Resveratrol induces depletion of TRAF6 and suppresses prostate cancer cell proliferation and migration

Journal Pre-proof Resveratrol induces depletion of TRAF6 and suppresses prostate cancer cell proliferation and migration Farjana Yeasmin Khusbu, Xi Zhou, Mridul Roy, Fang-Zhi Chen, Qian Cao, Han-Chun Chen

PII:

S1357-2725(19)30221-3

DOI:

https://doi.org/10.1016/j.biocel.2019.105644

Reference:

BC 105644

To appear in:

International Journal of Biochemistry and Cell Biology

Received Date:

14 June 2019

Revised Date:

8 October 2019

Accepted Date:

6 November 2019

Please cite this article as: Khusbu FY, Zhou X, Roy M, Chen F-Zhi, Cao Q, Chen H-Chun, Resveratrol induces depletion of TRAF6 and suppresses prostate cancer cell proliferation and migration, International Journal of Biochemistry and Cell Biology (2019), doi: https://doi.org/10.1016/j.biocel.2019.105644

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier.

Resveratrol induces depletion of TRAF6 and suppresses prostate cancer cell proliferation and migration Farjana Yeasmin Khusbu1, Xi Zhou1, Mridul Roy1,2, Fang-Zhi Chen3, Qian Cao1, Han-Chun Chen1* 1

Department of Biochemistry and Molecular Biology, School of Life Sciences, Central South University, Changsha, Hunan 410013, China.

2

Molecular Science and Biomedicine Laboratory, State Key Laboratory for Chemo/Biosensing and Chemometrics, College of Biology, College of Chemistry and Chemical Engineering, Hunan University, Changsha 410082, China.

3

Department of Urology, The Second Xiangya Hospital of Central South University, Changsha,

ro of

Hunan 410011, China.

* Correspondence: Principle corresponding author (post-publication): Han-Chun Chen, Department of Biochemistry and Molecular Biology, School of Life Sciences, Central South University, Changsha, Hunan 410013, China. (*E-mail: [email protected])

-p

All the editorial correspondence before publication is requested with Farjana Yeasmin Khusbu

re

(E-mail: [email protected])

Jo

ur

na

lP

Graphical Abstract

Abstract: Although the early diagnosis of prostate cancer (PCa) enhances life expectancy with a 5-year survival rate of 100%, metastasized-PCa is the fundamental reason for death by PCa, hence requires an advanced and target-directed treatment strategy. Metastasis is considered to be initiated with the epithelial-mesenchymal transition (EMT) event in which tumor cells change their epithelial characteristics into mesenchymal form and exacerbates the cancer progression. Herein, we investigated the effect and mechanism of resveratrol function in PCa cell proliferation and migration and reported that TNF-receptor associated factor 6 (TRAF6), an unconventional E3 ligase, is a key mediator of resveratrol function to inhibit PCa cell growth and proliferation and targeted for lysosomal degradation by resveratrol. MTT and cell counting demonstrated that resveratrol inhibited the viability and

ro of

proliferation in DU145 and PC3 cells. Resveratrol (50 μM) mediated the degradation of TRAF6 which in turn facilitated repression of the NF-κB pathway. Also, wound healing and transwell migration assays and level of EMT-related proteins showed that resveratrol used TRAF6, at least in part to inhibit cell migration. Overexpression of TRAF6 augmented EMT

-p

in PCa by upregulating the expression of transcription factor SLUG. Moreover, TRAF6 overexpression was closely associated with EMT process through the NF-κB pathway. Our

re

exploration exhibited that resveratrol may inhibit EMT through the TRAF6/NF-κB/SLUG axis. Altogether, this study represents that TRAF6 acts as an intermediary of resveratrol

lP

action to suppress PCa cell proliferation and migration, and concerns future attention to obtain as a therapeutic target for the treatment of PCa.

1. Introduction

na

Keywords: Prostate cancer; Epithelial-mesenchymal transition; Resveratrol; TRAF6.

Prostate cancer (PCa) is the fifth principal reason for cancerous death in men with

ur

1,276,106 new cases diagnosed in 2018 (Bray et al., 2018). The high incidence of PCa urges new and highly potent treatment approaches to be implemented. The conventional curative

Jo

management of PCa includes radical prostatectomy (RP) and radiation therapy (RT) (Bill-Axelson et al., 2014; Dal Pra and Souhami, 2016). Although a preliminary diagnosis of a localized tumor is lucrative with a 5-year survival rate of 100%, the metastasized state is fatal and the fundamental cause of PCa death. Epithelial-mesenchymal transition (EMT) is a crucial event in cancer metastasis which energizes static tumor cells to acquire mesenchymal characteristics with high mobility and migratory potentials (Chen et al., 2017b). Until now, there is no successful treatment therapy available for metastatic PCa, which exhorts quick intervention and development of effective drugs.

E3 ubiquitin ligase is one of the crucial components of the ubiquitin-proteasome system (UPS) that acts as the major determinant of protein fate in normal and pathological states (Bedford et al., 2011). Studies support that aberrant expression and function of E3 ligases are closely connected to cancer initiation, progression, and migration (Wang et al., 2017). There are over 600 E3 ligases that confer substrate specificity, and among them, ~80 enzymes have been characterized. By introducing polyubiquitin chains with conjugation to either the 48 lysine (K48) or 63 lysine (K63) site on ubiquitin, E3 ligase governs the proteasome-mediated degradation or the activation of the bound substrates, respectively. The K63-linked polyubiquitination bears essential regulatory characteristics as several downstream

ro of

biological pathways are dependent on the activation of critical initiators. TNF-receptor associated factor 6 (TRAF6), a non-conventional E3 ligase is required for the activation of interleukin 1 receptor (IL-1R) downstream signaling and acts as a bridge in the NF-κB pathway (Cao et al., 1996; Wang et al., 2001; Ye et al., 2002). As a signal transducer, TRAF6 conjugates to TAK1 kinase in a complex containing E2 Ubc13 and Uev1A and initiates K63

-p

polyubiquitination that activates TAK1 which in turn phosphorylates and activates IκB kinase (IKK). Activation of IKK leads to phosphorylation and degradation of IκBα, relieving

re

NF-κB from the inactive state (Lamothe et al., 2007). Accumulating evidence indicates TRAF6 as an oncogene; and divergent in TRAF6 expression has been documented in several

lP

cancers including prostate, colon, lung and gastric cancer, acute myeloid leukemia, squamous cell carcinoma, melanoma and osteosarcoma (Beroukhim et al., 2010; Fang et al., 2012; Gudey et al., 2014; Han et al., 2016; Luo et al., 2016; Meng et al., 2012; Singh et al.,

na

2012; Starczynowski et al., 2011; Yao et al., 2013). Several studies have linked TRAF6 to EMT and the development of metastatic cancers (Chen et al., 2018; Han et al., 2016; Han et al., 2014; Lin et al., 2014; Luo et al., 2016; Rezaeian et al., 2017). The association of TRAF6

ur

with cancer initiation, progression, and metastasis thus demands to develop a therapy

Jo

targeting this protein for cancer treatment. Resveratrol (trans-3,4´,5-trihydroxystilbene), a natural phytoalexin found mainly in

plant species (grape skin, red wine, berries, peanuts) has been documented to possess antioxidant, anti-inflammatory, neuroprotective and immunomodulatory properties (de Sa Coutinho et al., 2018; Naia et al., 2017; Zhang et al., 2018). In the past few years, studies showed that resveratrol has the potential to reduce cancer cell growth and viability, and induce cell cycle arrest and apoptosis, and hence characterized as an anti-cancer and a chemo-preventive agent (Pavan et al., 2016). Although the anti-tumor activity of resveratrol is mostly dependent on its effect on anti-apoptotic and cell cycle proteins, and signaling

pathways, the principal targets and the mechanisms are still ill-defined. Also, the effects of this natural polyphenol on E3 ligases, especially in prostate cancer, are not fully explored. In the present study, we aimed to investigate the underlying mechanism of the effect of resveratrol on androgen-insensitive PCa cell growth and proliferation. Besides, we examined the role of TRAF6 as a possible mediator of resveratrol function in repressing the NF-κB pathway and PCa migration. Here, we showed that TRAF6 is a key mediator of resveratrol function to inhibit PCa cell growth and proliferation and targeted for lysosomal degradation. Also, resveratrol facilitated repression of the NF-κB pathway and used TRAF6, at least in part, to inhibit cell migration. Moreover, TRAF6 overexpression was closely associated with

ro of

EMT process through the NF-κB pathway. Our exploration exhibited that resveratrol may inhibit EMT through the TRAF6/NF-κB/SLUG axis. 2. Materials and Methods

-p

2.1. Cell culture, treatment, and chemicals

The human prostate cancer cell lines DU145 and PC3 were obtained from the American Type Culture Collection (ATCC, USA) and cultured in RPMI 1640 medium (Gibco, MA,

re

USA) supplemented with 10% fetal bovine serum (Gibco) and 1% penicillin/streptomycin (Thermo Fisher Scientific, MA, USA) at 37 °C and 5% CO2. Resveratrol was dissolved in

lP

dimethylsulfoxide (DMSO) (Sigma-Aldrich,

MO, USA)

3-(4,5-Dimethylthiazol-2-Yl)-2,5-Diphenyltetrazolium

and stored at

Bromide

(MTT),

-20°C. MG132,

Bafilomycin A1 and EVP4593 were derived from Sigma, MedChemExpress (MCE, NJ,

na

USA), Thermo Fisher Scientific, and Selleckchem (TX, USA), respectively. 2.2. Cell viability and cell proliferation assay

ur

Cell viability was carried out using an MTT assay with 10 μL of MTT reagent was added to each well of a 96-well plate (1 × 104 cell/well). The absorbance was measured at 490 nm

Jo

with a spectrophotometer. For MTT assay PCa cell DU145 and PC3 were treated with different concentrations of resveratrol (0, 10, 25, 50, and 75 μM) for 48 hours. For MTT assay transfected cells (mock/scramble and ovTRAF6/SiTRAF6) were treated with 50 μM of resveratrol for 48 hours. Trypan blue exclusion assay was used to assess cell proliferation, and cells were counted manually in a hemocytometer. 2.3. Plasmid, SiRNA, and transient transfection pCMV3-TRAF6-Myc and pCMV3-C-Myc-NCV vectors were purchased from Sino Biological

Inc

(Beijing,

China).

TRAF6-SiRNA

(Sense:

5´GCAAAUGUCAUCUGUGAAUTT3´,

Antisense:

5´AUUCACAGAUGACAUUUGCTT3´) was purchased from GenePharma (Shanghai, China). TRAF6-pCMV3, control pCMV3, SiTRAF6, and scramble SiRNA were transfected using Lipofectamine 2000 reagent (Invitrogen, MA, USA) according to the manufacturer’s instructions. To achieve desired overexpression and knockdown, cells were incubated for 48 hours. 2.4. Immunofluorescence assay Immunofluorescence staining was performed using microscopic slides. Cells were treated with 50 μM of resveratrol for 48 hours and permeabilized with 0.1% Triton X-100

ro of

and blocked with 5% BSA. Anti-mouse-fluorescein isothiocyanate and anti-rabbit-Cy3 secondary antibodies (Jackson ImmunoResearch Inc. PA, USA) were incubated for 1 hour at room temperature and mounted using glycerol. Images were captured using a fluorescence microscope (Olympus Corporation, Shinjuku, Japan).

-p

2.5. Quantitative RT-PCR

For measuring mRNA expression, DU145 cells were treated with resveratrol for 48

re

hours. Total RNA was extracted using RNA Isolator (Vazyme Biotech Co., Nanjing, China) and quantified. mRNA expression was measured using cDNA synthesized from RNA and

lP

reverse transcription kit (Vazyme). The RT-PCR reactions were performed using HiScript II Q RT Supermix (Vazyme) and SYBR qPCR Master Mix (Vazyme) with specific primers

na

(Table 1) (Sangon Biotech, Shanghai, China).

Table 1. Primer pairs for E3 Ligases used in Quantitative RT-PCR. E3 Ligases

Forward (5´ to 3´)

Reverse (5´ to 3´)

TGCTGCTGAACTTGTGTGC

TACTGTCCCCATCCTCTTCG

Cbl (Cas-Br-M (murine) ecotropic retroviral transforming sequence)

CCCGAGGAGTCAGAAAATGA

GAGACAACCAGCCAAAGGAG

CHIP (Carboxy terminus of Hsp70-interacting protein)

TCAGGTGGATGAGAAGAGGAA

CTTGCGGTCGTAGGTGATG

FBXW7 (F-box and WD repeat domain containing 7)

AAGGTCCCAACAAGCATCAG

CCCGTTTTCAAGTCCCATAG

MDM2 (Murine and double minute 2)

GCCATTGAACCTTGTGTGATT

GGCAGGGCTTATTCCTTTTC

MEKK1 (Mitogen-activated protein kinase kinase kinase 1)

TCCAGTTCCACTCACTTCACC

TGTCCTGTTGACCATCCAAA

NEDD4 (Neural precursor cell expressed, developmentally down-regulated 4)

ACCGAATCCAGAAGCAAATG

TCAACATCTCCCAGTCCACA

Jo

ur

-TrCP (Beta-transducin repeat containing protein)

CAGGCACATCAGCGAAGAC

CAGAGCCAGACCGAGAGAGT

CTGCCACACACAGAAAAAGC

CCAGAGAGCCTTGCCATTTA

SIAH2 (Seven-in-absentia homologue 2)

GAACCTGGCTATGGAGAAGG

GGAGTAGGGACGGTATTCACA

SKP2 (S-phase kinase-associated protein 2)

GCTGAAGAGCAAAGGGAGTG

GGAGGCACAGACAGGAAAAG

SMURF1 (SMAD specific E3 ubiquitin protein ligase 1)

CCAGGGAGTGGCTTTACTTG

GTCGGGGTTGATTGAAGAAT

SMURF2 (SMAD specific E3 ubiquitin protein ligase 2)

GCTGGATTTCTCGGTTGTGT

GTGCCTATTCGGTCTCTGGA

TRAF6 (TNF receptor associated factor 6)

CCTGGATTCTACACTGGCAAA

CAAGGGAGGTGGCTGTCATA

TRAF7 (TNF receptor-associated factor 7)

TGTGTGGTGTCTCTGCGTCT

GCCCTCCAGTGTCTTCTGAC

WWP1 (WW domain containing E3 ubiquitin protein ligase 1)

TGAACAGTGGCAATCTCAGC

XIAP (X-Linked Inhibitor of Apoptosis)

TGCTCACCTAACCCCAAGAG

ro of

NEDD4L (Neural precursor cell expressed, developmentally down-regulated 4-like) SIAH1 (Seven-in-absentia homologue 1)

TGGTGGCAAAGGTCCATAAG

-p

AGGAAAGTGTCGCCTGTGTT

2.6. Western blotting and antibodies

re

Protein was extracted using RIPA lysis buffer (Thermo Fisher Scientific) containing phenylmethylsulfonylfluoride (PMSF) (Solarbio, Beijing, China) and protease inhibitor

lP

cocktail (Roche, Basel, Switzerland). Cytoplasmic and nuclear extracts were prepared using a Cytoplasmic and Nuclear Protein Extraction Kit (Thermo Fisher Scientific). The protein concentration was measured using the BCA Protein Quantification Kit (Vazyme). Equal

na

amounts of protein were blotted by 10-12% SDS-PAGE and transferred onto PVDF membrane. The blots were incubated overnight with primary antibodies and 2 hours with a secondary antibody in the following day. The blot images were developed using a

ur

chemiluminescence kit. The antibodies were used as follows: TRAF6, LC3B (Cell Signaling Technology, MA, USA), GAPDH, LAMP2, IκBα, E-cadherin (Proteintech, IL, USA),

Jo

LaminB, p65, P-p65, p50, P-IκBα, SLUG, and Vimentin (Wanleibio, Beijing, China). 2.7. Wound healing and transwell migration assay To perform wound healing assay, cells were seeded in 6-well plates, and a wound line

was produced between the cells. After 24 hours, the cells were transfected with SiRNA or expression vector. Transfected cells were treated with resveratrol for 24 hours and imaged using a microscope. For transwell migration assay, cells were seeded in the transwell upper chamber (filter) without serum and RPMI 1640 supplemented with 10% FBS was placed in

the lower chamber. The cells were allowed to migrate for 24 hours, followed by fixation and staining with 0.1% crystal violet. Images were captured using a microscope. 2.8. Statistical analysis Data are expressed as the mean±SD obtained from three independent experiments. Statistical significance of two group data was determined using the t-test and were considered statistically significant at p<0.05. One Way Analysis of Variance (ANOVA) and Fisher’s least significant difference test were applied to compare between different groups by SPSS 17.0 with an interpretation as *p<0.05 and **p<0.01.

ro of

3. Results 3.1. Inhibition of TRAF6 by resveratrol reduces prostate cancer cell proliferation

Several E3 ligases have been documented to be aberrantly expressed in prostate cancer. To examine the expression of E3 ligases in the presence of resveratrol, we treated p53

-p

mutant, moderate tumorigenic prostate cancer cell DU145 with different concentrations of resveratrol for 48 hours. We analyzed the changes in mRNA expression of 17 E3 ligases, which has been documented to be associated with PCa (Abreu-Martin et al., 1999; Cheng et

re

al., 2018a; Knauer et al., 2015; Knight et al., 2008; Lau et al., 2012; Liu et al., 2013; Sun, 2006; Wang et al., 2017; Wang et al., 2014). All ligases showed a high expression pattern

lP

except TRAF6 (p<0.05) in response to resveratrol (Figure 1A, and 1B). Five ligases were upregulated by more than 4-fold upon resveratrol treatment, SKP2 being the most increased ligase. To verify the effect of resveratrol on the expression of TRAF6, we assessed the

(Figure 1C).

na

protein level. Interestingly, resveratrol decreased TRAF6 protein in both DU145 and PC3

ur

We next analyzed any relation between the depletion of TRAF6 protein by resveratrol with PCa tumorigenesis. As resveratrol possesses anti-proliferative characteristics (Pavan et

Jo

al., 2016), we treated DU145 and PC3 cells with different concentrations of resveratrol (0, 10, 25, 50 μM) and inspected cell growth and proliferation via MTT assay and manual cell counting using trypan blue exclusion assay. Resveratrol significantly inhibited PCa cell viability and proliferation in a dose-dependent manner (p<0.05) (Figure 2A). Then, to characterize the biological effect on TRAF6 on PCa cell growth and proliferation, we employed loss-of- and gain-of-gene function by using TRAF6 specific SiRNA and pCMV3-TRAF6 overexpression plasmid, respectively in DU145 and PC3 cells. Transient transfection of SiTRAF6 or ovTRAF6 resulted in significant knockdown or overexpression of TRAF6 protein both in the presence or absence of resveratrol in the cell line tested (Figure

2B). Besides, the silencing of TRAF6 significantly inhibited PCa cell growth and proliferation (Figure 2C and 2D), whereas overexpression of TRAF6 intensified the growth in a time-dependent fashion (Figure 2E and 2F). Moreover, in the presence of resveratrol, while SiTRAF6 enhanced the effect of resveratrol on cell growth by reducing cell survival (Figure 2G), the overexpressed TRAF6 abolished the effect of resveratrol in comparison to the control group (Figure 2H). These results imply that TRAF6 has a stimulating effect on PCa cell growth and proliferation, and it might be a mediator of resveratrol action in lessening cancer cell proliferation. 3.2. Resveratrol mediates lysosomal degradation of TRAF6

ro of

Recently, a study denoted that resveratrol inhibits LPS-induced TRAF6 expression in RAW 264.7 macrophages (Jakus et al., 2013). In the present study, to evaluate the underlying mechanism of TRAF6 depletion by resveratrol, we treated the DU145 cells with different concentrations of resveratrol for 48 hours and examined the nuclear and cytoplasmic level of

-p

TRAF6 protein. Resveratrol caused a remarkable decrease of TRAF6 both in the cytoplasm and nucleus (Figure 3A). Considering the notion that resveratrol affects the protein but not

re

the mRNA level of TRAF6, we hypothesized that resveratrol causes proteasomal degradation of TRAF6. To this end, we treated the cells with proteasome inhibitor MG132 to prevent protein degradation. In the presence of 20 μM of MG132, there was no change in the TRAF6

lP

level, whereas the level was not restored with the simultaneous treatment of MG132 and resveratrol (Figure 3B). This result indicated that the proteasome pathway was not

na

responsible for TRAF6 reduction. To explore whether the lysosomal pathway was accountable, we treated the cells with NH4Cl for 24 hours, which inhibits the endosome-lysosome system acidification and lysosomal proteases (Ling et al., 1998). In the

ur

presence of 10 μM of NH4Cl, which caused substantial inhibition of lysosome as indicated by the expression of microtubule-associated proteins light chain 3B (LC3B), the TRAF6 protein

Jo

level was restored (Figure 3C). This observation suggested that resveratrol mediates TRAF6 degradation via lysosome. To further validate this outcome, we examined the protein level in the presence of lysosome-autophagosome fusion inhibitor Bafilomycin A1 (BafA1) (Yamamoto et al., 1998). BafA1 showed a similar response (12 hours) by rescuing the TRAF6 protein level in resveratrol-treated cells with no change in control cells. A concurrent reduction of LC3B expression was an indication of the failure of the formation of autolysosomes. (Figure 3D). These results implied that inhibition of lysosome function reverses the repressing effect of resveratrol on TRAF6.

To further establish the involvement of the lysosome, the DU145 cells treated with or without resveratrol were co-immunostained for TRAF6 and lysosomal membrane protein LAMP2. The fluorescence image exhibited that TRAF6 co-localized with LAMP2 in resveratrol-treated cells in the cytoplasm (Figure 3E). Together, the above results confirmed that resveratrol degrades TRAF6 in the lysosomal pathway in the cytosol. 3.3. Resveratrol-mediated degradation of TRAF6 inhibits NF-κB pathway Recent studies substantiated that the NF-κB pathway is constitutively active in PCa cell lines (Gasparian et al., 2002). NF-κB subunits p65 and p50 resides in the cytoplasm in an inactive state governed by inhibitory subunit IκBα. Upon stimuli, the IκB kinase, IKK

ro of

activates and dissociates IκBα from the subunits, leading p65 free to translocate to the nucleus to exert its regulatory effect on gene expression. TRAF6 is considered to be an upstream mediator of NF-κB activation by triggering the ubiquitination of TAK1 and IKK (Lamothe et al., 2007). Resveratrol has been demonstrated to inhibit this pathway in PC3

-p

cells but not in hormone-sensitive LNCaP cells (Benitez et al., 2009). In the present work, we first aimed to evaluate the modulatory effect of resveratrol on this pathway in DU145 cells.

re

In line with the previous studies, we also found that treatment with resveratrol lessened the phosphorylation of p65 and managed a static level of total p65. Besides, the p50 level was

lP

also exhibited to be static, along with a lower level of phosphorylated IκBα (Figure 4A). To examine whether TRAF6 could be a possible mediator of the resveratrol effect on the NF-κB pathway, we utilized silencing and overexpression of TRAF6. The knockdown of

na

TRAF6 triggered decreased phosphorylation of IκBα and p65 (Figure 4B) and obstructed the nuclear translocation of p65, which is accompanied by stagnant p50 level and elevated cytoplasmic p65 level when compared to scrambled SiRNA-transfected cells (Figure 4C).

ur

Furthermore, the effect of TRAF6 silencing was enhanced remarkably in the presence of resveratrol. On the contrary, overexpression of TRAF6 diminished the restrictive effect of

Jo

resveratrol on the NF-κB pathway displaying a low reduction of p65 in the nucleus (Figure 4D and 4E). Altogether, the derived results allude that TRAF6 performs a key role in resveratrol-mediated suppression of the NF-κB pathway. 3.4. Resveratrol suppresses prostate cancer cell migration by TRAF6 repression The prostate tumor becomes deadly when it acquires mesenchymal characteristics and initiates metastasis. The NF-κB pathway is one of the major inducers of EMT in response to which several transcription factors (TF) are orchestrated and downregulate the epithelial genes (Pires et al., 2017). Mesenchymal genes that are crucial for cell migration are

upregulated as well. Previously, resveratrol has been exhibited to mollify EMT event (Li et al., 2013). In our study, we first performed a wound-healing assay to examine PCa cell motility. In the presence of 50 μM of resveratrol, the cells showed a significant delay in wound closure after 24 hours compared to control in DU145 and PC3 cells (Figure 5A). Subsequently, cell migration was examined by performing a transwell migration assay, and the rate of migration was measured. The results appeared similar to wound-healing assay showing a decreased number of migrated cells in the lower chamber in compliance with resveratrol treatment (Figure 5B). To validate whether TRAF6 triggers EMT, we measured the expression of transcription factor SLUG, and classical EMT-related markers E-cadherin

ro of

and vimentin. SLUG is responsible for the decreased expression of the epithelial E-cadherin gene in the initiation of EMT (Saegusa et al., 2009). Furthermore, this transition raises the expression of vimentin gene, a marker of mesenchymal characteristics (Vuoriluoto et al., 2011). In the present study, in response to resveratrol, E-cadherin was observed to be

-p

heightened with decreased expression of SLUG and vimentin (Figure 5C).

Afterward, we performed gene knockdown and overexpression to assess the possible role of TRAF6 in mediating resveratrol function. The knockdown of TRAF6 reduced the rate

re

of wound closure and migration rate in DU145 cells (Figure 6A and 6B). Treatment of TRAF6-silenced DU145 cells with resveratrol lowered the rate of migration and number of

lP

migrated cells when compared to the untreated cells. The expression of EMT-related proteins was also altered. Downregulation of SLUG enhanced the expression of E-cadherin in response to which a reduction in vimentin was observed. On the other hand, overexpression

na

of TRAF6 neutralized the effect of resveratrol on cell motion indicating a liaison between TRAF6 and resveratrol in alleviating cell migration (Figure 7A and 7B). As expected,

ur

pCMV3-TRAF6 transfected cells showed a higher motility rate in comparison to mock-transfected cells. Besides, increased expression of SLUG was found that could not be restored by resveratrol (Figure 7C). Ultimately, it modified the downstream EMT markers

Jo

resulting in an enhanced level of vimentin. We asked whether altered expression of TRAF6 might have a role in upregulating SLUG

and initiating EMT via the NF-κB pathway and employed an NF-κB pathway inhibitor EVP4593 (Tobe et al., 2003). We treated pCMV3-TRAF6 transfected DU145 cells with or without EVP4593 (10 μM) for 24 hours. EVP4593 remarkably inhibited SLUG and mesenchymal vimentin expression and induced the expression of E-cadherin in control cells (Figure 8A). On the other hand, overexpressed TRAF6 abolished the effect of EVP4593 on EMT when compared to control cells supporting the findings, which were observed with

resveratrol treatment. We interpreted the observations like that in response to resveratrol SLUG is downregulated when the reduced level of TRAF6 interferes with the gene regulation governed by the NF-κB pathway (Figure 8C). A summary scheme with timeline has been presented in Figure 8C. The above results indicate that TRAF6 is a key mediator of PCa cell migration via the NF-κB pathway as well as resveratrol performance and a promising anti-cancer target in EMT event. 4. Discussion In this study, we aimed to examine the possible mechanism of the inhibitory role of resveratrol and revealed a previously unknown effect of this compound on PCa cell growth

ro of

and migration. Our results showed that resveratrol inhibits PCa cell growth and migration through the downregulation of NF-κB signaling cascade and EMT event by mediating the lysosomal degradation of TRAF6. We predict that TRAF6 might be a promising target of resveratrol for the treatment of PCa.

-p

TRAF6 as a mediator of resveratrol function: Resveratrol is demonstrated to show several anticancer effects, including anti-proliferative, anti-inflammatory, apoptosis

re

induction, and suppression of tumorigenic signaling pathways (Pavan et al., 2016). At the same time, several potential molecular targets for this compound has been demonstrated. For

lP

example, the previous study by our group showed that resveratrol regulates antioxidants in cancer cells to accumulate peroxide leading to mitochondrial dysfunction and apoptosis (Khan et al., 2013). It improves mitochondrial function and is identified as a SIRT1 and

Dasgupta

and

na

AMPK activator, which are the key metabolic effectors of resveratrol (Chen et al., 2012; Milbrandt,

2007).

Besides,

resveratrol

inhibits

COX

activities,

phosphodiesterases (PSD), and PI3K, MAPK and mTOR signaling (Cheng et al., 2018b; Liu

ur

and Liu, 2011; Park et al., 2012). In the present work, we sought to find out any effect of resveratrol on ubiquitin ligases. Hence, we selected a series of E3 ligases and found that

Jo

resveratrol decreases the mRNA expression of all the ligases except TRAF6. This drawn our attention further to check the protein level change of TRAF6 after resveratrol treatment. Previously TRAF6 is demonstrated to be degraded via autophagy-mediated lysosomal pathway induced by bortezomib (Fang et al., 2012). Interestingly, we found that resveratrol regulates the post-translational level of TRAF6, which was further confirmed by experimental prove that resveratrol degrades TRAF6 through lysosome. Overexpression of TRAF6 has been documented in several cancers and considered to predict poor prognosis in cancer patients (Han et al., 2016; Liu et al., 2017; Luo et al., 2016;

Wu et al., 2017). It has been demonstrated as an amplified oncogene triggering tumor progression in lung cancer (Starczynowski et al., 2011). In fact, recent studies also indicate that inhibiting TRAF6 either by natural compounds or by genetic ablation represents a promising strategy against cancers (Chen et al., 2017a; Morgan et al., 2019; Qi et al., 2017). Similarly, in our study, we demonstrated a significant role of TRAF6 in prostate cancer cell growth and proliferation. These results shed light on the notion that targeting TRAF6 signaling could be a promising new therapeutic approach to treat PCa. However, utilizing TRAF6 to treat PCa needs further studies regarding the expression of this protein in the clinical setting and different stages associated with cancer progression.

ro of

TRAF6 is a unique member of RING E3 ligase family with the potential of catalyzing Lys-63 linked polyubiquitination. As an unconventional E3 ligase, TRAF6 plays an essential role in several signaling cascades by activating key regulatory proteins through Lys-63 linked polyubiquitination instead of degrading through the proteasome pathway. It activates

-p

TGFβ type I receptor (TβRI), p38 and JNK MAPK pathways, PI3K-AKT signaling, and NF-κB pathway (Hamidi et al., 2017; Sorrentino et al., 2008; Sundar et al., 2015; Yamashita

re

et al., 2008). Active NF-κB pathway is involved in abnormal gene expression, which prompts irregular growth, tumor formation, and ultimately, the development of cancer, including prostate cancer (Hoesel and Schmid, 2013). We demonstrated that resveratrol downregulates

lP

the NF-κB signaling cascade by the suppression of TRAF6.

TRAF6 inhibition by resveratrol reduces cancer cell migration: Besides, activation of the

na

NF-κB pathway leads off bone metastasis (Feng and Guo, 2016). As a consequence, the involvement of this pathway in the initiation and progression of cancers, principally, which are likely to develop metastasis in bone is crucial. Current findings indicate that the

ur

invasiveness of cancer cells is especially triggered through EMT event. TRAF6 has been documented to play a vital role in EMT phenotypes, the migration and invasion ability by the

Jo

activation of HIF1α, Basigin and Ras signaling in several cancers including head and neck cell carcinoma, melanoma, esophageal squamous cell carcinoma and gastric cancer (Chen et al., 2018; Han et al., 2016; Han et al., 2014; Luo et al., 2016; Rezaeian et al., 2017). It has also been found that the ubiquitination of TβRI by TRAF6 leads to TGFβ-induced prostate cell migration and invasion (Sundar et al., 2015). Likewise, we exhibited that TRAF6 plays a pivotal role in initiating PCa cell migration and EMT event. Inhibition of TRAF6 impeded PCa cell motility; moreover, overexpressed TRAF6 enhanced the migration indicating a vital role of TRAF6 in PCa metastasis. Western blotting results supported that TRAF6

overexpression is associated with enhanced expression of EMT-driving transcription factor SLUG and mesenchymal marker vimentin. Suppression of cell migration through TRAF6/NF-κB/SLUG: Several studies have shown that resveratrol performs as an anti-metastatic agent by suppressing the progression of metastasis. It is anticipated that the anti-metastatic role could be associated with the inhibition of several signaling pathways (Xu et al., 2015). It was previously shown that resveratrol inhibited metastasis through inhibiting PI3K/Akt/NF-κB pathways and LPS-induced NF-κB pathway in Panc-1 pancreatic cancer cells and melanoma mouse model, respectively (Chen et al., 2012; Li et al., 2013). Given the regulatory role of TRAF6 on

ro of

NF-κB and the consequent EMT process, we explored the possibility of involving this pathway in resveratrol-mediated inhibition of cell migration and EMT in PCa. Simultaneous treatment with TRAF6 and an NF-κB pathway inhibitor supported the fact that TRAF6 overexpression is closely associated with the migration and EMT process through the NF-κB

-p

pathway. Rescuing TRAF6 by overexpression clearly ameliorated the inhibitory effect of resveratrol on cell migration and EMT associated protein expression, undoubtedly

re

demonstrating that resveratrol suppressed cell migration and EMT through the TRAF6/NF-κB/SLUG pathway. Hence, we suggest TRAF6 as a potential cellular target of resveratrol, at least for modulating EMT and cell migration, though this needs further

lP

confirmation. Given the various function exerts on the cells by resveratrol, multiple targets of

5. Conclusions

na

this compound are feasible, and this could be an important scientific direction in the future.

The present study illustrated that resveratrol is an effective agent acting against PCa cell growth and migration and provides substantial indications to be improved as a therapeutic

ur

agent in PCa treatment. Our study clarifies that overexpression of TRAF6 is responsible for enhanced growth, proliferation, and migration of PCa and resveratrol-induced lysosomal

Jo

degradation of TRAF6 suppresses the migration and EMT event through the NF-κB pathway. The present findings indicate that the TRAF6/NFκB/SLUG pathway may represent a promising target of resveratrol to control PCa growth and migration. It also imparts the fact that TRAF6 can be a potential target for future experimenting to explore the intertwined and intricate connection among dynamic signaling pathways, tumorigenesis as well as metastasis. Although designed and performed in in vitro cell system, our study provides a rationale to substantiate the findings in PCa animal models to make TRAF6 as a validated tumor marker and resveratrol as an accessible anti-cancer agent for clinical use.

Author Contributions: F.Y.K and H.C.C designed the study, analyzed and interpreted the data. F.Y.K conducted the experiments and drafted the manuscript. X.Z, F.Z.C, and Q.C reviewed the literature. M.R and H.C.C revised the manuscript.

Conflicts of Interest: The authors declare no conflict of interest.

Acknowledgement: This research was funded by the National Basic Research Program of

ro of

China (Grant No. 2011CB910700‐ 704).

References

Jo

ur

na

lP

re

-p

Abreu-Martin, M.T., A. Chari, A.A. Palladino, et al. 1999. Mitogen-activated protein kinase kinase kinase 1 activates androgen receptor-dependent transcription and apoptosis in prostate cancer. Mol Cell Biol. 19:5143-5154. Bedford, L., J. Lowe, L.R. Dick, et al. 2011. Ubiquitin-like protein conjugation and the ubiquitin-proteasome system as drug targets. Nat Rev Drug Discov. 10:29-46. 10.1038/nrd3321. Benitez, D.A., M.A. Hermoso, E. Pozo-Guisado, et al. 2009. Regulation of cell survival by resveratrol involves inhibition of NF kappa B-regulated gene expression in prostate cancer cells. Prostate. 69:1045-1054. 10.1002/pros.20953. Beroukhim, R., C.H. Mermel, D. Porter, et al. 2010. The landscape of somatic copy-number alteration across human cancers. Nature. 463:899-905. 10.1038/nature08822. Bill-Axelson, A., L. Holmberg, H. Garmo, et al. 2014. Radical prostatectomy or watchful waiting in early prostate cancer. N Engl J Med. 370:932-942. 10.1056/NEJMoa1311593. Bray, F., J. Ferlay, I. Soerjomataram, et al. 2018. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 68:394-424. 10.3322/caac.21492. Cao, Z., J. Xiong, M. Takeuchi, et al. 1996. TRAF6 is a signal transducer for interleukin-1. Nature. 383:443-446. 10.1038/383443a0. Chen, H., M. Li, E. Sanchez, et al. 2017a. Combined TRAF6 Targeting and Proteasome Blockade Has Anti-myeloma and Anti-Bone Resorptive Effects. Mol Cancer Res. 15:598-609. 10.1158/1541-7786.MCR-16-0293. Chen, L., Y.C. Li, L. Wu, et al. 2018. TRAF6 regulates tumour metastasis through EMT and CSC phenotypes in head and neck squamous cell carcinoma. J Cell Mol Med. 22:1337-1349. 10.1111/jcmm.13439. Chen, M.C., W.W. Chang, Y.D. Kuan, et al. 2012. Resveratrol inhibits LPS-induced epithelial-mesenchymal transition in mouse melanoma model. Innate Immun. 18:685-693. 10.1177/1753425912436589.

Jo

ur

na

lP

re

-p

ro of

Chen, T., Y. You, H. Jiang, et al. 2017b. Epithelial-mesenchymal transition (EMT): A biological process in the development, stem cell differentiation, and tumorigenesis. J Cell Physiol. 232:3261-3272. 10.1002/jcp.25797. Cheng, L., J. Zang, H.J. Dai, et al. 2018a. Ubiquitin ligase CHIP functions as an oncogene and activates the AKT signaling pathway in prostate cancer. Int J Oncol. 53:203-214. 10.3892/ijo.2018.4377. Cheng, T.M., Y.T. Chin, Y. Ho, et al. 2018b. Resveratrol induces sumoylated COX-2-dependent anti-proliferation in human prostate cancer LNCaP cells. Food Chem Toxicol. 112:67-75. 10.1016/j.fct.2017.12.011. Dal Pra, A., and L. Souhami. 2016. Prostate cancer radiation therapy: A physician's perspective. Phys Med. 32:438-445. 10.1016/j.ejmp.2016.02.012. Dasgupta, B., and J. Milbrandt. 2007. Resveratrol stimulates AMP kinase activity in neurons. Proc Natl Acad Sci U S A. 104:7217-7222. 10.1073/pnas.0610068104. de Sa Coutinho, D., M.T. Pacheco, R.L. Frozza, et al. 2018. Anti-Inflammatory Effects of Resveratrol: Mechanistic Insights. Int J Mol Sci. 19. 10.3390/ijms19061812. Fang, J., G. Rhyasen, L. Bolanos, et al. 2012. Cytotoxic effects of bortezomib in myelodysplastic syndrome/acute myeloid leukemia depend on autophagy-mediated lysosomal degradation of TRAF6 and repression of PSMA1. Blood. 120:858-867. 10.1182/blood-2012-02-407999. Feng, Z.M., and S.M. Guo. 2016. Tim-3 facilitates osteosarcoma proliferation and metastasis through the NF-kappaB pathway and epithelial-mesenchymal transition. Genet Mol Res. 15. 10.4238/gmr.15037844. Gasparian, A.V., Y.J. Yao, D. Kowalczyk, et al. 2002. The role of IKK in constitutive activation of NF-kappaB transcription factor in prostate carcinoma cells. J Cell Sci. 115:141-151. Gudey, S.K., R. Sundar, Y. Mu, et al. 2014. TRAF6 stimulates the tumor-promoting effects of TGFbeta type I receptor through polyubiquitination and activation of presenilin 1. Sci Signal. 7:ra2. 10.1126/scisignal.2004207. Hamidi, A., J. Song, N. Thakur, et al. 2017. TGF-beta promotes PI3K-AKT signaling and prostate cancer cell migration through the TRAF6-mediated ubiquitylation of p85alpha. Sci Signal. 10. 10.1126/scisignal.aal4186. Han, F., L. Zhang, W. Qiu, et al. 2016. TRAF6 promotes the invasion and metastasis and predicts a poor prognosis in gastric cancer. Pathol Res Pract. 212:31-37. 10.1016/j.prp.2015.11.005. Han, Q., F. Yao, C. Zhong, et al. 2014. TRAF6 promoted the metastasis of esophageal squamous cell carcinoma. Tumour Biol. 35:715-721. 10.1007/s13277-013-1098-z. Hoesel, B., and J.A. Schmid. 2013. The complexity of NF-kappaB signaling in inflammation and cancer. Mol Cancer. 12:86. 10.1186/1476-4598-12-86. Jakus, P.B., N. Kalman, C. Antus, et al. 2013. TRAF6 is functional in inhibition of TLR4-mediated NF-kappaB activation by resveratrol. J Nutr Biochem. 24:819-823. 10.1016/j.jnutbio.2012.04.017. Khan, M.A., H.C. Chen, X.X. Wan, et al. 2013. Regulatory effects of resveratrol on antioxidant enzymes: a mechanism of growth inhibition and apoptosis induction in cancer cells. Mol Cells. 35:219-225. 10.1007/s10059-013-2259-z.

Jo

ur

na

lP

re

-p

ro of

Knauer, S.K., N. Mahendrarajah, W.P. Roos, et al. 2015. The inducible E3 ubiquitin ligases SIAH1 and SIAH2 perform critical roles in breast and prostate cancers. Cytokine Growth Factor Rev. 26:405-413. 10.1016/j.cytogfr.2015.04.002. Knight, J.F., C.J. Shepherd, S. Rizzo, et al. 2008. TEAD1 and c-Cbl are novel prostate basal cell markers that correlate with poor clinical outcome in prostate cancer. Br J Cancer. 99:1849-1858. 10.1038/sj.bjc.6604774. Lamothe, B., A. Besse, A.D. Campos, et al. 2007. Site-specific Lys-63-linked tumor necrosis factor receptor-associated factor 6 auto-ubiquitination is a critical determinant of I kappa B kinase activation. J Biol Chem. 282:4102-4112. 10.1074/jbc.M609503200. Lau, A.W., H. Fukushima, and W. Wei. 2012. The Fbw7 and betaTRCP E3 ubiquitin ligases and their roles in tumorigenesis. Front Biosci (Landmark Ed). 17:2197-2212. Li, W., J. Ma, Q. Ma, et al. 2013. Resveratrol inhibits the epithelial-mesenchymal transition of pancreatic cancer cells via suppression of the PI-3K/Akt/NF-kappaB pathway. Curr Med Chem. 20:4185-4194. Lin, Y., Y. Qiu, C. Xu, et al. 2014. Functional role of asparaginyl endopeptidase ubiquitination by TRAF6 in tumor invasion and metastasis. J Natl Cancer Inst. 106:dju012. 10.1093/jnci/dju012. Ling, H., P. Ardjomand, S. Samvakas, et al. 1998. Mesangial cell hypertrophy induced by NH4Cl: role of depressed activities of cathepsins due to elevated lysosomal pH. Kidney Int. 53:1706-1712. 10.1046/j.1523-1755.1998.00952.x. Liu, M., and F. Liu. 2011. Resveratrol inhibits mTOR signaling by targeting DEPTOR. Commun Integr Biol. 4:382-384. 10.4161/cib.4.4.15309. Liu, T., Y. Li, H. Gu, et al. 2013. p21-Activated kinase 6 (PAK6) inhibits prostate cancer growth via phosphorylation of androgen receptor and tumorigenic E3 ligase murine double minute-2 (Mdm2). J Biol Chem. 288:3359-3369. 10.1074/jbc.M112.384289. Liu, X., Z. Wang, G. Zhang, et al. 2017. High TRAF6 Expression Is Associated With Esophageal Carcinoma Recurrence and Prompts Cancer Cell Invasion. Oncol Res. 25:485-493. 10.3727/096504016X14749340314441. Luo, Z., X. Zhang, W. Zeng, et al. 2016. TRAF6 regulates melanoma invasion and metastasis through ubiquitination of Basigin. Oncotarget. 7:7179-7192. 10.18632/oncotarget.6886. Meng, Q., M. Zheng, H. Liu, et al. 2012. TRAF6 regulates proliferation, apoptosis, and invasion of osteosarcoma cell. Mol Cell Biochem. 371:177-186. 10.1007/s11010-012-1434-4. Morgan, J.J., R.M. McAvera, and L.J. Crawford. 2019. TRAF6 Silencing Attenuates Multiple Myeloma Cell Adhesion to Bone Marrow Stromal Cells. Int J Mol Sci. 20. 10.3390/ijms20030702. Naia, L., T.R. Rosenstock, A.M. Oliveira, et al. 2017. Comparative Mitochondrial-Based Protective Effects of Resveratrol and Nicotinamide in Huntington's Disease Models. Mol Neurobiol. 54:5385-5399. 10.1007/s12035-016-0048-3. Park, S.J., F. Ahmad, A. Philp, et al. 2012. Resveratrol ameliorates aging-related metabolic phenotypes by inhibiting cAMP phosphodiesterases. Cell. 148:421-433. 10.1016/j.cell.2012.01.017.

Jo

ur

na

lP

re

-p

ro of

Pavan, A.R., G.D. Silva, D.H. Jornada, et al. 2016. Unraveling the Anticancer Effect of Curcumin and Resveratrol. Nutrients. 8. 10.3390/nu8110628. Pires, B.R., A.L. Mencalha, G.M. Ferreira, et al. 2017. NF-kappaB Is Involved in the Regulation of EMT Genes in Breast Cancer Cells. PLoS One. 12:e0169622. 10.1371/journal.pone.0169622. Qi, Y., A.R. Pradipta, M. Li, et al. 2017. Cinchonine induces apoptosis of HeLa and A549 cells through targeting TRAF6. J Exp Clin Cancer Res. 36:35. 10.1186/s13046-017-0502-8. Rezaeian, A.H., C.F. Li, C.Y. Wu, et al. 2017. A hypoxia-responsive TRAF6-ATM-H2AX signalling axis promotes HIF1alpha activation, tumorigenesis and metastasis. Nat Cell Biol. 19:38-51. 10.1038/ncb3445. Saegusa, M., M. Hashimura, T. Kuwata, et al. 2009. Requirement of the Akt/beta-catenin pathway for uterine carcinosarcoma genesis, modulating E-cadherin expression through the transactivation of slug. Am J Pathol. 174:2107-2115. 10.2353/ajpath.2009.081018. Singh, A., M.F. Sweeney, M. Yu, et al. 2012. TAK1 inhibition promotes apoptosis in KRAS-dependent colon cancers. Cell. 148:639-650. 10.1016/j.cell.2011.12.033. Sorrentino, A., N. Thakur, S. Grimsby, et al. 2008. The type I TGF-beta receptor engages TRAF6 to activate TAK1 in a receptor kinase-independent manner. Nat Cell Biol. 10:1199-1207. 10.1038/ncb1780. Starczynowski, D.T., W.W. Lockwood, S. Delehouzee, et al. 2011. TRAF6 is an amplified oncogene bridging the RAS and NF-kappaB pathways in human lung cancer. J Clin Invest. 121:4095-4105. 10.1172/JCI58818. Sun, Y. 2006. E3 ubiquitin ligases as cancer targets and biomarkers. Neoplasia. 8:645-654. 10.1593/neo.06376. Sundar, R., S.K. Gudey, C.H. Heldin, et al. 2015. TRAF6 promotes TGFbeta-induced invasion and cell-cycle regulation via Lys63-linked polyubiquitination of Lys178 in TGFbeta type I receptor. Cell Cycle. 14:554-565. 10.4161/15384101.2014.990302. Tobe, M., Y. Isobe, H. Tomizawa, et al. 2003. Discovery of quinazolines as a novel structural class of potent inhibitors of NF-kappa B activation. Bioorg Med Chem. 11:383-391. Vuoriluoto, K., H. Haugen, S. Kiviluoto, et al. 2011. Vimentin regulates EMT induction by Slug and oncogenic H-Ras and migration by governing Axl expression in breast cancer. Oncogene. 30:1436-1448. 10.1038/onc.2010.509. Wang, C., L. Deng, M. Hong, et al. 2001. TAK1 is a ubiquitin-dependent kinase of MKK and IKK. Nature. 412:346-351. 10.1038/35085597. Wang, D., L. Ma, B. Wang, et al. 2017. E3 ubiquitin ligases in cancer and implications for therapies. Cancer Metastasis Rev. 36:683-702. 10.1007/s10555-017-9703-z. Wang, Z., J. Wang, X. Li, et al. 2014. Bortezomib prevents oncogenesis and bone metastasis of prostate cancer by inhibiting WWP1, Smurf1 and Smurf2. Int J Oncol. 45:1469-1478. 10.3892/ijo.2014.2545. Wu, H., A. Hao, H. Cui, et al. 2017. TRAF6 expression is associated with poorer prognosis and high recurrence in urothelial bladder cancer. Oncol Lett. 14:2432-2438. 10.3892/ol.2017.6427.

Jo

ur

na

lP

re

-p

ro of

Xu, Q., L. Zong, X. Chen, et al. 2015. Resveratrol in the treatment of pancreatic cancer. Ann N Y Acad Sci. 1348:10-19. 10.1111/nyas.12837. Yamamoto, A., Y. Tagawa, T. Yoshimori, et al. 1998. Bafilomycin A1 prevents maturation of autophagic vacuoles by inhibiting fusion between autophagosomes and lysosomes in rat hepatoma cell line, H-4-II-E cells. Cell Struct Funct. 23:33-42. Yamashita, M., K. Fatyol, C. Jin, et al. 2008. TRAF6 mediates Smad-independent activation of JNK and p38 by TGF-beta. Mol Cell. 31:918-924. 10.1016/j.molcel.2008.09.002. Yao, F., Q. Han, C. Zhong, et al. 2013. TRAF6 promoted the tumorigenicity of esophageal squamous cell carcinoma. Tumour Biol. 34:3201-3207. 10.1007/s13277-013-0890-0. Ye, H., J.R. Arron, B. Lamothe, et al. 2002. Distinct molecular mechanism for initiating TRAF6 signalling. Nature. 418:443-447. 10.1038/nature00888. Zhang, L.F., X.L. Yu, M. Ji, et al. 2018. Resveratrol alleviates motor and cognitive deficits and neuropathology in the A53T alpha-synuclein mouse model of Parkinson's disease. Food Funct. 9:6414-6426. 10.1039/c8fo00964c.

Figure Legends Figure 1. Resveratrol induces TRAF6 inhibition in prostate cancer. A) Effect of resveratrol on different E3 ubiquitin ligases in DU145 PCa cell line. DU145 PCa cells were treated with various concentrations of resveratrol for 48 hours, and RNA was extracted. Quantitative RT-PCR was performed using cDNA prepared from RNA, and relative expression of mRNA was presented on a bar diagram (p<0.05). B) mRNA expression of TRAF6 in DU145 and PC3 PCa cells in response to resveratrol (NS; non-significant). C) TRAF6 protein expression in PCa cell lines was measured by Western blotting.

normalized with loading control GAPDH (TRAF6/GAPDH).

ro of

Densitometry analysis of TRAF6 intensity was carried out using ImageJ software. Data were

Figure 2. Inhibition of TRAF6 by resveratrol reduces prostate cancer cell proliferation. A) Effect of resveratrol on cell viability. PCa cells were treated with different concentrations of resveratrol for 48 hours. MTT assay was performed to calculate cell survival rate with the

-p

value of 0 μM resveratrol being 100%. B) PCa cells were transiently transfected with scramble SiRNA or empty vector and SiTRAF6 or TRAF6-vector followed by treatment

re

with or without resveratrol for 48 hours. In Western blotting assay, GAPDH was used as a control.C) PCa cell lines DU145 and PC3 were transiently transfected with scramble SiRNA

lP

or SiTRAF6, and cell viability was measured using MTT assay. D) Cell proliferation of DU145 and PC3 were assessed using manual cell counting following cells transfected with either scrambled or SiTRAF6. E) MTT assay was performed for measuring cell viability after

na

DU145 and PC3 PCa cells transiently transfected with empty vector (Mock) or TRAF6-vector (ovTRAF6). F) Following transient transfection of PCa cells, DU145 and PC3 with mock or TRAF6-vector cells were manually counted using trypan blue exclusion

ur

assay and plotted against different periods. G) DU145 cells were transiently transfected with scramble SiRNA or SiTRAF6 followed by treatment with resveratrol for 48 hours and

Jo

subjected to MTT assay. H) DU145 cells transfected with mock or TRAF6-vector were treated with resveratrol as described in G, and cell viability was analyzed using MTT. All data are represented as mean±SD (n=3, *p<0.05 and **p<0.01). Figure 3. Resveratrol mediates lysosomal degradation of TRAF6. A) Subcellular localization of TRAF6. DU145 cells were treated with the indicated concentration of resveratrol for 48 hours. Cytoplasmic and nuclear protein extracts were collected and prepared for Western blotting to detect TRAF6 expression. GAPDH and LaminB were used as cytoplasmic and nuclear control, respectively. B) DU145 cells were treated with 50 μM

resveratrol for 40 and 44 hours followed by treatment with proteasome inhibitor MG132 (20 μM) for 8 and 4 hours, respectively. The extracted protein was subjected to Western blotting to measure the expression of TRAF6. Densitometry measurement of TRAF6 intensity was calculated using ImageJ software and normalized with loading control GAPDH (TRAF6/GAPDH). C) Representative image of Western blotting of DU145 cells treated with or without resveratrol for 24 hours followed by treatment with vehicle or NH4Cl for 24 hours. D) DU145 cells were incubated with or without Bafilomycin A1 for 24 hours in the presence or absence of resveratrol, and LC3B and TRAF6 expression was measured using Western blotting. GAPDH, as an internal control. E) Co-localization of TRAF6 and LAMP2

ro of

proteins was visualized by immunofluorescence assay. DU145 cells were treated with resveratrol for 48 hours and immunostained with TRAF6 and LAMP2 antibodies followed by incubation with appropriate secondary antibodies. Nuclei were counter-stained with DAPI (blue), and images were captured using a fluorescence microscope with 100×

-p

magnification.

Figure 4. Resveratrol-mediated degradation of TRAF6 inhibits NF-κB pathway. A)

re

Effect of resveratrol on NF-κB pathway proteins. DU145 cells were treated with various concentrations of resveratrol, and total protein was collected for Western blotting. Indicated antibodies were used to observe their expression. GAPDH was used as a control. B) DU145

lP

cells were transiently transfected with scramble or SiTRAF6 and later treated with 50 μM of resveratrol for 48 hours. C) Cells were treated as mentioned in B. Cytoplasmic, and nuclear

na

protein extracts were collected and used to detect the subcellular localization of p65. D) Cells were transiently transfected with a vector encoding TRAF6 or an empty vector. Transfected cells were treated with 50 μM of resveratrol, and extracted protein was subjected to Western

ur

blotting. E) TRAF6 overexpression vector was transfected into DU145 cells, and later cells were fractioned as cytoplasmic and nuclear using a kit. Then, the expression of p65 protein

Jo

was compared in both fractions. GAPDH and LaminB were used respectively as cytoplasmic and nuclear controls. Figure 5. Resveratrol suppresses prostate cancer cell migration. A) PCa cells were seeded in 6-well plates, and a wound line was produced between the cells. Transfected cells were treated with resveratrol for 24 hours. The migration rate was plotted in a graph (n=3, p*<0.05, p**<0.01). B) Control and resveratrol-treated cells were seeded in the transwell upper chamber for 24 hours. The migrated cells were fixed using 4% paraformaldehyde and subjected for imaging (100×). The number of migrated cells was counted from 5 random

places and plotted in a bar diagram. Data are represented as mean±SD (n=3, *p<0.05). C) DU145 cells were treated with resveratrol for 48 hours and collected total protein was subjected to Western blotting. Figure 6. Knockdown of TRAF6 inhibited PCa cell migration. A) DU145 cells were transiently transfected with either scrambled or SiTRAF6 and wound healing assay was performed in the presence or absence of resveratrol. The wound closure was quantified from the difference between the wound areas at the beginning and incubation period of the experiment. Bar diagrams were generated for the migration rate from three independent experiments (p*<0.05). B) Cells transfected with control and TRAF6 siRNA in the presence

ro of

or absence of resveratrol were subjected for transwell assay and migration rates were calculated. Data are represented as mean±SD (n=3, *p<0.05). C) DU145 cells were transfected with scramble SiRNA or SiTRAF6 and treated with resveratrol for 48 hours and undergone Western blotting to detect the indicated proteins.

-p

Figure 7. Overexpression of TRAF6 augmented PCa cell migration. A) DU145 cells were transiently transfected with mock or TRAF6 vector, and wound healing assay was

re

performed as presented in Figure 5A in the presence or absence of resveratrol. Bar diagrams were generated for the migration rate from three independent experiments (p*<0.05). B)

lP

DU145 cells transfected with mock and TRAF6 expression vector in the presence or absence of resveratrol were subjected for transwell assay and migration rates were calculated. Data are represented as mean±SD (n=3, *p<0.05). C) Resveratrol was applied into a mock or a

na

TRAF6-PCMV3 vector-treated DU145 cell and protein was collected after 48 hours. Western blotting analysis was performed using GAPDH as a control.

ur

Figure 8. TRAF6 acts as an intermediary inhibiting EMT via NFkB pathway. A) DU145 cells were transfected with a mock or a TRAF6-PCMV3 vector and treated with or without NF-κB

Jo

pathway inhibitor EVP4593. Collected protein was used for Western blotting. B) Schematic diagram showing the proposed mechanism of resveratrol function in controlling cellular growth and migration in prostate cancer. Findings are shown in accordance with the timeline (left). Resveratrol degrades TRAF6 through lysosomal pathway leading to reduced cell proliferation and inhibition of NF-κB pathway, which in turn suppresses transcription factor SLUG and inhibits EMT event.

na

Jo ur

Jo ur na l

re -p r

lP

ur na

Jo

na l

ur

Jo

ur n

Jo

rn

Jo u

rn

Jo u

Jo ur na l