Resveratrol and curcumin ameliorate di-(2-ethylhexyl) phthalate induced testicular injury in rats

Accepted Manuscript Resveratrol and curcumin ameliorate di-(2-ethylhexyl) phthalate induced testicular injury in rats Amal Ahmed Abd El-Fattah, Atef Tadros Fahim, Nermin Abdel Hamid Sadik, Bassam Mohamed Ali PII: DOI: Reference:

S0016-6480(15)00249-X http://dx.doi.org/10.1016/j.ygcen.2015.09.006 YGCEN 12185

To appear in:

General and Comparative Endocrinology

Received Date: Revised Date: Accepted Date:

1 June 2015 9 August 2015 7 September 2015

Please cite this article as: El-Fattah, A.A.A., Fahim, A.T., Sadik, N.A.H., Ali, B.M., Resveratrol and curcumin ameliorate di-(2-ethylhexyl) phthalate induced testicular injury in rats, General and Comparative Endocrinology (2015), doi: http://dx.doi.org/10.1016/j.ygcen.2015.09.006

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Resveratrol and curcumin ameliorate di-(2-ethylhexyl) phthalate induced testicular injury in rats Amal Ahmed Abd El-Fattah1, Atef Tadros Fahim2, Nermin Abdel Hamid Sadik1* and Bassam Mohamed Ali2 1 2

Department of Biochemistry, Faculty of Pharmacy, Cairo University, Cairo, Egypt Department of Biochemistry, Faculty of Pharmacy, October 6 University, Cairo, Egypt

* Corresponding author. Address: Faculty of Pharmacy, Cairo University, Kasr El-Eini Street, Cairo 11562, Egypt. Tel.: +002 0103076776; fax: +20 2 3635140. E-mail address: [email protected].

Abstract The present study aimed to evaluate the protective role of resveratrol and curcumin on oxidative testicular damage induced by di-(2-ethylhexyl) phthalate (DEHP). Male Wistar rats were divided into six groups; three groups received oral daily doses of DEHP (2 g/ kg BW) for 45 days to induce testicular injury. Two of these groups received either resveratrol (80 mg/kg BW) or curcumin (200 mg/kg BW) orally for 30 days before and 45 days after DEHP administration. A vehicle-treated control group was also included. Another two groups of rats received either resveratrol or curcumin alone. Oxidative damage was observed by decreased levels of total antioxidant capacity (TAC) and glutathione (GSH) and increased malondialdehyde (MDA) level in the testes of DEHP-administered rats. Serum testosterone level as well as testicular marker enzymes activities; acid and alkaline phosphatases (ACP and ALP) and lactate dehydrogenase (LDH) showed severe declines. DEHP administration caused significant increases in the testicular gene expression levels of Nrf2, HO-1, HSP60, HSP70 and HSP90 as well as a significant decrease in c-Kit protein when compared with the control group. Histopathological observations provided evidence for the biochemical and molecular analysis. These DEHP-induced pathological alterations were attenuated by pretreatment with resveratrol and curcumin. We conclude that DEHP-induced injuries in biochemical, molecular and histological structure of testis were recovered by pretreatment with resveratrol and curcumin. The chemoprotective effects of these compounds may be due to their intrinsic antioxidant properties along with boosting Nrf2, HSP 60, HSP 70 and HSP 90 gene expression levels and as such may be useful potential tools in combating DEHPinduced testicular dysfunction. Keywords: DEHP; Nrf2; HO-1; HSPs; Resveratrol; Curcumin; Testes; Rat Abbreviations: ACP, acid phosphatase; ALP, alkaline phosphatase; AR , aldose reductase; ARE, Antioxidant Response Element; CMC, carboxymethylcellulose; DEHP, di-(2ethylhexyl)phthalate; FSH , follicle-stimulating hormone; FRAP, ferric reducing antioxidant power; GSH, reduced glutathione; HO-1, heme oxygenase 1; HSE, heat shock element; HSP, Heat-shock protein; HSF-1, heat shock factor-1; LH, luteinizing hormone; LDH, lactate dehydrogenase; MDA, malondialdehyde; MEHP, mono-(2-ethylhexyl) phthalate; Nrf2, Nuclear factor E2-related factor-2; PVC, polyvinyl chloride ; RT-PCR, reverse transcription polymerase chain reaction; ROS, reactive oxygen species; SIRT1, sirtuin1; TSSKs, Testisspecific serine/threonine kinases; TPTZ, tripyridyltriazine; TAC, total antioxidant capacity.

1

1. Introduction There is increasing public concern that environmental toxicants have the potential to impair human fertility (Colborn et al., 1993). The testis is sensitive to a variety of stressors such as hyperthermia, inflammation, radiation and exposure to agents that induce apoptosis of germ cells (Richburg, 2000). Exposure to phthalic acid esters is one of the most common causes of testicular injury. Phthalic acid esters are widely used as plasticizers in several plastic formulations such as polyvinyl chloride (PVC). Among various phthalate esters, DEHP is the most widely studied toxicants of the male reproductive organs (Harris et al., 1997; Ohashi et al., 2005). DEHP contamination is widespread as PVC containing DEHP is widely used in the manufacture of consumer goods, food containers, toys and medical instruments. The general population is exposed to DEHP through food, water and air, which raises concerns about its hazardous effect on human reproductive organs (Hoyer, 2001). Administration of DEHP was reported to reduce the fertility and induces testicular injury of laboratory animals (Oishi, 1986; Thomas and Thomas, 1984). After oral exposure, most DEHP is rapidly metabolized in the gut into mono-(2-ethylhexyl) phthalate (MEHP), the active metabolite which induces testicular injury (Gray and Gangolli, 1986; Pollack et al., 1985) through disruption of the function of Sertoli cell and Leydig cell (Lee et al., 1999; Richburg et al., 2002). Furthermore, MEHP induces oxidative stress in germ cells and causes apoptosis of spermatocytes as a direct action of MEHP on the germ cells (Kasahara et al., 2002). It was shown that spermatogenic disturbance induced by DEHP can be prevented by treatment with antioxidants (Ishihara et al., 2000). Nuclear factor E2-related factor-2 (Nrf2) is a transcription factor, which plays a key role in the cellular defense against oxidative and xenobiotic stresses through its capability to induce the expression of genes, which encode detoxifying enzymes such as heme oxygenase- 1 (HO-1) and antioxidant proteins (Jaiswal, 2004). Heat-shock proteins (HSPs), a class of functionally related highly conserved proteins, found in virtually all living organisms and are named according to their molecular weight (Li and Srivastava, 2004). HSP60, HSP70 and HSP90 also known as chaperones, play 2

crucial roles in folding/unfolding of proteins, assembly of multiprotein complexes, transport/sorting of proteins into correct subcellular compartments, cell-cycle control and signaling, and protection of cells against stress/apoptosis (Sõti et al., 2005). Resveratrol (3, 4, 5-trihydroxy-trans-stilbene) is a natural polyphenol obtained from grapes, mulberries, red wines and root extracts of the weed Polygonum cuspidatum. It is involved in numerous cellular responses including cell cycle arrest, apoptosis and differentiation. It exhibits anti-inflammatory, anticancer and anti-oxidant properties (Brisdelli et al., 2009). It also exhibits a protective effect against lipoperoxidation in cell membranes and against the DNA damage caused by reactive oxygen species (ROS) (Revel et al., 2001). Resveratrol has been demonstrated to protect sperm from apoptosis (Revel et al., 2001; Uguralp et al., 2005) and increase sperm output (Juan et al., 2005). Curcumin (1, 7- bis (4-hydroxy-3-methoxyphenyl)-1, 6-hepadiene-3, 5-dione), is a major active component of the turmeric which is obtained from Curcuma longa rhizomes (Zengiberaceae family) (Joe et al., 2004). It has been widely used as a spice to give the specific flavour and yellow colour to curry in many countries in Asia and Africa (Joe et al., 2004). Curcumin has been shown to be a powerful inhibitor of the proliferation of several tumour cells. It exhibits anticlastogenic, antiviral, anti-infective and antioxidant properties (Araujo and Leon, 2001). Curcumin was demonstrated to prevent peroxidative changes in the sperm and the testicular membrane, so enhancing sperm motility and decreasing spermatozoa abnormalities (Farombi et al., 2007). Therefore, the present study aimed to evaluate the protective effects of resveratrol and curcumin on the anti oxidative effect of Nrf2 and some HSPs expressions using DEHPmodel to induce testicular injury in rats. 2. Materials and methods 2.1. Drugs and chemicals Resveratrol, curcumin and DEHP were purchased from Sigma Chemical Company, St. Louis,

MO,

USA.

Trans-resveratrol

and

curcumin

were

suspended

in

0.5%

carboxymethylcellulose (CMC) solution for oral administration. DEHP (≥ 99% by GC, d = 0.981) was provided as a viscous liquid. All primers were synthesized by the laboratories of 3

the Midland Certified Reagent Company Inc. (Midland, TX, USA). All other chemicals used were of the highest purity and analytical grade. 2.2. Animals Adult male Wistar albino rats weighing 150−200 g were purchased from the Egyptian organization for biological products and vaccines (Cairo, Egypt). They were housed in individual plastic cages (3 rat/cage) placed in a well ventilated rat house of Faculty of Pharmacy, October 6 University under 12 h light/dark cycle at 22 ± 3◦C. The experiments were conducted in accordance with the approval of Research Ethics Committee of Faculty of Pharmacy, Cairo University, Cairo, Egypt. Animals were fed commercial pellet diet and water ad libitum throughout the experimental period. 2.3. Experimental design After one week of acclimatisation, rats were randomly divided into 6 groups each of 6−8 animals as follows:


Group I (n = 8) received CMC (2.5 ml/kg) and served as the vehicle-treated control.




Group II (n = 8) received oral daily doses of DEHP (2 g/ kg BW) for 45 days (Oishi, 1986).




Groups III and IV (n = 8) received resveratrol (80 mg/kg BW) (Jiang et al., 2008) and curcumin (200 mg/kg BW) (Farombi et al., 2007) orally for 30 days prior to DEHP administration as in group II and were followed concurrently daily for 45 days up to the end of experimental period.




Group V and VI (n = 6) received resveratrol and curcumin, respectively in the dose and duration as in Groups III and IV. The rats were weighed once a week. Summary of the dosage regimen is represented in Fig. 1.

2.4. Tissue sampling At the end of the experimental period (75 days) and 24 h after the last dose of resveratrol and curcumin, body weight was determined. Blood samples were drawn from the retro orbital plexus under light ether anesthesia and centrifuged to separate serum, which was kept at −80◦C until testosterone was assayed. Rats were then scarified by cervical

4

dislocation. Both testes were immediately excised, immersed in ice-cold physiological saline, dried, weighed and homogenized in ice-cold double distilled water. A suitable aliquot of the homogenate was mixed with Tris–HCl buffer (0.01 mol/l, pH 7.4) to make 10% homogenate and centrifuged at 10,000 xg at 4 ◦C for 30 min using Dupont Sorvall ultracentrifuge (USA). The resulting supernatant was used for the estimation of level of total antioxidant capacity (TAC) and activities of lactate dehydrogenase (LDH), acid phosphatase (ACP) and alkaline phosphatase (ALP). Glutathione (GSH) level was estimated in a second deproteinized aliquot of the homogenate. A third aliquot was mixed with 2.3% KCl, centrifuged at 3000 rpm and the resulting supernatant was used for the determination of malondialdehyde (MDA) level. For histopathological study, sections of the testis, immediately after sacrifice were fixed in 10% neutral buffered formalin, embedded in paraffin wax, cut at 5-µm thickness and stained with haematoxylin and eosin (H&E) after processing. The sections were then viewed under light microscope for histopathological changes. The rest of testicular tissues were stored at −80 ◦C for subsequent quantification of testicular Nrf2, HO-1, HSP60, HSP70, HSP90 and cKit protein gene expression levels by reverse transcription polymerase chain reaction (RTPCR) 2.5. Biochemical investigations 2.5.1. Serum testosterone level The level of serum testosterone was determined using a commercial ELISA kit (DSI Co., Saronno, Italy) (Marcus and Durnford, 1985). 2.5.2. Testicular markers LDH activity was determined using kit provided by Stanbio, San Antonio, TX, USA according to the method of Buhl and Jackson (1978). LDH assay is based on the interconversion of pyruvate and lactate. ACP and ALP activities were estimated using the kits supplied by Quimica Clinica Aplicada (Amposta, Tarragona, Spain) and Biolabo SA (Maizy, France) according to the methods described previously (Kind and King, 1954; Moss, 1982). The assay of ACP and ALP depends on the hydrolysis of p-

5

nitrophenylphosphate in acid and alkali medium, respectively. The liberated p-nitrophenol is quantified spectrophotometrically at 420 nm. 2.5.3. Antioxidant status The total antioxidant capacity level in testes was measured by the ferric reducing antioxidant power (FRAP) assay (Benzie and Strain, 1996), which measures the ferric reducing ability of antioxidants. At low pH, the ferrictripyridyltriazine complex (FeIIITPTZ) is reduced to the ferrous (FeII) form by the antioxidant (reductant). This reaction produces an intense blue color with an absorption maximum at 593 nm. The intensity of the color is proportional to the antioxidant capacity of the sample. GSH levels were determined chemically using 5,5-dithionitrobenzoic acid (Beutler et al., 1963). Lipid peroxidation was determined from MDA formation as an end product of the peroxidation of lipids. MDA reacts with thiobarbituric acid to generate a colored product that can be measured colorimetrically according to the method of Mihara and Uchiyama (1978). Protein levels were determined by the method of Lowry et al. (1951) using FolinCiocalteu reagent and with bovine serum albumin as standard. 2.5.4. Quantification of testicular Nrf2, HO-1, HSP60, HSP70, HSP90 and c-Kit protein gene expression levels by real time PCR (RT–PCR) Total RNA was isolated from testicular tissue homogenates using RNeasy Purification Reagent (Qiagen, Valencia, CA) according to manufacturer's instructions. The purity (A260/A280 ratio) and the concentration of RNA were obtained using spectrophotometry (Gene Quant 1300, Uppsala, Sweden). First-strand cDNA was synthesized from 4 µg of total RNA using an Oligo(dT)12-18 primer and Superscript™ II RNase Reverse Transcriptase, This mixture was incubated at 42 ◦C for 1 h, the kit was supplied by SuperScript Choice System (Life Technologies, Breda, the Netherlands). Real-time PCR (RT-PCR) amplification was carried out using 10 µL amplification mixtures containing Power SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA USA), equivalent to 8 ng of reverse-transcribed RNA and 300 nM primers. Primer sets for the PCR amplification of Nrf2, HO-1(Ren et al., 2011), HSP60, HSP70, HSP90, GAPDH (Chan et al., 2007) and c-Kit protein (Jiang et al., 2008) genes were selected based on published 6

sequences. Reactions were run on an ABI PRISM 7900 HT detection system (Applied Biosystems). PCR reactions consisting of 95 ◦C for 10 min (1 cycle), 94 ◦C for 15 s, and 60 ◦

C for 1 min (40 cycles), Data were analyzed with the ABI Prism sequence detection system

software and quantified using the v1·7 Sequence Detection Software from PE Biosystems (Foster City, CA). Relative expression of studied genes was calculated using the comparative threshold cycle method. All values were normalized to housekeeping gene GAPDH (Livak and Schmittgen, 2001). The PCR primer pairs used were enlisted in Table 1. 2.6. Statistical Analysis The values are expressed as mean ± standard error (S.E.M) for eight animals. Differences between groups were assessed by one-way analysis of variance (ANOVA). Tukey – Kramer test was performed for inter-group comparisons using Prism software 2007, version 5.01 (GraphPad software, Inc., San Diego, USA). Significance at P-values <0.001, <0.01 and <0.05 have been given respective symbols in the figures. 3. Results 3.1. Effects of resveratrol and curcumin on DEHP-induced changes in body weight gain and testes weight (Fig. 2) Rats exposed to DEHP (Group II) showed significant decreases in their body weight gain and testes weight (p < 0.001) when compared with the control group. Concurrent treatment with resveratrol and curcumin (Groups III and IV) caused significant increases in body weight gain and testes weight (p <0.001) when compared with the DEHP-treated group (Group II). 3.2. Effects of resveratrol and curcumin on DEHP-induced changes of serum testosterone level and testicular marker enzymes activities (Fig. 3) DEHP administration caused significant reductions in the activities of testicular ALP, ACP and LDH activities as well as serum testosterone level (p < 0.001) when compared with the control group. Resveratrol and curcumin were able to produce marked effects in the testes of DEHP-treated rats, as demonstrated by the restoration of the level of serum testosterone and the activity of LDH in the testes to almost normal levels when compared with the control group. A significant increase (p <0.001) in testicular ACP and ALP 7

activities were also detected in the resveratrol and curcumin-treated groups (Groups III and IV) as compared with the DEHP-treated group. 3.3. Effects of resveratrol and curcumin on DEHP-induced changes of testicular TAC, GSH and MDA levels (Fig. 4) Administration of DEHP resulted in substantial testicular damage, as demonstrated by the decreased level of testicular TAC and GSH and increased level of MDA (p < 0.001) when compared with the control group. Resveratrol and curcumin caused normalization of the testicular levels of GSH and MDA when compared with the control group. In addition, a significant increase in the level of testicular TAC (p < 0.001) was also observed in the resveratrol and curcumin-treated groups (Groups III and IV) as compared with the DEHPtreated group. 3.4. Effects of resveratrol and curcumin on DEHP-induced changes in relative expression testicular levels of Nrf2, HO-1, HSP60, HSP70, HSP90 and c-Kit protein (Fig. 5) DEHP administration caused significant increases in the testicular gene expression levels of Nrf2, HO-1, HSP60, HSP70 and HSP90 (each p < 0.001) when compared with the control group. On the other hand, the results revealed a significant decrease in the expression level of testicular c-Kit protein gene (p < 0.001) compared with the control group. Concurrent treatment with resveratrol and curcumin (Groups III and IV) resulted in a significant increase in the gene expression levels of testicular Nrf2, HO-1, HSP60, HSP70, HSP90 and c-Kit protein (each p < 0.001) compared with the DEHP group. Overall, no statistical significant difference in all studied parameters was revealed in the group received resveratrol and curcumin only (groups V and VI) compared with the normal rats, which suggests safety of resveratrol and curcumin dosages used in our study. 3.5. Histopathological examination (Fig. 6) The testicular tissue of the control (A), resveratrol (B), and curcumin (C) groups showed normal architecture with mature active seminiferous tubules and complete spermatogenic series. The DEHP-administered rat testes tissue (D and E) showed atrophy, degeneration, incomplete spermatogenic series in some of seminiferous tubules and homogenous eosinophilic material with oedema replacing the interstitial of Leydig cells. The

8

DEHP + resveratrol (F) and DEHP + curcumin groups (G) showed nearly normal mature active seminiferous tubules with complete spermatogenic series. 4. Discussion The present study demonstrated that DEHP administration resulted in a state of oxidative injury in the testes leading to testicular dysfunction that is consistent with a previous study (Hauser et al., 2004). This was demonstrated by the decrease in body weight gain, testes weight, testicular levels of TAC and GSH along with the increase of MDA level. Furthermore, DEHP administration resulted in significant decreases in serum testosterone level along with testicular LDH, ALP and ACP activities. The significant decrease in body weight gain and testes weight in the DEHP-treated group indicates that the general metabolic functions of the animals are not in the normal range and demonstrates the toxicity of DEHP. The reduction in the weight of the testes may be due to the reduced tubule size, spermatogenic arrest and inhibition of steroid biosynthesis of Leydig cells as the weight of the testes is largely dependent on the mass of the differentiated spermatogenic cells (Chapin et al., 1997). The decrease in the TAC and GSH and the increase in MDA levels in the testes may be attributed to mitochondrial dysfunction caused by MEHP, which induces the release of cytochrome c from the mitochondria to cytosol (Gulbins et al., 2003). MEHP has been shown to up-regulate the expression of Fas ligand in Sertoli cells (Kasahara et al., 2002). Thus, the enhanced release of cytochrome c in spermatocytes and activation of the Fas/Fas ligand system in Sertoli cells may co-operate in inducing apoptosis of germ cells in the testis, thereby causing atrophy of this organ. In addition, spermatozoa are more susceptible to peroxidative damage because of their high concentrations of polyunsaturated fatty acids and low antioxidant capacity (Vernet et al., 2004). The reduction in the level of GSH and the high level of MDA in the testes observed in the present study may reflect the inability of the testes to eliminate ROS possibly produced by DEHP and its metabolites and/or inactivation of the antioxidant enzymes caused by excess generation of ROS in the testes (Wang et al., 2004). This state of increased oxidative stress can explain the significant decrease in serum testosterone level in the DEHP treated 9

group demonstrating testicular insufficiency as an increase in oxidative stress causes ROSinduced damage to macromolecules such as DNA, protein and key enzymes involved in testicular steroidogenesis and spermatogenesis (Sen Gupta et al., 2004). Activities of testicular marker enzymes such as LDH, ACP and ALP are considered to be functional indicators of spermatogenesis. The decreased activity of LDH in the DEHPadministered rats represents a defect in spermatogenesis and testicular maturation. Lactate and pyruvate are found to play an important role in the metabolism of testis (Latchoumycandane and Mathur, 1999). Moreover, a unique isoenzyme of LDH has been found to be located in the inner mitochondrial membrane of the spermatogenic cells of the mature and developing testis. This isoenzyme plays an important role in transferring hydrogen from cytoplasm to mitochondria by redox coupling α-hydroxy acid/α-keto acid related to spermatozoa metabolism (Gu et al., 1989). The decreased activities of testicular ACP and ALP may lead to the destruction of seminiferous epithelium and loss of germinal elements, resulting in the reduction of the number of spermatids associated with the decrease in the daily sperm production in the testes (Hodgen and Sherins, 1973). Decrease activities of these enzymes would thus reflect the decreased testicular steroidogenesis in the DEHP treated rats as these enzymes are involved in the inter- and intracellular transport of necessary inputs for steroidogenesis (Latchoumycandane et al., 1997). Our results revealed that DEHP significantly up-regulated testicular mRNA of Nrf2 along with HO-1. These results may demonstrate an adaptive effect against oxidative stressinduced testicular damage exerted by DEHP. Nrf2 induces the expression of various cytoprotective and detoxification genes like the cytoprotective enzyme HO-1 (Takahashi et al., 2009) as well as other phase II enzymes (Siegel et al., 2004). Nrf2 was also reported to up-regulate glutamyl cysteine ligase modulatory (GCLM) and glutamyl cysteine ligase catalytic (GCLC) units, the two subunits of the rate- limiting enzyme in glutathione biosynthesis (Suh et al., 2004). Nrf2 is one of the main transcription factors that can either transactivate or repress gene expression via binding to the Antioxidant Response Element (ARE) located in the promoter or upstream promoter region of detoxification genes (Kensler et al., 2007). On exposure to ROS or electrophiles, Nrf2 is dissociated from its inhibitor 10

leading to its translocation and accumulation in the nucleus driving gene expression via the ARE (Zhang, 2006). The adaptive increase in HO-1 expression may be attributed to the formation of biliverdin which is then converted to bilirubin, which has an antioxidant effect (Stocker et al., 1987). Biliverdin, iron and carbon monoxide are the breakdown products of heme by HO-1 (Idriss et al., 2008). The results of the present study revealed increased gene expression levels of HSP60, HSP70 and HSP90 in the testicular tissues of the DEHP-treated group compared with the control. These heat shock proteins have a role in the repair or degradation of aberrantly folded or mutated proteins involved in various stressful conditions (Sõti et al., 2005). Increased gene expression levels of HSP60 (Zhang et al., 2005), HSP70 (Eddy, 1998) and HSP90 (Grad et al., 2010) was reported during spermatogenesis as germ cells undergo dramatic alterations in gene expression in both types and amounts of proteins present in each germ cell type. The observed increase in gene expression levels of HSP60 and HSP70 in testes of DEHPtreated rats may be helpful due to their anti-apoptotic effects. HSP60 was reported to modulate post-translational modification of Bcl-2 protein family as well as suppression of Bax and caspase 3 (Shan et al., 2003). HSP70 has been reported to inhibit cytochrome c release (Lee et al., 2013) and the activation of stress-activated protein kinase c-Jun Nterminal kinase and processing of procaspase- 3 (Mosser et al., 1997). HSP70 has been also reported to regulate the expression of other heat shock genes (El Golli-Bennour and Bacha, 2011). HSP90 is required for the catalytic activation, proper folding and stabilization of Testis-specific serine/threonine kinases (TSSKs) which are a family of post-meiotic kinases expressed in spermatids that are critical for spermiogenesis and male fertility in mammals (Li et al., 2011). The observed reduction of testicular c-kit protein gene expression level in DEHP-treated group may indicate testicular dysfunction. C-kit protein is a specific marker protein of spermatogenic cell membranes which is correlated with proliferation and differentiation of spermatogenic cells. It may play a role in preparing the germinal cells to enter meiosis. The c-kit gene mutation was reported to cause abnormal generation and migration of spermatogenic cells and ultimately in infertility (Ruan et al., 2005). 11

Histopathological examination supported the biochemical and molecular analysis. Testes of the DEHP-treated rats showed marked atrophy, degeneration, incomplete spermatogenic series in some seminiferous tubules, focal haemorrhage and homogenous eosinophilic material with oedema replacing the interstitial Leydig cells (Fig. 6D and E). The use of compounds that have antioxidant potential is a promising possible approach to ameliorate DEHP-induced testicular injury. In the present study, pretreatment with resveratrol and curcumin resulted in a significant increase in body weight gain, testes weight and testicular level of TAC. Furthermore, they caused normalization of testicular levels of GSH, MDA and LDH activity as well as serum testosterone level. They also caused a significant increase in testicular ALP and ACP activities. Our data are in accordance with the previously reported protective effect of resveratrol on benzo (a) pyrene-induced oxidative DNA damage and apoptosis of sperm (Revel et al., 2001) or against testicular injury associated with an ischemia-reperfusion model of oxidative stress (Uguralp et al., 2005). This protective effect of resveratrol may be related to its effective scavenging ability of ROS (Leonard et al., 2003). Resveratrol was shown to stimulate manganese superoxide dismutase (MnSOD) activity which is known to be a target of FOXO3a transcription factor (Robb et al., 2008), that was reported to be involved in growth control, differentiation and apoptosis (Giannakou et al., 2007). Resveratrol has been reported to be a direct activator of SIRT1, which stimulate transcriptional activity of FOXO3a by deacetylation (Albani et al., 2009). SIRT1-dependent FOXO3 deacetylation has also been reported to reduce the expression of proapoptotic genes and increase the activity of the anti-apoptotic Bcl2 (Ghosh et al., 2011). The significant increase of serum testosterone level in the DEHP + resveratrol group may be attributed to the stimulatory effect of resveratrol on the secretion of folliclestimulating hormone (FSH) and luteinizing hormone (LH), the major endocrine gonadotrophins regulators of spermatogenesis (Juan et al., 2005) through feedback regulation of hypothalamic-pituitary-gonadal axis. Moreover, resveratrol was reported to act as an estrogen agonist due to its structural similarity with estrogen (Abou‐Zeid and El‐Mowafy, 2004; Bhat et al., 2001), which could elevate the concentration of FSH and testosterone (Juan et al., 2005). Other in vitro studies proved the enhanced expression of c-kit protein in the 12

germ/Sertoli cell co-culture system with FSH or testosterone alone and that FSH manifested a synergistic effect with testosterone in stimulating germ cell proliferation (Mi et al., 2004). Resveratrol proved its antioxidant ability in our study by up-regulation of Nrf2/HO-1 mRNA, hence preserving GSH, TAC as well as reducing MDA levels in testes of the DEHP + resveratrol group compared to the DEHP group. This up-regulation of HO-1 by resveratrol may be mediated via the ARE-mediated transcriptional activation of Nrf2, which is compatible with a previous study in cultured PC12 cells (Chen et al., 2005). HO-1 antioxidant role stems from its ability to catalyze the breakdown of the pro-oxidant heme into biliverdin and carbon monoxide (Idriss et al., 2008). Biliverdin is then reduced by biliverdin reductase into bilirubin, which acts as an antioxidant against lipid peroxidation (Stocker et al., 1987). Carbon monoxide was shown to have an anti-inflammatory property (Otterbein et al., 2000) and anti-apoptotic activity by the up-regulation of the anti-apoptotic molecule Bcl2, and down-regulation of the proapoptotic signal Bax (Nakao et al., 2003). Resveratrol affirmed its testicular protective effect by causing further elevation in the expression level of HSP60, HSP70, and HSP90 in the testes of the DEHP + resveratrol group compared to the DEHP group. This may be attributed to the anti-apoptotic effect of HSP60 (Shan et al., 2003) and HSP70 (Lee et al., 2013) as well as stabilization of TSSKs by HSP90 (Li et al., 2011) as mentioned earlier. Resveratrol was found to promote SIRT1mediated deacetylation of heat shock factor-1(HSF-1) thus enhancing its binding to HSP promoters (Han et al., 2012). The normalization of c-kit protein gene expression level in the testes of the DEHP + resveratrol group is compatible with the result previously described beneficial effect of resveratrol on 2,5-hexanedione induced testicular injury in rats (Jiang et al., 2008). The protective effect of curcumin on DEHP-induced testicular injury was in accordance with the study of Farombi et al. (2007). This protective effect may be attributed to the ability of curcumin to scavenge free radicals, quenching oxygen radicals, inhibiting oxidative enzymes and chelating metal ions, thus restoring the antioxidant status (Wei et al., 2006). In addition, curcumin was shown to induce several enzymatic antioxidants such as catalase (Iqbal et al., 2003) and induce de novo synthesis of GSH (Zheng et al., 2007).

13

Curcumin proved its antioxidant capacity by up-regulation of Nrf2/HO-1 mRNA in testes of the DEHP + curcumin group compared to the DEHP group. Curcumin was reported to stimulate HO-1 activity by inactivation of the Nrf2-Keap1 complex leading to increased Nrf2 activity (Balogun et al., 2003). Increased Nrf2 activity by curcumin has been reported to exert a dose- and time-dependent increase in aldose reductase (AR) expression (Kang et al., 2007). The induction of AR expression represents an adaptive response that increases cellular resistance to toxic injury (Kang et al., 2007). In addition, curcumin affirmed its testicular protective effect by causing further significant elevation of HSP60, HSP70 and HSP90 as well as a significant increase of c-kit protein gene expression levels in the testes of the DEHP + curcumin group compared to the DEHP group. It has been demonstrated that curcumin induces HSF-1 phosphorylation and nuclear translocation, which leads to an increase of the binding of HSF-1 to the heat shock element (HSE) located upstream of HSP70 promoter and the subsequent increase of the HSP70 promoter activity (Teiten et al., 2009). All these findings were further confirmed by the histopathological examination, which revealed the ability of resveratrol and curcumin to maintain structurally and functionally active seminiferous tubules somewhat similar to that of the control. It can be concluded that DEHP-induced injuries in biochemical, molecular and histological structure of testes were recovered by pretreatment with resveratrol and curcumin. The chemoprotective effects of these compounds may be due to their intrinsic antioxidant properties along with boosting Nrf2, HSP60, HSP70 and HSP90 gene expression levels and as such may be useful potential tools in combating the DEHP-induced testicular dysfunction. Acknowledgments We thank Dr. Adel Bakeer, Faculty of Veterinary Medicine, Cairo University for performing the histopathological examinations of this study. The authors declare that they have no conflict of interest.

14

References Abou‐Zeid, L.A., El‐Mowafy, A.M., 2004. Differential recognition of resveratrol isomers by the human estrogen receptor‐α: Molecular dynamics evidence for stereoselective ligand binding. Chirality 16, 190-195. Albani, D., Polito, L., Batelli, S., De Mauro, S., Fracasso, C., Martelli, G., Colombo, L., Manzoni, C., Salmona, M., Caccia, S., 2009. The SIRT1 activator resveratrol protects SK‐N‐BE cells from oxidative stress and against toxicity caused by α‐synuclein or amyloid‐β (1‐42) peptide. Journal of neurochemistry 110, 1445-1456. Araujo, C.C., Leon, L.L., 2001. Biological activities of Curcuma longa L. Mem Inst Oswaldo Cruz 96, 723-728. Balogun, E., Hoque, M., Gong, P., Killeen, E., Green, C., Foresti, R., Alam, J., Motterlini, R., 2003. Curcumin activates the haem oxygenase-1 gene via regulation of Nrf2 and the antioxidant-responsive element. Biochem. J 371, 887-895. Benzie, I.F., Strain, J.J., 1996. The ferric reducing ability of plasma (FRAP) as a measure of "antioxidant power": the FRAP assay. Anal Biochem 239, 70-76. Beutler, E., Duron, O., Kelly, B.M., 1963. Improved method for the determination of blood glutathione. The Journal of laboratory and clinical medicine 61, 882-888. Bhat, K.P., Kosmeder, J.W., Pezzuto, J.M., 2001. Biological effects of resveratrol. Antioxidants and Redox Signaling 3, 1041-1064. Brisdelli, F., D'Andrea, G., Bozzi, A., 2009. Resveratrol: a natural polyphenol with multiple chemopreventive properties. Current drug metabolism 10, 530-546. Buhl, S.N., Jackson, K.Y., 1978. Optimal conditions and comparison of lactate dehydrogenase catalysis of the lactate-to-pyruvate and pyruvate-to-lactate reactions in human serum at 25, 30, and 37 degrees C. Clin Chem 24, 828-831. Chan, J.Y., Cheng, H.-L., Chou, J.L., Li, F.C., Dai, K.-Y., Chan, S.H., Chang, A.Y., 2007. Heat shock protein 60 or 70 activates nitric-oxide synthase (NOS) I-and inhibits NOS II-associated signaling and depresses the mitochondrial apoptotic cascade during brain stem death. Journal of Biological Chemistry 282, 4585-4600. Chapin, R.E., Harris, M.W., Davis, B.J., Ward, S.M., Wilson, R.E., Mauney, M.A., Lockhart, A.C., Smialowicz, R.J., Moser, V.C., Burka, L.T., Collins, B.J., 1997. The effects of perinatal/juvenile methoxychlor exposure on adult rat nervous, immune, and reproductive system function. Fundamental and applied toxicology : official journal of the Society of Toxicology 40, 138-157. Chen, C.-Y., Jang, J.-H., Li, M.-H., Surh, Y.-J., 2005. Resveratrol upregulates heme oxygenase-1 expression via activation of NF-E2-related factor 2 in PC12 cells. Biochemical and biophysical research communications 331, 993-1000. Colborn, T., vom Saal, F.S., Soto, A.M., 1993. Developmental effects of endocrine-disrupting chemicals in wildlife and humans. Environ Health Perspect 101, 378-384. Eddy, E., 1998. Regulation of gene expression during spermatogenesis, Seminars in cell & developmental biology. Elsevier, pp. 451-457. 15

El Golli-Bennour, E., Bacha, H., 2011. Hsp70 expression as biomarkers of oxidative stress: Mycotoxins’ exploration. Toxicology 287, 1-7. Farombi, E.O., Abarikwu, S.O., Adedara, I.A., Oyeyemi, M.O., 2007. Curcumin and kolaviron ameliorate di-n-butylphthalate-induced testicular damage in rats. Basic Clin Pharmacol Toxicol 100, 43-48. Ghosh, N., Ghosh, R., Mandal, S.C., 2011. Antioxidant protection: a promising therapeutic intervention in neurodegenerative disease. Free radical research 45, 888-905. Giannakou, M.E., Goss, M., Jacobson, J., Vinti, G., Leevers, S.J., Partridge, L., 2007. Dynamics of the action of dFOXO on adult mortality in Drosophila. Aging cell 6, 429-438. Grad, I., Cederroth, C.R., Walicki, J., Grey, C., Barluenga, S., Winssinger, N., De Massy, B., Nef, S., Picard, D., 2010. The molecular chaperone Hsp90α is required for meiotic progression of spermatocytes beyond pachytene in the mouse. PLoS One 5, e15770. Gray, T.J., Gangolli, S.D., 1986. Aspects of the testicular toxicity of phthalate esters. Environ Health Perspect 65, 229-235. Gu, Y., Davis, D., Lin, Y., 1989. Developmental changes in lactate dehydrogenase-X activity in young jaundiced male rats. Systems Biology in Reproductive Medicine 22, 131-136. Gulbins, E., Dreschers, S., Bock, J., 2003. Role of mitochondria in apoptosis. Experimental Physiology 88, 85-90. Han, S., Choi, J.-R., Shin, K.S., Kang, S.J., 2012. Resveratrol upregulated heat shock proteins and extended the survival of G93A-SOD1 mice. Brain research 1483, 112-117. Harris, C.A., Henttu, P., Parker, M.G., Sumpter, J.P., 1997. The estrogenic activity of phthalate esters in vitro. Environ Health Perspect 105, 802-811. Hauser, R., Duty, S., Godfrey-Bailey, L., Calafat, A.M., 2004. Medications as a source of human exposure to phthalates. Environ Health Perspect 112, 751-753. Hodgen, G.D., Sherins, R.J., 1973. Enzymes as markers of testicular growth and development in the rat. Endocrinology 93, 985-989. Hoyer, P.B., 2001. Reproductive toxicology: current and future directions. Biochem Pharmacol 62, 1557-1564. Idriss, N.K., Blann, A.D., Lip, G.Y., 2008. Hemoxygenase-1 in cardiovascular disease. Journal of the American College of Cardiology 52, 971-978. Iqbal, M., Sharma, S.D., Okazaki, Y., Fujisawa, M., Okada, S., 2003. Dietary supplementation of curcumin enhances antioxidant and phase II metabolizing enzymes in ddY male mice: possible role in protection against chemical carcinogenesis and toxicity. Pharmacology & toxicology 92, 33-38. Ishihara, M., Itoh, M., Miyamoto, K., Suna, S., Takeuchi, Y., Takenaka, I., Jitsunari, F., 2000. Spermatogenic disturbance induced by di-(2-ethylhexyl) phthalate is significantly prevented by treatment with antioxidant vitamins in the rat. Int J Androl 23, 85-94. Jaiswal, A.K., 2004. Nrf2 signaling in coordinated activation of antioxidant gene expression. Free radical biology & medicine 36, 1199-1207. 16

Jiang, Y.-G., Peng, T., Luo, Y., Li, M.-c., Lin, Y.-H., 2008. Resveratrol reestablishes spermatogenesis after testicular injury in rats caused by 2, 5-hexanedione. Chinese medical journal 121, 1204-1209. Joe, B., Vijaykumar, M., Lokesh, B.R., 2004. Biological properties of curcumin-cellular and molecular mechanisms of action. Crit Rev Food Sci Nutr 44, 97-111. Juan, M.E., Gonzalez-Pons, E., Munuera, T., Ballester, J., Rodríguez-Gil, J.E., Planas, J.M., 2005. trans-Resveratrol, a natural antioxidant from grapes, increases sperm output in healthy rats. The Journal of nutrition 135, 757-760. Kang, E.S., Kim, H.J., Eun, S.Y., Paek, K.S., Kim, H.J., Chang, K.C., Lee, J.H., Lee, H.T., Kim, J.H., Nishinaka, T., 2007. Up-regulation of aldose reductase expression mediated by phosphatidylinositol 3-kinase/Akt and Nrf2 is involved in the protective effect of curcumin against oxidative damage. Free Radical Biology and Medicine 43, 535-545. Kasahara, E., Sato, E.F., Miyoshi, M., Konaka, R., Hiramoto, K., Sasaki, J., Tokuda, M., Nakano, Y., Inoue, M., 2002. Role of oxidative stress in germ cell apoptosis induced by di(2ethylhexyl)phthalate. Biochem J 365, 849-856. Kensler, T.W., Wakabayashi, N., Biswal, S., 2007. Cell survival responses to environmental stresses via the Keap1-Nrf2-ARE pathway. Annual review of pharmacology and toxicology 47, 89-116. Kind, P.R., King, E.J., 1954. Estimation of plasma phosphatase by determination of hydrolysed phenol with amino-antipyrine. J Clin Pathol 7, 322-326. Latchoumycandane, C., Gupta, S., Mathur, P., 1997. Inhibitory effects of hypothyroidism on the testicular functions of postnatal rats. Biomedical letters 56, 171-177. Latchoumycandane, C., Mathur, P., 1999. Effects of hyperthyroidism on the physiological status of pubertal rat testis. Biomedical letters 59, 33-41. Lee, H., Kang, C., Yoo, Y.-S., Hah, D.-Y., Kim, C.H., Kim, E., Kim, J.S., 2013. Cytotoxicity and the induction of the stress protein Hsp 70 in Chang liver cells in response to zearalenone-induced oxidative stress. Environmental toxicology and pharmacology 36, 732-740. Lee, J., Richburg, J.H., Shipp, E.B., Meistrich, M.L., Boekelheide, K., 1999. The Fas system, a regulator of testicular germ cell apoptosis, is differentially up-regulated in Sertoli cell versus germ cell injury of the testis. Endocrinology 140, 852-858. Leonard, S.S., Xia, C., Jiang, B.-H., Stinefelt, B., Klandorf, H., Harris, G.K., Shi, X., 2003. Resveratrol scavenges reactive oxygen species and effects radical-induced cellular responses. Biochemical and biophysical research communications 309, 1017-1026. Li, Y., Sosnik, J., Brassard, L., Reese, M., Spiridonov, N.A., Bates, T.C., Johnson, G.R., Anguita, J., Visconti, P.E., Salicioni, A.M., 2011. Expression and localization of five members of the testisspecific serine kinase (Tssk) family in mouse and human sperm and testis. Molecular human reproduction 17, 42-56. Li, Z., Srivastava, P., 2004. Heat‐Shock Proteins. Current Protocols in Immunology, A. 1T. 1-A. 1T. 6. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402-408. 17

Lowry, O.H., Rosebrough, N.J., Farr, A.L., Randall, R.J., 1951. Protein measurement with the Folin phenol reagent. The Journal of biological chemistry 193, 265-275. Marcus, G.J., Durnford, R., 1985. A simple enzyme-linked immunosorbent assay for testosterone. Steroids 46, 975-986. Mi, Y., Zhang, C., Xie, M., Zeng, W., 2004. Effects of follicle-stimulating hormone and androgen on proliferation of cultured testicular germ cells of embryonic chickens. General and comparative endocrinology 138, 237-246. Mihara, M., Uchiyama, M., 1978. Determination of malonaldehyde precursor in tissues by thiobarbituric acid test. Anal Biochem 86, 271-278. Moss, D.W., 1982. Alkaline phosphatase isoenzymes. Clinical chemistry 28, 2007-2016. Mosser, D.D., Caron, A.W., Bourget, L., Denis-Larose, C., Massie, B., 1997. Role of the human heat shock protein hsp70 in protection against stress-induced apoptosis. Molecular and cellular biology 17, 5317-5327. Nakao, A., Kimizuka, K., Stolz, D.B., Neto, J.S., Kaizu, T., Choi, A.M., Uchiyama, T., Zuckerbraun, B.S., Nalesnik, M.A., Otterbein, L.E., 2003. Carbon monoxide inhalation protects rat intestinal grafts from ischemia/reperfusion injury. The American journal of pathology 163, 1587-1598. Ohashi, A., Kotera, H., Hori, H., Hibiya, M., Watanabe, K., Murakami, K., Hasegawa, M., Tomita, M., Hiki, Y., Sugiyama, S., 2005. Evaluation of endocrine disrupting activity of plasticizers in polyvinyl chloride tubes by estrogen receptor alpha binding assay. J Artif Organs 8, 252-256. Oishi, S., 1986. Testicular atrophy induced by di(2-ethylhexyl)phthalate: changes in histology, cell specific enzyme activities and zinc concentrations in rat testis. Arch Toxicol 59, 290-295. Otterbein, L.E., Bach, F.H., Alam, J., Soares, M., Lu, H.T., Wysk, M., Davis, R.J., Flavell, R.A., Choi, A.M., 2000. Carbon monoxide has anti-inflammatory effects involving the mitogen-activated protein kinase pathway. Nature medicine 6, 422-428. Pollack, G.M., Li, R.C., Ermer, J.C., Shen, D.D., 1985. Effects of route of administration and repetitive dosing on the disposition kinetics of di(2-ethylhexyl) phthalate and its mono-de-esterified metabolite in rats. Toxicol Appl Pharmacol 79, 246-256. Ren, J., Fan, C., Chen, N., Huang, J., Yang, Q., 2011. Resveratrol pretreatment attenuates cerebral ischemic injury by upregulating expression of transcription factor Nrf2 and HO-1 in rats. Neurochemical research 36, 2352-2362. Revel, A., Raanani, H., Younglai, E., Xu, J., Han, R., Savouret, J.F., Casper, R.F., 2001. Resveratrol, a natural aryl hydrocarbon receptor antagonist, protects sperm from DNA damage and apoptosis caused by benzo(a)pyrene. Reprod Toxicol 15, 479-486. Richburg, J.H., 2000. The relevance of spontaneous- and chemically-induced alterations in testicular germ cell apoptosis to toxicology. Toxicol Lett 112-113, 79-86. Richburg, J.H., Johnson, K.J., Schoenfeld, H.A., Meistrich, M.L., Dix, D.J., 2002. Defining the cellular and molecular mechanisms of toxicant action in the testis. Toxicol Lett 135, 167-183.

18

Robb, E.L., Page, M.M., Wiens, B.E., Stuart, J.A., 2008. Molecular mechanisms of oxidative stress resistance induced by resveratrol: Specific and progressive induction of MnSOD. Biochemical and biophysical research communications 367, 406-412. Ruan, H.-B., Zhang, N., Gao, X., 2005. Identification of a novel point mutation of mouse protooncogene c-kit through N-ethyl-N-nitrosourea mutagenesis. Genetics 169, 819-831. Sen Gupta, R., Kim, J., Gomes, C., Oh, S., Park, J., Im, W.B., Seong, J.Y., Ahn, R.S., Kwon, H.B., Soh, J., 2004. Effect of ascorbic acid supplementation on testicular steroidogenesis and germ cell death in cadmium-treated male rats. Molecular and cellular endocrinology 221, 57-66. Shan, Y.-X., Liu, T.-J., Su, H.-F., Samsamshariat, A., Mestril, R., Wang, P.H., 2003. Hsp10 and Hsp60 modulate Bcl-2 family and mitochondria apoptosis signaling induced by doxorubicin in cardiac muscle cells. Journal of molecular and cellular cardiology 35, 1135-1143. Siegel, D., Gustafson, D.L., Dehn, D.L., Han, J.Y., Boonchoong, P., Berliner, L.J., Ross, D., 2004. NAD(P)H:quinone oxidoreductase 1: role as a superoxide scavenger. Molecular pharmacology 65, 1238-1247. Sõti, C., Nagy, E., Giricz, Z., Vígh, L., Csermely, P., Ferdinandy, P., 2005. Heat shock proteins as emerging therapeutic targets. British journal of pharmacology 146, 769-780. Stocker, R., Yamamoto, Y., McDonagh, A.F., Glazer, A.N., Ames, B.N., 1987. Bilirubin is an antioxidant of possible physiological importance. Science 235, 1043-1046. Suh, J.H., Shenvi, S.V., Dixon, B.M., Liu, H., Jaiswal, A.K., Liu, R.-M., Hagen, T.M., 2004. Decline in transcriptional activity of Nrf2 causes age-related loss of glutathione synthesis, which is reversible with lipoic acid. Proceedings of the National Academy of Sciences of the United States of America 101, 3381-3386. Takahashi, T., Shimizu, H., Morimatsu, H., Maeshima, K., Inoue, K., Akagi, R., Matsumi, M., Katayama, H., Morita, K., 2009. Heme Oxygenase-1 is an Essential Cytoprotective Component in Oxidative Tissue Injury Induced by Hemorrhagic Shock. Journal of clinical biochemistry and nutrition 44, 28-40. Teiten, M.-H., Reuter, S., Schmucker, S., Dicato, M., Diederich, M., 2009. Induction of heat shock response by curcumin in human leukemia cells. Cancer letters 279, 145-154. Thomas, J.A., Thomas, M.J., 1984. Biological effects of di-(2-ethylhexyl) phthalate and other phthalic acid esters. Crit Rev Toxicol 13, 283-317. Uguralp, S., Mizrak, B., Bay Karabulut, A., 2005. Resveratrol reduces ischemia reperfusion injury after experimental testicular torsion. Eur J Pediatr Surg 15, 114-119. Vernet, P., Aitken, R., Drevet, J., 2004. Antioxidant strategies in the epididymis. Molecular and cellular endocrinology 216, 31-39. Wang, Y., Song, L., Zhu, Z., Chen, J., He, J., Liu, R., Wang, X., 2004. [Effect of dibutyl phthalate on the biochemical enzymes and lipid peroxidation in rat testes]. Zhonghua nan ke xue = National journal of andrology 10, 729-733. Wei, Q.-Y., Chen, W.-F., Zhou, B., Yang, L., Liu, Z.-L., 2006. Inhibition of lipid peroxidation and protein oxidation in rat liver mitochondria by curcumin and its analogues. Biochimica et Biophysica Acta (BBA)-General Subjects 1760, 70-77. 19

Zhang, D.D., 2006. Mechanistic studies of the Nrf2-Keap1 signaling pathway. Drug metabolism reviews 38, 769-789. Zhang, X.-S., Lue, Y.-H., Guo, S.-H., Yuan, J.-X., Hu, Z.-Y., Han, C.-S., Hikim, A., Swerdloff, R.S., Wang, C., Liu, Y.-X., 2005. Expression of HSP105 and HSP60 during germ cell apoptosis in the heat-treated testes of adult cynomolgus monkeys (Macaca fascicularis). Front Biosci 10, 3110-3121. Zheng, S., Yumei, F., Chen, A., 2007. De novo synthesis of glutathione is a prerequisite for curcumin to inhibit hepatic stellate cell (HSC) activation. Free Radical Biology and Medicine 43, 444-453.

20

Fig. 1. Schematic representation of dosage regimen of the different studied groups.

21

Fig. 2. Effect of pretreatment with resveratrol and curcumin on DEHP-induced changes of body weight gain (A) and testes weight (B) in the different studied groups. Values are expressed as mean ± SEM for 6-8 rats. The symbols #, ** and * represent statistical significance at p < 0.001, p < 0.01 and p < 0.05, respectively. Body weight gain = final body weight − initial body weight. a. Significant difference from control group. b. Significant difference from DEHP group.

22

A

Fig. 3. Effect of pretreatment with either resveratrol or curcumin on DEHP-induced changes of serum testosterone level (A) and testicular ALP, ACP (B) and LDH (C) activities in the different studied groups. Values are expressed as mean ± SEM for 6-8 rats. The symbols # and ** represent statistical significance at p < 0.001 and p < 0.01, respectively. a. Significant difference from control group. b. Significant difference from DEHP group. 23

Fig. 4. Effect of pretreatment with either resveratrol or curcumin on DEHP-induced changes of testicular TAC (A), GSH (B) and MDA (C) levels in the different studied groups. Values are expressed as mean ± SEM for 6-8 rats. a. Significant difference from control group at p < 0.001. b. Significant difference from DEHP group at p < 0.001. 24

Fig. 5. Effect of pretreatment with resveratrol and curcumin on DEHP-induced changes of testicular gene expression levels of Nrf2 and HO-1 (A), HSP60, HSP70 and HSP90 (B) and ckit protein (C) in the different studied groups. Values are expressed as mean ± SEM for six rats in each group. a. Significant difference from control group at p < 0.001. 25

b. Significant difference from DEHP group at p < 0.001.

A

B

C

DD

E

F

G

Fig. 6. Photomicrographs of testicular tissue stained with H&E (x40) of control (A), resveratrol (B), curcumin (C), DEHP (D, E), DEHP + resveratrol (F) and DEHP + curcumin (G) groups. 26

Table 1. Sequence of all primers used in the experiment Primer Nrf2

Sequence Forward 5’ CCCAGCACATCCAGACAGAC 3’ Forward 5’ TATCCAGGGCAAGCGACTC 3’

HO-1

Forward 5’ GCTCTATCGT GCTCGCATGA 3’ Forward 5’ AATTCCCACTGCCACGGTC 3’

Hsp60

Forward 5’ AGGCATGAAGTTTGATAGAGG 3’ Reverse 5’ TTFFCAATTTCAAGAGCAGG 3’

Hsp70

Forward 5’ GGACAAGTCGGAGAACG 3’ Reverse 5’ CCGAGTAGGTGGTGAAG 3’

Hsp90

Forward 5’ TTCATCCGTGGTGTGGTT 3’ Reverse 5’ AGTTCTCTTTGTCTTCAGCC 3’

c-kit protein

Forward 5’ ACAGGCAGACGCCGCACTTTAT 3’ Reverse 5’ CATCGGGCTCCGTTTCTACTCA 3’

GAPDH

Forward 5’ GCCAAAAGGGTCATCATCTC 3’ Reverse 5’ GGCCATCCACAGTCTTCT 3’

27

DEHP induced testicular injury

Oxidative stress +

↓Testosterone ↓c-kit protein ↓TAC ↓GSH ↑MDA ↓ALP ↓ACP ↓LDH

Reversed

+

+

↑Nrf2→ ↑HO-1

+

↑ HSP60 ↑ HSP70 ↑ HSP90

+

Resveratrol Curcumin Natural antioxidants

Proposed mechanism of DEHP-induced testicular injury and inhibitory effects of resveratrol and curcumin

Highlights •

Di-(2-ethylhexyl) phthalate (DEHP) caused an oxidative testicular damage in rats.

•

Resveratrol or curcumin attenuated the DEHP-induced pathological alterations.

•

The effects of these compounds may be due to their intrinsic antioxidant properties.

•

These compounds boosted Nrf2/HO-1, HSP60, HSP70 and HSP90 gene expression levels.