- Email: [email protected]
Resveratrol inhibits epithelial-mesenchymal transition and renal fibrosis by antagonizing the hedgehog signaling pathway
G Model
BCP-12087; No. of Pages 10 Biochemical Pharmacology xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
Biochemical Pharmacology journal homepage: www.elsevier.com/locate/biochempharm
Resveratrol inhibits epithelial-mesenchymal transition and renal fibrosis by antagonizing the hedgehog signaling pathway Yongheng Bai a, Hong Lu b, Cunzao Wu c, Yong Liang a, Silu Wang a, Chengcheng Lin a, Bicheng Chen a, Peng Xia c,* a b c
Wenzhou Key Laboratory of Surgery, The First Affiliated Hospital of Wenzhou Medical University, Wenzhou, China Department of Laboratory Medicine, The First Affiliated Hospital of Wenzhou Medical University, Wenzhou, China Department of Transplantation, The First Affiliated Hospital of Wenzhou Medical University, Wenzhou, China
A R T I C L E I N F O
A B S T R A C T
Article history: Received 3 July 2014 Accepted 2 September 2014 Available online xxx
Epithelial-to-mesenchymal transition (EMT), a biologic process in which tubular cells lose their epithelial phenotypes and acquire new characteristic features of mesenchymal properties, is increasingly recognized as an integral part of renal tissue fibrogenesis. Recent studies indicate that resveratrol, a botanical compound derived mainly from the skins of red grapes, may have anti-fibrotic effects in many tissues, but the potential molecular mechanism remains unknown. In the present study, we identified that resveratrol inhibits the induction of EMT and deposition of extracellular matrix (ECM) through antagonizing the hedgehog pathway in vitro and in vivo. In rats with unilateral ureteral obstruction (UUO), administration of resveratrol (20 mg/kg/day) significantly reduced serum creatinine. Resveratrol also decreased expression of TGF-b1, and inhibited the phenotypic transition from epithelial cells to mesenchymal cells, and the deposition of ECM in UUO rats. In cultured renal tubular epithelial cells (NRK-52E), TGF-b1-induced EMT and ECM synthesis was abolished with the treatment of resveratrol. The induction of EMT was associated with the activation of the hedgehog pathway. Resveratrol treatment markedly inhibited the over-activity of the hedgehog pathway in the obstructed kidney and in TGF-b1-treated NRK-52E cells, resulted in reduction of cellular proliferation, EMT and ECM accumulation. Thus, these results suggest that resveratrol is able to inhibit EMT and fibrosis in vivo and in vitro through antagonizing the hedgehog pathway, and resveratrol may have therapeutic potential for patients with fibrotic kidney diseases. ß 2014 Elsevier Inc. All rights reserved.
Keywords: Resveratrol Epithelial-to-mesenchymal transition (EMT) Renal fibrosis Hedgehog signaling pathway
1. Introduction Renal tubulointerstitial fibrosis is the common pathway for all kinds of progressive chronic kidney diseases to end-stage renal failure [1,2]. Pathologically, tubulointerstitial fibrosis is a process that characterized by extracellular matrix (ECM) deposition in association with inflammatory cells infiltration, tubular epithelial cells loss and fibroblast accumulation [3]. In fibrogenesis, epithelial-to-mesenchymal transition (EMT) is increasingly recognized as an integral part of renal fibrogenesis [4]. EMT is a biologic process in which tubular cells lose their epithelial phenotypes such
* Corresponding author at: Department of Transplantation, The First Affiliated Hospital of Wenzhou Medical University, 2# Fuxue Lane, Wenzhou 325000, China. Tel.: +86 577 88069338; fax: +86 577 55578999-660061. E-mail addresses: [email protected], [email protected] (P. Xia).
as E-cadherin and tight junction protein 1 (Tjp1), and acquire new characteristic features of mesenchymal properties such as asmooth muscle actin (a-SMA) and vimentin [5–7]. The major driving force behind EMT during the fibrogenic phase of fibrosis appears to be various profibrotic growth factors, including transforming growth factor b1 (TGF-b1) [8,9] and connective tissue growth factor (CTGF) [10]. In kidney, TGF-b1-induced EMT can be reversed by bone morphogenic protein 7 (BMP-7) [11], thereby leading to reduction of fibroblast proliferation and collagen synthesis. Regulation of EMT may be a potential target to prevent progressive renal tubulointerstitial fibrosis. Recently, several studies showed that the hedgehog signaling was involved in EMT and tissue fibrogenesis [12–14]. Aberrant activation of hedgehog signaling pathway results in pathological consequences, including a variety of human tumors, such as pancreatic cancer [15], gastric cancer [16] and basal cell carcinoma [17]. In addition to these, activated hedgehog signaling has been
http://dx.doi.org/10.1016/j.bcp.2014.09.002 0006-2952/ß 2014 Elsevier Inc. All rights reserved.
Please cite this article in press as: Bai Y, et al. Resveratrol inhibits epithelial-mesenchymal transition and renal fibrosis by antagonizing the hedgehog signaling pathway. Biochem Pharmacol (2014), http://dx.doi.org/10.1016/j.bcp.2014.09.002
G Model
BCP-12087; No. of Pages 10 2
Y. Bai et al. / Biochemical Pharmacology xxx (2014) xxx–xxx
demonstrated to have profibrogenic effects [18]. In hepatic fibrosis, activation of the hedgehog pathway is triggered through binding of the ligands, including sonic hedgehog (Shh), to its membrane receptor patched 1 (Ptch1). The binding of ligand to Ptch1 relieves a signal transducer Smoothened (Smo), and activates a cascade that leads to translocation of the transcription factor Gli1 to the nucleus. As a result, activated hedgehog signaling promotes fibrogenesis [18]. In kidney, over-activity of hedgehog signaling not only promotes tissue regeneration, but also induces TGF-b1 expression [14]. Thus, screening the high effective pharmaceutical agents to inhibit the activation of hedgehog signaling provides a large opportunity for the development of anti-fibrotic drugs. Resveratrol, a botanical compound derived mainly from the skins of red grapes, has been widely used in traditional medicine and dietary supplements. A series of reports highlighted its benefits in cardioprotection [19], neuroprotection [20], and immune regulation [21]. Recent study has shown that resveratrol inhibited cellular proliferation and induced apoptosis through the hedgehog signaling pathway in pancreatic cancer cells [22] and prostate cancer cells [23]. Take into account these, we hypothesized that resveratrol may have an anti-fibrotic effect through antagonizing the hedgehog signaling pathway. In the present study, we investigated the anti-fibrotic effects of resveratrol on kidney tissues of rats with unilateral ureteral obstruction (UUO) and TGF-b1-treated renal tubular epithelial cells (NRK-52E). Furthermore, the phenotypic transition from epithelial cells to mesenchymal cells, ECM deposition and the activity of hedgehog signaling were also evaluated. Our findings indicate that resveratrol is able to inhibit tubular EMT and renal fibrosis in vivo and in vitro through suppressing the hedgehog pathway, and resveratrol exerts therapeutic potential for patients with fibrotic kidney diseases.
system (Leica Microsystems, Wetzlar, Germany) and a DFC 420C 5M digital microscope camera (Leica Microsystems). Tubulointerstitial damage and the degree of interstitial collagen deposition were graded as described previously [25]. 2.3. Immunohistochemical analysis Immunohistochemical analysis was performed with 4-mmthick kidney sections that had been dewaxed with xylene and hydrated using sequential ethanol (100, 95, 85, and 75%) and distilled water. Endogenous peroxidase was blocked with 3% hydrogen peroxide. Antigen retrieval was performed by heating sections in 0.1% sodium citrate buffer (pH 6.0). For hedgehog signaling pathway, anti-Shh (1:100, Biogot Technology, Shanghai, China), anti-Ptch1 (1:200, Santa Cruz Biotechnology, Santa Cruz, CA, USA), anti-Smo (1:100, Santa Cruz), and anti-Gli1 (1:100, Biogot) antibody were used. For EMT, anti-a-SMA (1:100, Santa Cruz), anti-type III collagen (1:100, Biogot) and anti-E-cadherin (1:100, Abcam, Cambridge, MA, USA) antibody were used. In addition, PCNA (1:200, Santa Cruz) expression was also determined by using immunochemical streptavidin-perosidase method. All samples were semi-quantitatively or quantitatively assessed by two independent investigators in a blinded manner. 2.4. Enzyme-linked immunoabsorbent assay (ELISA) Rat kidney tissues (100 mg) were homogenized and centrifuged and the supernatant was collected. Avidin-biotin complex-ELISA was used according to the manufacturer’s protocol to determine TGF-b1 and Shh levels. ELISA kits were purchased from Xitang Biotechnology (Shanghai, China). All experiments were repeated at least three times.
2. Materials and methods 2.5. Cell culture and treatment 2.1. Animal model and tissue preparation Forty-two male Sprague-Dawley rats weighing 180–200 g and 6–8 weeks old were purchased from the Experimental Animal Center of Wenzhou Medical University (Wenzhou, China). Rats were housed in a temperature-, humidity- and light-controlled environment, and fed a standard rat chow and water. Rats were fasted on the day prior to experiments being conducted. Weightmatched rats were randomly assigned to three groups: (1) a sham operation group (n = 6); (2) a vehicle group (n = 18, UUO rats treated with normal saline); and (3) resveratrol group (n = 18, UUO rats treated with resveratrol). UUO surgery was performed as previously described [24], and after 2 h postoperatively, UUO rats received daily intragastric administration consecutively for 7 or 14 days with either normal saline or resveratrol (20 mg/kg/d, lot No. 20120330, Yuanye Biotechnology, Shanghai, China). The kidneys were excised on days 7 and 14 after UUO surgery, and serum samples were collected to examine the levels of creatinine and blood urea nitrogen using an AU5800 automatic biochemistry analyzers (Beckman Coulter Inc., Kraemer Boulevard Brea, CA, USA). The animal study protocols were approved by the Institutional Animal Care and Use Committee of Wenzhou Medical University, China. 2.2. Histopathological examination Kidney specimens fixed in formalin and embedded in paraffin were cut into 4-mm sections and stained with Hematoxylin and eosin (HE, Yuanye) and Masson’s trichrome (Yuanye). Slides were examined and pictures taken using a DM4000 B LED microscope
The rat renal tubular epithelial cell line (NRK-52E) was purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). NRK-52E cells were maintained in Dulbecco’s Modified Eagle Medium (Invitrogen, CA, USA) supplemented with 5% fetal bovine serum (FBS, Invitrogen), 100 U/ml penicillin and 100 mg/ml streptomycin (Invitrogen). The NRK-52E cells were seeded in the complete medium containing 5% FBS at approximately 70% confluence in six-well culture plates. After 24 h, the complete medium was replaced with serum-free medium for 24 h before treatment with recombinant TGF-b1 (Lot No. 0312209-1, PeproTech, RockyHill, NJ, USA) or resveratrol (10, 100 mmol/ml). 2.6. Immunocytochemical staining NRK-52E cells were cultured with TGF-b1 with or without resveratrol in the six-well plates containing glass slides and were then washed with PBS and fixed with 4% paraformaldehyde (Sigma–Aldrich, St. Louis, MO, USA) at 4 8C for 30 min. After permeabilization with 0.1% Triton X-100 for 10 min, the specimens were washed with PBS and then blocked with 10% FBS to eliminate the nonspecific fluorescence. Immunofluorescence staining was performed using anti-type III collagen (1:100), aSMA (1:200), E-cadherin (1:200), Ptch1 (1:200), Smo (1:200), Gli1 (1:100), and PCNA (1:200) as the primary antibody, and the cell preparations were incubated with DyLight 488/594 labeled secondary antibodies (Beyotime Biotechnology, Jiangsu, China). The immunocytochemical samples were semiquantitatively or quantitatively assessed by two independent investigators in a blinded manner.
Please cite this article in press as: Bai Y, et al. Resveratrol inhibits epithelial-mesenchymal transition and renal fibrosis by antagonizing the hedgehog signaling pathway. Biochem Pharmacol (2014), http://dx.doi.org/10.1016/j.bcp.2014.09.002
G Model
BCP-12087; No. of Pages 10 Y. Bai et al. / Biochemical Pharmacology xxx (2014) xxx–xxx
2.7. Reverse transcription-polymerase chain reaction (RT-PCR) Total RNA was extracted from rat kidneys and NRK-52E cells using TRIzol reagent (Invitrogen), reverse-transcribed to cDNA templates using a ReverTra Ace qPCR RT kit (Toyobo, Japan). Quantitative RT-PCR was performed using a SYBR Green Realtime PCR Master Mix -Plus- (Toyobo, Japan). Quality was analyzed on agarose gels, and quantities were measured using a Varioskan Flash (Thermo Fisher Scientific, USA). The sequence-specific primers for Shh, Ptch1, Smo, Gli1, Col1a1, Col3a1, Tjp1, TGFb1R, MMP-2, TIMP-2, fibronection, S100A4, and a-SMA, all listed in Table 1, were synthesized by Invitrogen, and b-actin was used as an endogenous reference gene. Samples were analyzed in triplicate using an Applied Biosystems 7500 Real-Time PCR System (Life Technologies, Foster City, CA, USA). The melting curve was examined to verify that a single product was amplified. For quantitative analysis, all samples were analyzed using the DDCT value method. 2.8. Statistical analysis Data is presented as mean standard error of the mean. All statistical analyses were performed using a Statistical Package for Social Sciences (version 16.0, SPSS Inc., Chicago, USA). A two-sided Student’s t-test was used to analyze differences between the two groups. One-way analysis of variance was used when more than two groups were present. A p-value of <0.05 was considered statistically significant. 3. Results 3.1. Effect of resveratrol on renal dysfunction of UUO rats Table 2 shows the changes in the functional parameters in the experimental groups as a result of resveratrol treatment for two weeks. Although there is no significant difference in the levels of blood urea nitrogen between the vehicle-treated group and the sham-operation group, the levels of serum creatinine are significant higher in UUO group than the sham group. With the treatment of resveratrol, the levels of blood urea nitrogen in whole blood did not show a marked decline, but resveratrol administration decreased significantly the levels of serum creatinine. Thus, resveratrol at this dose exerts protective effects to some extent on renal function. 3.2. Effect of resveratrol on interstitial fibrosis in kidney tissues of UUO rats Rodent UUO is a well-characterized experimental model resulting in renal interstitial fibrosis [24]. As shown in Fig. 1A
3
Table 2 Levels of serum creatinine and blood urea nitrogen in each group. Group
Serum creatinine
Blood urea nitrogen
7d
14 d
7d
14 d
Sham UUO Resveratrol
37.3 7.8 51.4 9.9* 42.6 5.8**
42.3 10.1 55.1 11.3* 44.5 6.7**
7.47 1.9 6.89 1.4 8.41 2.6
7.11 1.2 7.51 2.1 7.05 1.3
n = 6, mean standard deviations. * P < 0.05 versus sham group. ** P < 0.05 versus UUO group.
and C, histologic examination with HE staining revealed obvious diffuse congestion and edema, and focal hemorrhaging had occurred in the renal interstitium of 7-day obstructed kidneys, simultaneously accompanied by inflammatory cell infiltration, epithelial cell necrosis and marked tubular dilation. With the treatment of resveratrol, the damage to the renal interstitium, which included inflammatory cell infiltration, tubular dilation and atrophy, was alleviated, especially at day 14. To assess the degree of interstitial fibrosis, the deposition of total collagen was determined by Masson’s trichrome staining. We found that collagen accumulation in kidney tissues increased significantly as obstruction time progressed (Fig. 1B and C). At day 14 after obstruction surgery, the fibrosis was more severe. The deposition of total collagen in the renal interstitium was reduced by resveratrol treatment, especially at day 14 after UUO operation. These results indicated that resveratrol ameliorated ureteral obstruction-induced interstitial fibrosis and this anti-fibrotic effect is positively associated with the action time of the drug. Effect of resveratrol on ECM deposition, EMT, and TGF-b1 expression in UUO kidneys Myofibroblasts are the predominant type of interstitial cells in the fibrotic kidney and the major source of ECM components such as type I and III collagens during renal fibrosis [1]. Emerging evidence shows that the EMT process may be involved in the production of myofibroblasts [4]. In the present study, as shown in Fig. 2A, resveratrol administration decreased expression levels of mesenchymal markers a-SMA and type III collagen in UUO rats, and increased the level of epithelial marker E-cadherin. In addition, resveratrol also induced the down-regulation in mRNA expression of a-SMA, S100A4, and Col3a1 (encoding type III collagen), and the up-regulation in mRNA expression of Tjp1 (Fig. 2B). S100A4 (also known as Mts1 and FSP1) is a specific fibroblast protein, and may function in motility, invasion, and tubulin polymerization [26]. Tjp1 is a scaffolding protein of the membrane-associated guanylate kinase family associated with tight junctions [27]. Thus, these findings demonstrated that resveratrol exerts anti-fibrotic effect through suppressing the phenotypic transition from
Table 1 Two-step real-time RT-PCR primers for analysis. Gene
Forward sequence (50 ! 30 )
Reverse sequence (50 ! 30 )
Product size (bp)
Shh Gli1 Ptch1 Smo Col1a1 Col3a1 TGF-b1R a-SMA Fibronection Tjp1 S100A4 MMP-2 TIMP-2 b-actin
ACAAGAAACTCCGAACGATT CCTCGTGGCTTTCATCAACTCT TCCAGCCGACCCAGATTG TGTGGCTCAGGTAGATGG GATCCTGCCGATGTCGCTAT AAGGCTGAAGGAAATAGC TGATCCATCCGTTGAAGAAA GGCATCCACGAAACCACCT ACACGGTTTCCCATTACG AACAGAGCCGAGCAGTTAGCC ATACTCAGGCAACGAGGGTG CGGTTTATTTGGCGGACAG GTGAGCGAGAAGGAGGTGGAT CCCATCTATGAGGGTTACGC
ACAAGAAACTCCGAACGATT(R) GAAGCATCATTGAACCCTGAGTAGA ACATAGTCGTAGCCCCTGAAGTG GGTGGTTGCTCTTGATGG GGAGGTCTTGGTGGTTTTGTATTC AATGTCATAGGGTGCGATA CTAGCTGCTCCATTGGCATA CCGCCGATCCAGACAGAAT TTTCCATTCCCGAGACAT CAACATCAGCAATCGGTCCA CTTCCGGGGCTCCTTATC TGGTCAGTGGCTTGGGGTAT CTGGGTGATGCTAAGCGTGTC TTTAATGTCACGCACGATTTC
183 185 252 170 276 147 144 212 220 238 247 202 273 150
Please cite this article in press as: Bai Y, et al. Resveratrol inhibits epithelial-mesenchymal transition and renal fibrosis by antagonizing the hedgehog signaling pathway. Biochem Pharmacol (2014), http://dx.doi.org/10.1016/j.bcp.2014.09.002
G Model
BCP-12087; No. of Pages 10 4
Y. Bai et al. / Biochemical Pharmacology xxx (2014) xxx–xxx
Fig. 1. Resveratrol alleviates interstitial fibrosis in the kidney tissues of UUO rats. (A) Renal tubular injury was assessed by HE staining. (B) The deposition of total fibrosis in kidney tissues of UUO rats was determined by Masson’s trichrome staining. Blue (aniline blue) represents collagen fibers; red (acid fuchsin) represents muscle fibers. Bar = 200 mm. (C) Tubulointerstitial damage and the degree of interstitial collagen deposition were assessed semiquantitatively as described in Section 2. *P < 0.05, ** P < 0.01 versus the sham group; #P < 0.05, ##P < 0.01 versus the UUO group.
epithelial cells to mesenchymal cells and ECM accumulation in kidney tissues of UUO rats. Furthermore, interestingly, we found that the effect of resveratrol on EMT and ECM deposition shows time-dependent manner. The changes in expression of EMTrelated genes and proteins in 7-day UUO rats were more significant than that in 14-day UUO rats. Contrarily, the changes in expression of ECM-related molecules were more significant in 14-day UUO rats than that in 14-day UUO rats. These results suggested that the effect of resveratrol on EMT is occurred before ECM deposition. In fibrotic kidney, the induction of EMT and ECM deposition may be triggered by enhanced TGF-b1 expression [9]. In this study, evidence from ELISA showed that the levels of TGF-b1 were increased in kidney tissues of UUO rats in a time-dependent manner (Fig. 2C). With the treatment of resveratrol, enhanced TGFb1 levels were inhibited in 14-day UUO rats, though the difference is not significant in 7-day UUO rats.
3.3. Effect of resveratrol on hedgehog signaling in UUO kidneys In UUO rats, various damage factors including microenvironment pressure and hypoxia induce apoptosis and necrosis of tubular epithelial cells, accompanied by excessive proliferation of mesenchymal cells [7,8]. In this study, we found that ureteral obstruction operation increased the expression levels of PCNA, an auxiliary protein of DNA polymerase delta that is involved in cellular proliferation. Compared with that in sham-operation rats, the ratio of PCNA-positive cells/total cells was significantly increased in UUO rats (P < 0.05, Fig. 3), especially in 7-day UUO rats. Interestingly, PCNA is mainly expressed around renal tubules. We hypothesized that this expression feature may be associated with aberrant proliferation of epithelial cells. Thus, we investigated the activity of hedgehog signaling, a proliferation-relevant signaling pathway, in UUO rats. As shown in Fig. 4, the mRNA and
Please cite this article in press as: Bai Y, et al. Resveratrol inhibits epithelial-mesenchymal transition and renal fibrosis by antagonizing the hedgehog signaling pathway. Biochem Pharmacol (2014), http://dx.doi.org/10.1016/j.bcp.2014.09.002
G Model
BCP-12087; No. of Pages 10 Y. Bai et al. / Biochemical Pharmacology xxx (2014) xxx–xxx
5
Fig. 2. Resveratrol inhibits EMT and ECM accumulation in UUO rats. (A) Resveratrol increased the expression of E-cadherin and decreased the expression of a-SMA and type III collagen in kidney tissues of 7-day UUO rats compared with the vehicle groups, as determined by immunohistochemical staining. Bar = 100 mm. (B) Quantitative RT-PCR showed that mRNA expression levels of a-SMA, S100A4, and Col3a1 was increased in UUO rats, but decreased after resveratrol treatment. On the contrary, down-regulated mRNA expression levels of Tjp1 in UUO rats were up-regulated in resveratrol-treated rats. (C) The levels of TGF-b1 determined by ELISA in UUO rats were enhanced, but inhibited by resveratrol. *P < 0.05, **P < 0.01 versus the sham; #P < 0.05 versus the UUO group.
protein expression levels of Shh, Smo and Gli1 were significantly increased in 7-day UUO rats, and the expression of Ptch1 was decreased, suggesting that the hedgehog signaling was activated in kidney tissues after UUO. Further study showed that, as well as PCNA, these hedgehog signaling-related molecules were mainly expressed around renal tubules. These findings indicated that activation of hedgehog signaling may be an important factor triggering epithelial cell proliferation in a feedback way. Activated hedgehog signaling is also involved in tubular EMT, resulted in excessive accumulation of myofibroblasts and ECM components. In UUO rats, the hedgehog signaling-related proliferative activity can be inhibited by resveratrol administration. Resveratrol not only down-regulated the ratio of PCNA-positive cells/total cells, but also inhibited the activation of hedgehog signaling. However, these effects of resveratrol did not show time-dependent behavior. We hypothesized that it may be associated with the degree of hedgehog signaling activation. The activity of hedgehog signaling peaks at 7 days after obstruction operation, and this pattern may regulate the effect of resveratrol on epithelial cell proliferation and tubular EMT.
the induction of EMT, and reducing the deposition of ECM components, it should be confirmed again in vitro experiments. Thus, first, we investigated the effects of resveratrol on EMT and ECM deposition in TGF-b1-treated rat renal tubular epithelial cells (NRK-52E). As shown in Fig. 5A, TGF-b1 enhanced the protein expression of a-SMA and type III collagen, and down-regulated expression of E-cadherin. In addition, TGF-b1 increased the mRNA expression of its receptor TGF-b1R, resulted in up-regulated mRNA expression of fibronection, S100A4 and Col1a1 (Fig. 5B). Moreover, TGF-b1 decreased MMP-2 expression and increased TIMP-2 expression, suggesting that down-regulated expression ratio of MMP-2/TIMP-2. These changes in TGF-b1-treated NRK-52E cells were inhibited or even reversed by resveratrol treatment. The inhibition of resveratrol showed a concentration-dependent manner, and the higher concentration (100 mmol/ml) had stronger inhibitive action to EMT and ECM deposition. Also, resveratrol relieved the expression ratio of MMP-2/TIMP-2.
3.4. Effect of resveratrol on EMT, ECM deposition in TGF-b1-treated NRK-52E cells
To clarify the effect of resveratrol on hedgehog signaling, we detected the mRNA and protein expression of Shh, Ptch1, Smo, and Gli1, indicated by quantitative RT-PCR and immunofluorescence staining, respectively. In TGF-b1-treated NRK-52E cells, resveratrol inhibited PCNA expression (Fig. 6), and this inhibition may be associated with enhanced protein expression of Smo and Gli1 and
Despite our in vivo experiments demonstrated that resveratrol exerts renal anti-fibrotic effects through inhibiting the overactivity of hedgehog signaling and cellular proliferation, abolishing
3.5. Effect of resveratrol on hedgehog signaling in TGF-b1-treated NRK-52E cells
Please cite this article in press as: Bai Y, et al. Resveratrol inhibits epithelial-mesenchymal transition and renal fibrosis by antagonizing the hedgehog signaling pathway. Biochem Pharmacol (2014), http://dx.doi.org/10.1016/j.bcp.2014.09.002
G Model
BCP-12087; No. of Pages 10 6
Y. Bai et al. / Biochemical Pharmacology xxx (2014) xxx–xxx
Fig. 3. Resveratrol inhibits the expression of PCNA in UUO rats. (A) The expression of PCNA was determined by immunohistochemical staining. Bar = 50 mm. (B) The ratio of PCNA-positive cells/total cells determined according to Fig. 3A in UUO rats was increased, but decreased by resveratrol treatment. *P < 0.05 versus the sham group; #P < 0.05, ## P < 0.01 versus the UUO group.
Fig. 4. Resveratrol inhibited over-activity of hedgehog signaling in UUO rats. (A) The location and expression of Shh, Ptch1, Smo, and Gli1 were determined by immunohistochemical staining. Bar = 100 mm. Our results showed that the expression of Shh, Smo and Gli1 in 7-day UUO rats was increased, but decreased after resveratrol treatment. However, down-regulated expression of Ptch1 in 7-day UUO rats was up-regulated by resveratrol. (B) The levels of Shh indicated by ELISA in UUO rats were increased, but decreased by resveratrol treatment. (C) Quantitative RT-PCR showed that changes in gene expression of Ptch1, Smo and Gli1 are in accordance with changes in protein expression. *P < 0.05, **P < 0.01 versus the sham group; #P < 0.05, ##P < 0.01 versus the UUO group.
Please cite this article in press as: Bai Y, et al. Resveratrol inhibits epithelial-mesenchymal transition and renal fibrosis by antagonizing the hedgehog signaling pathway. Biochem Pharmacol (2014), http://dx.doi.org/10.1016/j.bcp.2014.09.002
G Model
BCP-12087; No. of Pages 10 Y. Bai et al. / Biochemical Pharmacology xxx (2014) xxx–xxx
7
Fig. 5. Resveratrol inhibits EMT and ECM accumulation in TGF-b1-treated NRK-52E cells. (A) Immunofluorescence staining indicated up-regulated expression of a-SMA and type III collagen and down-regulated expression of E-cadherin in NRK-52E cells after TGF-b1 treatment. The TGF-b1-mediated induction was abolished by resveratrol. Bar = 100 mm. (B) Resveratrol decreased TGF-b1-induced over-expression of TGF-b1R, TIMP-2, fibronection, S100A4, and Col3a1 mRNA, and increased TGF-b1-induced lowexpression of MMP-2 mRNA in NRK-52E cells, detected by quantitative RT-PCR. Res10, 10 mmol/ml resveratrol; Res100, 100 mmol/ml resveratrol; *P < 0.05, **P < 0.01 versus the control; #P < 0.05, ##P < 0.01 versus the TGF-b1 group.
decreased expression of Ptch1 (Fig. 7A). Furthermore, resveratrol also inhibited up-regulated mRNA expression of Shh and Gli1 and down-regulated mRNA expression of Ptch1 (Fig. 7B). Based on these results, it is suggested that TGF-b1-induced over-activity of hedgehog signaling in NRK-52E cells is inhibited by resveratrol. 4. Discussion In the present study, we investigated the effect of resveratrol on renal tubulointerstitial fibrosis using an experimental rat model and a cell culture system. In UUO rats, resveratrol exerts its
protective effects by reducing the levels of serum creatinine, inflammatory cell infiltration and the degree of interstitial fibrosis. In addition, resveratrol-induced inhibition of ECM components deposition is associated with the abolishment or reversion of EMT. Our further study showed that the induction of EMT is triggered by the activation of hedgehog signaling, which can be inhibited by resveratrol treatment. Our results provide a rational for the use of resveratrol as a potential supplemental treatment to attenuate renal tubulointerstitial fibrosis. The pathological characteristics of renal interstitial fibrosis are extensive ECM deposition in the cortical interstitium [7]. Altering
Please cite this article in press as: Bai Y, et al. Resveratrol inhibits epithelial-mesenchymal transition and renal fibrosis by antagonizing the hedgehog signaling pathway. Biochem Pharmacol (2014), http://dx.doi.org/10.1016/j.bcp.2014.09.002
G Model
BCP-12087; No. of Pages 10 8
Y. Bai et al. / Biochemical Pharmacology xxx (2014) xxx–xxx
Fig. 6. Expression of PCNA in NRK-52E cells with TGF-b1 with or without resveratrol. (A) Immunofluorescence staining indicated that TGF-b1-mediated up-regulated expression of PCNA in NRK-52E cells was inhibited by resveratrol treatment. Bar = 50 mm. (B) The ratio of PCNA-positive cells/total cells determined according to Fig. 6A in TGF-b1-treated NRK-52E cells were increased, but decreased by resveratrol treatment. #P < 0.05 versus the TGF-b1 group.
the balance of degradation and production of ECM components may be an important factor triggering fibrogenesis [28]. In TGF-b1treated renal tubular epithelial cells, resveratrol inhibited downregulated expression ratio of MMP-2/TIMP-2. MMP-2, which is regulated by TIMP-2, is a member of the matrix metalloproteinase family that is involved in the breakdown of ECM in normal physiological processes, such as embryonic development and tissue remodeling [29]. The enhanced ratio of MMP-2/TIMP-2 induced by resveratrol indicated up-regulation of ECM degradation and down-regulation of ECM production, resulted in reduction of ECM components such as type I and III collagens. Myofibroblasts are terminally differentiated cells responsible for the synthesis and accumulation of interstitial ECM components [1]. In addition to tissue resident fibroblasts, myofibroblasts originate from tubular epithelial cells via EMT, which has been demonstrated to be induced by TGF-b1 [8,9]. In the obstructed kidney, resveratrol administration decreased TGF-b1 expression and inhibited the induction of EMT. In TGF-b1-treated tubular epithelial cells, resveratrol reduced TGF-b1R expression and relieved the EMT process. These findings provide strong support that resveratrol inhibits excessive deposition of ECM components is through suppressing TGF-b1 pathway and the induction of EMT. To epithelial cells, EMT may be a process of abnormal proliferation. Tubular cells lose their epithelial phenotypes and acquire mesenchymal characteristic features, which can make them possess more adaptability and competence in the microenvironment of injury [30]. However, these changes also come with bad denouement. For example, large amounts of ECM components are produced and deposited in the cortical interstitium that resulted in renal fibrosis [1]. In the process of proliferation, enhanced PCNA expression may be associated with activation of
proliferation-related signaling, such as hedgehog signaling. Previous studies showed that activated hedgehog signaling not only promotes kidney development (such as Pax2, Sall1) [31], but also results in up-regulated expression of c-Myc, Cyclin D1 and FOXA2, which are key regulators in cell cycle regulation [32,33]. Abnormal cell growth and differentiation may be one important reason for EMT [34]. Thus, we investigated the effects of resveratrol on cellular proliferation and activity of hedgehog signaling. Our results showed that hedgehog signaling is activated in the obstructed kidney and in TGF-b1-treated renal tubular epithelial cells. Research in recent years has suggested that the activity of hedgehog signaling is increased during the EMT process [12,13]. Fabian and his group confirmed that hedgehog signaling acts in a paracrine manner during kidney fibrosis [14], similar to its role during renal development [35]. Hedgehog signaling also promotes myofibroblast activation and tubular EMT by directly controlling the expression of a battery of fibrogenic genes, such as Gli1, Snail1, desmin, a-SMA, fibronectin, and type I collagen, leading to increased matrix deposition and scar formation [36,37]. Our results revealed that hedgehog signaling-related molecules and epithelial cell marker E-cadherin was co-expressed in the same areas of the fibrotic kidney (around renal tubules), and it implicated that over-activated hedgehog signaling is involved in the induction of EMT. In addition, during the EMT process induced by TGF-b1 in vitro, activated hedgehog signaling promotes the proliferation of epithelial cells. However, further study showed that the outcome of cellular proliferation does not increase cell number, but induces morphologic changes. Thus, hedgehog signaling may be essential to the induction of EMT and the formation of renal fibrosis. Our in vivo and in vitro experiment showed that the over-activity of hedgehog signaling can be
Please cite this article in press as: Bai Y, et al. Resveratrol inhibits epithelial-mesenchymal transition and renal fibrosis by antagonizing the hedgehog signaling pathway. Biochem Pharmacol (2014), http://dx.doi.org/10.1016/j.bcp.2014.09.002
G Model
BCP-12087; No. of Pages 10 Y. Bai et al. / Biochemical Pharmacology xxx (2014) xxx–xxx
9
Fig. 7. Resveratrol inhibited activation of hedgehog signaling in TGF-b1-treated NRK-52E cells. (A) TGF-b1-induced up-regulated expression of Smo and Gli1 by using immunofluorescence staining and down-regulated expression of Ptch1 was suppressed by resveratrol. (B) TGF-b1 increased gene expression of Shh and Gli1 and decreased gene expression of Ptch1 in NRK-52E cells, but was inhibited by resveratrol. *P < 0.05 versus the control; #P < 0.05 versus the TGF-b1 group.
down-regulated by resveratrol treatment. As a result, resveratrol reduced cellular proliferation and inhibited tubular EMT. As a novel modulator of hedgehog signaling, resveratrol exerts marked anti-cancer effects [22,23]. Recent studies revealed that resveratrol also has anti-fibrosis activity in many tissues, such as lung and liver [38,39]. However, the underlying molecular mechanism remains unknown. Our study provides molecular evidence that resveratrol ameliorates fibrosis by antagonizing the hedgehog signaling pathway. However, there exist obvious limitations that the hedgehog signaling pathway is not induced to be over-activated or lowactivated, and so it can not prove that hedgehog signaling is necessary for resveratrol to have therapeutic benefits. In addition, the dose/concentration of resveratrol used in this study needs clear. We found that resveratrol treatment at high concentrations (greater than 100 mmol/ml) could induce marked apoptosis and necrosis of tubular epithelial cells. Thus, it is very important for resveratrol to have an appropriate dose/concentration used in vivo. In conclusion, our findings suggested that resveratrol may be a potential therapeutics to prevent progressive renal tubulointerstitial fibrosis. The possible molecular mechanism is that resveratrol
suppresses the activation of the hedgehog signaling pathway, reduces TGF-b1 expression and abolishes the induction of EMT, resulted in excessive ECM components synthesis and deposition in the cortical interstitium. Conflict of interest None. Acknowledgements This study was sponsored by Zhejiang Extremely Key Subject of Surgery, and supported by the Wenzhou Municipal Science and Technology Plan Project (Grant Nos. Y20110028 and Y20130158). The project also supported by the Natural Science Foundation of Zhejiang province, China (Grant Nos. LQ12H05001 and LY12H05004). References [1] Meran S, Steadman R. Fibroblasts and myofibroblasts in renal fibrosis. Int J Exp Pathol 2011;92:158–67.
Please cite this article in press as: Bai Y, et al. Resveratrol inhibits epithelial-mesenchymal transition and renal fibrosis by antagonizing the hedgehog signaling pathway. Biochem Pharmacol (2014), http://dx.doi.org/10.1016/j.bcp.2014.09.002
G Model
BCP-12087; No. of Pages 10 10
Y. Bai et al. / Biochemical Pharmacology xxx (2014) xxx–xxx
[2] Vilayur E, Harris DC. Emerging therapies for chronic kidney disease: what is their role. Nat Rev Nephrol 2009;5:375–83. [3] Liu Y. Epithelial to mesenchymal transition in renal fibrogenesis: pathologic significance, molecular mechanism, and therapeutic intervention. J Am Soc Nephrol 2004;15:1–12. [4] Liu Y. New insights into epithelial-mesenchymal transition in kidney fibrosis. J Am Soc Nephrol 2009;21:212–22. [5] Alpers CE, Hudkins KL, Floege J, Johnson RJ. Human renal cortical interstitial cells with some features of smooth muscle cells participate in tubulointerstitial and crescentic glomerular injury. J Am Soc Nephrol 1994;5:201–9. [6] Bi WR, Xu GT, Lv LX, Yang CQ. The ratio of transforming growth factor-beta1/ bone morphogenetic protein-7 in the progression of the epithelial-mesenchymal transition contributes to rat liver fibrosis. Genet Mol Res 2014;13: 1005–14. [7] Kalluri R, Weinberg RA. The basics of epithelial-mesenchymal transition. J Clin Invest 2009;119:1420–8. [8] Yang J, Liu Y. Dissection of key events in tubular epithelial to myofibroblast transition and its implications in renal interstitial fibrosis. Am J Pathol 2001;159:1465–75. [9] Zavadil J, Bottinger EP. TGF-beta and epithelial-to-mesenchymal transitions. Oncogene 2005;24:5764–74. [10] Strutz F, Zeisberg M, Ziyadeh FN, Yang CQ, Kalluri R, Muller GA, et al. Role of basic fibroblast growth factor-2 in epithelial-mesenchymal transformation. Kidney Int 2002;61:1714–28. [11] Zeisberg M, Hanai J, Sugimoto H, Mammoto T, Charytan D, Strutz F, et al. BMP7 counteracts TGF-beta1-induced epithelial-to-mesenchymal transition and reverses chronic renal injury. Nat Med 2003;9:964–8. [12] Ding H, Zhou D, Hao S, Zhou L, He W, Nie J, et al. Sonic hedgehog signaling mediates epithelial-mesenchymal communication and promotes renal fibrosis. J Am Soc Nephrol 2012;23:801–13. [13] Omenetti A, Porrello A, Jung Y, Yang L, Popov Y, Choi SS, et al. Hedgehog signaling regulates epithelial-mesenchymal transition during biliary fibrosis in rodents and humans. J Clin Invest 2008;118:3331–42. [14] Fabian SL, Penchev RR, St-Jacques B, Rao AN, Sipila P, West KA, et al. HedgehogGli pathway activation during kidney fibrosis. Am J Pathol 2012;180:1441–53. [15] Thayer SP, di Magliano MP, Heiser PW, Nielsen CM, Roberts DJ, Lauwers GY, et al. Hedgehog is an early and late mediator of pancreatic cancer tumorigenesis. Nature 2003;425:851–6. [16] Yoo YA, Kang MH, Lee HJ, Kim BH, Park JK, Kim HK, et al. Sonic hedgehog pathway promotes metastasis and lymphangiogenesis via activation of Akt, EMT, and MMP-9 pathway in gastric cancer. Cancer Res 2011;71:7061–70. [17] Pasca di Magliano M, Hebrok M. Hedgehog signalling in cancer formation and maintenance. Nat Rev Cancer 2003;3:903–11. [18] Syn WK, Jung Y, Omenetti A, Abdelmalek M, Guy CD, Yang L, et al. Hedgehogmediated epithelial-to-mesenchymal transition and fibrogenic repair in nonalcoholic fatty liver disease. Gastroenterology 2009;137:1478–88. e8. [19] Wu JM, Wang ZR, Hsieh TC, Bruder JL, Zou JG, Huang YZ. Mechanism of cardioprotection by resveratrol, a phenolic antioxidant present in red wine (Review). Int J Mol Med 2001;8:3–17. [20] Fonseca-Kelly Z, Nassrallah M, Uribe J, Khan RS, Dine K, Dutt M, et al. Resveratrol neuroprotection in a chronic mouse model of multiple sclerosis. Front Neurol 2012;3:84.
[21] Dominguez B, Pardo BG, Noia M, Millan A, Gomez-Tato A, Martinez P, et al. Microarray analysis of the inflammatory and immune responses in head kidney turbot leucocytes treated with resveratrol. Int Immunopharmacol 2013;15:588–96. [22] Ding XZ, Adrian TE. Resveratrol inhibits proliferation and induces apoptosis in human pancreatic cancer cells. Pancreas 2002;25:e71–6. [23] Slusarz A, Shenouda NS, Sakla MS, Drenkhahn SK, Narula AS, MacDonald RS, et al. Common botanical compounds inhibit the hedgehog signaling pathway in prostate cancer. Cancer Res 2010;70:3382–90. [24] Bai Y, Lu H, Zhang G, Wu C, Lin C, Liang Y, et al. Sedum sarmentosum Bunge extract exerts renal anti-fibrotic effects in vivo and in vitro. Life Sci 2014;105:22–30. [25] Lin SL, Chen RH, Chen YM, Chiang WC, Lai CF, Wu KD, et al. Pentoxifylline attenuates tubulointerstitial fibrosis by blocking Smad3/4-activated transcription and profibrogenic effects of connective tissue growth factor. J Am Soc Nephrol 2005;16:2702–13. [26] Yang HC, Rossini M, Ma LJ, Zuo Y, Ma J, Fogo AB. Cells derived from young bone marrow alleviate renal aging. J Am Soc Nephrol 2011;22:2028–36. [27] Pozzi A, Zent R. ZO-1 and ZONAB interact to regulate proximal tubular cell differentiation. J Am Soc Nephrol 2010;21:388–90. [28] Martins VL, Caley M, O’Toole EA. Matrix metalloproteinases and epidermal wound repair. Cell Tissue Res 2012;351:255–68. [29] Ban CR, Twigg SM. Fibrosis in diabetes complications: pathogenic mechanisms and circulating and urinary markers. Vasc Health Risk Manag 2008;4:575–96. [30] Bai Y, Lu H, Hu L, Hong D, Ding L, Chen B. Effect of Sedum sarmentosum BUNGE extract on aristolochic acid-induced renal tubular epithelial cell injury. J Pharmacol Sci 2014;124:445–56. [31] Gill PS, Rosenblum ND. Control of murine kidney development by sonic hedgehog and its GLI effectors. Cell Cycle 2006;5:1426–30. [32] Katoh Y, Katoh M. Hedgehog signaling pathway and gastric cancer. Cancer Biol Ther 2005;4:1050–4. [33] Cutcliffe C, Kersey D, Huang CC, Zeng Y, Walterhouse D, Perlman EJ. Clear cell sarcoma of the kidney: up-regulation of neural markers with activation of the sonic hedgehog and Akt pathways. Clin Cancer Res 2005;11:7986–94. [34] Yang L, Besschetnova TY, Brooks CR, Shah JV, Bonventre JV. Epithelial cell cycle arrest in G2/M mediates kidney fibrosis after injury. Nat Med 2010;16:535– 43. 1p following 143. [35] Yu J, Carroll TJ, McMahon AP. Sonic hedgehog regulates proliferation and differentiation of mesenchymal cells in the mouse metanephric kidney. Development 2002;129:5301–12. [36] Thiery JP. Epithelial-mesenchymal transitions in development and pathologies. Curr Opin Cell Biol 2003;15:740–6. [37] Rowe RG, Li XY, Hu Y, Saunders TL, Virtanen I, Garcia de Herreros A, et al. Mesenchymal cells reactivate Snail1 expression to drive three-dimensional invasion programs. J Cell Biol 2009;184:399–408. [38] Akgedik R, Akgedik S, Karamanli H, Uysal S, Bozkurt B, Ozol D, et al. Effect of resveratrol on treatment of bleomycin-induced pulmonary fibrosis in rats. Inflammation 2012;35:1732–41. [39] Di Pascoli M, Divi M, Rodriguez-Vilarrupla A, Rosado E, Gracia-Sancho J, Vilaseca M, et al. Resveratrol improves intrahepatic endothelial dysfunction and reduces hepatic fibrosis and portal pressure in cirrhotic rats. J Hepatol 2012;58:904–10.
Please cite this article in press as: Bai Y, et al. Resveratrol inhibits epithelial-mesenchymal transition and renal fibrosis by antagonizing the hedgehog signaling pathway. Biochem Pharmacol (2014), http://dx.doi.org/10.1016/j.bcp.2014.09.002
BCP-12087; No. of Pages 10 Biochemical Pharmacology xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
Biochemical Pharmacology journal homepage: www.elsevier.com/locate/biochempharm
Resveratrol inhibits epithelial-mesenchymal transition and renal fibrosis by antagonizing the hedgehog signaling pathway Yongheng Bai a, Hong Lu b, Cunzao Wu c, Yong Liang a, Silu Wang a, Chengcheng Lin a, Bicheng Chen a, Peng Xia c,* a b c
Wenzhou Key Laboratory of Surgery, The First Affiliated Hospital of Wenzhou Medical University, Wenzhou, China Department of Laboratory Medicine, The First Affiliated Hospital of Wenzhou Medical University, Wenzhou, China Department of Transplantation, The First Affiliated Hospital of Wenzhou Medical University, Wenzhou, China
A R T I C L E I N F O
A B S T R A C T
Article history: Received 3 July 2014 Accepted 2 September 2014 Available online xxx
Epithelial-to-mesenchymal transition (EMT), a biologic process in which tubular cells lose their epithelial phenotypes and acquire new characteristic features of mesenchymal properties, is increasingly recognized as an integral part of renal tissue fibrogenesis. Recent studies indicate that resveratrol, a botanical compound derived mainly from the skins of red grapes, may have anti-fibrotic effects in many tissues, but the potential molecular mechanism remains unknown. In the present study, we identified that resveratrol inhibits the induction of EMT and deposition of extracellular matrix (ECM) through antagonizing the hedgehog pathway in vitro and in vivo. In rats with unilateral ureteral obstruction (UUO), administration of resveratrol (20 mg/kg/day) significantly reduced serum creatinine. Resveratrol also decreased expression of TGF-b1, and inhibited the phenotypic transition from epithelial cells to mesenchymal cells, and the deposition of ECM in UUO rats. In cultured renal tubular epithelial cells (NRK-52E), TGF-b1-induced EMT and ECM synthesis was abolished with the treatment of resveratrol. The induction of EMT was associated with the activation of the hedgehog pathway. Resveratrol treatment markedly inhibited the over-activity of the hedgehog pathway in the obstructed kidney and in TGF-b1-treated NRK-52E cells, resulted in reduction of cellular proliferation, EMT and ECM accumulation. Thus, these results suggest that resveratrol is able to inhibit EMT and fibrosis in vivo and in vitro through antagonizing the hedgehog pathway, and resveratrol may have therapeutic potential for patients with fibrotic kidney diseases. ß 2014 Elsevier Inc. All rights reserved.
Keywords: Resveratrol Epithelial-to-mesenchymal transition (EMT) Renal fibrosis Hedgehog signaling pathway
1. Introduction Renal tubulointerstitial fibrosis is the common pathway for all kinds of progressive chronic kidney diseases to end-stage renal failure [1,2]. Pathologically, tubulointerstitial fibrosis is a process that characterized by extracellular matrix (ECM) deposition in association with inflammatory cells infiltration, tubular epithelial cells loss and fibroblast accumulation [3]. In fibrogenesis, epithelial-to-mesenchymal transition (EMT) is increasingly recognized as an integral part of renal fibrogenesis [4]. EMT is a biologic process in which tubular cells lose their epithelial phenotypes such
* Corresponding author at: Department of Transplantation, The First Affiliated Hospital of Wenzhou Medical University, 2# Fuxue Lane, Wenzhou 325000, China. Tel.: +86 577 88069338; fax: +86 577 55578999-660061. E-mail addresses: [email protected], [email protected] (P. Xia).
as E-cadherin and tight junction protein 1 (Tjp1), and acquire new characteristic features of mesenchymal properties such as asmooth muscle actin (a-SMA) and vimentin [5–7]. The major driving force behind EMT during the fibrogenic phase of fibrosis appears to be various profibrotic growth factors, including transforming growth factor b1 (TGF-b1) [8,9] and connective tissue growth factor (CTGF) [10]. In kidney, TGF-b1-induced EMT can be reversed by bone morphogenic protein 7 (BMP-7) [11], thereby leading to reduction of fibroblast proliferation and collagen synthesis. Regulation of EMT may be a potential target to prevent progressive renal tubulointerstitial fibrosis. Recently, several studies showed that the hedgehog signaling was involved in EMT and tissue fibrogenesis [12–14]. Aberrant activation of hedgehog signaling pathway results in pathological consequences, including a variety of human tumors, such as pancreatic cancer [15], gastric cancer [16] and basal cell carcinoma [17]. In addition to these, activated hedgehog signaling has been
http://dx.doi.org/10.1016/j.bcp.2014.09.002 0006-2952/ß 2014 Elsevier Inc. All rights reserved.
Please cite this article in press as: Bai Y, et al. Resveratrol inhibits epithelial-mesenchymal transition and renal fibrosis by antagonizing the hedgehog signaling pathway. Biochem Pharmacol (2014), http://dx.doi.org/10.1016/j.bcp.2014.09.002
G Model
BCP-12087; No. of Pages 10 2
Y. Bai et al. / Biochemical Pharmacology xxx (2014) xxx–xxx
demonstrated to have profibrogenic effects [18]. In hepatic fibrosis, activation of the hedgehog pathway is triggered through binding of the ligands, including sonic hedgehog (Shh), to its membrane receptor patched 1 (Ptch1). The binding of ligand to Ptch1 relieves a signal transducer Smoothened (Smo), and activates a cascade that leads to translocation of the transcription factor Gli1 to the nucleus. As a result, activated hedgehog signaling promotes fibrogenesis [18]. In kidney, over-activity of hedgehog signaling not only promotes tissue regeneration, but also induces TGF-b1 expression [14]. Thus, screening the high effective pharmaceutical agents to inhibit the activation of hedgehog signaling provides a large opportunity for the development of anti-fibrotic drugs. Resveratrol, a botanical compound derived mainly from the skins of red grapes, has been widely used in traditional medicine and dietary supplements. A series of reports highlighted its benefits in cardioprotection [19], neuroprotection [20], and immune regulation [21]. Recent study has shown that resveratrol inhibited cellular proliferation and induced apoptosis through the hedgehog signaling pathway in pancreatic cancer cells [22] and prostate cancer cells [23]. Take into account these, we hypothesized that resveratrol may have an anti-fibrotic effect through antagonizing the hedgehog signaling pathway. In the present study, we investigated the anti-fibrotic effects of resveratrol on kidney tissues of rats with unilateral ureteral obstruction (UUO) and TGF-b1-treated renal tubular epithelial cells (NRK-52E). Furthermore, the phenotypic transition from epithelial cells to mesenchymal cells, ECM deposition and the activity of hedgehog signaling were also evaluated. Our findings indicate that resveratrol is able to inhibit tubular EMT and renal fibrosis in vivo and in vitro through suppressing the hedgehog pathway, and resveratrol exerts therapeutic potential for patients with fibrotic kidney diseases.
system (Leica Microsystems, Wetzlar, Germany) and a DFC 420C 5M digital microscope camera (Leica Microsystems). Tubulointerstitial damage and the degree of interstitial collagen deposition were graded as described previously [25]. 2.3. Immunohistochemical analysis Immunohistochemical analysis was performed with 4-mmthick kidney sections that had been dewaxed with xylene and hydrated using sequential ethanol (100, 95, 85, and 75%) and distilled water. Endogenous peroxidase was blocked with 3% hydrogen peroxide. Antigen retrieval was performed by heating sections in 0.1% sodium citrate buffer (pH 6.0). For hedgehog signaling pathway, anti-Shh (1:100, Biogot Technology, Shanghai, China), anti-Ptch1 (1:200, Santa Cruz Biotechnology, Santa Cruz, CA, USA), anti-Smo (1:100, Santa Cruz), and anti-Gli1 (1:100, Biogot) antibody were used. For EMT, anti-a-SMA (1:100, Santa Cruz), anti-type III collagen (1:100, Biogot) and anti-E-cadherin (1:100, Abcam, Cambridge, MA, USA) antibody were used. In addition, PCNA (1:200, Santa Cruz) expression was also determined by using immunochemical streptavidin-perosidase method. All samples were semi-quantitatively or quantitatively assessed by two independent investigators in a blinded manner. 2.4. Enzyme-linked immunoabsorbent assay (ELISA) Rat kidney tissues (100 mg) were homogenized and centrifuged and the supernatant was collected. Avidin-biotin complex-ELISA was used according to the manufacturer’s protocol to determine TGF-b1 and Shh levels. ELISA kits were purchased from Xitang Biotechnology (Shanghai, China). All experiments were repeated at least three times.
2. Materials and methods 2.5. Cell culture and treatment 2.1. Animal model and tissue preparation Forty-two male Sprague-Dawley rats weighing 180–200 g and 6–8 weeks old were purchased from the Experimental Animal Center of Wenzhou Medical University (Wenzhou, China). Rats were housed in a temperature-, humidity- and light-controlled environment, and fed a standard rat chow and water. Rats were fasted on the day prior to experiments being conducted. Weightmatched rats were randomly assigned to three groups: (1) a sham operation group (n = 6); (2) a vehicle group (n = 18, UUO rats treated with normal saline); and (3) resveratrol group (n = 18, UUO rats treated with resveratrol). UUO surgery was performed as previously described [24], and after 2 h postoperatively, UUO rats received daily intragastric administration consecutively for 7 or 14 days with either normal saline or resveratrol (20 mg/kg/d, lot No. 20120330, Yuanye Biotechnology, Shanghai, China). The kidneys were excised on days 7 and 14 after UUO surgery, and serum samples were collected to examine the levels of creatinine and blood urea nitrogen using an AU5800 automatic biochemistry analyzers (Beckman Coulter Inc., Kraemer Boulevard Brea, CA, USA). The animal study protocols were approved by the Institutional Animal Care and Use Committee of Wenzhou Medical University, China. 2.2. Histopathological examination Kidney specimens fixed in formalin and embedded in paraffin were cut into 4-mm sections and stained with Hematoxylin and eosin (HE, Yuanye) and Masson’s trichrome (Yuanye). Slides were examined and pictures taken using a DM4000 B LED microscope
The rat renal tubular epithelial cell line (NRK-52E) was purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). NRK-52E cells were maintained in Dulbecco’s Modified Eagle Medium (Invitrogen, CA, USA) supplemented with 5% fetal bovine serum (FBS, Invitrogen), 100 U/ml penicillin and 100 mg/ml streptomycin (Invitrogen). The NRK-52E cells were seeded in the complete medium containing 5% FBS at approximately 70% confluence in six-well culture plates. After 24 h, the complete medium was replaced with serum-free medium for 24 h before treatment with recombinant TGF-b1 (Lot No. 0312209-1, PeproTech, RockyHill, NJ, USA) or resveratrol (10, 100 mmol/ml). 2.6. Immunocytochemical staining NRK-52E cells were cultured with TGF-b1 with or without resveratrol in the six-well plates containing glass slides and were then washed with PBS and fixed with 4% paraformaldehyde (Sigma–Aldrich, St. Louis, MO, USA) at 4 8C for 30 min. After permeabilization with 0.1% Triton X-100 for 10 min, the specimens were washed with PBS and then blocked with 10% FBS to eliminate the nonspecific fluorescence. Immunofluorescence staining was performed using anti-type III collagen (1:100), aSMA (1:200), E-cadherin (1:200), Ptch1 (1:200), Smo (1:200), Gli1 (1:100), and PCNA (1:200) as the primary antibody, and the cell preparations were incubated with DyLight 488/594 labeled secondary antibodies (Beyotime Biotechnology, Jiangsu, China). The immunocytochemical samples were semiquantitatively or quantitatively assessed by two independent investigators in a blinded manner.
Please cite this article in press as: Bai Y, et al. Resveratrol inhibits epithelial-mesenchymal transition and renal fibrosis by antagonizing the hedgehog signaling pathway. Biochem Pharmacol (2014), http://dx.doi.org/10.1016/j.bcp.2014.09.002
G Model
BCP-12087; No. of Pages 10 Y. Bai et al. / Biochemical Pharmacology xxx (2014) xxx–xxx
2.7. Reverse transcription-polymerase chain reaction (RT-PCR) Total RNA was extracted from rat kidneys and NRK-52E cells using TRIzol reagent (Invitrogen), reverse-transcribed to cDNA templates using a ReverTra Ace qPCR RT kit (Toyobo, Japan). Quantitative RT-PCR was performed using a SYBR Green Realtime PCR Master Mix -Plus- (Toyobo, Japan). Quality was analyzed on agarose gels, and quantities were measured using a Varioskan Flash (Thermo Fisher Scientific, USA). The sequence-specific primers for Shh, Ptch1, Smo, Gli1, Col1a1, Col3a1, Tjp1, TGFb1R, MMP-2, TIMP-2, fibronection, S100A4, and a-SMA, all listed in Table 1, were synthesized by Invitrogen, and b-actin was used as an endogenous reference gene. Samples were analyzed in triplicate using an Applied Biosystems 7500 Real-Time PCR System (Life Technologies, Foster City, CA, USA). The melting curve was examined to verify that a single product was amplified. For quantitative analysis, all samples were analyzed using the DDCT value method. 2.8. Statistical analysis Data is presented as mean standard error of the mean. All statistical analyses were performed using a Statistical Package for Social Sciences (version 16.0, SPSS Inc., Chicago, USA). A two-sided Student’s t-test was used to analyze differences between the two groups. One-way analysis of variance was used when more than two groups were present. A p-value of <0.05 was considered statistically significant. 3. Results 3.1. Effect of resveratrol on renal dysfunction of UUO rats Table 2 shows the changes in the functional parameters in the experimental groups as a result of resveratrol treatment for two weeks. Although there is no significant difference in the levels of blood urea nitrogen between the vehicle-treated group and the sham-operation group, the levels of serum creatinine are significant higher in UUO group than the sham group. With the treatment of resveratrol, the levels of blood urea nitrogen in whole blood did not show a marked decline, but resveratrol administration decreased significantly the levels of serum creatinine. Thus, resveratrol at this dose exerts protective effects to some extent on renal function. 3.2. Effect of resveratrol on interstitial fibrosis in kidney tissues of UUO rats Rodent UUO is a well-characterized experimental model resulting in renal interstitial fibrosis [24]. As shown in Fig. 1A
3
Table 2 Levels of serum creatinine and blood urea nitrogen in each group. Group
Serum creatinine
Blood urea nitrogen
7d
14 d
7d
14 d
Sham UUO Resveratrol
37.3 7.8 51.4 9.9* 42.6 5.8**
42.3 10.1 55.1 11.3* 44.5 6.7**
7.47 1.9 6.89 1.4 8.41 2.6
7.11 1.2 7.51 2.1 7.05 1.3
n = 6, mean standard deviations. * P < 0.05 versus sham group. ** P < 0.05 versus UUO group.
and C, histologic examination with HE staining revealed obvious diffuse congestion and edema, and focal hemorrhaging had occurred in the renal interstitium of 7-day obstructed kidneys, simultaneously accompanied by inflammatory cell infiltration, epithelial cell necrosis and marked tubular dilation. With the treatment of resveratrol, the damage to the renal interstitium, which included inflammatory cell infiltration, tubular dilation and atrophy, was alleviated, especially at day 14. To assess the degree of interstitial fibrosis, the deposition of total collagen was determined by Masson’s trichrome staining. We found that collagen accumulation in kidney tissues increased significantly as obstruction time progressed (Fig. 1B and C). At day 14 after obstruction surgery, the fibrosis was more severe. The deposition of total collagen in the renal interstitium was reduced by resveratrol treatment, especially at day 14 after UUO operation. These results indicated that resveratrol ameliorated ureteral obstruction-induced interstitial fibrosis and this anti-fibrotic effect is positively associated with the action time of the drug. Effect of resveratrol on ECM deposition, EMT, and TGF-b1 expression in UUO kidneys Myofibroblasts are the predominant type of interstitial cells in the fibrotic kidney and the major source of ECM components such as type I and III collagens during renal fibrosis [1]. Emerging evidence shows that the EMT process may be involved in the production of myofibroblasts [4]. In the present study, as shown in Fig. 2A, resveratrol administration decreased expression levels of mesenchymal markers a-SMA and type III collagen in UUO rats, and increased the level of epithelial marker E-cadherin. In addition, resveratrol also induced the down-regulation in mRNA expression of a-SMA, S100A4, and Col3a1 (encoding type III collagen), and the up-regulation in mRNA expression of Tjp1 (Fig. 2B). S100A4 (also known as Mts1 and FSP1) is a specific fibroblast protein, and may function in motility, invasion, and tubulin polymerization [26]. Tjp1 is a scaffolding protein of the membrane-associated guanylate kinase family associated with tight junctions [27]. Thus, these findings demonstrated that resveratrol exerts anti-fibrotic effect through suppressing the phenotypic transition from
Table 1 Two-step real-time RT-PCR primers for analysis. Gene
Forward sequence (50 ! 30 )
Reverse sequence (50 ! 30 )
Product size (bp)
Shh Gli1 Ptch1 Smo Col1a1 Col3a1 TGF-b1R a-SMA Fibronection Tjp1 S100A4 MMP-2 TIMP-2 b-actin
ACAAGAAACTCCGAACGATT CCTCGTGGCTTTCATCAACTCT TCCAGCCGACCCAGATTG TGTGGCTCAGGTAGATGG GATCCTGCCGATGTCGCTAT AAGGCTGAAGGAAATAGC TGATCCATCCGTTGAAGAAA GGCATCCACGAAACCACCT ACACGGTTTCCCATTACG AACAGAGCCGAGCAGTTAGCC ATACTCAGGCAACGAGGGTG CGGTTTATTTGGCGGACAG GTGAGCGAGAAGGAGGTGGAT CCCATCTATGAGGGTTACGC
ACAAGAAACTCCGAACGATT(R) GAAGCATCATTGAACCCTGAGTAGA ACATAGTCGTAGCCCCTGAAGTG GGTGGTTGCTCTTGATGG GGAGGTCTTGGTGGTTTTGTATTC AATGTCATAGGGTGCGATA CTAGCTGCTCCATTGGCATA CCGCCGATCCAGACAGAAT TTTCCATTCCCGAGACAT CAACATCAGCAATCGGTCCA CTTCCGGGGCTCCTTATC TGGTCAGTGGCTTGGGGTAT CTGGGTGATGCTAAGCGTGTC TTTAATGTCACGCACGATTTC
183 185 252 170 276 147 144 212 220 238 247 202 273 150
Please cite this article in press as: Bai Y, et al. Resveratrol inhibits epithelial-mesenchymal transition and renal fibrosis by antagonizing the hedgehog signaling pathway. Biochem Pharmacol (2014), http://dx.doi.org/10.1016/j.bcp.2014.09.002
G Model
BCP-12087; No. of Pages 10 4
Y. Bai et al. / Biochemical Pharmacology xxx (2014) xxx–xxx
Fig. 1. Resveratrol alleviates interstitial fibrosis in the kidney tissues of UUO rats. (A) Renal tubular injury was assessed by HE staining. (B) The deposition of total fibrosis in kidney tissues of UUO rats was determined by Masson’s trichrome staining. Blue (aniline blue) represents collagen fibers; red (acid fuchsin) represents muscle fibers. Bar = 200 mm. (C) Tubulointerstitial damage and the degree of interstitial collagen deposition were assessed semiquantitatively as described in Section 2. *P < 0.05, ** P < 0.01 versus the sham group; #P < 0.05, ##P < 0.01 versus the UUO group.
epithelial cells to mesenchymal cells and ECM accumulation in kidney tissues of UUO rats. Furthermore, interestingly, we found that the effect of resveratrol on EMT and ECM deposition shows time-dependent manner. The changes in expression of EMTrelated genes and proteins in 7-day UUO rats were more significant than that in 14-day UUO rats. Contrarily, the changes in expression of ECM-related molecules were more significant in 14-day UUO rats than that in 14-day UUO rats. These results suggested that the effect of resveratrol on EMT is occurred before ECM deposition. In fibrotic kidney, the induction of EMT and ECM deposition may be triggered by enhanced TGF-b1 expression [9]. In this study, evidence from ELISA showed that the levels of TGF-b1 were increased in kidney tissues of UUO rats in a time-dependent manner (Fig. 2C). With the treatment of resveratrol, enhanced TGFb1 levels were inhibited in 14-day UUO rats, though the difference is not significant in 7-day UUO rats.
3.3. Effect of resveratrol on hedgehog signaling in UUO kidneys In UUO rats, various damage factors including microenvironment pressure and hypoxia induce apoptosis and necrosis of tubular epithelial cells, accompanied by excessive proliferation of mesenchymal cells [7,8]. In this study, we found that ureteral obstruction operation increased the expression levels of PCNA, an auxiliary protein of DNA polymerase delta that is involved in cellular proliferation. Compared with that in sham-operation rats, the ratio of PCNA-positive cells/total cells was significantly increased in UUO rats (P < 0.05, Fig. 3), especially in 7-day UUO rats. Interestingly, PCNA is mainly expressed around renal tubules. We hypothesized that this expression feature may be associated with aberrant proliferation of epithelial cells. Thus, we investigated the activity of hedgehog signaling, a proliferation-relevant signaling pathway, in UUO rats. As shown in Fig. 4, the mRNA and
Please cite this article in press as: Bai Y, et al. Resveratrol inhibits epithelial-mesenchymal transition and renal fibrosis by antagonizing the hedgehog signaling pathway. Biochem Pharmacol (2014), http://dx.doi.org/10.1016/j.bcp.2014.09.002
G Model
BCP-12087; No. of Pages 10 Y. Bai et al. / Biochemical Pharmacology xxx (2014) xxx–xxx
5
Fig. 2. Resveratrol inhibits EMT and ECM accumulation in UUO rats. (A) Resveratrol increased the expression of E-cadherin and decreased the expression of a-SMA and type III collagen in kidney tissues of 7-day UUO rats compared with the vehicle groups, as determined by immunohistochemical staining. Bar = 100 mm. (B) Quantitative RT-PCR showed that mRNA expression levels of a-SMA, S100A4, and Col3a1 was increased in UUO rats, but decreased after resveratrol treatment. On the contrary, down-regulated mRNA expression levels of Tjp1 in UUO rats were up-regulated in resveratrol-treated rats. (C) The levels of TGF-b1 determined by ELISA in UUO rats were enhanced, but inhibited by resveratrol. *P < 0.05, **P < 0.01 versus the sham; #P < 0.05 versus the UUO group.
protein expression levels of Shh, Smo and Gli1 were significantly increased in 7-day UUO rats, and the expression of Ptch1 was decreased, suggesting that the hedgehog signaling was activated in kidney tissues after UUO. Further study showed that, as well as PCNA, these hedgehog signaling-related molecules were mainly expressed around renal tubules. These findings indicated that activation of hedgehog signaling may be an important factor triggering epithelial cell proliferation in a feedback way. Activated hedgehog signaling is also involved in tubular EMT, resulted in excessive accumulation of myofibroblasts and ECM components. In UUO rats, the hedgehog signaling-related proliferative activity can be inhibited by resveratrol administration. Resveratrol not only down-regulated the ratio of PCNA-positive cells/total cells, but also inhibited the activation of hedgehog signaling. However, these effects of resveratrol did not show time-dependent behavior. We hypothesized that it may be associated with the degree of hedgehog signaling activation. The activity of hedgehog signaling peaks at 7 days after obstruction operation, and this pattern may regulate the effect of resveratrol on epithelial cell proliferation and tubular EMT.
the induction of EMT, and reducing the deposition of ECM components, it should be confirmed again in vitro experiments. Thus, first, we investigated the effects of resveratrol on EMT and ECM deposition in TGF-b1-treated rat renal tubular epithelial cells (NRK-52E). As shown in Fig. 5A, TGF-b1 enhanced the protein expression of a-SMA and type III collagen, and down-regulated expression of E-cadherin. In addition, TGF-b1 increased the mRNA expression of its receptor TGF-b1R, resulted in up-regulated mRNA expression of fibronection, S100A4 and Col1a1 (Fig. 5B). Moreover, TGF-b1 decreased MMP-2 expression and increased TIMP-2 expression, suggesting that down-regulated expression ratio of MMP-2/TIMP-2. These changes in TGF-b1-treated NRK-52E cells were inhibited or even reversed by resveratrol treatment. The inhibition of resveratrol showed a concentration-dependent manner, and the higher concentration (100 mmol/ml) had stronger inhibitive action to EMT and ECM deposition. Also, resveratrol relieved the expression ratio of MMP-2/TIMP-2.
3.4. Effect of resveratrol on EMT, ECM deposition in TGF-b1-treated NRK-52E cells
To clarify the effect of resveratrol on hedgehog signaling, we detected the mRNA and protein expression of Shh, Ptch1, Smo, and Gli1, indicated by quantitative RT-PCR and immunofluorescence staining, respectively. In TGF-b1-treated NRK-52E cells, resveratrol inhibited PCNA expression (Fig. 6), and this inhibition may be associated with enhanced protein expression of Smo and Gli1 and
Despite our in vivo experiments demonstrated that resveratrol exerts renal anti-fibrotic effects through inhibiting the overactivity of hedgehog signaling and cellular proliferation, abolishing
3.5. Effect of resveratrol on hedgehog signaling in TGF-b1-treated NRK-52E cells
Please cite this article in press as: Bai Y, et al. Resveratrol inhibits epithelial-mesenchymal transition and renal fibrosis by antagonizing the hedgehog signaling pathway. Biochem Pharmacol (2014), http://dx.doi.org/10.1016/j.bcp.2014.09.002
G Model
BCP-12087; No. of Pages 10 6
Y. Bai et al. / Biochemical Pharmacology xxx (2014) xxx–xxx
Fig. 3. Resveratrol inhibits the expression of PCNA in UUO rats. (A) The expression of PCNA was determined by immunohistochemical staining. Bar = 50 mm. (B) The ratio of PCNA-positive cells/total cells determined according to Fig. 3A in UUO rats was increased, but decreased by resveratrol treatment. *P < 0.05 versus the sham group; #P < 0.05, ## P < 0.01 versus the UUO group.
Fig. 4. Resveratrol inhibited over-activity of hedgehog signaling in UUO rats. (A) The location and expression of Shh, Ptch1, Smo, and Gli1 were determined by immunohistochemical staining. Bar = 100 mm. Our results showed that the expression of Shh, Smo and Gli1 in 7-day UUO rats was increased, but decreased after resveratrol treatment. However, down-regulated expression of Ptch1 in 7-day UUO rats was up-regulated by resveratrol. (B) The levels of Shh indicated by ELISA in UUO rats were increased, but decreased by resveratrol treatment. (C) Quantitative RT-PCR showed that changes in gene expression of Ptch1, Smo and Gli1 are in accordance with changes in protein expression. *P < 0.05, **P < 0.01 versus the sham group; #P < 0.05, ##P < 0.01 versus the UUO group.
Please cite this article in press as: Bai Y, et al. Resveratrol inhibits epithelial-mesenchymal transition and renal fibrosis by antagonizing the hedgehog signaling pathway. Biochem Pharmacol (2014), http://dx.doi.org/10.1016/j.bcp.2014.09.002
G Model
BCP-12087; No. of Pages 10 Y. Bai et al. / Biochemical Pharmacology xxx (2014) xxx–xxx
7
Fig. 5. Resveratrol inhibits EMT and ECM accumulation in TGF-b1-treated NRK-52E cells. (A) Immunofluorescence staining indicated up-regulated expression of a-SMA and type III collagen and down-regulated expression of E-cadherin in NRK-52E cells after TGF-b1 treatment. The TGF-b1-mediated induction was abolished by resveratrol. Bar = 100 mm. (B) Resveratrol decreased TGF-b1-induced over-expression of TGF-b1R, TIMP-2, fibronection, S100A4, and Col3a1 mRNA, and increased TGF-b1-induced lowexpression of MMP-2 mRNA in NRK-52E cells, detected by quantitative RT-PCR. Res10, 10 mmol/ml resveratrol; Res100, 100 mmol/ml resveratrol; *P < 0.05, **P < 0.01 versus the control; #P < 0.05, ##P < 0.01 versus the TGF-b1 group.
decreased expression of Ptch1 (Fig. 7A). Furthermore, resveratrol also inhibited up-regulated mRNA expression of Shh and Gli1 and down-regulated mRNA expression of Ptch1 (Fig. 7B). Based on these results, it is suggested that TGF-b1-induced over-activity of hedgehog signaling in NRK-52E cells is inhibited by resveratrol. 4. Discussion In the present study, we investigated the effect of resveratrol on renal tubulointerstitial fibrosis using an experimental rat model and a cell culture system. In UUO rats, resveratrol exerts its
protective effects by reducing the levels of serum creatinine, inflammatory cell infiltration and the degree of interstitial fibrosis. In addition, resveratrol-induced inhibition of ECM components deposition is associated with the abolishment or reversion of EMT. Our further study showed that the induction of EMT is triggered by the activation of hedgehog signaling, which can be inhibited by resveratrol treatment. Our results provide a rational for the use of resveratrol as a potential supplemental treatment to attenuate renal tubulointerstitial fibrosis. The pathological characteristics of renal interstitial fibrosis are extensive ECM deposition in the cortical interstitium [7]. Altering
Please cite this article in press as: Bai Y, et al. Resveratrol inhibits epithelial-mesenchymal transition and renal fibrosis by antagonizing the hedgehog signaling pathway. Biochem Pharmacol (2014), http://dx.doi.org/10.1016/j.bcp.2014.09.002
G Model
BCP-12087; No. of Pages 10 8
Y. Bai et al. / Biochemical Pharmacology xxx (2014) xxx–xxx
Fig. 6. Expression of PCNA in NRK-52E cells with TGF-b1 with or without resveratrol. (A) Immunofluorescence staining indicated that TGF-b1-mediated up-regulated expression of PCNA in NRK-52E cells was inhibited by resveratrol treatment. Bar = 50 mm. (B) The ratio of PCNA-positive cells/total cells determined according to Fig. 6A in TGF-b1-treated NRK-52E cells were increased, but decreased by resveratrol treatment. #P < 0.05 versus the TGF-b1 group.
the balance of degradation and production of ECM components may be an important factor triggering fibrogenesis [28]. In TGF-b1treated renal tubular epithelial cells, resveratrol inhibited downregulated expression ratio of MMP-2/TIMP-2. MMP-2, which is regulated by TIMP-2, is a member of the matrix metalloproteinase family that is involved in the breakdown of ECM in normal physiological processes, such as embryonic development and tissue remodeling [29]. The enhanced ratio of MMP-2/TIMP-2 induced by resveratrol indicated up-regulation of ECM degradation and down-regulation of ECM production, resulted in reduction of ECM components such as type I and III collagens. Myofibroblasts are terminally differentiated cells responsible for the synthesis and accumulation of interstitial ECM components [1]. In addition to tissue resident fibroblasts, myofibroblasts originate from tubular epithelial cells via EMT, which has been demonstrated to be induced by TGF-b1 [8,9]. In the obstructed kidney, resveratrol administration decreased TGF-b1 expression and inhibited the induction of EMT. In TGF-b1-treated tubular epithelial cells, resveratrol reduced TGF-b1R expression and relieved the EMT process. These findings provide strong support that resveratrol inhibits excessive deposition of ECM components is through suppressing TGF-b1 pathway and the induction of EMT. To epithelial cells, EMT may be a process of abnormal proliferation. Tubular cells lose their epithelial phenotypes and acquire mesenchymal characteristic features, which can make them possess more adaptability and competence in the microenvironment of injury [30]. However, these changes also come with bad denouement. For example, large amounts of ECM components are produced and deposited in the cortical interstitium that resulted in renal fibrosis [1]. In the process of proliferation, enhanced PCNA expression may be associated with activation of
proliferation-related signaling, such as hedgehog signaling. Previous studies showed that activated hedgehog signaling not only promotes kidney development (such as Pax2, Sall1) [31], but also results in up-regulated expression of c-Myc, Cyclin D1 and FOXA2, which are key regulators in cell cycle regulation [32,33]. Abnormal cell growth and differentiation may be one important reason for EMT [34]. Thus, we investigated the effects of resveratrol on cellular proliferation and activity of hedgehog signaling. Our results showed that hedgehog signaling is activated in the obstructed kidney and in TGF-b1-treated renal tubular epithelial cells. Research in recent years has suggested that the activity of hedgehog signaling is increased during the EMT process [12,13]. Fabian and his group confirmed that hedgehog signaling acts in a paracrine manner during kidney fibrosis [14], similar to its role during renal development [35]. Hedgehog signaling also promotes myofibroblast activation and tubular EMT by directly controlling the expression of a battery of fibrogenic genes, such as Gli1, Snail1, desmin, a-SMA, fibronectin, and type I collagen, leading to increased matrix deposition and scar formation [36,37]. Our results revealed that hedgehog signaling-related molecules and epithelial cell marker E-cadherin was co-expressed in the same areas of the fibrotic kidney (around renal tubules), and it implicated that over-activated hedgehog signaling is involved in the induction of EMT. In addition, during the EMT process induced by TGF-b1 in vitro, activated hedgehog signaling promotes the proliferation of epithelial cells. However, further study showed that the outcome of cellular proliferation does not increase cell number, but induces morphologic changes. Thus, hedgehog signaling may be essential to the induction of EMT and the formation of renal fibrosis. Our in vivo and in vitro experiment showed that the over-activity of hedgehog signaling can be
Please cite this article in press as: Bai Y, et al. Resveratrol inhibits epithelial-mesenchymal transition and renal fibrosis by antagonizing the hedgehog signaling pathway. Biochem Pharmacol (2014), http://dx.doi.org/10.1016/j.bcp.2014.09.002
G Model
BCP-12087; No. of Pages 10 Y. Bai et al. / Biochemical Pharmacology xxx (2014) xxx–xxx
9
Fig. 7. Resveratrol inhibited activation of hedgehog signaling in TGF-b1-treated NRK-52E cells. (A) TGF-b1-induced up-regulated expression of Smo and Gli1 by using immunofluorescence staining and down-regulated expression of Ptch1 was suppressed by resveratrol. (B) TGF-b1 increased gene expression of Shh and Gli1 and decreased gene expression of Ptch1 in NRK-52E cells, but was inhibited by resveratrol. *P < 0.05 versus the control; #P < 0.05 versus the TGF-b1 group.
down-regulated by resveratrol treatment. As a result, resveratrol reduced cellular proliferation and inhibited tubular EMT. As a novel modulator of hedgehog signaling, resveratrol exerts marked anti-cancer effects [22,23]. Recent studies revealed that resveratrol also has anti-fibrosis activity in many tissues, such as lung and liver [38,39]. However, the underlying molecular mechanism remains unknown. Our study provides molecular evidence that resveratrol ameliorates fibrosis by antagonizing the hedgehog signaling pathway. However, there exist obvious limitations that the hedgehog signaling pathway is not induced to be over-activated or lowactivated, and so it can not prove that hedgehog signaling is necessary for resveratrol to have therapeutic benefits. In addition, the dose/concentration of resveratrol used in this study needs clear. We found that resveratrol treatment at high concentrations (greater than 100 mmol/ml) could induce marked apoptosis and necrosis of tubular epithelial cells. Thus, it is very important for resveratrol to have an appropriate dose/concentration used in vivo. In conclusion, our findings suggested that resveratrol may be a potential therapeutics to prevent progressive renal tubulointerstitial fibrosis. The possible molecular mechanism is that resveratrol
suppresses the activation of the hedgehog signaling pathway, reduces TGF-b1 expression and abolishes the induction of EMT, resulted in excessive ECM components synthesis and deposition in the cortical interstitium. Conflict of interest None. Acknowledgements This study was sponsored by Zhejiang Extremely Key Subject of Surgery, and supported by the Wenzhou Municipal Science and Technology Plan Project (Grant Nos. Y20110028 and Y20130158). The project also supported by the Natural Science Foundation of Zhejiang province, China (Grant Nos. LQ12H05001 and LY12H05004). References [1] Meran S, Steadman R. Fibroblasts and myofibroblasts in renal fibrosis. Int J Exp Pathol 2011;92:158–67.
Please cite this article in press as: Bai Y, et al. Resveratrol inhibits epithelial-mesenchymal transition and renal fibrosis by antagonizing the hedgehog signaling pathway. Biochem Pharmacol (2014), http://dx.doi.org/10.1016/j.bcp.2014.09.002
G Model
BCP-12087; No. of Pages 10 10
Y. Bai et al. / Biochemical Pharmacology xxx (2014) xxx–xxx
[2] Vilayur E, Harris DC. Emerging therapies for chronic kidney disease: what is their role. Nat Rev Nephrol 2009;5:375–83. [3] Liu Y. Epithelial to mesenchymal transition in renal fibrogenesis: pathologic significance, molecular mechanism, and therapeutic intervention. J Am Soc Nephrol 2004;15:1–12. [4] Liu Y. New insights into epithelial-mesenchymal transition in kidney fibrosis. J Am Soc Nephrol 2009;21:212–22. [5] Alpers CE, Hudkins KL, Floege J, Johnson RJ. Human renal cortical interstitial cells with some features of smooth muscle cells participate in tubulointerstitial and crescentic glomerular injury. J Am Soc Nephrol 1994;5:201–9. [6] Bi WR, Xu GT, Lv LX, Yang CQ. The ratio of transforming growth factor-beta1/ bone morphogenetic protein-7 in the progression of the epithelial-mesenchymal transition contributes to rat liver fibrosis. Genet Mol Res 2014;13: 1005–14. [7] Kalluri R, Weinberg RA. The basics of epithelial-mesenchymal transition. J Clin Invest 2009;119:1420–8. [8] Yang J, Liu Y. Dissection of key events in tubular epithelial to myofibroblast transition and its implications in renal interstitial fibrosis. Am J Pathol 2001;159:1465–75. [9] Zavadil J, Bottinger EP. TGF-beta and epithelial-to-mesenchymal transitions. Oncogene 2005;24:5764–74. [10] Strutz F, Zeisberg M, Ziyadeh FN, Yang CQ, Kalluri R, Muller GA, et al. Role of basic fibroblast growth factor-2 in epithelial-mesenchymal transformation. Kidney Int 2002;61:1714–28. [11] Zeisberg M, Hanai J, Sugimoto H, Mammoto T, Charytan D, Strutz F, et al. BMP7 counteracts TGF-beta1-induced epithelial-to-mesenchymal transition and reverses chronic renal injury. Nat Med 2003;9:964–8. [12] Ding H, Zhou D, Hao S, Zhou L, He W, Nie J, et al. Sonic hedgehog signaling mediates epithelial-mesenchymal communication and promotes renal fibrosis. J Am Soc Nephrol 2012;23:801–13. [13] Omenetti A, Porrello A, Jung Y, Yang L, Popov Y, Choi SS, et al. Hedgehog signaling regulates epithelial-mesenchymal transition during biliary fibrosis in rodents and humans. J Clin Invest 2008;118:3331–42. [14] Fabian SL, Penchev RR, St-Jacques B, Rao AN, Sipila P, West KA, et al. HedgehogGli pathway activation during kidney fibrosis. Am J Pathol 2012;180:1441–53. [15] Thayer SP, di Magliano MP, Heiser PW, Nielsen CM, Roberts DJ, Lauwers GY, et al. Hedgehog is an early and late mediator of pancreatic cancer tumorigenesis. Nature 2003;425:851–6. [16] Yoo YA, Kang MH, Lee HJ, Kim BH, Park JK, Kim HK, et al. Sonic hedgehog pathway promotes metastasis and lymphangiogenesis via activation of Akt, EMT, and MMP-9 pathway in gastric cancer. Cancer Res 2011;71:7061–70. [17] Pasca di Magliano M, Hebrok M. Hedgehog signalling in cancer formation and maintenance. Nat Rev Cancer 2003;3:903–11. [18] Syn WK, Jung Y, Omenetti A, Abdelmalek M, Guy CD, Yang L, et al. Hedgehogmediated epithelial-to-mesenchymal transition and fibrogenic repair in nonalcoholic fatty liver disease. Gastroenterology 2009;137:1478–88. e8. [19] Wu JM, Wang ZR, Hsieh TC, Bruder JL, Zou JG, Huang YZ. Mechanism of cardioprotection by resveratrol, a phenolic antioxidant present in red wine (Review). Int J Mol Med 2001;8:3–17. [20] Fonseca-Kelly Z, Nassrallah M, Uribe J, Khan RS, Dine K, Dutt M, et al. Resveratrol neuroprotection in a chronic mouse model of multiple sclerosis. Front Neurol 2012;3:84.
[21] Dominguez B, Pardo BG, Noia M, Millan A, Gomez-Tato A, Martinez P, et al. Microarray analysis of the inflammatory and immune responses in head kidney turbot leucocytes treated with resveratrol. Int Immunopharmacol 2013;15:588–96. [22] Ding XZ, Adrian TE. Resveratrol inhibits proliferation and induces apoptosis in human pancreatic cancer cells. Pancreas 2002;25:e71–6. [23] Slusarz A, Shenouda NS, Sakla MS, Drenkhahn SK, Narula AS, MacDonald RS, et al. Common botanical compounds inhibit the hedgehog signaling pathway in prostate cancer. Cancer Res 2010;70:3382–90. [24] Bai Y, Lu H, Zhang G, Wu C, Lin C, Liang Y, et al. Sedum sarmentosum Bunge extract exerts renal anti-fibrotic effects in vivo and in vitro. Life Sci 2014;105:22–30. [25] Lin SL, Chen RH, Chen YM, Chiang WC, Lai CF, Wu KD, et al. Pentoxifylline attenuates tubulointerstitial fibrosis by blocking Smad3/4-activated transcription and profibrogenic effects of connective tissue growth factor. J Am Soc Nephrol 2005;16:2702–13. [26] Yang HC, Rossini M, Ma LJ, Zuo Y, Ma J, Fogo AB. Cells derived from young bone marrow alleviate renal aging. J Am Soc Nephrol 2011;22:2028–36. [27] Pozzi A, Zent R. ZO-1 and ZONAB interact to regulate proximal tubular cell differentiation. J Am Soc Nephrol 2010;21:388–90. [28] Martins VL, Caley M, O’Toole EA. Matrix metalloproteinases and epidermal wound repair. Cell Tissue Res 2012;351:255–68. [29] Ban CR, Twigg SM. Fibrosis in diabetes complications: pathogenic mechanisms and circulating and urinary markers. Vasc Health Risk Manag 2008;4:575–96. [30] Bai Y, Lu H, Hu L, Hong D, Ding L, Chen B. Effect of Sedum sarmentosum BUNGE extract on aristolochic acid-induced renal tubular epithelial cell injury. J Pharmacol Sci 2014;124:445–56. [31] Gill PS, Rosenblum ND. Control of murine kidney development by sonic hedgehog and its GLI effectors. Cell Cycle 2006;5:1426–30. [32] Katoh Y, Katoh M. Hedgehog signaling pathway and gastric cancer. Cancer Biol Ther 2005;4:1050–4. [33] Cutcliffe C, Kersey D, Huang CC, Zeng Y, Walterhouse D, Perlman EJ. Clear cell sarcoma of the kidney: up-regulation of neural markers with activation of the sonic hedgehog and Akt pathways. Clin Cancer Res 2005;11:7986–94. [34] Yang L, Besschetnova TY, Brooks CR, Shah JV, Bonventre JV. Epithelial cell cycle arrest in G2/M mediates kidney fibrosis after injury. Nat Med 2010;16:535– 43. 1p following 143. [35] Yu J, Carroll TJ, McMahon AP. Sonic hedgehog regulates proliferation and differentiation of mesenchymal cells in the mouse metanephric kidney. Development 2002;129:5301–12. [36] Thiery JP. Epithelial-mesenchymal transitions in development and pathologies. Curr Opin Cell Biol 2003;15:740–6. [37] Rowe RG, Li XY, Hu Y, Saunders TL, Virtanen I, Garcia de Herreros A, et al. Mesenchymal cells reactivate Snail1 expression to drive three-dimensional invasion programs. J Cell Biol 2009;184:399–408. [38] Akgedik R, Akgedik S, Karamanli H, Uysal S, Bozkurt B, Ozol D, et al. Effect of resveratrol on treatment of bleomycin-induced pulmonary fibrosis in rats. Inflammation 2012;35:1732–41. [39] Di Pascoli M, Divi M, Rodriguez-Vilarrupla A, Rosado E, Gracia-Sancho J, Vilaseca M, et al. Resveratrol improves intrahepatic endothelial dysfunction and reduces hepatic fibrosis and portal pressure in cirrhotic rats. J Hepatol 2012;58:904–10.
Please cite this article in press as: Bai Y, et al. Resveratrol inhibits epithelial-mesenchymal transition and renal fibrosis by antagonizing the hedgehog signaling pathway. Biochem Pharmacol (2014), http://dx.doi.org/10.1016/j.bcp.2014.09.002