Resveratrol delays replicative senescence of human mesothelial cells via mobilization of antioxidative and DNA repair mechanisms

Free Radical Biology and Medicine 52 (2012) 2234–2245

Contents lists available at SciVerse ScienceDirect

Free Radical Biology and Medicine journal homepage: www.elsevier.com/locate/freeradbiomed

Original Contribution

Resveratrol delays replicative senescence of human mesothelial cells via mobilization of antioxidative and DNA repair mechanisms$ Justyna Miku"a-Pietrasik a,1, Angelika Kuczmarska a,1, B"az˙ej Rubis´ b, Violetta Filas c, Marek Murias d, Pawe" Zielin´ski e, Katarzyna Piwocka f, Krzysztof Ksia˛z˙ek a,n ´ University of Medical Sciences, S´wi˛ecickiego 6, 60-781 Poznan ´ , Poland Department of Pathophysiology, Poznan ´ University of Medical Sciences, Przybyszewskiego 49, 60-355, Poznan ´ , Poland Department of Clinical Chemistry and Molecular Diagnostics, Poznan c ´ University of Medical Sciences, Garbary 15, 61-866 Poznan ´ , Poland Department of Pathology, Poznan d ´ University of Medical Sciences, Dojazd 30, 60-631 Poznan ´ , Poland Department of Toxicology, Poznan e ´ University of Medical Sciences, Szamarzewskiego 62, 60-569 Poznan ´ , Poland Department of Thoracic Surgery, Poznan f Laboratory of Cytometry, Nencki Institute of Experimental Biology, Polish Academy of Sciences, Pasteura 3, 02-093 Warsaw, Poland a

b

a r t i c l e i n f o

a b s t r a c t

Article history: Received 15 November 2011 Received in revised form 23 March 2012 Accepted 25 March 2012 Available online 30 April 2012

Resveratrol (3,40 ,5-trihydroxy-trans-stilbene; RVT) is a natural phytoestrogen known to modulate the rate of senescence in cultured cells. The mechanism by which RVT affects this process is still elusive. In this paper we used human peritoneal mesothelial cells (HPMCs) to examine the effect of RVT (0.5 and 10 mM) on their growth and senescence, with particular emphasis paid to parameters associated with oxidative stress. The results showed that RVT used at a concentration of 0.5 mM (but not at 10 mM) markedly improved HPMC growth capacity, as evidenced by elevated expression of PCNA antigen, augmented fraction of cells in the S phase of the cell cycle, and increased number of divisions achieved before senescence. These effects coincided with diminished expression and activity of senescenceassociated b-galactosidase but were not associated with changes in the telomere length and an incidence of apoptosis. Moreover cells exposed to 0.5 mM RVT were characterized by increased release of reactive oxygen species, which was accompanied by up-regulated biogenesis of mitochondria and collapsed mitochondrial membrane potential. At the same time, they displayed increased activity of superoxide dismutase and reduced DNA damage (8-OH-dG and g-H2A.X level). The efficiency of 8-OHdG repair was increased which could be related to increased activity of DNA glycosylase I (hOgg1). As shown using RT-PCR, expression of hOgg1 mRNA in these cells was markedly elevated. Collectively, our results indicate that delayed senescence of HPMCs exposed to RVT may be associated with mobilization of antioxidative and DNA repair mechanisms. & 2012 Elsevier Inc. All rights reserved.

Keywords: Cellular senescence DNA damage Mesothelial cells Oxidative stress Resveratrol

Introduction Abbreviations: 8-OH-dG, 8-hydroxy-20 -deoxyguanosine; BSA, bovine serum albumin; CPD, cumulative number of population doublings; CPM, counts per minute; FBS, fetal bovine serum; DMSO, dimethyl sulfoxide; H2DCFDA, 20 ,70 dichlorodihydrofluorescein diacetate; hOgg1, DNA glycosylase I; HPMCs, human peritoneal mesothelial cells; JC-1, 5,50 ,6,60 -tetrachloro-1,10 ,3,30 -tetraethylbenzimidazolylcarbocyanine iodide; HUVEC, human umbilical vein endothelial cells; NAO, N-nonyl acridine orange; PBS, phosphate-buffered saline; PCNA, proliferating cell nuclear antigen; ROS, reactive oxygen species; RVT, resveratrol; SA-b-Gal, senescence-associated b-galactosidase; SOD, superoxide dismutase; TCA, trichloroacetic acid $ The authors declare no conflict of interest. n Corresponding author. Fax: þ48 618 546 574. E-mail addresses: [email protected] (J. Miku"a-Pietrasik), [email protected] (A. Kuczmarska), [email protected] (B. Rubis´), vfi[email protected] (V. Filas), [email protected] (M. Murias), [email protected] (P. Zielin´ski), [email protected] (K. Piwocka), [email protected] (K. Ksia˛z˙ek). 1 J.M.-P. and A.K. contributed equally to this work. 0891-5849/$ - see front matter & 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.freeradbiomed.2012.03.014

Replicative senescence is a phenomenon that limits growth of normal somatic cells in vitro and also, probably, in vivo [1]. There is broad agreement that senescence is a cell response to extensive and usually irreparable injury to telomeric and/or nontelomeric regions of the genome [2,3]. Although numerous internal and external stimuli have been recognized to elicit cellular senescence [4], the oxidative stress—especially in terms of a deleterious activity of reactive oxygen species (ROS)—has been found to be the major one [5]. Since a key intracellular source of ROS are mitochondria, dysfunctional metabolism of these structures has been identified as a central element driving the development of the oxidative stress in cells undergoing replicative senescence [6,7]. Resveratrol (3,40 ,5-trihydroxy-trans-stilbene; RVT) is a naturally occurring polyphenolic phytoestrogen produced by a wide

J. Miku!a-Pietrasik et al. / Free Radical Biology and Medicine 52 (2012) 2234–2245

range of plants, including grapes, peanuts, and mulberries. This compound is acknowledged for its cardioprotective, anti-inflammatory, and anticancer properties (see [8] for review). In recent years RVT has attracted a great deal of attention also due to its antiaging activity. It has been observed that it is able to extend the lifespan of multiple model organisms, including Saccharomyces cerevisiae [9], Drosophila melanogaster [10], and Caenorhabditis elegans [11]. There is evidence that this effect may be associated with the activation of sirtuins which belong to the family of NAD(þ)-dependent histone deacetylases and play an important role in the regulation of energy homeostasis, maintenance of genetic stability, and stress response [9,12]. In contrast to well established life-prolonging effects of RVT in vivo, the results obtained from the in vitro studies are sparse and ambiguous. It has been found that RVT improves the proliferative capacity of mesenchymal stem cells [13] and endothelial progenitor cells [14], whereas in keratinocytes it exerts the opposite effect [15]. The conflicting results have also been shown with respect to its impact on replicative cell lifespan. Namely, in fibroblasts RVT increased the number of population doublings achieved before entry into senescence [16], while in endothelial cells (HUVECs), the cell lifespan was significantly diminished [17]. Interestingly enough, there is an ongoing debate on whether RVT displays antioxidative or prooxidative activity. In a classic view, RVT is considered as a strong antioxidant due to its ability to reduce the production of ROS [18] and up-regulate the efficacy of the antioxidative systems, including reduced glutathione [19] and superoxide dismutase [20]. This picture has been blurred, however, by the plethora of studies on cancer cells in which RVT was found to disrupt cellular antioxidant activities leading to the enhanced oxidative stress and concomitant growth inhibition and/or apoptosis [21,22]. Also in endothelial cells, their premature senescence in response to RVT has been found to proceed with an increased generation of ROS [17]. Because of this ‘‘oxidative duality,’’ the issue of whether and how RVT modulates cellular oxidative stress during senescence is still poorly understood. Taking the aforementioned into account we designed a project to deeply elucidate both the ambiguities concerning the activity of RVT in vitro, namely its effect on cell growth/senescence, and the oxidative cell balance. To this end we employed human peritoneal mesothelial cells (HPMCs)—the major cell population within the peritoneal cavity with a well-characterized mechanism of senescence [23–25]—and examined parameters such as the efficiency of DNA synthesis, the number of population doublings achieved, the expression of senescence marker (SA-b-Gal), the length of telomeres, the occurrence of apoptosis, the generation of ROS, the activity of antioxidants (superoxide dismutase; SOD), the magnitude of DNA damage (8-OH-dG, g-H2A.X), the activity of DNA repair mechanism (DNA glycosylase I; hOgg1), and the metabolism of mitochondria (biogenesis, inner membrane potential).

Methods Chemicals Unless otherwise stated, all chemicals were purchased from Sigma-Aldrich Corp. (St. Louis, MO, USA). The tissue culture plastics were from Nunc (Roskilde, Denmark). Approximately 99% pure RVT was obtained from SigmaAldrich Corp. A stock solution was prepared in dimethyl sulfoxide (DMSO) and diluted in a culture medium to desired final concentration. The concentration of DMSO was always 0.05% (v/v). During the experiments RVT was used at concentrations up to

2235

10 mM which, as shown in the preliminary studies, did not affect HPMC viability. Fresh culture media were prepared from the stock solutions every 3 day. A chemical stability of RVT in culture media within this time period was confirmed using high performance liquid chromatography (HPLC), as described in detail in [26]. Cell cultures Primary cultures of human peritoneal mesothelial cells were isolated from the pieces of omentum, as described elsewhere [27]. Briefly, the tissue fragments were obtained from consenting patients undergoing elective abdominal surgery. The study was approved by the institutional ethics committee and all the patients gave their informed consent. All cultures were established from individuals with no evidence of peritonitis and no overt diabetes, uremia, and peritoneal malignancy. The age of the donors ranged from 24 to 30 years. The cells were propagated in medium M199 supplemented with L-glutamine (2 mM), penicillin (100 U/ml), streptomycin (100 mg/ml), hydrocortisone (0.4 mg/ml), and 10% (v/v) fetal bovine serum (FBS) (Gibco, Invitrogen, Karlsruhe, Germany). The cultures were maintained at 37 1C in a humidified atmosphere of 95% air and 5% CO2. HPMCs were forced to senescence by the serial passaging at 7-day intervals with a fixed seeding density of 3  104 cells/cm2. The cells from passages 1–2 were treated as ‘‘young,’’ while those that failed to increase in number during 4 weeks and stained 470% for SA-b-Gal were considered as ‘‘senescent’’ [25]. During the experiments, HPMCs were continuously exposed to standard growth medium (control group) and to the medium supplemented with 0.5 and 10 mM RVT. The culture media were exchanged every 3 day. Measurement of cell proliferation using MTT assay HPMCs were seeded into 96-well plates at a low density of 1  103 cells/cm2 and allowed to attach for 12 h. Then the cells were incubated in medium containing 1.25 mg/ml of the MTT salt [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] for 24 h at 37 1C. The formazan product generated was solubilized by the addition of 20% sodium dodecyl sulfate and 50% N,Ndimethylformamide. Absorbance of the converted dye was recorded at 595 nm with a reference wavelength of 690 nm. Measurement of cell proliferation using [3H]thymidine uptake assay HPMCs were plated onto 48-well clusters at a density of 2.5  104/cm2 and allowed to attach for 4 h. The subconfluent cultures were then exposed to the control medium or medium with RVT for 24 h at 37 1C. The mixture was labeled with 1 mCi/ml [methyl-3H]thymidine (Institute of Radioisotopes, Prague, Czech Republic) and supplemented with 1% FBS to stimulate HPMC proliferation. After incubation, cells were harvested in trypsin– EDTA solution and precipitated with 20% (w/v) trichloroacetic acid (TCA) overnight at 4 1C. The precipitate was washed with 10% TCA and dissolved in 0.1 N NaOH. The radioactivity released was measured in a beta liquid scintillation counter (LKB Wallac, Turku, Finland). Results were expressed as the counts per minute (cpm). Detection of senescence-associated b-galactosidase (SA-b-Gal) The presence of SA-b-Gal was detected according to Dimri et al. [28]. Briefly, HPMCs were grown on Lab-Tek Chamber Slides, fixed with 3% formaldehyde, washed, and exposed for 6 h at 37 1C to a solution containing 1 mg/ml 5-bromo-4-chloro-3-indolyl-b-

2236

J. Miku!a-Pietrasik et al. / Free Radical Biology and Medicine 52 (2012) 2234–2245

D-galactopyranoside (X-Gal), 5 mM potassium ferrocyanide, 5 mM potassium ferricyanide, 150 mM NaCl, 2 mM MgCl2, and 40 mM citric acid, pH 6.0. In addition, SA-b-Gal activity was quantified by measuring the rate of conversion of 4-methylumbelliferyl-b-D-galactopyranose to 4-methylumbelliferone [29]. Immunocytochemistry for proliferating cell nuclear antigen (PCNA) For immunostaining HPMCs were cultured in Lab-Tek Chamber Slides (Nunc, Roskilde, Denmark) and fixed with 70% ethanol. PCNA antigen was detected with the use of specific monoclonal antibody (clone PC10; Dako, Glostrup, Denmark), diluted 1:500 in 0.05 mM Tris–HCl, pH 7.6, 2% bovine serum albumin (BSA) for 20 min at a room temperature. After washing with the phosphatebuffered saline (PBS), the cells were treated with 0.3% H2O2 to quench endogenous peroxidase activity. Bound antibodies were detected by immunoperoxidase staining using the EnVision þ System (Dako) as per the manufacturer’s instructions. Measurement of cell cycle distribution and apoptosis by flow cytometry Cells were harvested with trypsin-EDTA solution and fixed in ice-cold 70% ethanol overnight at 20 1C. After washing with PBS, cells were resuspended in 0.1 M sodium citrate, pH 7.8, for 1 min, and incubated for 30 min in PBS containing 5 mg/ml of propidium iodide (Molecular Probes, Eugene, OR, USA) and 0.1 mg/ml of RNAse A. In order to determine cell distribution in the cell cycle, one million cells were analyzed using a FACSCalibur flow cytometer with ModFit LT software (Verity Software House, Topsham, ME, USA). The incidence of apoptosis was monitored according to the presence of subG1 fraction in cells stained with propidium iodide and analyzed using a FACSCalibur flow cytometer with Cell-Quest software (Becton-Dickinson, Plymouth, UK). Determination of telomere length with real-time PCR Telomere length was measured by real-time PCR as previously described [30], with the following modifications. Briefly, DNA was isolated from cells using mini columns (GenElute Mammalian Genomic DNA Miniprep Kit, Sigma-Aldrich, St. Louis, MO, USA) followed by spectrophotometric measurement (Spekol, AnalytikJena, De). To analyze the telomere length, real-time PCR was performed using 5 ng of total DNA. Telomere PCRs contained primers Telg (ACACTAAGGTTTGGGTTTGGGTTTGGGTTTGGGTTAGTGT) and Telc (TGTTAGGTATCCCTATCCCTATCCCTATCCCTATCCCTAACA). The real-time polymerase chain reaction was carried out using LightCycler 2.0 (Roche Diagnostics, IN, USA) and the qualitative analysis was performed using melting curve analysis. Detection of reactive oxygen species ROS with fluorescence method ROS production was assessed using 20 ,70 -dichlorodihydrofluorescein diacetate (H2DCFDA) that can be trapped inside the cells and activated (as dichlorofluorescein; DCFH) by intracellular ROS. This method of ROS release measurement is particularly reliable, specifically for the detection of hydroxyl, peroxyl, alkoxyl, carbonate, and peroxynitrite radicals. To lesser extent, DCFDA reacts with hydrogen peroxide and superoxide radical anion [31]. Briefly, 1  105 cells were incubated with 5 mM H2DCFDA (Molecular Probes, Eugene, OR, USA) for 45 min at 37 1C, then gently washed, and solubilized with the lysis buffer (Promega,

Madison, WI, USA). Fluorescence generated was monitored in a spectrofluorometer Wallac Victor 2 (Perkin-Elmer, MA, USA) with excitation at 485 nm and emission at 535 nm. The method has been standardized so that the fluorescence emission from the medium (caused by fluorescein diffused out) was barely detectable and did not interfere with the actual results. Nonetheless, in each experimental group appropriate controls were included in order to determine the level of the background fluorescence produced by the cells as well as by the plate with medium but without the cells. The actual results of sample fluorescence were normalized with respect to the cellular background values and expressed as relative light units (RLU) per 105 cells. In some experiments production of ROS was monitored in cells probed with 5 mM H2DCFDA using the fluorescent microscope Zeiss Axio Obserwer D1 (Carl-Zeiss, Jena, Germany).

Measurement of superoxide dismutase activity Total SOD activity was measured in cell lysates with a commercially available kit (R&D Systems Europe, Abingdon, UK), as per the manufacturer’s instructions. In the assay, superoxide ions are generated by the xanthine/xanthine oxidase system and convert nitroblue-tetrazolium (NBT) to NBT-diformazan, which is detectable by light absorption at 560 nm. By neutralizing superoxide, SOD decreases the rate of NBT conversion in proportion to SOD activity in a sample. The results were expressed as milliunits of SOD activity per 105 cells.

Assessment of mitochondrial biogenesis and mitochondrial membrane potential Mitochondrial biogenesis was examined in cells probed with a fluorescent dye N-nonyl acridine orange (NAO). NAO binds to cardiolipin, a mitochondrial inner membrane-specific phospholipid and thus the fluorescence of NAO-probed cells is commonly used as a measure of mitochondrial biogenesis (equated with their mass) [6,32]. In brief, 1  105 cells were incubated with 10 mM NAO for 10 min at 37 1C in the dark. Subsequently, cells were washed with PBS and transferred to semitransparent 96-well plates (Nunc) and the emitted fluorescence was recorded at an excitation wavelength of 435 nm and an emission wavelength of 535 nm, using a Wallac Victor 2 spectrofluorometer. The results were expressed as relative light units per 105 cells. For mitochondrial membrane potential measurements the Mitochondria Staining Kit (Sigma) was employed. During the analysis 1  105 cells was incubated with 1 mM 5,50 ,6,60 -tetrachloro-1,10 ,3,30 -tetraethylbenzimidazolylcarbocyanine iodide (JC-1), which is a lipophilic cationic fluorescent dye exhibiting potentialdependent accumulation in mitochondria [6]. JC-1 accumulates in the functional mitochondria forming red fluorescent J-aggregates (at 590 nm), while mitochondria deenergization results in the accumulation of green fluorescent monomers (at 525 nm). Thus the rise in the green/red fluorescence intensity ratio indicates a drop of the mitochondrial membrane potential values. The ratio of the green/ red fluorescence depends only on the membrane potential and is not associated with other variables, including mitochondria size, shape, and density [33]. After 30 min of incubation at 37 1C, the cells were carefully washed with PBS and transferred to semitransparent 96-well plates (Nunc) and the green and red fluorescences were recorded using an Infinite M200 spectrofluorometer (Tecan Group Ltd, Mannedorf, Switzerland). The mitochondrial membrane potential was calculated according to the ratio of green to red fluorescence, and expressed as absolute values.

J. Miku!a-Pietrasik et al. / Free Radical Biology and Medicine 52 (2012) 2234–2245

Determination of 8-hydroxy-20 -deoxyguanosine (8-OH-dG) concentration Oxidative DNA damage was assessed by measuring 8-OH-dG concentration with a competitive immunoassay (Cell Biolabs Inc., San Diego, CA, USA). In brief, the cells were cultured in Lab-Tek Chamber Slides and exposed to RVT for 24 h, and then a total genomic DNA was extracted from HPMCs using a GenElute Mammalian Genomic DNA Miniprep Kit (Sigma). DNA samples containing unknown concentrations of 8-OH-dG were then mixed with 8-OH-dG standards and incubated with an anti-8-OH-dG antibody for 1 h. Bound antibodies were detected after the incubation with horseradish peroxidase-labeled secondary antibody, and 8-OH-dG concentrations were read from the standard curve and expressed as picogram of 8-OH-dG per 105 cells. Detection of DNA double-strand breaks using immunofluorescence The presence of DNA double-strand breaks was examined according to a visualization of phosphorylated variant of histone H2A.X (g-H2A.X). To this end, the cells were cultured in Lab-Tek Chamber Slides and exposed to RVT for 24 h. Afterward the cells were washed with PBS, fixed with 3% formaldehyde, and incubated with the monoclonal antibody against g-H2A.X (Ser 139) (Upstate Biotechnology, Lake Placid, NY, USA), diluted 1:2000 for 1 h at room temperature. Next, the cells were washed and treated with Alexa Fluor 594 goat anti-mouse IgG (Molecular Probes, Eugene, OR, USA), diluted 1:4000. After that the cells were stained with 1 mg/ml DAPI. The specimens were mounted and inspected in the Zeiss Axio Obserwer D1 microscope. Reverse transcription-PCR for an assessment of DNA glycosylase I mRNA level RNA extraction was carried out using the RNA Bee (Tel-Test, Friendswood, TX, USA) and purified according to the manufacturer’s protocol. One microgram of RNA was reverse-transcribed into cDNA with random hexamer primers, and cDNA was subjected to PCR. The profile of replication cycles was denaturation at 94 1C for 50 s, annealing at 58 1C for 50 s, and polymerization at 72 1C for 1 min. In each reaction, the expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) served as the internal control. The primers used for PCR were as follows: hOGG1 forward, 50 -CTGCCTTCTGGACAATCTTT-30 ; hOGG1 reverse,

2237

50 -TAGCCCGCCCTGTTCTTC-30 designed to amplify a 551-bp region; GAPDH forward, 50 -CCATGGAGAAGGCTGGGG-30 ; and GAPDH reverse 50 -CAAAGTTGTCATGGATGACC-30 designed to amplify a 194-bp region (total number of cycles, 28). The PCR products were separated on 3% agarose gels stained with ethidium bromide, and then visualized. Statistics Statistical analysis was performed using the GraphPad Prism 5.00 software (GraphPad Software, San Diego, CA, USA). The means were compared using the repeated measures analysis of variance (ANOVA) with the Newman-Keuls test as a post hoc. When appropriate the two-way ANOVA and the Wilcoxon matched pairs test were used. The results were expressed as means7SEM. The differences with a P value o0.05 were considered to be statistically significant.

Results Resveratrol improves the proliferation of young HPMCs In order to examine the effect of RVT (ranging from 0.1 to 10 mM) on cell proliferation in vitro, the MTT assay performed on low-density cultures exposed to this stilbene for 24 h was employed. The results showed that under these conditions RVT clearly improved the pace at which HPMCs proliferate, and this effect was evident at concentrations of 0.1, 0.5, and 1 mM. The greatest growth acceleration, specifically by 29 79% (Po0.05), was recorded in the cells exposed to RVT at 0.5 mM (Fig. 1A). Although the MTT assay is commonly used to determine cell proliferation, it reflects this process rather in an indirect manner. For this reason we verified the obtained results using the second but more specific method, namely according to an assessment of the effectiveness of the radiolabeled thymidine incorporation into the newly synthesized DNA of exponentially growing cells. Results of these studies were consistent with the results of the MTT test and revealed that after 24 h of incubation with 0.5 mM RVT cell growth was accelerated by 49711% (Po0.05) compared to the control group (Fig. 1B). According to the above observations, two concentrations of RVT were chosen for all subsequent experiments: 0.5 mM which has been found to stimulate the growth rate of young HPMCs most efficiently, and 10 mM which did not affect the growth of

Fig. 1. Effect of RVT on short-term HPMC proliferation. The proliferative capacity of young HPMCs was examined using the MTT assay (A) and according to incorporation of radiolabeled thymidine (B). The asterisks indicate a significant difference compared to the control group. Experiments were performed in triplicates with HPMC cultures derived from 9 different donors.

2238

J. Miku!a-Pietrasik et al. / Free Radical Biology and Medicine 52 (2012) 2234–2245

young cells but which may constitute a point of reference for the cells exposed to 0.5 mM RVT and which may also modulate some phenomena associated with cell senescence, including a longterm growth kinetics, an expression of senescence markers, or oxidative stress-related parameters.

Resveratrol delays replicative senescence in cultured HPMCs In order to evaluate the effect of RVT on HPMC replicative lifespan, the cells were subcultivated at a constant 7-day interval until a complete cessation of their capacity to divide. These experiments showed that the cells propagated under 0.5 mM RVT displayed improved expandability and delayed entry into senescence compared with the control cells. The replicative cell lifespan of these cells, estimated according to the cumulative number of population doublings achieved (CPD), was by 5176% (Po0.001) higher than that characterizing the untreated control cells. At the same time, the long-term proliferative potential of cells cultured in the presence of 10 mM remained unchanged (Fig. 2A). It must be stressed that at the point at which the control cells approached senescence (passage 6th), the cells exposed to 0.5 mM RVT still replicated vigorously and did not display senescence-like morphology, including enlargement and/or flattening. In their case, the senescence-associated growth arrest was seen three passages later. Therefore, to reliably show the effect of RVT on HPMCs behavior, the subsequent parameters were analyzed and compared in the cells from the same (6th) passage. Because only the control cells were at this time truly senescent, from the semantic reasons the senescent control HPMCs and the 6th passage-derived cells treated with RVT will be together referred to as the ‘‘late-passage cells.’’

The ultimate exhaustion of cell proliferative capacity coincides with a mass appearance of cells characterized by the cytoplasmic activity of senescence marker—senescence-associated b-galactosidase (SA-b-Gal) [28]. We observed that in the cultures that displayed an improved long-term growth capacity in response to 0.5 mM RVT, the fraction of SA-b-Gal-positive cells was markedly reduced. In young cell cultures it was lower by 7773% (Po 0.001), while in late-passage cultures by 26 74% (Po0.001) compared to the control group. In the case of cells exposed to 10 mM RVT, the percentage of SA-b-Gal-positive cells was similar to that characterizing the untreated cells (Fig. 2B and D). The results of the cytochemical, semiquantitative SA-b-Gal analysis were supplemented with the quantitative measurement of SA-b-Gal activity. These studies showed that 0.5 mM RVT reduced the activity of SA-b-Gal by 15 715% (P o0.05) and by 31710% (P o0.05) in young and late-passage HPMCs, respectively. Similarly to the cytochemical detection of SA-b-Gal also in this case 10 mM RVT did not alter the enzyme activity compared with the control group (Fig. 2C).

Resveratrol improves HPMC ability for DNA synthesis In order to mechanistically justify the extended proliferative lifespan of HPMCs continuously exposed to RVT, the expression of proliferating cell nuclear antigen and cell distribution in the different phases of the cell cycle were examined. The immunocytochemical measurements of PCNA expression showed that the fraction of PCNA-positive cells was increased in response to 0.5 mM RVT by 10 72% (Po0.01) and by 3475% (Po0.001), for young and late-passage HPMC cultures, respectively. The percentage of the PCNA-positive cells in the cultures exposed to 10 mM

Fig. 2. Effect of RVT on replicative senescence of HPMCs. Cells were forced to senescence by serial passaging at 7-day intervals, as described under Methods, and then the cumulative numbers of population doublings (A), expression (B), and activity (C) of SA-b-Gal were examined. Representative result of cytochemical detection of SA-b-Gal (positive cells are exemplified with arrows); magnification  40 (D). The frames in panel A indicate two time points, corresponding to young and late-passage cells, at which cells treated with RVT were compared with the control group. The asterisks indicate a significant difference compared to the control group. Experiments were performed in triplicates with HPMC cultures derived from 12 different donors. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

J. Miku!a-Pietrasik et al. / Free Radical Biology and Medicine 52 (2012) 2234–2245

RVT was comparable with the control group irrespective of the replicative age of the cells (Fig. 3A). The results of PCNA level examination were confronted with the analysis of the effect of RVT on cell distribution in various phases of the cell cycle, in particular in the S phase encompassing the cells actively synthesizing their DNA. The flow cytometry analysis of HPMCs probed with propidium iodide revealed that the cell exposure to 0.5 mM RVT increases the fraction of the cells in the S phase either in young (by 25 79%; Po0.01) or in latepassage cultures (by 77 712%; Po0.001). At the same time, 10 mM RVT did not alter the subset of replicating cells replicating their DNA (Fig. 3B and C). Resveratrol does not affect telomere length and apoptosis incidence during senescence of HPMCs It has been described that senescence of HPMCs growing under standard culture conditions is not associated with an attrition of telomeric DNA [24] or an altered frequency of apoptotic cell death [23]. The significant effect of RVT on HPMC senescence prompted us to reevaluate the involvement of these two phenomena. The telomere length was assessed with the quantitative real-time PCR while the presence of apoptotic cells bearing oligonucleosomally

2239

fragmented DNA (so-called subG1 fraction) was monitored with the flow cytometry. The results of these analyses showed that RVT did not influence telomere length and the extent of apoptotic cell fraction, irrespective of the replicative age of culture and the stilbene concentration used (Table 1). Resveratrol up-regulates the production of ROS and the total activity of SOD The experiments on cells continuously exposed to RVT and then probed with a fluorescent dye, H2DCFDA, showed that the generation of ROS by young HPMCs exposed to 0.5 mM RVT was by 93737% higher (Po0.05) compared to control group. An even stronger effect was observed in cells exposed to 10 mM RVT (an increase by 192739%; Po0.001). Noteworthy, the production of ROS in cells treated with 10 mM RVT was also considerably higher compared to their counterparts exposed to 0.5 mM RVT (Po0.05). In late-passage cultures, ROS release by cells treated with 0.5 and 10 mM RVT was comparable to that of the control group (Fig. 4A). Afterward, we examined the second aspect of the oxidative cell status, namely the activity of intracellular antioxidants. In our studies the total activity of superoxide dismutase was used as a measure of the antioxidative cell capacity. The measurements performed using

Fig. 3. Effect of RVT on the expression of PCNA antigen (A) and cell cycle distribution (B). Representative histograms showing cell-cycle distribution in young HPMCs exposed to 0.5 and 10 mM RVT. Fraction of cells in the S phase is highlighted in red (C). The asterisks indicate a significant difference compared to the control group. Experiments were performed with HPMC cultures derived from 9 (PCNA) and 4 (cell-cycle distribution) different donors. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

Table 1 The effect of resveratrol (RVT) on the telomere length and the percentage of apoptotic cells in young and late-passage HPMC cultures. Parameter

Telomere length (kbp) SubG1 fraction (%)

Young HPMCs

Late-passage HPMCs

Control

RVT 0.5

RVT 10

Control

RVT 0.5

RVT 10

3.17 1.9 7.17 0.9

2.97 1.2 7.27 0.6

4.1 7 1.9 7.2 7 0.5

5.1 71.1 8.9 71.9

5.6 71.5 8.6 72.2

5.17 1.4 7.37 1.5

The experiments were performed in triplicates with HPMC cultures derived from 6 different donors.

2240

J. Miku!a-Pietrasik et al. / Free Radical Biology and Medicine 52 (2012) 2234–2245

the commercial xanthine/xanthine oxidase system showed that SOD activity in young cells exposed to 0.5 mM RVT was by 4176% higher (Po0.001) compared to the control ones. In turn, the cells exposed to 10 mM RVT displayed SOD activity which was higher compared to the controls by 1673% (Po0.001). The enzyme activity in cells treated with 0.5 mM RVT was significantly greater than in cells treated with 10 mM RVT (Po0.001). In late-passage cells 0.5 mM RVT up-regulated SOD activity by 87712% (Po0.001) compared to the control cells while in cultures exposed to 10 mM RVT the total SOD level was similar to that characterizing the control group. Importantly, SOD activity in late-passage HPMCs treated with 0.5 mM RVT did not differ from that recorded for young cells (Fig. 4B). Because, unexpectedly, both the ROS release and the SOD activity in cells treated with RVT were accordingly increased, to profoundly investigate the reciprocal relationship between these two parameters we evaluated them again in the time-course experiments on young HPMCs from the 1st passage. Studies showed that cells treated with RVT generate ROS time dependently with a peak value reached after 2 h of exposure. After that point, ROS generation steadily decreased reaching an initial level at 12 h (for 0.5 mM RVT) or at 72 h (for 10 mM RVT) of the

experiment. It must be stressed that the maximal level of ROS in cells exposed to 10 mM RVT was significantly higher than in cells treated with 0.5 mM RVT (Po0.01) (Fig. 4C and D). The analogical studies carried out with respect to SOD revealed that the enzyme activity in cells treated with RVT rises time dependently but, compared to ROS release, there is a significant shift in a time at which SOD activity reaches the highest level. In cells exposed to 0.5 mM RVT, SOD activity achieved the maximal value after 12 h of incubation and remained unchanged till 72 h of the experiment. At the same time, SOD activity in cells exposed to 10 mM RVT achieved a peak also at 12 h but starting from that time point, it started to decrease reaching a baseline level at 48 h of the experiment. Moreover, from 12 h of incubation till the end of the experiment, SOD activity in cells treated with 0.5 mM RVT was significantly greater compared with 10 mM RVT (Fig. 4E). Resveratrol stimulates biogenesis of mitochondria and increases mitochondrial membrane potential Since the abnormal mitochondria metabolism, in particular, increased efflux of ROS from the electron transport chain

Fig. 4. Effect of RVT on ROS release (A) and SOD (B) activity in young and late-passage HPMCs. Representative staining of ROS in young HPMC cultures probed with H2DCFDA; magnification  100. (C) Redox-sensitive fluorescence probe H2DCFDA (5 mM) was added to the medium for 1 h. Images of ROS-induced fluorescence were observed by fluorescence microscopy. Arrows indicate the cells that were stained with H2DCFDA. Changes in ROS generation (D) and SOD activity (E) in cells treated with RVT in the time-course experiments. The asterisks indicate a significant difference compared to the control group. Experiments were performed in duplicates with HPMC cultures derived from 10 different donors. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

J. Miku!a-Pietrasik et al. / Free Radical Biology and Medicine 52 (2012) 2234–2245

machinery has been recognized as a major source of oxidative stress during cell senescence, the effects of RVT on two vital aspects of mitochondria function, i.e., their biogenesis and the inner membrane potential, have been examined. The measurements of mitochondria biogenesis—according to cell labeling with the fluorescence dye, NAO—showed that in young cells RVT increased mitochondria mass by 68 727% (Po0.05) and by 49 727% (Po0.05), for 0.5 and 10 mM RVT, respectively. At the same time, mitochondria mass in late-passage cultures exposed to RVT did not differ from the values obtained for the control group (Fig. 5A). In order to examine the mitochondrial membrane potential, the cells were probed with another fluorescent dye, JC-1. The results of these investigations showed that 0.5 mM RVT reduced mitochondrial membrane potential in young HPMCs by 2676% (Po0.01) compared to the control cells. Conversely, in latepassage cultures, the values of this parameter in cells treated with 0.5 mM RVT were considerably higher than in the controls (by 30 75%; Po0.001). At the same time, mitochondrial mem-

2241

brane potential in both young and late-passage HPMCs exposed to 10 mM RVT did not differ from that in the untreated cells (Fig. 5B).

Resveratrol decreases DNA damage in young and late-passage HPMCs The magnitude of DNA injury in cells propagated in the presence of RVT was examined according to the measurements of the concentration of the oxidative DNA adduct, 8-OH-dG, and the presence of DNA double-strand breaks, visualized as the foci of phosphorylated variant of histone H2A.X (g-H2A.X). Studies of 8-OH-dG level showed that after 24 h of exposure to RVT, the concentration of this DNA adduct in young HPMCs was by 34 75% (Po0.01) and by 22 77% (Po0.01) lower compared to control cells, for 0.5 and 10 mM RVT, respectively. Noteworthy, the concentration of 8-OH-dG in cells exposed to 0.5 mM RVT was significantly lower than in cells exposed to 10 mM RVT (Po0.05). In late-passage cells, in turn, the 8-OH-dG level in cells exposed to 0.5 mM RVT was 2273% (P o0.01) lower than in the untreated

Fig. 5. Effect of RVT on mitochondrial mass (A) and mitochondrial membrane potential (B) in young and late-passage HPMCs. The asterisks indicate a significant difference compared to the control group. Experiments were performed in triplicates with HPMC cultures derived from 9 different donors.

Fig. 6. Effect of RVT on 8-OH-dG (A) and histone g-H2A.X (B) level in young and late-passage HPMCs. The presence of g-H2A.X (green pixels) in a representative HPMC culture counterstained with DAPI; magnification  100 (C). The arrows indicate cells bearing g-H2A.X. The asterisks indicate a significant difference compared to the control group. Experiments were performed in duplicates with HPMC cultures derived from 10 different donors.

2242

J. Miku!a-Pietrasik et al. / Free Radical Biology and Medicine 52 (2012) 2234–2245

ones cells, while in cells treated with 10 mM RVT it remained unchanged (Fig. 6A). A concomitant examination of cells bearing DNA doublestrand breaks revealed that 24 h incubation of HPMCs with 0.5 mM RVT diminished the fraction of g-H2A.X-positive cells by 3875% (Po0.001) and by 31 74% (Po0.001) compared to the control cells, for young and late-passage HPMC cultures, respectively. RVT used at a concentration of 10 mM did not alter the extent of g-H2A.X-positive cell fraction in young and in latepassage cultures (Fig. 6B and C). Resveratrol improves the efficiency of 8-OH-dG repair mechanism In order to examine the effect of RVT on the efficiency of DNA damage repair mechanisms, we focused on cell ability to remove 8-OH-dG, which is primarily associated with the activity of DNA glycosylase I (hOgg1). In a first group of experiments hOgg1 activity was assessed in an indirect manner in cells preexposed to RVT for 2 h (the time that corresponds to the maximal ROS release upon RVT treatment), gently washed, and then allowed to recover in standard medium for up to 72 h. The results showed that under these conditions, cell exposure to both concentrations of RVT led to a

significant rise in 8-OH-dG level (time-point 0). Afterward, the concentration of 8-OH-dG in cells preexposed to 0.5 mM RVT gradually declined so that after 12, 24, and 72 h it was significantly lower than in cells at the time-point 0. On the other hand, in cells preexposed to 10 mM RVT, the concentration of 8-OH-dG remained elevated over the whole 72-h recovery period (Fig. 7A). In the next step we examined the changes in the expression of mRNA for hOgg1 in young HPMCs exposed to RVT in the time intervals corresponding to the above-described studies on 8-OHdG repair efficiency. The PCR analysis revealed that under such a regimen, in cells pretreated with 0.5 mM RVT, hOgg1 mRNA level steadily increased reaching the highest level at the 72 h of the exposure. In the case of cell pretreatment with 10 mM RVT, after a temporary up-regulation of hOgg1 mRNA (the peak reached at the 4 h of the experiment), it gradually declined to the values comparable with the time-point 0 (Fig. 7B and C).

Discussion In the present study we show that resveratrol—used at a low concentration of 0.5 mM—improves proliferative capacity and delays the onset of senescence in human peritoneal mesothelial

Fig. 7. Effect of RVT on the efficiency of 8-OH-dG repair (A) and the expression of DNA glycosylase I (hOgg1) mRNA in young HPMCs (B,C). Panel B shows a representative RT-PCR analysis of four performed. The asterisks indicate a significant difference compared to values obtained for the time-point 0. Experiments were performed in duplicates with HPMC cultures derived from 9 different donors.

J. Miku!a-Pietrasik et al. / Free Radical Biology and Medicine 52 (2012) 2234–2245

cells in vitro. Furthermore we found evidence that this beneficial effect of RVT may be linked with the mobilization of antioxidative and DNA repair mechanisms, which is preceded by hormetic-like strong but temporary increase in the generation of ROS. Importantly, such a low concentration of RVT—taking into account its absorption and bioavailability after oral ingestion [34]—is easily achievable in dietary sources, e.g., red wines in which RVT concentration ranges from 0.1 to 14.3 mg/L [35]. Primary cultures of omentum-derived HPMCs display very limited capacity to divide in vitro and thus constitute a convenient tool for studies on various aspects of replicative cell senescence, including the search for agents that may modulate the rate of this process [23,36]. During the experiments we employed two concentrations of RVT (0.5 and 10 mM) which are on the opposite poles of the range of the nontoxic doses of this compound with respect to HPMCs. Since a clear dose dependency of RVT on cell growth has previously been reported [13], each parameter in this paper was evaluated using both RVT doses. From the very beginning, however, HPMCs growth and senescence were affected only by the lower of two RVT concentrations. In fact, as per our knowledge, 0.5 mM is the lowest concentration of RVT which has been found to either effectively stimulate growth or retard senescence in cultured cells. For example, in the case of lung fibroblasts replicative senescence was delayed upon prolonged exposure to 5 mM [16]. In mesenchymal stem cells, in turn, the authors employed RVT at 0.1 mM, but observed acceleration of cell growth in short-term experiments only [13]. In this respect it must be stressed that the range of available RVT concentrations for the experiments on HPMCs was rather limited since doses above 10 mM appeared to markedly reduce the culture viability. In this feature HPMCs markedly differ from other cell types (e.g., fibroblasts) in which even concentrations of RVT as high as 100 mM were used to assess cell growth [37]. In this field HPMCs are preferably similar to keratinocytes which remained viable at RVT concentrations up to 10–20 mM [15]. Both keratinocytes and HPMCs are known to be very sensitive to environmental insult, e.g., oxidative stress which on the one hand limits their growth potential and on the other hand decreases a threshold of their viability in vitro [25,38]. The analysis of cell growth potential revealed that HPMCs exposed to 0.5 mM RVT display increased efficiency of DNA synthesis which was evidenced according to increased uptake of the radiolabeled thymidine into the exponentially growing cells and to increased fraction of cells in the S phase of the cell cycle. Furthermore, the improved cell proliferative capacity in response to RVT coincided with an extended cell replicative lifespan which was longer by a half compared with that in untreated control cells. This retarded onset of senescence appeared not to be related either to the maintenance of the length of telomeric DNA or to the diminished incidence of apoptotic cell death. At the same time, an improved cell proliferation was associated with markedly reduced expression and activity of a senescent cell marker, SA-b-Gal [28]. The examination of such an extensive panel of parameters associated with cell growth and senescence was highly advisable since the vast majority of previous reports concerning the effect of RVT on cell behavior were based only on the individual parameters associated with these phenomena, in particular on the expression of SA-b-Gal combined (or not) with a short-term cell proliferation [14,39,40]. This was of special importance also because the presence of SA-b-Gal may be often induced artificially even in very young cultures, and the results of short-term cell proliferation may have not be compatible with the ultimate senescence kinetics [36]. Also for these reasons, the qualitative cytochemical method of SA-b-Gal detection was enriched in a quantitative analysis of the enzyme activity in the whole cell population. The results obtained using both methods were consistent.

2243

Nonetheless our results pointing out the replication-prolonging effect of RVT on HPMCs are in line with those obtained by Giovannelli et al. on MRC5 fibroblasts [16] but stay in sharp contrast with those of Schilder et al. on endothelial cells (HUVECs) [17]. It must be stressed, however, that in the latter report, the acceleration of cellular senescence was observed in cells exposed to 10 mM RVT, which in our case did not affect HPMC growth and senescence at all. On the other hand, we found an interesting parallel with that paper. Namely, in both cases, the exposure to RVT led to cell accumulation in the S phase of the cell cycle. In our opinion, the accumulation of cells in this phase indicates the improved growth capacity of culture and not, as suggested by Schilder and colleagues, inhibition of DNA synthesis [17]. In fact, cells that passed the G1/S checkpoint entered a new round of replication and vigorously replicated their DNA. This is in keeping with our further observation that cells exposed to RVT display increased expression of PCNA proliferating antigen which is specific for the S phase and acts as a processivity factor for DNA polymerase d [41]. Therefore we can hypothesize that in both HPMCs and HUVECs, cell accumulation in the S phase may reflect an improved rate of divisions, but—maybe due to large differences in the maximal lifespan of these cells (up to 10 population doublings for HPMCs and 450 for HUVECs)—in our studies it resulted in an increased number of divisions achieved while in the endothelial cells in the premature exhaustion of their growth capacity leading to accelerated senescence. Cellular replicative senescence is associated with increased oxidative stress which is primarily attributed to an increased efflux of ROS from dysfunctional mitochondria [6]. With respect to the biological activity of RVT, the literature data provide disparate information on its effect on ROS release. In some experimental models RVT has been found to reduce ROS level [18,42] while in the others, to increase it [17,21]. In order to delineate the exact effect of RVT on the oxidative stress during senescence of HPMCs, we examined both sides of the oxidative cell status, namely the generation of ROS and the activity of antioxidant and DNA repair mechanisms. The studies showed that young HPMCs exposed to both doses of RVT generated increased amounts of ROS in a dose-dependent manner which partly resembled results of the studies on endothelial cells that generated increased amount of ROS in response to 10 mM RVT [17]. The maximal level of ROS release in RVT-treated HPMCs was recorded after 2 h of exposure (for the both RVT concentrations) and then it dropped reaching a baseline level at 72 h of incubation. Interestingly enough, when ROS generation was recorded in young cells from the second passage (after 14 day of continuous incubation) it appeared to be above the control group again. This effect, that may seem somewhat unexpected, is probably associated with an increasing percentage of prematurely senescent (and thus generating more ROS) HPMCs whose fraction, as revealed our previous studies, at this point is quite high [24,25]. It is very likely that the elevated release of ROS by HPMCs treated with RVT may be a result of the up-regulated biogenesis of mitochondria in these cells the effect of which has previously been observed in coronary arterial endothelial cells (CAECs) and attributed to increased activity of proliferator-activated receptorcoactivator-1 alpha, nuclear respiratory factor-1, and mitochondrial transcription factor A [43]. Increased mitochondrial mass in HPMCs coincided with reduced values of mitochondrial membrane potential which may be, in turn, a direct reaction to respiratory chain damage (due to deleterious ROS activity), increased permeability of the inner membrane for the protons, and/or opening of mitochondrial megachannel. The reciprocal relationship between accordingly increased ROS and mitochondrial mass and depleted mitochondrial membrane potential has previously been reported in fibroblasts [6] and HPMCs [44] as a

2244

J. Miku!a-Pietrasik et al. / Free Radical Biology and Medicine 52 (2012) 2234–2245

part of so-called retrograde signaling response. It is worth noting that in late-passage HPMCs exposed to 0.5 mM RVT, the values of mitochondrial membrane potential were higher than in both senescent control cells and their counterparts treated with 10 mM RVT, implying the augmented capacity of those cells to generate ATP which, in turn, may explain (at least partly) their extended lifespan. Increased generation of ROS by HPMCs treated with RVT was followed (a peak reached after 12 h of incubation) by the induction of SOD activity. Similar activation of the antioxidative defense (the manganese isoform of SOD) upon treatment with RVT has recently been observed by Robb et al. in lung fibroblasts [45]. Importantly, our studies showed that the enzyme activity was greater in cells exposed to 0.5 mM RVT, and—in contrast to 10 mM RVT—this up-regulated activity remained unchanged even at the 72 h of the exposure (when ROS level returned to initial level). Also in cells exposed for 14 day to RVT, SOD activity was elevated in cells treated with 0.5 and 10 mM RVT; however, in the former it was significantly higher. Since RVT has been found to increase both ROS release and SOD activity one may speculate that of these two effects, the mobilization of the antioxidant was more pronounced and thus biologically relevant. In addition, it cannot be ruled out that the activation of ROS release by 0.5 mM RVT may constitute an example of hormetic-like activity in which strong but temporary bursts of ROS may stimulate cellular antioxidative mechanisms, e.g., SOD activity [46]. In fact, hormetic activity of RVT has already been postulated by others, especially in the context of its anticancer potential [47]. If this concept is correct, an important question arises concerning the paradoxical effect of RVT in which the SOD activity is permanently up-regulated only in cells exposed to lower concentrations of the stilbene. We suppose that this effect may be explained by the nature of hormesis phenomenon which requires regular cell stimulation with truly low (and thus nontoxic) doses of a stressor (0.5 mM of RVT) which, in turn, may imply that its higher doses (10 mM of RVT) may induce cell antioxidative mechanisms to a lesser extent, not at all, or may even decrease their effectiveness (e.g., via certain gene damage). In fact, we observed that the level of ROS generated in response to 0.5 mM RVT (either in the short-term time-course experiments or after 14 day of exposure) was markedly lower compared with 10 mM RVT. It is likely that excessive oxidative stress in cells exposed to 10 mM RVT—which cannot be explained simply according to increased biogenesis of mitochondria (see Fig. 5A)—may be related to some another molecular events elicited by higher doses of RVT. This can be, for instance, a decreased cellular uptake of dehydroascorbic acid through sodiumindependent glucose transporters (Glut-1 and Glut-3) the effect of which has been revealed by Park et al. in cancer cells treated with high doses of RVT [48], and which may lead to the weakening of mitochondria protection against ROS due to decreased conversion of dehydroascorbate to ascorbate [49]. In order to verify our reasoning concerning the primacy of the antioxidant induction on ROS generation in response to RVT, we examined the effect of the stilbene on the magnitude of oxidative DNA damage, including the concentration of 8-OH-dG and the level of DNA double-strand breaks (g-H2A.X foci). The results showed that the extent of the both types of DNA injury in cells exposed to 0.5 mM RVT was decreased compared with that of the control group, and this effect was evident in young and in latepassage cells. Reduced concentration of 8-OH-dG is probably associated with the activation of DNA glycosylase I (hOgg1), a major enzyme involved in repair of this kind of DNA lesion [50], whose action efficiency (likely due to up-regulated mRNA level) in cells treated with 0.5 mM was increased. These results are in keeping with earlier studies on a wide variety of cells in which strong attenuation of oxidative DNA damage by RVT was observed [51–53].

Conclusions Our findings suggest that RVT used at a low concentration of 0.5 mM, despite the stimulation of ROS release, may globally be considered as an antioxidative agent, since the temporary induction of ROS may be the way by which the stilbene mobilizes cellular antioxidative and DNA repair mechanisms. It is very likely that that such a sequence of events elicited by 0.5 mM RVT underlies the improved proliferative capacity and delayed onset of replicative senescence in the primary cultures of omentumderived HPMCs.

References [1] Rodier, F.; Campisi, J. Four faces of cellular senescence. J. Cell Biol. 192:547–556; 2011. [2] von Zglinicki, T.; Saretzki, G.; Ladhoff, J.; d’Adda di Fagagna, F.; Jackson, S. P. Human cell senescence as a DNA damage response. Mech. Ageing Dev. 126:111–117; 2005. [3] Nakamura, A. J.; Chiang, Y. J.; Hathcock, K. S.; Horikawa, I.; Sedelnikova, O. A.; Hodes, R. J.; Bonner, W. M. Both telomeric and non-telomeric DNA damage are determinants of mammalian cellular senescence. Epigenetics Chromatin 1:6; 2008. [4] Campisi, J.; d’Adda di Fagagna, F. Cellular senescence: when bad things happen to good cells. Nat. Rev. Mol. Cell Biol. 8:729–740; 2007. [5] Lu, T.; Finkel, T. Free radicals and senescence. Exp. Cell Res. 314:1918–1922; 2008. [6] Passos, J. F.; Saretzki, G.; Ahmed, S.; Nelson, G.; Richter, T.; Peters, H.; Wappler, I.; Birket, M. J.; Harold, G.; Schaeuble, K.; Birch-Machin, M. A.; Kirkwood, T. B.; von Zglinicki, T. Mitochondrial dysfunction accounts for the stochastic heterogeneity in telomere-dependent senescence. PLoS Biol. 5:e110; 2007. [7] Passos, J. F.; von Zglinicki, T.; Saretzki, G. Mitochondrial dysfunction and cell senescence: cause or consequence? Rejuvenation Res 9:64–68; 2006. [8] Smoliga, J. M.; Baur, J. A.; Hausenblas, H. A. Resveratrol and health—a comprehensive review of human clinical trials. Mol. Nutr. Food Res. 55:1129–1141; 2011. [9] Howitz, K. T.; Bitterman, K. J.; Cohen, H. Y.; Lamming, D. W.; Lavu, S.; Wood, J. G.; Zipkin, R. E.; Chung, P.; Kisielewski, A.; Zhang, L. L.; Scherer, B.; Sinclair, D. A. Small molecule activators of sirtuins extend Saccharomyces cerevisiae lifespan. Nature 425:191–196; 2003. [10] Wood, J. G.; Rogina, B.; Lavu, S.; Howitz, K.; Helfand, S. L.; Tatar, M.; Sinclair, D. Sirtuin activators mimic caloric restriction and delay ageing in metazoans. Nature 430:686–689; 2004. [11] Zarse, K.; Schmeisser, S.; Birringer, M.; Falk, E.; Schmoll, D.; Ristow, M. Differential effects of resveratrol and SRT1720 on lifespan of adult Caenorhabditis elegans. Horm. Metab Res. 42:837–839; 2010. [12] Marques, F. Z.; Markus, M. A.; Morris, B. J. Resveratrol: cellular actions of a potent natural chemical that confers a diversity of health benefits. Int. J. Biochem. Cell Biol. 41:2125–2128; 2009. [13] Dai, Z.; Li, Y.; Quarles, L. D.; Song, T.; Pan, W.; Zhou, H.; Xiao, Z. Resveratrol enhances proliferation and osteoblastic differentiation in human mesenchymal stem cells via ER-dependent ERK1/2 activation. Phytomedicine 14:806–814; 2007. [14] Xia, L.; Wang, X. X.; Hu, X. S.; Guo, X. G.; Shang, Y. P.; Chen, H. J.; Zeng, C. L.; Zhang, F. R.; Chen, J. Z. Resveratrol reduces endothelial progenitor cells senescence through augmentation of telomerase activity by Akt-dependent mechanisms. Br. J. Pharmacol. 155:387–394; 2008. [15] Holian, O.; Walter, R. J. Resveratrol inhibits the proliferation of normal human keratinocytes in vitro. J. Cell Biochem. Suppl. 36:55–62; 2001. [16] Giovannelli, L.; Pitozzi, V.; Jacomelli, M.; Mulinacci, N.; Laurenzana, A.; Dolara, P.; Mocali, A. Protective effects of resveratrol against senescenceassociated changes in cultured human fibroblasts. J. Gerontol. A Biol. Sci. Med. Sci 66:9–18; 2011. [17] Schilder, Y. D.; Heiss, E. H.; Schachner, D.; Ziegler, J.; Reznicek, G.; Sorescu, D.; Dirsch, V. M. NADPH oxidases 1 and 4 mediate cellular senescence induced by resveratrol in human endothelial cells. Free Radic. Biol. Med. 46:1598–1606; 2009. [18] Leonard, S. S.; Xia, C.; Jiang, B. H.; Stinefelt, B.; Klandorf, H.; Harris, G. K.; Shi, X. Resveratrol scavenges reactive oxygen species and effects radical-induced cellular responses. Biochem. Biophys. Res. Commun. 309:1017–1026; 2003. [19] Brito, P. M.; Mariano, A.; Almeida, L. M.; Dinis, T. C. Resveratrol affords protection against peroxynitrite-mediated endothelial cell death: a role for intracellular glutathione. Chem. Biol. Interact. 164:157–166; 2006. [20] Spanier, G.; Xu, H.; Xia, N.; Tobias, S.; Deng, S.; Wojnowski, L.; Forstermann, U.; Li, H. Resveratrol reduces endothelial oxidative stress by modulating the gene expression of superoxide dismutase 1 (SOD1), glutathione peroxidase 1 (GPx1) and NADPH oxidase subunit (Nox4). J. Physiol Pharmacol. 60(4): 111–116; 2009.

J. Miku!a-Pietrasik et al. / Free Radical Biology and Medicine 52 (2012) 2234–2245

[21] Santandreu, F. M.; Valle, A.; Oliver, J.; Roca, P. Resveratrol potentiates the cytotoxic oxidative stress induced by chemotherapy in human colon cancer cells. Cell Physiol. Biochem. 28:219–228; 2011. [22] Low, I. C.; Chen, Z. X.; Pervaiz, S. Bcl-2 modulates resveratrol-induced ROS production by regulating mitochondrial respiration in tumor cells. Antioxid. Redox. Signal. 13:807–819; 2010. [23] Ksiazek, K.; Piwocka, K.; Brzezinska, A.; Sikora, E.; Zabel, M.; Breborowicz, A.; Jorres, A.; Witowski, J. Early loss of proliferative potential of human peritoneal mesothelial cells in culture: the role of p16INK4a-mediated premature senescence. J Appl. Physiol. 100:988–995; 2006. [24] Ksiazek, K.; Passos, J. F.; Olijslagers, S.; Saretzki, G.; Martin-Ruiz, C.; von Zglinicki, T. Premature senescence of mesothelial cells is associated with non-telomeric DNA damage. Biochem. Biophys. Res. Commun. 362:707–711; 2007. [25] Ksiazek, K.; Mikula-Pietrasik, J.; Jorres, A.; Witowski, J. Oxidative stressmediated early senescence contributes to the short replicative life span of human peritoneal mesothelial cells. Free Radic. Biol. Med 45:460–467; 2008. [26] Murias, M.; Miksits, M.; Aust, S.; Spatzenegger, M.; Thalhammer, T.; Szekeres, T.; Jaeger, W. Metabolism of resveratrol in breast cancer cell lines: impact of sulfotransferase 1A1 expression on cell growth inhibition. Cancer Lett. 261:172–182; 2008. [27] Yung, S.; Li, F. K.; Chan, T. M. Peritoneal mesothelial cell culture and biology. Perit. Dial. Int. 26:162–173; 2006. [28] Dimri, G. P.; Lee, X.; Basile, G.; Acosta, M.; Scott, G.; Roskelley, C.; Medrano, E. E.; Linskens, M.; Rubelj, I.; Pereira-Smith, O.; Campisi, J. A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc. Natl. Acad. Sci. USA 92:9363–9367; 1995. [29] Gary, R. K.; Kindell, S. M. Quantitative assay of senescence-associated betagalactosidase activity in mammalian cell extracts. Anal. Biochem. 343:329–334; 2005. [30] Cawthon, R. M. Telomere length measurement by a novel monochrome multiplex quantitative PCR method. Nucleic Acids Res 37:e21; 2009. [31] Halliwell, B.; Whiteman, M. Measuring reactive species and oxidative damage in vivo and in cell culture: how should you do it and what do the results mean? Br J. Pharmacol 142:231–255; 2004. [32] Widlansky, M. E.; Wang, J.; Shenouda, S. M.; Hagen, T. M.; Smith, A. R.; Kizhakekuttu, T. J.; Kluge, M. A.; Weihrauch, D.; Gutterman, D. D.; Vita, J. A. Altered mitochondrial membrane potential, mass, and morphology in the mononuclear cells of humans with type 2 diabetes. Transl. Res. 156:15–25; 2010. [33] Smiley, S. T.; Reers, M.; Mottola-Hartshorn, C.; Lin, M.; Chen, A.; Smith, T. W.; Steele Jr G. D.; Chen, L. B. Intracellular heterogeneity in mitochondrial membrane potentials revealed by a J-aggregate-forming lipophilic cation JC-1. Proc. Natl. Acad. Sci. USA 88:3671–3675; 1991. [34] Walle, T.; Hsieh, F.; DeLegge, M. H.; Oatis Jr J. E.; Walle, U. K. High absorption but very low bioavailability of oral resveratrol in humans. Drug Metab. Dispos. 32:1377–1382; 2004. [35] Baur, J. A.; Sinclair, D. A. Therapeutic potential of resveratrol: the in vivo evidence. Nat. Rev. Drug Discov. 5:493–506; 2006. [36] Ksiazek, K.; Korybalska, K.; Jorres, A.; Witowski, J. Accelerated senescence of human peritoneal mesothelial cells exposed to high glucose: the role of TGFbeta1. Lab. Invest. 87:345–356; 2007. [37] Faragher, R. G.; Burton, D. G.; Majecha, P.; Fong, N. S.; Davis, T.; Sheerin, A.; Ostler, E. L. Resveratrol, but not dihydroresveratrol, induces premature senescence in primary human fibroblasts. Age (Dordr. ) ; 2011.

2245

[38] Ramirez, R. D.; Morales, C. P.; Herbert, B. S.; Rohde, J. M.; Passons, C.; Shay, J. W.; Wright, W. E. Putative telomere-independent mechanisms of replicative aging reflect inadequate growth conditions. Genes Dev. 15:398–403; 2001. [39] Kao, C. L.; Chen, L. K.; Chang, Y. L.; Yung, M. C.; Hsu, C. C.; Chen, Y. C.; Lo, W. L.; Chen, S. J.; Ku, H. H.; Hwang, S. J. Resveratrol protects human endothelium from H(2)O(2)-induced oxidative stress and senescence via SirT1 activation. J. Atheroscler. Thromb. 17:970–979; 2010. [40] Demidenko, Z. N.; Blagosklonny, M. V. At concentrations that inhibit mTOR, resveratrol suppresses cellular senescence. Cell Cycle 8:1901–1904; 2009. [41] Arroyo, M. P.; Downey, K. M.; So, A. G.; Wang, T. S. Schizosaccharomyces pombe proliferating cell nuclear antigen mutations affect DNA polymerase delta processivity. J. Biol. Chem. 271:15971–15980; 1996. [42] Tang, Y.; Xu, J.; Qu, W.; Peng, X.; Xin, P.; Yang, X.; Ying, C.; Sun, X.; Hao, L. Resveratrol reduces vascular cell senescence through attenuation of oxidative stress by SIRT1/NADPH oxidase-dependent mechanisms. J. Nutr. Biochem.; 2012. [Epub ahead of print]. [43] Csiszar, A.; Labinskyy, N.; Pinto, J. T.; Ballabh, P.; Zhang, H.; Losonczy, G.; Pearson, K.; de, C. R.; Pacher, P.; Zhang, C.; Ungvari, Z. Resveratrol induces mitochondrial biogenesis in endothelial cells. Am. J. Physiol. Heart Circ. Physiol 297:H13–H20; 2009. [44] Ksiazek, K.; Passos, J. F.; Olijslagers, S.; von, Z. T. Mitochondrial dysfunction is a possible cause of accelerated senescence of mesothelial cells exposed to high glucose. Biochem. Biophys. Res. Commun. 366:793–799; 2008. [45] Robb, E. L.; Page, M. M.; Wiens, B. E.; Stuart, J. A. Molecular mechanisms of oxidative stress resistance induced by resveratrol: specific and progressive induction of MnSOD. Biochem. Biophys. Res. Commun. 367:406–412; 2008. [46] Liu, R.; Buettner, G. R.; Oberley, L. W. Oxygen free radicals mediate the induction of manganese superoxide dismutase gene expression by TNFalpha. Free Radic. Biol. Med. 28:1197–1205; 2000. [47] Calabrese, E. J.; Mattson, M. P.; Calabrese, V. Resveratrol commonly displays hormesis: occurrence and biomedical significance. Hum. Exp. Toxicol. 29:980–1015; 2010. [48] Park, J. B. Inhibition of glucose and dehydroascorbic acid uptakes by resveratrol in human transformed myelocytic cells. J. Nat. Prod 64:381–384; 2001. [49] Lee, Y. C.; Huang, H. Y.; Chang, C. J.; Cheng, C. H.; Chen, Y. T. Mitochondrial GLUT10 facilitates dehydroascorbic acid import and protects cells against oxidative stress: mechanistic insight into arterial tortuosity syndrome. Hum. Mol. Genet. 19:3721–3733; 2010. [50] Boiteux, S.; Radicella, J. P. The human OGG1 gene: structure, functions, and its implication in the process of carcinogenesis. Arch. Biochem. Biophys. 377:1–8; 2000. [51] Guo, L.; Wang, L. H.; Sun, B.; Yang, J. Y.; Zhao, Y. Q.; Dong, Y. X.; Spranger, M. I.; Wu, C. F. Direct in vivo evidence of protective effects of grape seed procyanidin fractions and other antioxidants against ethanol-induced oxidative DNA damage in mouse brain cells. J. Agric. Food Chem. 55:5881–5891; 2007. [52] Sgambato, A.; Ardito, R.; Faraglia, B.; Boninsegna, A.; Wolf, F. I.; Cittadini, A. Resveratrol, a natural phenolic compound, inhibits cell proliferation and prevents oxidative DNA damage. Mutat. Res. 496:171–180; 2001. [53] Yen, G. C.; Duh, P. D.; Lin, C. W. Effects of resveratrol and 4-hexylresorcinol on hydrogen peroxide-induced oxidative DNA damage in human lymphocytes. Free Radic. Res. 37:509–514; 2003.