- Email: [email protected]
Resveratrol Alleviates Lung Ischemia and Reperfusion–Induced Pulmonary Capillary Injury Through Modulating Pulmonary Mitochondrial Metabolism
Resveratrol Alleviates Lung Ischemia and ReperfusioneInduced Pulmonary Capillary Injury Through Modulating Pulmonary Mitochondrial Metabolism D.Y.-W. Yeha, Y.H. Fub, Y.-C. Yangb, and J.-J. Wangb,* a Division of Chest Medicine, Internal Medicine, Shin Kong Wu-Ho-Su Memorial Hospital, Taipei; and bSchool of Medicine, Fu Jen Catholic University, New Taipei City, Taiwan
ABSTRACT Objective. Lung ischemia and reperfusion (I/R) injury is one of the major causes of postoperative pulmonary dysfunction after cardiopulmonary surgery and thoracic organ transplantation. Recent studies suggest that lung I/R injury may be associated with defects in pulmonary mitochondrial function, in addition to damage from reactive oxygen species. In this study, we examined effects of one lung I/R injury on the other lung, and the protective efficacy of resveratrol on mitochondrial biogenesis in lungs. Methods. Studies were performed in male Sprague-Dawley rats in 3 groups: shamoperated, lung I/R injury, and treated with resveratrol before lung I/R injury (20 mg/kg/d, orally). Lung ischemia was established by occluding the lung left hilum for 60 minutes, followed by releasing the occlusion and closing the chest. Four days after ischemia, we assessed the lung water content and protein concentration in lung lavage of the nonischemic lung; lung inflammation and pulmonary oxidative stress were assessed by leukocyte counts and tissue content of malondialdehyde (MDA), respectively. The level of mitochondrial biogenesis was determined according to PGC1-a mRNA expression. Results. The left lung I/R injury significantly suppressed right lung PGC1-a mRNA expression, increasing pulmonary oxidative stress, lung water content, and lavage leukocyte count and protein concentration (P < .05). Resveratrol treatment attenuated lung injury as well as increasing PGC1-a mRNA expression. Conclusions. Resveratrol treatment protects lung against I/R injury through improving mitochondrial biogenesis and reducing oxidative stress and leukocyte infiltration.
L
OSS of ventilation and lung ischemia are 2 frequent scenarios occurring in lung transplantation and cardiopulmonary bypass surgery [1], resulting in increased production of reactive oxygen species (ROS) and reduced pulmonary adenosine triphosphate (ATP) levels [2]. Lung reperfusion, although it is necessary to revitalize ischemic lungs, frequently induces series of complex events leading to further lung damage, known as pulmonary ischemia and reperfusion (I/R) injury. Although exact mechanisms of pulmonary I/R-induced lung injury has not been fully understood, infiltration of polymorphonuclear leukocytes (PMNs) and segregation of macrophages in the lungs, as well as excessive production of ROS such as superoxide and peroxides, are implicated in lung injury [3]. On the other
hand, Sommer et al [4] demonstrated that pulmonary I/Rinduced lung edema is closely associated with the degree of pulmonary mitochondrial dysfunction. Resveratrol (3,5,40 -trihydroxy-trans-stilbene), an extract of red wine and
Funding: Operating grants (101SKH-FJU-01) from the Shin Kong Wu-Ho-Su Memorial Hospital (Taipei) to Dr. Diana Yu-Wung Yeh and Dr Jiun-Jr Wang and NSC-101-2320-B-030 from National Science Council Taiwan to Dr Jiun-Jr Wang. *Address correspondence to Jiun-Jr Wang, PhD, Associate Professor, School of Medicine, Fu Jen Catholic University, No 510, Zhongzheng Rd, Xinzhuang Dist, New Taipei City, 24205, Taiwan. E-mail: [email protected]
ª 2014 by Elsevier Inc. All rights reserved. 360 Park Avenue South, New York, NY 10010-1710
0041-1345/14/$esee front matter http://dx.doi.org/10.1016/j.transproceed.2013.11.094
Transplantation Proceedings, 46, 1131e1134 (2014)
1131
1132
a phytoalexin, has been demonstrated to be protective against myocardial I/R injury with its antiinflammatory and mitochondrial genesis capacity [5]. Lagouge et al [6] also showed that resveratrol can increase tissue aerobic capacity and PGC-1a mRNA expression, promoting genes for oxidative phosphorylation. In the present study, we aimed to investigate the protective efficacy of resveratrol treatment against pulmonary I/R-induced lung injury and its association with mitochondrial biogenesis. The severity of lung injury was assessed by lung water content, according to lung weightetoebody weight ratio (LW/BW) and lung wet weightetoedry weight ratio (W/D), and protein concentration in the lung lavage. Lung inflammation and pulmonary oxidative stress were measured by lavage leukocyte count and malondialdehyde (MDA) level in the lung tissue, respectively. The degree of mitochondrial biogenesis was determined according to PGC1-a mRNA expression.
MATERIALS AND METHODS Sprague-Dawley rats (250e300 g) were anesthetized with the use of Zolitil 50 (50 mg/kg intraperitoneally [IP]), followed by a left anterolateral thoracotomy at the 5th intercostal space with an incision w1.5 cm in width (7). The left lung ischemia was conducted by occluding the left lung hilum for 60 minutes with the use of a microvascular clamp, followed by reperfusion through releasing the clamp and closing the thoracic incision in coupled layers of sutures. After their wounds were cleansed with povidine iodine, the rats were returned to their cages. On the 4th day, the rats were anesthetized following the same procedure as described above. The left femoral artery was cannulated with a polyethylene catheter, through which blood samples were collected and aortic pressure monitored (BLPR2; World Precision Instruments, Sarasota, FL, USA). At the end of study, animals were killed with an overdose of anesthetics (200 mg/kg IP). The whole lung, including trachea, was removed and weighed immediately for the LW/BW ratio. The left main bronchus was firmly tied. The upper right lobe was dissected after the right upper lobe bronchus was tied; the lung was measured immediately for the wet weight, and the dry weight was determined by placing the lung tissue in an oven at 70 C for 7 days.
Neutrophil and Macrophage Cell Counts in Bronchoalveolar Lavage Fluid (BALF) BALF was acquired from the right lung, excluding the upper right lobe, by flushing the lung slowly with 1.25 mL saline solution 3 times. BALF was placed on a slide and stained with Liu stain. Leukocytes were counted and categorized with the use of an optical microscope (1000, Olympus CX31, Tokyo, Japan), where 100 cells were counted on each slide. Neutrophil and macrophage counts were presented as percentages of total erythrocytes.
YEH, FU, YANG, AND WANG
Evaluation of Pulmonary Oxidative Stress by MDA Content in the Lung Tissue MDA level in the lung tissue was evaluated by means of enzymelinked immunosorbent assay kit (ab118970; Abcam San Francisco, CA, USA), where 200 mg of right lung tissue was dissected, homogenized, and lysed at 4 C, followed by centrifugation at 15,000 rpm. The MDA content was examined in the top supernate according to the manufacturer’s guideline.
Real-Time Polymerase Chain Reaction (PCR) Analyses of PGC-1a mRNA Expression mRNA was extracted from the right lung tissue with the use of TRI Reagent (Molecular Research Center) and quantified by Taqman real-time PCR technology with the use of an ABI Prism 7700 Sequence Detection System from PEeApplied Biosystems. Antibodies used were rat PGC-1a (Santa Cruz Biotechnology Paso Robles, CA, USA). The sequences of the primer oligonucleotides and the double-labeled Taqman oligonucleotide probes were as follows: PGC-1a: forward primer GGCCCGGTACAGTGAGTGTT, reverse primer ATTGCTCCGGCCCTTTCTT; TaqMan probe TGGTACCCAAGGCAGCCACTCCAC.
Experimental Design The study was performed on male Sprague-Dawley rats in 3 groups: a sham-operated group (n ¼ 8), a lung I/R group (n ¼ 10), and a group treated orally with resveratrol 15 minutes before lung ischemia and every day until the 4th day (120 mg/kg/d; n ¼ 10). All rats underwent the same surgical preparation up to the hilum occlusion.
Data Analysis Data are presented as mean SEM. Comparisons across multiple groups were analyzed with the use of 1-way analysis of variance, with a Tukey post hoc test. P < .05 was considered to be statistically significant.
RESULTS
With reference to the sham group, left lung I/R injury markedly increased right lung pulmonary capillary permeability, evident by increases in LW/BW (Fig 1A) and W/D (Fig 1B) ratios and lavage protein concentration (Fig 1C), as well as increasing lung inflammation and lipid peroxidation, demonstrated by notable increases in the lavage neutrophils in differential count (Fig 1D) and tissue MDA content (Fig 1E), respectively. We also found that left lung I/R injury reduced right lung mitochondrial biogenesis, as shown by decrease in PGC-1a mRNA expression compared with the sham group (Fig 1F). In contrast, resveratrol treatment reduced pulmonary vascular permeability, lavage neutrophil count, and tissue MDA level. In contrast, PGC1a mRNA expression in resveratrol-treated lung was markedly increased, suggesting protection of pulmonary mitochondrial biogenesis against I/R injury.
Protein Concentration in Broncholavage Fluid The remaining BALF was centrifuged at 1500g for 10 minutes. The top supernate was extracted to examine the albumin concentration with the use of spectrophotometry at 630 nm (Multiskan FC; Thermo Fisher Scientific, Waltham, MA, USA).
DISCUSSION
Lung I/R injury is a complex phenomenon and has been considered to be the primary cause of acute graft failure after lung transplantation, resulting in a high mortality
RESVERATROL ALLEVIATES LUNG ISCHEMIA
∗
0.015
0.010
0.005
20
∗
Neutrophil Macrophage
∗
15
10
5
0
Lung I/R resveratrol+I/R
∗
6
∗
5
4 0 Sham
C
∗
500 400 300 200 100 0
Sham
E
Lung I/R resveratrol+I/R
Lung I/R resveratrol+I/R
∗
0.8
∗
0.6
0.4
0.2
0.0
Lung I/R resveratrol+I/R
∗
600
Control
Lung Tissue MDA (pmol/mg)
B Wet Weight/Dry Weight (W/D)
D
0.000
Sham
Protein content in BALF (mg/dL)
∗
Differential cell count (%)
0.020
Sham
F PGC1- mRNA (% of sham)
Lung Weight/Body Weight (LW/BW)
A
1133
Lung I/R resveratrol+I/R
*
1.2 1.0 0.8 0.6 0.4 0.2 0.0
Sham
rate [2]. In a rat model, we studied the impact to the right lung of left lung I/R injury, induced by complete obstruction of pulmonary arterial blood flow and ventilation (anoxic ischemia). We found that anoxic I/R injury of the left lung markedly increased pulmonary vascular permeability, lavage neutrophil count, and lipid peroxidation, as well as decreased mitochondrial biogenesis in the nonischemic right lung. In addition to inflammatory responses [8], I/R injury has been demonstrated causing mitochondrial dysfunction in solid organs, including heart [9] and kidneys [10], through depletion of intracellular energy and production of oxygen free radicals [6]. Damage to mitochondria often leads to cell death, because through regulating ATP generation, mitochondria can trigger apoptosis and necrosis pathways and have the ultimate control of cell life [11]. More recently, Sommer et al [4] demonstrated that pulmonary I/R injury induces hyperpolarization of inner mitochondrial membrane potential and impairs respiratory chain function complexes I, II, and III, promoting myeloperoxidase activity and lung edema.
Fig 1. Left lung Ischemia and reperfusion (I/R) injury markedly increased right lung pulmonary (A) lung weightetoebody-weight * ratio, (B) lung wet weightetoedry weight ratio ratio, and (C) lavage protein concentration, as well as (D) lavage neutrophils in differential cell count and (E) tissue malondialdehyde (MDA) content. (F) Left lung I/R injury also reduced right lung PGC-1a mRNA expression compared with sham group. BALF, broncholaveolar lavage fluid. Lung I/R resveratrol+I/R *P < .05 (statistically significant).
In humans and other animals, PGC-1a is a coactivator which influences multiple phenotypic traits, controlling mitochondrial biogenesis and aerobic capacity [6]. Puente-Maestu et al [11] demonstrated that increase in PGC-1a mRNA expression in patients with chronic obstructive lung disease was associated with decreased pulmonary oxidative stress and improved aerobic capacity. In the present study, we found that PGC-1a mRNA expression in the lungs were markedly improved with resveratrol protecting against I/R injury. Resveratrol, a polyphenolic compound found in grape skin, was found to have phytoestrogenic effects on hormone and antiinflammatory and antioxidant properties [6]. Resverotrol was also found to inhibit of MyD88-independent signaling pathway of Toll-like receptor 4, which in turn mediates I/R associated lung injury [7]. In a addition, Lagouge et al [6] demonstrated that resveratrol can increase mitochondrial activity through activating PGC-1a and SIRT1 activity, eventually regulating energy homeostasis. We showed that resveratrol treatment significantly attenuates lung I/R injury, essentially related to its antiinflammatory and antioxidative
1134
capacity. More importantly, resveratrol maintained PGC-1a activity during I/R injury and protected mitochondrial biogenesis and homeostasis. In conclusion, ischemia and reperfusion of the left lung induced right lung injury, involving neutrophils and oxidative stress and reduced mitochondrial biogenesis, resulting in significant increases in lung water content and lavage protein concentration. Resveratrol treatment effectively reduces the lipid peroxidation and alveolar neutrophils and protects mitochondrial homeostasis. REFERENCES [1] Allison RC, Kyle J, Adkins WK, et al. Effect of ischemia reperfusion or hypoxia reoxygenation on lung vascular permeability and resistance. J Appl Physiol 1990;69:597e603. [2] den Hengst WA, Gielis JF, Lin JY, et al. Lung ischemiareperfusion injury: a molecular and clinical view on a complex pathophysiological process. Am J Physiol Heart Circ Physiol 2010;299:H1283e99. [3] Campos R, Shimizu MH, Volpini RA, et al. N-Acetylcysteine prevents pulmonary edema and acute kidney injury in rats with sepsis submitted to mechanical ventilation. Am J Physiol Lung Cell Mol Physiol 2012;302:L640e50.
YEH, FU, YANG, AND WANG [4] Sommer SP, Sommer S, Sinha B, et al. Ischemia-reperfusion injury-induced pulmonary mitochondrial damage. J Heart Lung Transplant 2011;30:811e8. [5] Hung LM, Su MJ, Chen JK. Resveratrol protects myocardial ischemia-reperfusion injury through both NO-dependent and NOindependent mechanisms. Free Radic Biol Med 2004;15(36): 774e81. [6] Lagouge M, Argmann C, Gerhart-Hines Z, et al. Resveratrol improves mitochondrial function and protects against metabolic disease by activating SIRT1 and PGC-1alpha. Cell 2006;15(127): 1109e22. [7] Shimamoto A, Pohlman TH, Shomura S, et al. Toll-like receptor 4 mediates lung ischemia-reperfusion injury. Ann Thorac Surg 2006;82:2017e23. [8] Inci I, Zhai W, Arni S, et al. N-acetylcysteine attenuates lung ischemia-reperfusion injury after lung transplantation. Ann Thorac Surg 2007;84:240e6. [9] Balkova P, Hlavackova M, Milerova M, et al. N-Acetylcysteine treatment prevents the up-regulation of MnSOD in chronically hypoxic rat hearts. Physiol Res 2011;60:467e74. [10] Lin M, Li L, Li L, et al. The protective effect of baicalin against renal ischemia-reperfusion injury through inhibition of inflammation and apoptosis. BMC Complement Altern Med 2014 Jan 13;14:19. [11] Puente-Maestu L, Lazaro A, Tejedor A, et al. Effects of exercise on mitochondrial DNA content in skeletal muscle of patients with COPD. Thorax 2011;66:121e7.
ABSTRACT Objective. Lung ischemia and reperfusion (I/R) injury is one of the major causes of postoperative pulmonary dysfunction after cardiopulmonary surgery and thoracic organ transplantation. Recent studies suggest that lung I/R injury may be associated with defects in pulmonary mitochondrial function, in addition to damage from reactive oxygen species. In this study, we examined effects of one lung I/R injury on the other lung, and the protective efficacy of resveratrol on mitochondrial biogenesis in lungs. Methods. Studies were performed in male Sprague-Dawley rats in 3 groups: shamoperated, lung I/R injury, and treated with resveratrol before lung I/R injury (20 mg/kg/d, orally). Lung ischemia was established by occluding the lung left hilum for 60 minutes, followed by releasing the occlusion and closing the chest. Four days after ischemia, we assessed the lung water content and protein concentration in lung lavage of the nonischemic lung; lung inflammation and pulmonary oxidative stress were assessed by leukocyte counts and tissue content of malondialdehyde (MDA), respectively. The level of mitochondrial biogenesis was determined according to PGC1-a mRNA expression. Results. The left lung I/R injury significantly suppressed right lung PGC1-a mRNA expression, increasing pulmonary oxidative stress, lung water content, and lavage leukocyte count and protein concentration (P < .05). Resveratrol treatment attenuated lung injury as well as increasing PGC1-a mRNA expression. Conclusions. Resveratrol treatment protects lung against I/R injury through improving mitochondrial biogenesis and reducing oxidative stress and leukocyte infiltration.
L
OSS of ventilation and lung ischemia are 2 frequent scenarios occurring in lung transplantation and cardiopulmonary bypass surgery [1], resulting in increased production of reactive oxygen species (ROS) and reduced pulmonary adenosine triphosphate (ATP) levels [2]. Lung reperfusion, although it is necessary to revitalize ischemic lungs, frequently induces series of complex events leading to further lung damage, known as pulmonary ischemia and reperfusion (I/R) injury. Although exact mechanisms of pulmonary I/R-induced lung injury has not been fully understood, infiltration of polymorphonuclear leukocytes (PMNs) and segregation of macrophages in the lungs, as well as excessive production of ROS such as superoxide and peroxides, are implicated in lung injury [3]. On the other
hand, Sommer et al [4] demonstrated that pulmonary I/Rinduced lung edema is closely associated with the degree of pulmonary mitochondrial dysfunction. Resveratrol (3,5,40 -trihydroxy-trans-stilbene), an extract of red wine and
Funding: Operating grants (101SKH-FJU-01) from the Shin Kong Wu-Ho-Su Memorial Hospital (Taipei) to Dr. Diana Yu-Wung Yeh and Dr Jiun-Jr Wang and NSC-101-2320-B-030 from National Science Council Taiwan to Dr Jiun-Jr Wang. *Address correspondence to Jiun-Jr Wang, PhD, Associate Professor, School of Medicine, Fu Jen Catholic University, No 510, Zhongzheng Rd, Xinzhuang Dist, New Taipei City, 24205, Taiwan. E-mail: [email protected]
ª 2014 by Elsevier Inc. All rights reserved. 360 Park Avenue South, New York, NY 10010-1710
0041-1345/14/$esee front matter http://dx.doi.org/10.1016/j.transproceed.2013.11.094
Transplantation Proceedings, 46, 1131e1134 (2014)
1131
1132
a phytoalexin, has been demonstrated to be protective against myocardial I/R injury with its antiinflammatory and mitochondrial genesis capacity [5]. Lagouge et al [6] also showed that resveratrol can increase tissue aerobic capacity and PGC-1a mRNA expression, promoting genes for oxidative phosphorylation. In the present study, we aimed to investigate the protective efficacy of resveratrol treatment against pulmonary I/R-induced lung injury and its association with mitochondrial biogenesis. The severity of lung injury was assessed by lung water content, according to lung weightetoebody weight ratio (LW/BW) and lung wet weightetoedry weight ratio (W/D), and protein concentration in the lung lavage. Lung inflammation and pulmonary oxidative stress were measured by lavage leukocyte count and malondialdehyde (MDA) level in the lung tissue, respectively. The degree of mitochondrial biogenesis was determined according to PGC1-a mRNA expression.
MATERIALS AND METHODS Sprague-Dawley rats (250e300 g) were anesthetized with the use of Zolitil 50 (50 mg/kg intraperitoneally [IP]), followed by a left anterolateral thoracotomy at the 5th intercostal space with an incision w1.5 cm in width (7). The left lung ischemia was conducted by occluding the left lung hilum for 60 minutes with the use of a microvascular clamp, followed by reperfusion through releasing the clamp and closing the thoracic incision in coupled layers of sutures. After their wounds were cleansed with povidine iodine, the rats were returned to their cages. On the 4th day, the rats were anesthetized following the same procedure as described above. The left femoral artery was cannulated with a polyethylene catheter, through which blood samples were collected and aortic pressure monitored (BLPR2; World Precision Instruments, Sarasota, FL, USA). At the end of study, animals were killed with an overdose of anesthetics (200 mg/kg IP). The whole lung, including trachea, was removed and weighed immediately for the LW/BW ratio. The left main bronchus was firmly tied. The upper right lobe was dissected after the right upper lobe bronchus was tied; the lung was measured immediately for the wet weight, and the dry weight was determined by placing the lung tissue in an oven at 70 C for 7 days.
Neutrophil and Macrophage Cell Counts in Bronchoalveolar Lavage Fluid (BALF) BALF was acquired from the right lung, excluding the upper right lobe, by flushing the lung slowly with 1.25 mL saline solution 3 times. BALF was placed on a slide and stained with Liu stain. Leukocytes were counted and categorized with the use of an optical microscope (1000, Olympus CX31, Tokyo, Japan), where 100 cells were counted on each slide. Neutrophil and macrophage counts were presented as percentages of total erythrocytes.
YEH, FU, YANG, AND WANG
Evaluation of Pulmonary Oxidative Stress by MDA Content in the Lung Tissue MDA level in the lung tissue was evaluated by means of enzymelinked immunosorbent assay kit (ab118970; Abcam San Francisco, CA, USA), where 200 mg of right lung tissue was dissected, homogenized, and lysed at 4 C, followed by centrifugation at 15,000 rpm. The MDA content was examined in the top supernate according to the manufacturer’s guideline.
Real-Time Polymerase Chain Reaction (PCR) Analyses of PGC-1a mRNA Expression mRNA was extracted from the right lung tissue with the use of TRI Reagent (Molecular Research Center) and quantified by Taqman real-time PCR technology with the use of an ABI Prism 7700 Sequence Detection System from PEeApplied Biosystems. Antibodies used were rat PGC-1a (Santa Cruz Biotechnology Paso Robles, CA, USA). The sequences of the primer oligonucleotides and the double-labeled Taqman oligonucleotide probes were as follows: PGC-1a: forward primer GGCCCGGTACAGTGAGTGTT, reverse primer ATTGCTCCGGCCCTTTCTT; TaqMan probe TGGTACCCAAGGCAGCCACTCCAC.
Experimental Design The study was performed on male Sprague-Dawley rats in 3 groups: a sham-operated group (n ¼ 8), a lung I/R group (n ¼ 10), and a group treated orally with resveratrol 15 minutes before lung ischemia and every day until the 4th day (120 mg/kg/d; n ¼ 10). All rats underwent the same surgical preparation up to the hilum occlusion.
Data Analysis Data are presented as mean SEM. Comparisons across multiple groups were analyzed with the use of 1-way analysis of variance, with a Tukey post hoc test. P < .05 was considered to be statistically significant.
RESULTS
With reference to the sham group, left lung I/R injury markedly increased right lung pulmonary capillary permeability, evident by increases in LW/BW (Fig 1A) and W/D (Fig 1B) ratios and lavage protein concentration (Fig 1C), as well as increasing lung inflammation and lipid peroxidation, demonstrated by notable increases in the lavage neutrophils in differential count (Fig 1D) and tissue MDA content (Fig 1E), respectively. We also found that left lung I/R injury reduced right lung mitochondrial biogenesis, as shown by decrease in PGC-1a mRNA expression compared with the sham group (Fig 1F). In contrast, resveratrol treatment reduced pulmonary vascular permeability, lavage neutrophil count, and tissue MDA level. In contrast, PGC1a mRNA expression in resveratrol-treated lung was markedly increased, suggesting protection of pulmonary mitochondrial biogenesis against I/R injury.
Protein Concentration in Broncholavage Fluid The remaining BALF was centrifuged at 1500g for 10 minutes. The top supernate was extracted to examine the albumin concentration with the use of spectrophotometry at 630 nm (Multiskan FC; Thermo Fisher Scientific, Waltham, MA, USA).
DISCUSSION
Lung I/R injury is a complex phenomenon and has been considered to be the primary cause of acute graft failure after lung transplantation, resulting in a high mortality
RESVERATROL ALLEVIATES LUNG ISCHEMIA
∗
0.015
0.010
0.005
20
∗
Neutrophil Macrophage
∗
15
10
5
0
Lung I/R resveratrol+I/R
∗
6
∗
5
4 0 Sham
C
∗
500 400 300 200 100 0
Sham
E
Lung I/R resveratrol+I/R
Lung I/R resveratrol+I/R
∗
0.8
∗
0.6
0.4
0.2
0.0
Lung I/R resveratrol+I/R
∗
600
Control
Lung Tissue MDA (pmol/mg)
B Wet Weight/Dry Weight (W/D)
D
0.000
Sham
Protein content in BALF (mg/dL)
∗
Differential cell count (%)
0.020
Sham
F PGC1- mRNA (% of sham)
Lung Weight/Body Weight (LW/BW)
A
1133
Lung I/R resveratrol+I/R
*
1.2 1.0 0.8 0.6 0.4 0.2 0.0
Sham
rate [2]. In a rat model, we studied the impact to the right lung of left lung I/R injury, induced by complete obstruction of pulmonary arterial blood flow and ventilation (anoxic ischemia). We found that anoxic I/R injury of the left lung markedly increased pulmonary vascular permeability, lavage neutrophil count, and lipid peroxidation, as well as decreased mitochondrial biogenesis in the nonischemic right lung. In addition to inflammatory responses [8], I/R injury has been demonstrated causing mitochondrial dysfunction in solid organs, including heart [9] and kidneys [10], through depletion of intracellular energy and production of oxygen free radicals [6]. Damage to mitochondria often leads to cell death, because through regulating ATP generation, mitochondria can trigger apoptosis and necrosis pathways and have the ultimate control of cell life [11]. More recently, Sommer et al [4] demonstrated that pulmonary I/R injury induces hyperpolarization of inner mitochondrial membrane potential and impairs respiratory chain function complexes I, II, and III, promoting myeloperoxidase activity and lung edema.
Fig 1. Left lung Ischemia and reperfusion (I/R) injury markedly increased right lung pulmonary (A) lung weightetoebody-weight * ratio, (B) lung wet weightetoedry weight ratio ratio, and (C) lavage protein concentration, as well as (D) lavage neutrophils in differential cell count and (E) tissue malondialdehyde (MDA) content. (F) Left lung I/R injury also reduced right lung PGC-1a mRNA expression compared with sham group. BALF, broncholaveolar lavage fluid. Lung I/R resveratrol+I/R *P < .05 (statistically significant).
In humans and other animals, PGC-1a is a coactivator which influences multiple phenotypic traits, controlling mitochondrial biogenesis and aerobic capacity [6]. Puente-Maestu et al [11] demonstrated that increase in PGC-1a mRNA expression in patients with chronic obstructive lung disease was associated with decreased pulmonary oxidative stress and improved aerobic capacity. In the present study, we found that PGC-1a mRNA expression in the lungs were markedly improved with resveratrol protecting against I/R injury. Resveratrol, a polyphenolic compound found in grape skin, was found to have phytoestrogenic effects on hormone and antiinflammatory and antioxidant properties [6]. Resverotrol was also found to inhibit of MyD88-independent signaling pathway of Toll-like receptor 4, which in turn mediates I/R associated lung injury [7]. In a addition, Lagouge et al [6] demonstrated that resveratrol can increase mitochondrial activity through activating PGC-1a and SIRT1 activity, eventually regulating energy homeostasis. We showed that resveratrol treatment significantly attenuates lung I/R injury, essentially related to its antiinflammatory and antioxidative
1134
capacity. More importantly, resveratrol maintained PGC-1a activity during I/R injury and protected mitochondrial biogenesis and homeostasis. In conclusion, ischemia and reperfusion of the left lung induced right lung injury, involving neutrophils and oxidative stress and reduced mitochondrial biogenesis, resulting in significant increases in lung water content and lavage protein concentration. Resveratrol treatment effectively reduces the lipid peroxidation and alveolar neutrophils and protects mitochondrial homeostasis. REFERENCES [1] Allison RC, Kyle J, Adkins WK, et al. Effect of ischemia reperfusion or hypoxia reoxygenation on lung vascular permeability and resistance. J Appl Physiol 1990;69:597e603. [2] den Hengst WA, Gielis JF, Lin JY, et al. Lung ischemiareperfusion injury: a molecular and clinical view on a complex pathophysiological process. Am J Physiol Heart Circ Physiol 2010;299:H1283e99. [3] Campos R, Shimizu MH, Volpini RA, et al. N-Acetylcysteine prevents pulmonary edema and acute kidney injury in rats with sepsis submitted to mechanical ventilation. Am J Physiol Lung Cell Mol Physiol 2012;302:L640e50.
YEH, FU, YANG, AND WANG [4] Sommer SP, Sommer S, Sinha B, et al. Ischemia-reperfusion injury-induced pulmonary mitochondrial damage. J Heart Lung Transplant 2011;30:811e8. [5] Hung LM, Su MJ, Chen JK. Resveratrol protects myocardial ischemia-reperfusion injury through both NO-dependent and NOindependent mechanisms. Free Radic Biol Med 2004;15(36): 774e81. [6] Lagouge M, Argmann C, Gerhart-Hines Z, et al. Resveratrol improves mitochondrial function and protects against metabolic disease by activating SIRT1 and PGC-1alpha. Cell 2006;15(127): 1109e22. [7] Shimamoto A, Pohlman TH, Shomura S, et al. Toll-like receptor 4 mediates lung ischemia-reperfusion injury. Ann Thorac Surg 2006;82:2017e23. [8] Inci I, Zhai W, Arni S, et al. N-acetylcysteine attenuates lung ischemia-reperfusion injury after lung transplantation. Ann Thorac Surg 2007;84:240e6. [9] Balkova P, Hlavackova M, Milerova M, et al. N-Acetylcysteine treatment prevents the up-regulation of MnSOD in chronically hypoxic rat hearts. Physiol Res 2011;60:467e74. [10] Lin M, Li L, Li L, et al. The protective effect of baicalin against renal ischemia-reperfusion injury through inhibition of inflammation and apoptosis. BMC Complement Altern Med 2014 Jan 13;14:19. [11] Puente-Maestu L, Lazaro A, Tejedor A, et al. Effects of exercise on mitochondrial DNA content in skeletal muscle of patients with COPD. Thorax 2011;66:121e7.