in

Received in revised form

primordial germ cells (PGCs). Based on our previous findings of several microRNA miR-427

26 October 2013

recognition elements (MREs) in the 3 0 untranslated region of the mRNA, we first examined

Accepted 17 November 2013

whether DEADSouth mRNA was degraded by miR-427 targeting in somatic cells. Injection of

Available online 26 November 2013

antisense miR-427 oligomer and reporter mRNA for mutated MREs revealed that DEADSouth mRNA was potentially degraded in somatic cells via miR-427 targeting, but not in PGCs

Keywords: DDX25

after the mid-blastula transition (MBT). The expression level of miR-427 was very low in PGCs, which probably resulted in the lack of miR-427-mediated degradation. In addition, the DEADSouth gene was expressed zygotically after MBT. Thus, the predominant expres-

miRNA

sion of DEADSouth mRNA in the PGCs is ensured by multiple mechanisms including zygotic

Vasa Germline

expression and prohibition from miR-427-mediated degradation.

Germ plasm

 2014 Published by Elsevier Ireland Ltd.

Primordial germ cell

1.

Introduction

In Xenopus, the germline is generated by the inheritance of a special cytoplasm, called ‘germ plasm’, which is present at vegetal cortex of the fertilized egg (Ikenishi, 1998). Recently, using cytoplasmic transfer, we demonstrated that the germ plasm contains a determinant necessary and sufficient for germline development in Xenopus laevis (Tada et al., 2012). DEADSouth mRNA has been identified as a component of the germ plasm (MacArthur et al., 2000). Expression of the DEADSouth gene begins in early diplotene oocytes during oogenesis. The transcript is initially present in the ooplasm and perinuclear mitochondrial aggregates in pre-stage I oocytes, accumulates in the mitochondrial cloud at stage I and then

localizes to the germ plasm in the vegetal cortex of mature oocytes. After fertilization, DEADSouth mRNA is present in the germ plasm and is detectable in the primordial germ cells (PGCs) at least until the tailbud stage embryo (Kataoka et al., 2006). Thus, the expression profile of DEADSouth is similar to that of other germ plasm components including nanos1 mRNA (Zhou and King, 2004). Such persistent expression in PGCs suggests that DEADSouth is very important for PGC development. Previously, we demonstrated that the DEADSouth 3 0 untranslated region (UTR) was involved in the PGC-specific expression of a reporter protein (Kataoka et al., 2006). This was initially detected in embryos around stage 7 and then appeared to be restricted to PGCs in the mid-blastula transition

* Corresponding author. Tel./fax: +81 791 58 0187. E-mail address: [email protected] (H. Orii). 1 Present address: National Institute for Basic Biology, 38 Nishigonaka, Myodaiji, Okazaki, Aichi 444-8585, Japan. 2 Present address: Institute of Molecular Biotechnology of the Austrian Academy of Sciences, Dr. Bohr-Gasse 3, A-1030 Vienna, Austria. 0925-4773/$ - see front matter  2014 Published by Elsevier Ireland Ltd. http://dx.doi.org/10.1016/j.mod.2013.11.002

16

MECHANISMS OF DEVELOPMENT

(MBT, around stage 9) and onwards, with loss of expression in somatic cells. This suggested that PGC-specific expression might result from clearance of the reporter mRNA in somatic cells. Dissection of the DEADSouth 3 0 UTR allowed to define region A as a region required for the PGC-specific expression. In addition, we found three possible microRNA miR-427 recognition elements (MREs) in region A. Because it is well known that miR-427 in Xenopus and miR-430 in zebrafish— an equivalent to miR-427—are involved in the clearance of multiple maternal mRNAs with MREs at the MBT (Giraldez et al., 2006; Lund et al., 2009), DEADSouth mRNA might also be a target of miR-427-mediated mRNA clearance. In zebrafish, germline-specific mRNAs including nanos1 and TDRD7 (Tudor-domain-containing protein 7) have MREs for miR-430 and degrade in somatic cells after the MBT (Giraldez et al., 2006). However, in PGCs, they are protected from miR-430mediated degradation by the DAZL protein (Mishima et al., 2006; Takeda et al., 2009). In Xenopus, dead end (dnd) mRNA is a component of germ plasm and is detected in a PGC-specific manner until tailbud stage (Horvay et al., 2006). Recently, it was shown that dnd mRNA was also degraded in somatic cells by targeting of miR-18, but not of miR-427 (Koebernick et al., 2010). In this study, we focus on regulatory mechanisms for PGCspecific expression of DEADSouth mRNA. We suggest that even if it is in somatic cells, DEADSouth mRNA is degraded by miR-427 targeting, but not in PGCs. In addition, zygotic expression also ensures persistent presence of this mRNA in PGCs after the MBT.

2.

1 3 1 ( 2 0 1 4 ) 1 5 –2 3

Results

2.1. miR-427 targets DEADSouth mRNA degradation in somatic cells Our previous deletion analysis of the 3 0 UTR of DEADSouth mRNA showed that a 368-nucleotide sequence, designated region A, regulates its PGC-specific expression (Fig. 1A; Kataoka et al., 2006). In addition, we found three possible target sites for miR-427 (microRNA recognition element: MRE) in region A (Fig. 1B). Therefore, we speculated that DEADSouth mRNA might be degraded by miR-427 in the somatic cells. First, we examined the stability of the reporter mRNA encoding the fluorescent protein Venus fused with the DEADSouth 3 0 UTR (v-DS, Kataoka et al., 2006) in the somatic cells of miR-427-depleted embryos (Fig. 2). To deplete miR-427, we injected an antisense miR-427 locked nucleic acid oligomer (anti-miR427 LNA) together with reporter v-DS mRNA into the animal hemisphere of fertilized X. laevis eggs. As a control, embryos were also coinjected with a mutated LNA oligomer (anti-miR427mut LNA). Embryos at stages 11 and 30 were subjected to reverse transcription polymerase chain reaction (RT-PCR) analysis to monitor the level of the injected v-DS mRNA. Although the injected v-DS mRNA remained at stage 11 regardless of the coinjected LNA oligomers, it was detected only in the miR-427-depleted embryos at stage 30 by RT-PCR (Fig. 2A). This was also confirmed by the observation of Venus fluorescence from v-DS mRNA (Fig. 2B–D).

Fig. 1 – Expression pattern of venus fused with region A of DEADSouth 3 0 UTR in the middle of 3 0 UTR of Xenopus b-globin (A and A 0 ) and the sequence of region A (B). (A) Whole-mount lateral view of stage 41 tadpole. Scale bar: 1 mm. (A 0 ) Highmagnification of the area indicated in (A). Arrowheads indicate PGCs. Scale bar: 250 lm. (B) The possible target sites for miR-427 (MRE, in red) found in the region A of DEADSouth 3 0 UTR (DDBJ/GenBank/EMBL accession No. AF190623 nucleotides 1804–2287).

MECHANISMS OF DEVELOPMENT

1 3 1 ( 2 0 1 4 ) 1 5 –2 3

17

Fig. 2 – DEADSouth mRNA was degraded specifically by miR-427. (A) RT-PCR for v-DS mRNA in embryos at stages 11 and 30 coinjected with anti-miR427 LNA or anti-miR427mut LNA. The ubiquitously expressed ODC gene was used as a control. Note that the injected v-DS mRNA was detected in every embryo at stage 11, but detected only in embryos coinjected with antimiR427 LNA at stage 30. (B) Expression of venus reporter mRNA at stage 30. (C) and (D) Expression of venus reporter mRNA at stage 30 in an embryo coinjected with anti-miR427 LNA or anti-miR427mut LNA. Note that Venus fluorescence was detected only in the embryos coinjected with anti-miR427 LNA. Scale bar, 1 mm.

Next, we investigated three possible MREs for miR-427 in region A of the DEADSouth 3 0 UTR for evidence of degradation. Based on the mRNA encoding Venus fused with a part of the DEADSouth 3 0 UTR including region A in the middle of the 3 0

UTR of Xenopus b-globin (MRE123, formerly called bG/ABC, see Kataoka et al., 2006), we generated a mutated reporter, MRE1m2m3m, in which the nucleotides C and A of each MRE were substituted with G and U, respectively (Fig. 3A).

Fig. 3 – Degradation of DEADSouth mRNA via MREs in region A of the 3 0 UTR. (A) Sequences of wild type (upper) and mutated MREs (lower). Three possible MREs in region A were mutated (MRE1m2m3m). (B–G) MRE123 or MRE1m2m3m reporter mRNA was injected without/with siR-427 or siR-427m into the animal hemisphere of fertilized eggs. The embryos at 41 were examined for degradation of injected mRNA by Venus fluorescence. Note that the MRE1m2m3 m reporter mRNA was degraded specifically by siR-427m, but not by siR-427. Scale bar, 1 mm.

18

MECHANISMS OF DEVELOPMENT

1 3 1 ( 2 0 1 4 ) 1 5 –2 3

Fig. 4 – Degradation of reporter mRNA with normal or mutated MREs. (left) Northern blot analysis for total RNA (10 lg/lane) at stages 1 (just after microinjection), 11 (gastrula) and 30 (tailbud). 18S rRNA bands are shown as loading controls (lower in each row). Closed and open arrowheads indicate sizes of the original and elongated mRNA, respectively. The ratios of band intensity at stage 30 to that at stage 11 are also shown. Each ratio was the mean of duplicated experiments. (right) WISH for venus mRNA in stage 30 embryos injected with the indicated mRNA. The percentage of embryos in which a Venus fluorescence signal was detected in the somatic cells is shown in the right. The lowest two rows show the results from the experiments in which MRE123 and MRE1m2m3m mRNAs were injected at the vegetal pole, respectively. Scale bar, 1 mm.

When MRE1m2m3 m mRNA was injected into the animal hemisphere of fertilized eggs, Venus fluorescence was observed in the embryo (Fig. 3B), although little fluorescence could be detected in the embryos injected with MRE123 without mutations (Fig. 3C). Fluorescence from MRE1m2m3m mRNA was not detected in embryos coinjected with small interfering RNA siR-427m, a synthesized miR-427 harboring the targeting sequence for the mutated MREs (Fig. 3D). In contrast, fluorescence from MRE1m2m3m mRNA was detected in the embryos coinjected with siR-427 (Fig. 4F). Conversely, the fluorescence from MRE123 mRNA was not observed in the embryos coinjected with siR-427 or siR-427m (Fig. 3E, G). These results suggest that the MRE123 mRNA was degraded in somatic cells by targeting of endogenous miR-427. Furthermore, to determine the contributions of each MRE to mRNA degradation, we generated various reporter mRNAs with one or two MREs and evaluated the extent of their degradation by northern blot hybridization for the reporter venus mRNA and whole-mount in situ hybridization (WISH) (Fig. 4). Comparison of band intensity at stage 30 with that at stage 11 revealed that the reporter mRNA with three MREs (MRE123)

was degraded almost completely (the ratio for stage 30 to stage 11 was 0.01). In addition, the reporter mRNA was not detected in somatic cells in any injected embryo by WISH. In contrast, 28% of the reporter mRNA with all three mutated MREms (MRE1m2m3m) remained in stage 30 embryos and the reporter RNA was detected in somatic cells in all of the injected embryos. This indicated that little degradation of MRE1m2m3 m mRNA occurred, because the total amount of RNA per embryo increased 2–2.5-fold from stages 11 to 30 (K. Kataoka unpublished) by active synthesis of rRNA (Shiokawa et al., 1994). When these reporter mRNAs were injected into the vegetal pole, they were degraded similarly. Thus, degradation must have occurred in somatic cells all over the embryo except in the PGCs, because MRE123 mRNA injected into the vegetal pole was detected only in PGCs by WISH (Fig. 4). When the reporter mRNAs with a single normal MRE were injected, the amounts of MRE12m3m, MRE1m23m and MRE1m2m3 reporter mRNAs remaining at stage 30 were 13%, 23% and 7%, respectively. The signal of MRE1m2m3 was hardly detected, although MRE12m3m and MRE1m23m were detected throughout the embryo by WISH. Although

MECHANISMS OF DEVELOPMENT

1 3 1 ( 2 0 1 4 ) 1 5 –2 3

19

Fig. 5 – Zygotic expression of DEADSouth gene. (A) Sequence alignment of the 3 0 UTR of DEADSouth cDNA of X. laevis (DDBJ/ GenBank/EMBL accession No. AF190623 nucleotides 1625–1892) and X. borealis. PCR primers are indicated with arrows. PCR using these primers resulted in species-specific amplification of 248 and 224 bp sequences from X. laevis and X. borealis, respectively. (B) Species-specific amplification using cDNA from X. laevis or X. borealis oocytes as a template. (C) Expression of DEADSouth gene in hybrid embryos between X. laevis and X. borealis at stages 3 and 20. X. laevis- and X. borealis-specific amplifications are indicated by open and closed arrowheads, respectively, in (B) and (C). Note that the DEADSouth transcript from the male was detected only in stage 20 embryos.

comparison of the degradation levels showed that MRE3 contributed most to the degradation, MRE1 plus MRE2 were more effective than MRE3. Thus every MRE seemed to be involved in degradation, but their efficiencies differed. Interestingly, the injected mRNA at stage 11 was slightly longer than that of the original one. We examined the change in length of poly(A) tail during degradation by PCR poly(A) test (PAT) assay (Fig. S1). The poly(A) tail of MRE123 mRNA became longer at stage 7 and then was shortened at stage 11. In contrast, the poly(A) tail of MRE1m2m3m mRNA became longer and maintained this at stage 11. Taken together, these results suggest that even if DEADSouth mRNA is present in somatic cells, it is degraded after MBT by miR-427 targeting to the MREs in the 3 0 UTR. The degradation of DEADSouth mRNA is associated with its deadenylation.

2.2.

The DEADSouth gene is expressed zygotically

It has been believed that miR-427 is expressed ubiquitously throughout the embryo at MBT (Lund et al., 2009; Rosa et al., 2009). DEADSouth mRNA is detectable in a PGC-specific manner after MBT (Kataoka et al., 2006). These finding suggest that DEADSouth is expressed zygotically in PGCs after MBT. To investigate the zygotic expression of DEADSouth after MBT, we used hybrids between X. laevis and X. borealis. We cloned a cDNA fragment of DEADSouth from an X. borealis ovary by 3 0 rapid amplification of cDNA ends, sequenced it and designed a set of PCR primers to distinguish X. laevis and X. borealis DEADSouth genes (Fig. 5A). PCR using the primer set results in 248 and 224 bp fragments when cDNAs of X. laevis and X. borealis are used as templates, respectively (Fig. 5B). In hybrids of female X. laevis crossed with male X.

borealis, and female X. borealis crossed with male X. laevis, male-specific bands were detected only at stage 20 (after MBT) in addition to female-specific bands. In contrast, female-specific bands were detected only at stage 3 (before MBT) (Fig. 5C). This indicated that zygotic transcription of DEADSouth occurred by stage 20.

2.3. PGCs

Mature miR-427 is expressed at very low levels in

As described above, it has been suggested that the degradation in the somatic cells and the zygotic expression contributed to the predominant expression of DEADSouth in the PGCs after MBT. If miR-427 is expressed throughout the embryo including PGCs, in PGCs the maternal DEADSouth mRNA might be degraded once during MBT and then transcribed zygotically again after MBT. However, this seems unreasonable. Therefore, we investigated the expression of miR-427 in early stage embryos by WISH with relation to PGCs (Fig. 6A–L). Expression of miR-427 was detected initially at stage 9 (Fig. 6A–E). We observed strong signals in almost all cells in the animal hemisphere; however, only weak signals were seen in vegetal blastomeres. No signal was detected using a sense LNA probe, indicating that they were specific (Fig. 6I). Interestingly, the signals were detected as puncta in the nuclei, as well as in the cytoplasm (Fig. 6D, E). Subsequently, the signals became weaker (Fig. 6F–H). This expression profile corresponded to a previous report using northern blotting (Watanabe et al., 2005). In addition, we performed simultaneous detection of miR-427 and Xpat mRNA as a PGC marker (Hudson and Woodland, 1998). No signals for miR-427 were detected in PGCs; however these were Xpat-positive (Fig. 6J–L). We also examined the expression of miR-427 in PGCs by northern blot hybridization, because WISH is less

20

MECHANISMS OF DEVELOPMENT

1 3 1 ( 2 0 1 4 ) 1 5 –2 3

Fig. 6 – Expression of miR-427 during early development in X. laevis. WISH with antisense (A–H) and sense LNA probes (I) for miR-427. Signals in blue (high) to brown (low) depended on the expression level. (A–C) Animal, lateral and vegetal views at stage 9, respectively. (D, E) High magnification images of the equatorial region of the stage 9 embryo. Nuclei are also stained with PI in (E). (F) Vegetal views at stage 11. (G) Dorsal view at stage 17. (H) (I) Lateral views at stages 31 and 9, respectively. (J, K, L) Vegetal views of WISH at indicated stages with antisense Xpat riboprobe (red) and antisense miR-427 LNA probe (blue). Note that signals for Xpat are not overlapped with those for miR-427. Scale bars are 0.5 mm in (A–C, F, G, I), 0.1 mm in (D, E), 0.2 mm in (J–L) and 1 mm in (H), respectively. (M) Northern blot analysis for miR-427. Total RNAs from whole embryos (0.5 lg), endodermal cells (1268 cells) and PGCs (1268 cells) at stage 17 were loaded into lanes 1, 2 and 3, respectively. After detection for miR-427 (upper), the blot was reprobed with a 5S rRNA probe for normalization (lower).

suitable for quantitative analysis. We labeled PGCs by injecting v-DS mRNA at the vegetal pole of fertilized eggs and isolated PGCs (Venus-positive) and endodermal cells (Venus-negative) manually from the neurula embryos (stage 17). Total RNA from 1286 cells of each cell type, was subjected to northern blot hybridization using a radioactive LNA probe (Fig. 6M); 5S ribosomal RNA was used for normalization. The amount of miR-427 in the PGCs was less than one-seventh of that in the endodermal cells.

2.4. Is a low level of expression of miR-427 sufficient to maintain DEADSouth mRNA in PGCs? It is possible that the low expression level of miR-427 prohibits DEADSouth mRNA from degradation in PGCs. We investigated whether a lack of miR-427 was sufficient to maintain the mRNA in PGCs. We coinjected the MRE123 or MRE1m2m3m reporter mRNAs into the vegetal pole of fertilized eggs with excess amounts of siR-427 or siR-427m. There was no loss of fluorescence from reporter mRNAs in the PGCs with any combination (Fig. 7A–D). This was not because the injected siRNAs were not incorporated in PGCs, because doubly positive cells for siR-427m and the reporter were observable when fluorescence-labeled siR-427m was coinjected with reporter mRNAs (Fig. S2). These results suggest that the effector Argonaute (Ago) protein complex might be lacking or inactive in PGCs because siR-427m could target the MRE1m2m3m effectively for degradation in somatic cells.

3.

Discussion

In this study, we demonstrated several possible mechanisms to ensure PGC-specific expression of DEADSouth mRNA

as follows: (1) Zygotic expression of DEADSouth gene was demonstrated. (2) Clearance of DEADSouth mRNA by miR427 was possible in somatic cells. (3) No degradation of injected DEADSouth mRNA was seen in PGCs. In addition, the absence of degradation of the mRNA in PGCs seemed to be caused by a low expression level of miR-427 and protection from miR-427 targeting. Many mRNAs have been identified as components of the germ plasm in Xenopus (Cuykendall and Houston, 2010). Although most of them are also detectable in PGCs until MBT, some are not detectable from MBT onward. For example, Germes mRNA was detectable only before MBT (Berekelya et al., 2003). Nanos1 mRNA was detectable until the tailbud stage even though there was no zygotic transcription after MBT (Lai et al., 2011). However, it is not known whether most germ plasm-specific genes are expressed zygotically in PGCs after MBT. We showed that the persistence of DEADSouth mRNA in PGCs was caused by zygotic expression after MBT. Although DEADSouth encodes an RNA helicase different from vasa (MacArthur et al., 2000), it is interesting that DEADSouth is similar in its expression profile to vasa in zebrafish (Knaut et al., 2000) in addition to partial compatibility of their function (Yamaguchi et al., 2013). Clearance of DEADSouth mRNA in somatic cells by miR-427 may be also important to ensure the PGC-specific expression of the DEADSouth protein, which is similar to that of zebrafish nanos1 mRNA via miR-430 (an equivalent to Xenopus miR-427). In contrast to the single MRE in the zebrafish nanos1 3 0 UTR, three MREs in region A of the 3 0 UTR of DEADSouth are involved in degradation via miR-427. Each MRE seems to contribute in varying degrees to the degradation. The presence of several MREs suggests that PGC-specific expression of DEADSouth mRNA is regulated restrictedly. The degradation of

MECHANISMS OF DEVELOPMENT

Fig. 7 – Effect of siR-427 on the degradation of reporter mRNA in PGCs of stage 41 tadpoles. (A–D) Whole-mount lateral views are shown with injected reporter mRNA and siRNA. (A 0 –D 0 ) High-magnification of the areas including aligned PGCs indicated in (A–D), respectively. Scale bars, 1 mm in (D) and 500 lm in (D 0 ). DEADSouth mRNA in somatic cells is associated with complete deadenylation, which is similar to that of zebrafish nanos1 mRNA, but is different from that of zebrafish vasa mRNA, which shows incomplete deadenylation (Mishima et al., 2006). The mRNA for dnd is also known to be restricted to PGCs in Xenopus. Interestingly, this seems to be degraded in somatic cells by miR-18 targeting, but is protected in PGCs by the cooperative activities of ElrB1 and DND (Koebernick et al., 2010). However, it is not likely that DEADSouth mRNA is degraded in somatic cells by miR-18, because the fluorescence signal from v-DS mRNA is weak in somatic cells until stage 17 (Kataoka et al., 2006) when miR-18 is not yet highly expressed (Watanabe et al., 2005). In addition, in our studies the degradation was completely inhibited by the antisensemiR427 LNA oligomer, which is specific to miR-427, but not specific to miR-18. Using WISH and northern blot hybridization, we found that miR-427 was very little expressed in PGCs. This might be why no degradation of the DEADSouth mRNA occurred only in Xenopus PGCs. This contrasts with the ubiquitous expression of miR-430 in zebrafish embryos (Giraldez et al., 2006). In addition, an excessive supply of siR-427 to Xenopus PGCs resulted in no degradation of the MRE123 reporter mRNA. This suggests that miR-427 was not accessible to DEADSouth 3 0 UTR in the Xenopus PGCs, probably because of the lack of the Ago protein (Lund et al., 2011). Interestingly, a reporter mRNA with MRE was repressed in zebrafish PGCs as well as in somatic cells by injection of high amounts of the microRNA corresponding to the MRE (Mishima et al., 2006). It was shown that the RNA-binding proteins DND1 and DAZL inhibited repression of germ plasm mRNAs such as nanos1 and tdrd7 in PGCs via miR-430 targeting (Kedde et al., 2007; Takeda et al., 2009). In Xenopus, dnd mRNA is protected from miR-18-mediated RNA clearance in somatic cells by ElrB1 and DND proteins in a synergistic manner (Koebernick et al., 2010). Although it remains to be determined whether they bind to DEADSouth 3 0 UTR, DND, DAZL and ElrB1 proteins are likely candidates responsible for inhibiting miR-427-mediated RNA degradation in Xenopus PGCs. This hypothesis was supported by our findings that the DND and DAZL proteins were localized to the germ plasm in Xenopus PGCs (unpublished data) as well as DEADSouth mRNA (MacArthur et al., 2000). We cannot exclude another possibility, that the microRNAassociated machinery including microRNA processing and

1 3 1 ( 2 0 1 4 ) 1 5 –2 3

21

microRNA-mediated degradation is incomplete in Xenopus PGCs. In Xenopus, it has been demonstrated that the Ago protein available for microRNA processing was absent in early embryos before MBT, so that microRNA production including siRNA processing was blocked (Lund et al., 2011). The expression of Ago proteins is controlled developmentally. It is possible that expression of Ago proteins is delayed in PGCs as well as the zygotic expression of other genes (Venkatarama et al., 2010). If so, it is a reasonable explanation for the expression of mature miR-427 at a low level in PGCs. We suggest that the PGC-specific expression of DEADSouth is ensured by several mechanisms. These possible mechanisms might be also involved in the restricted expression of other PGC-specific mRNAs. It is essential to reveal the mechanisms if we are to understand the specification of PGCs.

4.

Experimental procedures

4.1.

Xenopus embryos

Adult male and female X. laevis and X. borealis were purchased commercially and maintained at 22 C in circulatory tanks. Embryos were obtained as described previously (Kataoka et al., 2006), allowed to develop at 18 C and staged according to Nieuwkoop and Faber (1994). Normally developing embryos were selected and subjected to further analyses.

4.2.

Cloning of the 3 0 UTR of X. borealis DEADSouth

Total RNA was extracted from X. borealis oocytes and subjected to cDNA synthesis using Ready-To-Go Prime FirstStrand Beads with GeneRacer Oligo dT primer (Invitrogen). The cDNA was amplified using GeneRacer 3 0 Primer (Invitrogen) and DEADSouth-Fw1 primer 5 0 –CTTCAAAAATCCAAGAGAATGCCCTTCCAA–3 0 . The product was amplified again using GeneRacer 3 0 Nested Primer (Invitrogen) and DEADSouth-Fw2 primer 5 0 –TGTACTGGCTATGCTGAGTCGTGTG–3 0 . The PCR product was cloned into a pCRII-TOPO vector (Invitrogen) and sequenced. The nucleotide sequence data will appear in the DDBJ/EMBL/GenBank nucleotide sequence databases with the accession number AB827302.

4.3.

RT-PCR

Total RNA was extracted using TRIzol (Invitrogen). To detect zygotic expression of DEADSouth, 1 lg of total RNA was subjected to cDNA synthesis using Ready-To-Go You-Prime First-Strand Beads with random hexamers (GE Healthcare Life Science), according to the manufacturer’s protocol (Yamaguchi et al., 2013). To examine the degradation of injected reporter mRNA, 200 ng of total RNA was subjected to cDNA synthesis using the kit with a PAT-dT-anchor primer 5 0 – GCGAGCTCCGCGGCCGCGTTTTTTTTTTTT–3 0 . The cDNA was diluted appropriately and used for PCR as a template. Primer sequences and annealing temperatures were as follows. For venus mRNA, forward 5 0 –CCGACCACATGAAGCAGCACGACTTCTTCA–3 0 and reverse 5 0 –GCAAATAACCAAGACC TTCAACAGG–3 0 , 58 C; Ornithine decarboxylase (ODC) forward 5 0 –GCAAAGCCATTGTGAAGACTCTCTCCATTC–3 0 and reverse 5 0 –AAGCTTTGCATTCGGGTGATTCCTTGCCAC–3 0 , 66 C;

22

MECHANISMS OF DEVELOPMENT

DEADSouth forward 5 0 –TCTTGCCGAATGCAGTACTAGTGAA–3 0 and reverse 5 0 –GCAAATAACCAAGACCTTCAACAGG–3 0 , 58 C. PCR cycling numbers were determined empirically.

4.4.

Constructs

All reporters with mutated MREs were constructed from MRE123 (previously called bG/ABC) by PCR technology as described (Kataoka et al., 2006). pCS2-Venus-DEADSouth 3 0 UTR (v-DS) was also used as described (Kataoka et al., 2006).

4.5.

Preparation and microinjection of mRNAs

The constructs were digested with XhoI and subjected to mRNA synthesis. The mRNA was synthesized using an mMESSAGE mMACHINE SP6 Kit (Ambion) and injected into the indicated region of a fertilized egg (0.7 fmol/egg, 4.6 nL/egg). Small interfering RNA (siRNA, Sigma Genosys) was also injected as an exogenous microRNA (12 fmol/egg around the animal pole, 184 fmol/egg at the vegetal pole) (Kataoka et al., 2006). The sequences (sense/antisense) of siR-427 and siR-427 m were 5 0 –AAAGUGCUUCCUGUUUUGGGUU–3 0 /5 0 –CCCAAAACAGGAA GCACUUUUU–3 0 and 5 0 –AAAGACCUUCCUGUUUUGGGUU–3 0 / 5 0 –CCCAAAACAGGAAGGUCUUUUU–3 0 , respectively (Proligo). LNA oligomers were also coinjected to inhibit the effect of miR-427 (180 fmol/egg) (Obad et al., 2011). The sequences of LNA-anti-miR-427 and LNA-anti-miR-427mut were 5 0 –AGCACTTT–3 0 and 5 0 –AGGTCTTT–3 0 , respectively (all nucleotides were modified by Locked Nucleic Acids, Nippon EGT). No abnormal development was observed externally in the embryos injected at these doses.

4.6.

(GE Healthcare). It was fixed on the membrane by a UV cross-linker, baked at 80 C for 1 h and hybridized with 32P-labeled probe in ULTRAhyb-Oligo (Ambion) at 50 C for 18 h. The membrane was washed twice with 2 · SSC/0.5% SDS at 50 C for 30 min, rinsed with 0.1 · SSC/0.1% SDS and analyzed using an image analyzer FLA3000 (Fuji Film). miR-427LNAas (antisense) and 5S rRNA (5 0 –AGCCTACGACACCTGGTATTCCCAGGCGGT–3 0 , Proligo) were end-labeled using c[32P]-ATP (GE Healthcare). Comparison between PGCs and endodermal cells was performed after normalization with 5S rRNA probe. Northern blotting for venus mRNA and quantification of band intensities were performed as described (Kataoka et al., 2006).

4.8.

PAT assay

Total RNA was extracted using TRIzol (Invitrogen) from 20 embryos at stages 1, 7 and 11, which had been injected with reporter mRNA (460 pg/embryo), and treated with DNase I (TaKaRa). Ten nanogram aliquots of the RNA were subjected to cDNA synthesis with AMV reverse transcriptase (Promega) and the PAT-dT-anchor primer and were filtrated through microspin S-400HR column (GE Healthcare). The cDNA was amplified by PCR with a DEADSouth specific primer CTAGAAAAGAAGTTCACCAGCC and the PAT-dT-anchor primer and then was subjected to 1.5% agarose gel electrophoresis in 90 mM Tris–borate/1 mM EDTA (pH 8).

Acknowledgements We thank the members of our laboratory, especially Dr. Makoto Mochii, for their support and for fruitful discussions.

Whole-mount in situ hybridization

Embryos at given stages were fixed and subjected to WISH for microRNA and venus, essentially according to Kloosterman et al. (2006) and Kataoka et al. (2006), respectively. Hybridization was performed at 50 C (microRNAs and Xpat) or 60 C (venus). The probes for venus and Xpat were labeled with digoxigenin-UTP (Roche) and fluorescein-UTP (Roche), respectively. Synthetic oligonucleotides (NipponEGT): (antisense, 5 0 –A*CGC*CCA*AAA*CAG*GAA*GCA*CTTT–3 0 miR427LNAas) and 5 0 –A*AAG*TGC*TTC*CTG*TTT*TGG*GCGT– 3 0 (sense, miR427LNA) (nucleotides followed by * are Locked Nucleic Acids) were end-labeled with digoxigenin-dUTP and used at 20 pmol/mL for hybridization. Digoxigenin was detected with anti-digoxigenin-AP Fab fragments (Roche) and BM purple (Roche). Fluorescein was detected with anti-fluorescein-AP Fab fragments (Roche) and Fast Red (Roche). Specimens were bleached with 1% H2O2/5% formamide/0.5 · SSC and stained for nuclei with 0.1 lg/mL propidium iodide.

4.7.

1 3 1 ( 2 0 1 4 ) 1 5 –2 3

Northern blot hybridization

PGCs and endodermal cells were collected manually from dissociated stage 17 embryos injected with v-DS mRNA as a PGC tracer (Yamaguchi et al., 2013). Total RNA was extracted from 1268 PGCs or 1268 endodermal cells using TRIzol (Invitrogen), separated on 15% denaturing acrylamide gel (8 M urea/ 0.5 · TBE) and electro-transferred to Hybond N+ membrane

Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/ j.mod.2013.11.002.

R E F E R E N C E S

Berekelya, L.A., Ponomarev, M.B., Luchinskaya, N.N., Belyavsky, A.V., 2003. Xenopus germes encodes a novel germ plasmassociated transcript. Gene Expr. Patterns 3, 521–524. Cuykendall, T.N., Houston, D.W., 2010. Identification of germ plasm-associated transcripts by microarray analysis of Xenopus vegetal cortex RNA. Dev. Dyn. 239, 1838–1848. Giraldez, A.J., Mishima, Y., Rihel, J., Grocock, R.J., Van Dongen, S., Inoue, K., Enright, A.J., Schier, A.F., 2006. Zebrafish miR-430 promotes deadenylation and clearance of maternal mRNAs. Science 312, 75–79. Horvay, K., Claussen, M., Katzer, M., Landgrebe, J., Pieler, T., 2006. Xenopus Dead end mRNA is a localized maternal determinant that serves a conserved function in germ cell development. Dev. Biol. 291, 1–11. Hudson, C., Woodland, H.R., 1998. Xpat, a gene expressed specifically in germ plasm and primordial germ cells of Xenopus. Mech. Dev. 73, 159–168. Ikenishi, K., 1998. Germ plasm in Caenorhabditis elegans, Drosophila and Xenopus. Dev. Growth Differ. 40, 1–10.

MECHANISMS OF DEVELOPMENT

Kataoka, K., Yamaguchi, T., Orii, H., Tazaki, A., Watanabe, K., Mochii, M., 2006. Visualization of the Xenopus primordial germ cells using a green fluorescent protein controlled by cis elements of the 3 0 untranslated region of DEADSouth gene. Mech. Dev. 123, 746–760. Kedde, M., Strasser, M.J., Boldajipour, B., Oude Vrielink, J.A.F., Slanchev, K., le Sage, C., Nagel, R., Voorhoeve, P.M., van Duijse, J., Ørom, U.A., Lund, A.H., Perrakis, A., Raz, E., Agami, R., 2007. RNA-binding protein Dnd1 inhibits microRNA access to target mRNA. Cell 131, 1273–1286. Kloosterman, W.P., Wienholds, E., de Bruijn, E., Kauppinen, S., Plasterk, R.H.A., 2006. In situ detection of miRNAs in animal embryos using LNA-modified oligonucleotide probes. Nat. Methods 3, 27–29. Knaut, H., Pelegri, F., Bohmann, K., Schwarz, H., Nusslein-Volhard, C., 2000. Zebrafish vasa RNA but not its protein is a component of the germ plasm and segregates asymmetrically before germline specification. J. Cell. Biol. 149, 875–888. Koebernick, K., Loeber, J., Arthur, P.K., Tarbashevich, K., Pieler, T., 2010. Elr-type proteins protect Xenopus Dead end mRNA from miR-18-mediated clearance in the soma. Proc. Natl. Acad. Sci. USA 107, 16148–16153. Lai, F., Zhou, Y., Luo, X., Fox, J., King, M.L., 2011. Nanos1 functions as a translational repressor in the Xenopus germline. Mech. Dev. 128, 153–163. Lund, E., Liu, M., Hartley, R.S., Sheets, M.D., Dahlberg, J.E., 2009. Deadenylation of maternal mRNAs mediated by miR-427 in Xenopus laevis embryos. Rna 15, 2351–2363. Lund, E., Sheets, M.D., Imboden, S.B., Dahlberg, J.E., 2011. Limiting Ago protein restricts RNAi and microRNA biogenesis during early development in Xenopus laevis. Genes Dev. 25, 1121–1131. MacArthur, H., Houston, D.W., Bubunenko, M., Mosquera, L., King, M.L., 2000. DEADSouth is a germ plasm specific DEAD-box RNA helicase in Xenopus related to eIF4A. Mech. Dev. 95, 291–295. Mishima, Y., Giraldez, A., Takeda, Y., Fujiwara, T., Sakamoto, H., Schier, A.F., Inoue, K., 2006. Differential regulation of germline mRNAs in soma and germ cells by zebrafish miR-430. Curr. Biol. 16, 2135–2142.

1 3 1 ( 2 0 1 4 ) 1 5 –2 3

23

Nieuwkoop, P.D., Faber, J., 1994. Normal table of Xenopus laevis (Daudin): A Systematical And Chronological Survey Of The Development From The Fertilized Egg Till The End Of Metamorphosis. Garland Pub. Obad, S., dos Santos, C.O., Petri, A., Heidenblad, M., Broom, O., Ruse, C., Fu, C., Lindow, M., Stenvang, J., Straarup, E.M., Hansen, H.F., Koch, T., Pappin, D., Hannon, G.J., Kauppinen, S., 2011. Silencing of microRNA families by seed-targeting tiny LNAs. Nat. Genet. 43, 371–378. Rosa, A., Spagnoli, F.M., Brivanlou, A.H., 2009. The miR-430/427/ 302 family controls mesendodermal fate specification via species-specific target selection. Dev. Cell 16, 517–527. Shiokawa, K., Kurashima, R., Shinga, J., 1994. Temporal control of gene expression from endogenous and exogeneouslyintroduced DNAs in early embryogenesis of Xenopus laevis. Int. J. Dev. Biol. 38, 249–255. Tada, H., Orii, H., Mochii, M., Watanabe, K., 2012. Ectopic formation of primordial germ cells by transplantation of the germ plasm: direct evidence for germ cell determinant in Xenopus. Dev. Biol. 371, 86–93. Takeda, Y., Mishima, Y., Fujiwara, T., Sakamoto, H., Inoue, K., 2009. DAZL relieves miRNA-mediated repression of germline mRNAs by controlling poly(A) tail length in zebrafish. PLoS ONE 4, e7513. Venkatarama, T., Lai, F., Luo, X., Zhou, Y., Newman, K., King, M.L., 2010. Repression of zygotic gene expression in the Xenopus germline. Development 137, 651–660. Watanabe, T., Takeda, A., Mise, K., Okuno, T., Suzuki, T., Minami, N., Imai, H., 2005. Stage-specific expression of microRNAs during Xenopus development. FEBS Lett. 579, 318–324. Yamaguchi, T., Taguchi, A., Watanabe, K., Orii, H., 2013. DEADSouth protein localizes to germ plasm and is required for the development of primordial germ cells in Xenopus laevis. Biol. Open 2, 191–199. Zhou, Y., King, M.L., 2004. Sending RNAs into the future: RNA localization and germ cell fate. IUBMB Life 56, 19–27.