- Email: [email protected]
Resveratrol inhibits Interleukin-6 induced invasion of human gastric cancer cells
Biomedicine & Pharmacotherapy 99 (2018) 766–773
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha
Resveratrol inhibits Interleukin-6 induced invasion of human gastric cancer cells Tingting Yanga,1, Jianmei Zhangb,1, Junting Zhoua, Meixiao Zhua, Li Wanga, Lianhe Yana, a b
T
⁎
Division of Chinese Medicine, The Sixth Affiliated Hospital of Wenzhou Medical College, People's Hospital of Lishui City, Lishui, Zhejiang, China Division of Gastroenterology, The Sixth Affiliated Hospital of Wenzhou Medical College, People's Hospital of Lishui City, Lishui, Zhejiang, China
A R T I C L E I N F O
A B S T R A C T
Keywords: Interleukin-6 Resveratrol Raf/MAPK Gastric cancer Metastasis
Previous studies show that migration and invasion are the primary causes of death in patients with gastric carcinoma. Increasing evidences have been shown Interleukin-6 could stimulate cancer cells invasion and be associated with cancer development. However, its role in gastric cancer has never been investigated. As an anticancer drug isolated from Chinese medicine, resveratrol was reported to inhibit cancer cells growth and induce apoptosis, but its roles in gastric cancer have not been well understood. In this study, we found that Interleukin-6 was upregulated in blood of gastric cancer patients by enzyme-linked immunosorbent assay. In gastric cancer cell line model, we found that non-cytotoxic concentration of resveratrol inhibited the Interleukin6 induced SGC7901 cell invasion and matrix metalloproteinases activation. Our studies showed that IL-6 induced SGC7901 cell invasion depends on the Raf/MAPK pathway activation, resveratrol could inhibit this pathway activation. We further showed that resveratrol inhibits the IL-6 induced metastasis by vein injection of luciferaselabeled cancer cells. In conclusion, these results indicate that Interleukin-6 promotes tumor growth and metastasis in gastric cancer, resveratrol has the potential to prevent the Interleukin-6 induced gastric cancer metastasis by blocking the Raf/MAPK signaling activation.
1. Introduction Gastric cancer is one of the most common malignancy cancers occurred in China even all around the world, causing approximately one million deaths per year [1]. The incidence of gastric cancer is decreasing in the last decade due to the early diagnose and effective therapy skills [2,3]. Delayed diagnosis and recurrence are the main cause for death [4,5]. Therefore, it is necessary for establishing new methods to predictive the gastric cancer at the early stage for enhancing the outcome of gastric cancer patients. Gastric cancer is a kind of cancer with high motility mainly due to its strong invasion and metastasis ability. The first step for cancer cell invasion and metastasis is the secretion of matrix metalloproteinases (MMPs) to degrade the extracellular matrix, which is natural barrier for preventing tumor cell escape from the original lesions [6–8]. Previous studies have shown that Interleukin-6 (IL-6) is a multifunctional cytokine which was produced by a wide range of cells, and plays a central role in host defense mechanisms and growth of various cancer cells [7,9]. IL-6 has the ability to protect cells from apoptosis induced by a wide variety of extracellular stimulates, such as UV irradiation, free
radical generation, or even anticancer drugs by activating the AKT and NF-kB pathways, both pathways are essential for supporting cancer cell survival and invasion [8]. Thus, inhibiting the IL-6 induced those pathways activation may serve as potential strategy for gastric cancer therapy. Resveratrol (3, 4′, 5-trihydroxystilbene, RSV) is most notably in skin of red grapes, peanuts, red wine, polygonum cuspidatum and many other Chinese medicines [10,11]. RSV has been studied extensively for its anticancer properties in various types of cancers [12–15]. Resveratrol has been broadly reported to be an effective anticancer drug through multiple pathways, including p53 [16], AMPK/mTOR [17], JNK/ERK [18]. Although it was reported that RSV has the ability to inhibit the gastric cancer proliferation [19,20], however, the actual mechanisms are not fully understood. Our study aims to explore the roles of IL-6 in gastric cancer cells progression, and to build a theoretical basis for developing new therapeutic strategies by using resveratrol. Our results demonstrate that IL6 was upregulated in serum of gastric cancer patient compared with those healthy people. Non-cytotoxic concentration of resveratrol inhibits the IL-6 induced SGC7901 cell invasion and MMPs activation by
Abbreviations: RSV, resveratrol; IL-6, Interleukin-6; MMP, matrix metalloproteinases; ELISA, enzyme-linked immunosorbent assay ⁎ Corresponding author at: Division of Chinese Medicine, The Sixth Affiliated Hospital of Wenzhou Medical College, People's Hospital of Lishui City, Lishui, Zhejiang 323000, China. E-mail address: [email protected] (L. Yan). 1 These authors contributed equally. https://doi.org/10.1016/j.biopha.2018.01.153 Received 29 October 2017; Received in revised form 29 January 2018; Accepted 29 January 2018 0753-3322/ © 2018 Elsevier Masson SAS. All rights reserved.
Biomedicine & Pharmacotherapy 99 (2018) 766–773
T. Yang et al.
Plate Auto-Reader (Labsystems). The percentage of cell viability was calculated as follows: cell viability (%) = OD treatment / OD con-
blocking the Raf/MAPK pathway. 2. Methods and materials
trol × 100%.
2.1. Materials and antibodies
2.6. Transwell invasion assay
RSV, IL-6 and MTT were purchased from Sigma (St. Louis, MO, USA). RSV was dissolved in DMSO (0.1% v/v final concentration) to a 100 mM stock solution. Antibody against IL-6, Raf, p-ERK1/2, ERK and β-actin were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Dulbecco's modified Eagle’s medium (DMEM) was obtained from Invitrogen Biotechnology (Camarillo, USA). Fetal bovine serum was purchased from Hyclone (Utah, USA). Inhibitors for ERK (U0126) was purchased from Santa Cruz Biotechnology. Transwell chamber, Matrigel and gelatin were purchased from BD Biosciences (San Jose, USA).
Transwell cell invasion assay was performed in 12 well plates with 8 μm diameter chamber inserts. The invasion chamber was pre-coated with Matrigel, 1 × 104 cells were suspended in 500 μL serum free DMEM and seeded in the upper well and DMEM medium with 10% FBS in the lower well. After 72 h incubation, remove the inside contents, and stain with crystal violet. At least 6 representative images of each well were taken, and cell numbers were counted using ImageJ. The experiments were performed in triplicate.
2.2. Cell line
Equal numbers of cells were seeded and treated IL-6 or RSV as indicated in figures in serum-free conditions. The conditioned medium was then harvested and concentrated by ultra-filtration centrifugation. The sample (30 μg) was mixed with loading buffer and subjected to gelatin zymogram gel (10% SDS-polyacrylamide gel, 0.1% gelatin). Electrophoresis was performed at 100 V for 3 h at 4 °C. The gels were then washed with washing buffer (2.5% Triton X-100 in ddH2O) at room temperature to remove SDS, followed by incubation overnight at 37 °C in reaction buffer (40 mM Tris-HCl, pH 8.0, 10 mM CaCl2). After incubation, the gels were stained with Coomassie blue R-250 (0.125% Coomassie blue R-250, 50% methanol, 10% acetic acid) for 4 h and destained with destaining solution (20% methanol, 10% acetic acid, 70% ddH2O) until the clear bands were visualized. MMP-2 and MMP-9 (gelatinase) activity was visible as clear bands against the dark blue background, then the gel was scanned and analyzed with ImageJ software.
2.7. Gelatin zymography to detect the MMPs level
The human gastric cancer cell lines were obtained from the American Type Culture Collection (ATCC, USA), and cultured in full DMEM medium supplemented with 10% (v/v) heat-inactivated fetal bovine serum, 100 U/ml penicillin and 100 U/ml streptomycin at 37 ◦C in a humidified atmosphere with 5% CO2. All experiments were performed during the exponential phase of cell growth and the concentration for IL-6 is 20 pg/μl. 2.3. Enzyme-linked immunosorbent assay The IL-6 levels of the patients and cell culture medium were determined by using commercially available enzyme-linked immunosorbent assay (ELISA) kits (R&D Systems, Minneapolis, MN) following the manufacturer’s instructions. All samples (50 non-tumor and 50 tumor samples) were used after obtaining informed consent. The Ethics Committee approved all protocols according to the Declaration of Helsinki (as revised in Tokyo 2004). Each measurement was repeated in triplicate, and the average value was recorded (pg/mL).
2.8. qPCR for the quantification of IL-6 RNA was extracted from 25 pairs of patient tissues by Trizol following the manufacturer's instructions. After extraction, RNA quantity was measured using nanodrop mechanism based on the absorbance ratio of A260/A280. Then 2 μg of total mRNA was converted to cDNA and gene expression quantified by Takara MasterMix kit. IL-6 (Forward primer CCAGCTATGAACTCCTTCTC and reverse primer GCTTGTTCCTCACATCTCTC) expression levels were normalized by GAPDH (Forward primer TGAAGGTCGGAGTCAACGGA and reverse primer CATGTGGGCCATGAGGTC). Data were analyzed with the Sequence detector software (v1.9, Applied Biosystems) and analyzed using the 2−ΔΔCT method. Bars represent average expression of three biological replicates and error bars represent standard deviation.
2.4. Western blot analysis Cells were treated with the conditions as indicated, cells were harvested, washed with PBS and lysed in ice-cold RIPA lysis buffer for 30 min. After protein quantitation, totally 30 μg protein was boiled in sample loading buffer for 5 min before separation by SDS-PAGE. Proteins were transferred onto a nitrocellulose membrane, and blocked with 10% non-fat milk for 30 min at room temperature. Membranes (Millipore, Billerica, USA) were incubated overnight at 4◦C with the indicated antibodies. The dilution ratio of the antibodies is 1:1000 for IL-6, p-ERK1/2 and ERK, 1:500 for p-Raf and Raf and 1:2000 for βactin. Blots were rinsed with TBST for three times, followed by incubating with secondary antibody for 1 h at room temperature. Transferred proteins were visualized with ECL and exposed to X-ray film. Results were analyzed with ImageJ software. Each value represents the mean of triple experiments, and is presented as the relative density of protein bands normalized to β-actin.
2.9. Immunohistochemical staining Immunohistochemistry was performed on paraformaldehyde fixed paraffin sections. Briefly, paraffin sections were deparaffinized in xylene, followed by a graded series of alcohols (100, 95 and 75%) and rehydrated in water followed by Tris-buffered saline. Following antigen retrieval, slides were incubated with 3% H2O2 to inhibit endogenous peroxidase. Slides were then blocked with 3% BSA and incubated with indicated antibodies (1:300 for MMP2 MMP9 and 1:200 for IL-6 p-Raf). After washing, the tissue sections were treated with biotinylated antirabbit secondary antibody (Zymed Laboratories Inc., South San Francisco, CA, USA), followed by further incubation with streptavidinhorseradish peroxidase complex (Zymed). Tissue sections were then immersed in 3,3′-diaminobenzidine and counterstained with 10% Mayer's hematoxylin, dehydrated and mounted. The percentage of positive cells was graded as per the following criteria: 0, less than 10%; 1, 10–30%; 2, 31–50%; 3, more than 50%.
2.5. Cell viability assay The exponentially growing cells (7 × 103 cells) were plated into 96well plate, after attaching, the cells were treated with as indicated in the figures for 24 h. After incubation, 20 μl 3-(4,5-dimethylthiazol-2yl)- 2,5-diphenyltetrazolium bromide (MTT, Sigma, USA) (1 mg/ml final concentration) was added to each well, followed by 4 h incubation at 37◦C, then medium was removed and 150 μl DMSO was added to each well. The plate was then shaken for 10 min in the dark at room temperature. The absorbance value at 490 nm was read using a Micro767
Biomedicine & Pharmacotherapy 99 (2018) 766–773
T. Yang et al.
amount of IL-6 secretion, as shown in Fig. 1D and E. Taken together, the result showed a significant correlation that IL-6 level was much higher in gastric cancer patients compared with normal control group, suggesting that IL-6 might play an important role for gastric cancer progression.
2.10. Metastasis model HSC-39_Luciferase cells (1 × 106/100 μl DMEM) were subcutaneously implanted into the thighs of 6-week-old male NOD/SCID mice. The antibodies and resveratrol were administered via intratumorally injection and bioluminescent images were measured using an IVIS Spectrum (Xenogen IVIS 100; Caliper). Bioluminescent signals were quantified from ROIs using the Living Image software (Xenogen). Mice were maintained under specific pathogen–free conditions approved by the Wenzhou Medical University at the Laboratory Animal Center.
3.2. IL-6 induces gastric cancer cells invasion in vitro To investigate the role of IL-6 in gastric cancer invasion, we add extra human recombinant IL-6 into the culture medium for SGC-7901 cells, since this cell line secrete lower IL-6 compared with the other cell lines. Transwell invasion assays were performed to test the effect of altering IL-6 on cell invasion. We found that human recombinant IL-6 led to a significant increase of cell invasion in SGC-7901 cells (P < .05, Fig. 2B (a–b) and 2C), the result showed that IL-6 treatment increased SGC-7901 invasion reach to about 40.2% compared with the control group. As cell invasion also related with matrix metalloproteinases secretion, thus we further detected the MMPs in culture medium after cells treated with IL-6 for 48 h, as shown in Fig. 3A (a–b) and 3B, IL-6 treated cells have a high level of both MMP2 and MMP9 in conditional medium. Thus, IL-6 may exert a pro-metastatic effect on gastric cancer cells. To further validate our conclusion, we used Anti-IL-6 neutralize antibody to diminish the effect of IL-6 in culture medium, as shown in Fig. 2D (a–b) and E, when we use anti-IL-6 antibody pretreated with the HSC-39 cells, which secrete more IL-6 compared with the other cell lines. The cell invasive ability was dramatically decreased about 60% compared with the Anti-IgG group. Similarly, we also showed that neutralizing the IL-6 in HSC-39 cells decreased the MMP2 and MMP9 secretion, as shown in Fig. 3C (a–b) and Fig. 3D. Taken together, these data suggested that IL-6 secretion is essential for gastric cancer cells invasion in vitro.
2.11. Statistical analysis Results are expressed as Mean ± SEM. Significance was calculated with the SPSS13.0 statistical software (SPSS, Chicago, IL, USA). Comparisons between 2 groups were performed with an unpaired 2tailed Student’s t-test and multiple group comparisons were performed ANOVA. Difference were considered significant when P < .05. 3. Results 3.1. Highly expression of IL-6 in blood is correlated with gastric cancer To know the expression level of IL-6 in gastric cancer, the ELISA technique was used to determine the IL-6 level in plasma from 50 gastric cancer patients and 50 normal control patients randomly. As shown in Fig. 1A, the amount of IL-6 in tumor patients was higher compared with the control group. We further extracted the RNA from both gastric cancer tissue as well as its conjuncted tissues, we then performed real-time PCR to analysis the mRNA level between the two groups, as shown in Fig.1B, the IL-6 expression level in cancer tissue was higher in comparison with the paracancer tissue. Similarity, we shown in Fig. 1C that the protein expression in cancer tissue and paracancer tissue was further confirmed our conclusion. We next detected the IL-6 secretion in supernatant and protein expression of different gastric cancer cell lines, the data showed that SGC-7901 cell lines with a lower level of IL-6 expression but HSC-39 cells with a high
3.3. Non-toxicity dose of Resveratrol inhibits IL-6 induced invasion Resveratrol has been studied extensively for its anticancer properties in various types of cancers [12]. In this study, we are considering whether RSV could reverse the IL-6 induced cell invasion and MMPs Fig. 1. The levels of IL-6 was significantly higher in gastric cancer patients than those in control normal groups (P < .001, Student's t-test). (A) ELISA assay to show the level of IL-6 in gastric patients. Horizontal lines represent the mean values for IL-6 between the noncancer and cancer patients. (B) IL-6 mRNA expression level and (C) protein expression level in gastric cancer and its associated conjuncted tissue. (D) IL-6 mRNA expression level and (E) protein expression level in different gastric cancer cell lines. *p < .05, **p < .01, ***p < .005.
768
Biomedicine & Pharmacotherapy 99 (2018) 766–773
T. Yang et al.
Fig. 2. IL-6 induces invasion activity of gastric cancer SGC7901 cells. (A) The cell viability of SGC7901 cell were measured by MTT assay after cells treated with different doses of RSV. (B) SGC7901 cells were seeded to the upper Boyden chamber and human recombinant IL-6 was added into the culture medium and placed cover the cells. After 48 h, the invasive cells were stained, and photos were taken under microscope. (C) The invasion activity of SGC7901 cell was measured by counting the staining positive cells. (D) HSC-39 cells were seeded to the upper Boyden chamber and IL-6 neutralizing antibody or resveratrol were added into the culture medium and placed in the upper chamber. After 48 h, the invasive cells were stained, and photos were taken under microscope. (E) The invasion activity of HSC-39 cell was measured by counting the staining positive cells. Columns show mean number of cells harvested for 3 experiments done in triplicate (*p < .05, ***p < .005).
769
Biomedicine & Pharmacotherapy 99 (2018) 766–773
T. Yang et al.
Fig. 3. RSV treatment suppress IL-6 induced MMP-2 and -9 expressions. (A and C) Cell supernatant were harvested from different treatment and then subjected to Gelatinase zymograms assay. (B and D) Relative intensity (MMP/no treatment group) of data from Gelatinase zymograms analysis was shown into a histogram. Columns show mean number of cells harvested for 3 experiments done in triplicate (*p < .05, ***p < .005).
secretion. We firstly detected different dose of RSV on cell viability, as shown in Fig. 2A, we used 10 and 20 μM for this study since the concentration lower than 20 μM has no effective role for cell viability. We then combined treatment the SGC-7901 cells with both RSV and IL-6, the data in Fig. 2B (c–d) and 2C showed that RSV could reverse the IL-6 induced invasion, the inhibition ratio for 10 μM and 20 μM of resveratrol reached to 18.3% and 37%, respectively, as well as the MMPs secretion as shown in Fig. 3A (c–d) and 3B. Similarly, in HSC-39 cell line, which has a high level of IL-6, we observed that treatment with resveratrol significantly decreased the cell invasion as well as the MMP2 and MMP9 secretion, as shown in Fig. 2D (c–d), Fig. 2E, Fig. 3C (c–d) and Fig. 3D. Taken together, these data demonstrate that RSV mediates in preventing the IL-6 induced cancer cell invasion and metastasis.
found that blocking the MAPK activation also inhibited the IL-6 induced MAPK signaling activation, as well as the IL-6 induced cell invasion (Fig. 4C) and MMPs secretion (Fig. 4D). Taken together, these data showed that IL-6 induced SGC-7901 cell invasion through the RafMAPK signaling. Our data showed RSV reversed the IL-6 induced cancer cell invasion, however, the mechanisms is not fully understood. In this study, as shown in Fig. 4A (d–e) and 4B, the data showed that RSV blocked the activation of Raf/MAPK signaling induced by IL-6, as indicated by the phosphorylation of Raf/ERK, which indicated that RSV could reverse the IL-6 induced Raf/MAPK signaling activation to block the cancer cell invasion and MMPs secretion.
3.5. Resveratrol has the potential to inhibit the IL-6 induced metastasis of gastric cancer cell
3.4. Resveratrol inhibits IL-6 induced invasion and MMPs secretion through Raf/MAPK pathway
To validate the correlation of IL-6, p-Raf, MMP2 and MMP9, we stained the clinical gastric cancer tissue with the specific antibodies, as shown in Fig. 5A, the data showed that IL-6 high expression tissues with a high expression of p-Raf, MMP2 and MMP9, which indicated there is a positive correlation among IL-6, p-Raf and MMPs. Next, we are wondering whether resveratrol could inhibit the IL-6 associated cell metastasis in vivo, we transfected and selected a stable luciferase labelled HSC-39 cells, we injected the cells into vein tail of nude-mice. We then measured the metastasis ability under bioluminescence three weeks later. As shown in Fig. 5B, we injected the HSC-39 cells into 5 mice each group through vein tail, we treated the mice with anti-IL-6 antibody or resveratrol every four days for 3 weeks, the data showed that resveratrol or Anti-IL-6 treated mice has a significant inhibition of cancer cell metastasis.
IL-6 is a secreted cytokine with multiple functions, previous studies showed that IL-6 binds to its receptors to trigger many distinct pathways activation, including Jak/STAT, Raf/MAPK, and PI3-K/Akt pathways in different types of cancer [21]. In gastric cancer cell lines, the detailed pathways invasion induced by IL-6 is still unclear. To investigate whether Raf/MAPK signaling was involved in IL-6 stimulation, we first checked the expression levels of phosphorylated-Raf, phosphorylated-ERK pathways after cells incubation with IL-6. As shown in Fig. 4 A (a–b) and 4B, IL-6 induced Raf/MAPK signaling activation as indicated by the phosphorylation of Raf and ERK. To further confirm the Raf-ERK pathway activation induced by IL-6 involved in SGC-7901 cell invasion, we used MAPK pathway inhibitors, U0126, to block the activation of ERK signaling. As shown in Fig. 4A(c) and 4B we 770
Biomedicine & Pharmacotherapy 99 (2018) 766–773
T. Yang et al.
Fig. 4. Activation of Raf/MAPK pathway by IL-6 stimulation. (A) Phosphorylated Raf and phosphorylated ERK proteins were measured after cells were treatment with different condition for 48 h. Total Raf, ERK and β-actin were used as the internal loading control. (B) Relative intensity (p-Raf/Raf and p-ERK/ERK) of data from western blot were analyzed and showed into a histogram. (C) SGC7901 cells were seeded to the upper Boyden chamber, human recombinant IL-6 and different dose of U0126 was added into the culture medium and placed cover the cells. After 48 h, the invasive cells were stained, and photos were taken under microscope. (D) Cell treated with IL-6 and U0126, then supernatant were harvested from different treatment and then subjected to Gelatinase zymograms assay. Relative intensity (MMP/no treatment group) of data from Gelatinase zymograms analysis was shown under the bands. Columns show mean number of cells harvested for 3 experiments done in triplicate (*p < .05, **p < .005).
4. Discussion
transformation [26,27]. It has been applied as a potential therapy target by interfering the cytokines in clinician [28]. Malignant tumor cell invasive into surrounding tissues should overcome three main barriers, namely the extracellular matrix (extracellular matrix, ECM) degradation, invasion and metastasis, and cell proliferation [6,29]. It is necessary that secretion of MMPs, like MMP2 and MMP9 by cancer cells to degradation the barrier is the initial step for cancer migration and invasion [23,30], resulting in gastric cancer cell metastasis to other tissues [31]. This process may dependent on distinct pathways activation. In this study, we found that activation of Ras-MAPK pathway induced by IL-6 was involved in gastric cancer invasion, even though there was a report documenting that IL-6 activation of MAPK pathways in prostate cancer cells to induce tumor cell proliferation and the total activation of ERK can improve athletic ability of tumor cells to reduce adhesion between cells [32,33], the involvement of Raf-MAPK pathway activation contributes to invasion of gastric cancer is still need further studied. It’s quite interesting to find potential drugs for invasive cancer treatment. In recent years, the anti-tumor activities of Chinese herbal have attracted more and more laboratory workers as well as clinicals [13,34–36]. However, due to the complexity ingredients of Chinese herbal medicine, the anticancer properties of the ingredients extracted from herbal need further elaboration [35]. Previous studies have shown
Clinical studies have shown that tumor metastasis and migration of human gastric cancer is the leading cause of death. IL-6 is an important inflammatory cytokine. Previous studies have reported that there is abundant pro-inflammatory cytokines including IL-6 secreted by cancer cells. Previous studies have shown that increased secretion of IL-6 plays an important role in promoting cancer cell proliferation, adhesion and metastasis [22,23]. In this study, we initially detected the expression status of IL-6 in samples of surgical resected gastric cancer tissues. Our data indicated that the level of IL-6 expression in gastric cancer was significantly higher than that in normal tumor-adjacent tissues. Until now, the functions of IL-6 in gastric cancer is not fully understand, even though it has been reported that in vitro cultured cells, IL-6 is usually established as a chemo-attractive to induce tumor cell migration and invasion [24,25]. Importantly, our data demonstrated that high level of IL-6 was correlated with a significant cancer invasion and metastasis. We further showed that resveratrol has the potential to reverse IL-6 enhanced cancer malignance. Altogether, these results suggest that IL-6 expression is critical for prognosis determination in gastric cancer patients. In cancer cell model or cancer patients, cytokines continues secretion in special condition is one of the reasons for cancer malignant 771
Biomedicine & Pharmacotherapy 99 (2018) 766–773
T. Yang et al.
Fig. 5. Resveratrol has the potential to inhibit the IL-6 induced metastasis of gastric cancer cell. (A) IHC staining showed that IL-6 has a positive correlation with p-Raf signaling and MMP2/9 in clinical samples. (B) Metastasis model showed that anti-IL-6 antibodies and resveratrol treatment has the potential to inhibit the HSC-39 cells metastasis in mice.
inhibition of the Raf/ERK pathway, this will provide a theoretical basis for the use of resveratrol in applicating as an anticancer drug. Based on the above indicated properties of resveratrol, it will be a bright future for the coming trail of RSV in clinical. In summary, as shown in Fig. 6, the studies showed that the invasion of human gastric cancer cells induced by IL-6 via activation of the Raf-MAPK signaling activation, and further study showed the RSV could block the IL-6 induced invasion through the blocking of this pathway. These findings will be providing a theoretical basis for designing cancer prevention strategies.
that resveratrol, the major ingredient from Polygonum herbal, is a natural phytoalexin, have the ability to inhibit tumor growth, induce tumor cell apoptosis as well as block tumor metastasis [12,34]. Resveratrol has been reported to induce esophageal cancer, liver cancer, stomach cancer, breast cancer, cervical cancer, prostate cancer and other tumor cells growth inhibition and apoptosis through district mechanisms [37–39]. In agreement with these reports, in our study, we are using human gastric cancer cells as a model, we found that low dose of RSV inhibits human gastric cancer cell invasion induced by IL-6, majority by blocking the IL-6 induced Raf-MAPK pathway activation. Interesting, RSV was also reported to reduce the IL-6 production and secretion, which is important for tumor microenvironment changes and inflammation. On the other hand, using mouse model, our study further showed that both resveratrol treatment and IL-6 neutralize antibody could block the gastric cancer cell metastasis in vivo. Therefore, we suggest that IL-6-induced gastric cancer invasion and metastasis is mediated through a Raf/ERK-dependent pathway. Then, resveratrol suppresses IL-6 induced cell migration and metastasis through
Authors contributions TTY and JMZ performed experiments, data analysis and contributed to the manuscript preparation. JMZ contributed towards collecting the patients’ samples from the division of Gastroenterology of the hospital. JTZ, MXZ and LW contributed to discussion and proofreading. TTY and LHY were responsible for the conception and design of the study, data 772
Biomedicine & Pharmacotherapy 99 (2018) 766–773
T. Yang et al.
[11] J. Burns, T. Yokota, H. Ashihara, M.E. Lean, A. Crozier, Plant foods and herbal sources of resveratrol, J. Agric. Food Chem. 50 (2002) 3337–3340. [12] M. Athar, J.H. Back, L. Kopelovich, D.R. Bickers, A.L. Kim, Multiple molecular targets of resveratrol: anti-carcinogenic mechanisms, Arch. Biochem. Biophys. 486 (2009) 95–102. [13] T. Yang, L. Wang, M. Zhu, L. Zhang, L. Yan, Properties and molecular mechanisms of resveratrol: a review, Die Pharm.-Int. J. Pharm. Sci. 70 (2015) 501–506. [14] M. Hasan, H. Bae, An overview of stress-induced resveratrol synthesis in grapes: perspectives for resveratrol-enriched grape products, Molecules 22 (2017) 294. [15] R. Frazzi, M. Guardi, Cellular and molecular targets of resveratrol on lymphoma and leukemia cells, Molecules (2017) 22. [16] D.C. Ferraz da Costa, E. Fialho, J.L. Silva, Cancer chemoprevention by resveratrol: the p53 tumor suppressor protein as a promising molecular target, Molecules 22 (2017) 1014. [17] J. Zhang, J. Chiu, H. Zhang, T. Qi, Q. Tang, K. Ma, et al., Autophagic cell death induced by resveratrol depends on the Ca(2+)/AMPK/mTOR pathway in A549 cells, Biochem. Pharmacol. 86 (2013) 317–328. [18] Q. Xie, Y. Yang, Z. Wang, F. Chen, A. Zhang, C. Liu, Resveratrol-4-OD-(2’-galloyl)glucopyranoside isolated from Polygonum cuspidatum exhibits anti-hepatocellular carcinoma viability by inducing apoptosis via the JNK and ERK pathway, Molecules 19 (2014) 1592–1602. [19] Q. Yang, B. Wang, W. Zang, X. Wang, Z. Liu, W. Li, et al., Resveratrol inhibits the growth of gastric cancer by inducing G1 phase arrest and senescence in a Sirt1dependent manner, PLoS One 8 (2013) e70627. [20] Z. Wang, W. Li, X. Meng, B. Jia, Resveratrol induces gastric cancer cell apoptosis via reactive oxygen species, but independent of sirtuin1, Clin. Exp. Pharmacol. Physiol. 39 (2012) 227–232. [21] T. Hirano, K. Nakajima, M. Hibi, Signaling mechanisms through gp130: a model of the cytokine system, Cytokine Growth Fact. Rev. 8 (1997) 241–252. [22] A. Eltweri, L. Howells, A. Thomas, A. Dennison, D. Bowrey, PWE-169 treatment of oesophageal cell lines with docosahexaenoic fatty acid (DHA) and oxaliplatin: effects on proliferation, expression of vascular endothelial growth factor and IL-6, Gut 64 (2015) A286–A287. [23] M.T. Lin, B.R. Lin, C.C. Chang, C.Y. Chu, H.J. Su, S.T. Chen, et al., IL-6 induces AGS gastric cancer cell invasion via activation of the c-Src/RhoA/ROCK signaling pathway, Int. J. Cancer 120 (2007) 2600–2608. [24] M. Rokavec, M.G. Oner, H. Li, R. Jackstadt, L. Jiang, D. Lodygin, et al., IL-6R/ STAT3/miR-34a feedback loop promotes EMT-mediated colorectal cancer invasion and metastasis, J. Clin. Invest. 124 (2014) 1853–1867. [25] K. Taniguchi, M. Karin, IL-6 and related cytokines as the critical lynchpins between inflammation and cancer, Seminars in Immunology, Elsevier, 2014. [26] M.C. Patra, S. Choi, Recent progress in the molecular recognition and therapeutic importance of Interleukin-1 receptor-associated Kinase 4, Molecules (2016) 21. [27] F. Rusolo, B. Pucci, G. Colonna, F. Capone, E. Guerriero, M.R. Milone, et al., Evaluation of selenite effects on selenoproteins and cytokinome in human hepatoma cell lines, Molecules 18 (2013) 2549–2562. [28] G. Dranoff, Cytokines in cancer pathogenesis and cancer therapy, Nat. Rev. Cancer 4 (2004) 11–22. [29] D.E. Kleiner, W.G. Stetler-Stevenson, Matrix metalloproteinases and metastasis, Cancer Chemother. Pharmacol. 43 (Suppl) (1999) S42–51. [30] M. Zou, X. Zhang, C. Xu, IL6-induced metastasis modulators p-STAT3, MMP-2 and MMP-9 are targets of 3, 3′-diindolylmethane in ovarian cancer cells, Cell. Oncol. 39 (2016) 47–57. [31] Y. Yonemura, Y. Endou, H. Fujita, S. Fushida, E. Bandou, K. Taniguchi, et al., Role of MMP-7 in the formation of peritoneal dissemination in gastric cancer, Gastric Cancer 3 (2000) 63–70. [32] M. Sano, K. Fukuda, T. Sato, H. Kawaguchi, M. Suematsu, S. Matsuda, et al., ERK and p38 MAPK, but not NF-κB, are critically involved in reactive oxygen species–mediated induction of IL-6 by angiotensin II in cardiac fibroblasts, Circ. Res. 89 (2001) 661–669. [33] A.P. Costa-Pereira, Regulation of IL-6-type cytokine responses by MAPKs, Biochem. Soc. Trans. 42 (2014) 59–62. [34] M. Athar, J.H. Back, X. Tang, K.H. Kim, L. Kopelovich, D.R. Bickers, et al., Resveratrol: a review of preclinical studies for human cancer prevention, Toxicol. Appl. Pharmacol. 224 (2007) 274–283. [35] T. Efferth, P.C. Li, V.S. Konkimalla, B. Kaina, From traditional Chinese medicine to rational cancer therapy, Trends Mol. Med. 13 (2007) 353–361. [36] C.K. Singh, M.A. Ndiaye, N. Ahmad, Resveratrol and cancer: challenges for clinical translation, Biochim. Biophys. Acta, Mol. Basis Dis. 1852 (2015) 1178–1185. [37] A.K. Joe, H. Liu, M. Suzui, M.E. Vural, D. Xiao, I.B. Weinstein, Resveratrol induces growth inhibition, S-phase arrest, apoptosis, and changes in biomarker expression in several human cancer cell lines, Clin. Cancer Res. 8 (2002) 893–903. [38] M.A. Seyed, I. Jantan, S.N.A. Bukhari, K. Vijayaraghavan, A comprehensive review on the chemotherapeutic potential of piceatannol for cancer treatment, with mechanistic insights, J. Agric. Food. Chem. (2016). [39] J. Zhang, K. Ma, T. Qi, X. Wei, Q. Zhang, G. Li, et al., P62 regulates resveratrolmediated Fas/Cav-1 complex formation and transition from autophagy to apoptosis, Oncotarget 6 (2015) 789–801.
Fig. 6. A short diagram shown IL-6 induced SGC7901 cancer cell invasion through the activation of Raf/MAPK pathway, RSV has the ability to reduce the IL-6 production and secretion, which played an important role for inducing cancer invasion by through activation of the Raf/MAPK pathway.
presentation and manuscript preparation. All authors read and approved the final manuscript. Conflict of interest The authors declare no conflict of interest. Acknowledgement This work was supported by High-Level Personal Special Support Fund of Lishui City (2014RC27) to Dr. YAN. References [1] J.W. Morgan, L. Ji, G. Friedman, M. Senthil, C. Dyke, S.S. Lum, The role of the cancer center when using lymph node count as a quality measure for gastric cancer surgery, JAMA Surg. 150 (2015) 37–43. [2] X.Z. Chen, W.H. Zhang, J.K. Hu, A difficulty in improving population survival outcome of gastric cancer in mainland China: low proportion of early diseases, Med. Oncol. 31 (2014) 315. [3] L. Ye, Z.Y. Zhang, W.D. Du, M.E. Schneider, Y. Qiu, Y. Zhou, et al., Genetic analysis of ADIPOQ variants and gastric cancer risk: a hospital-based case-control study in China, Med. Oncol. 30 (2013) 658. [4] J. Deng, R. Zhang, L. Wu, L. Zhang, X. Wang, Y. Liu, et al., Superiority of the ratio between negative and positive lymph nodes for predicting the prognosis for patients with gastric cancer, Ann. Surg. Oncol. 22 (2015) 1258–1266. [5] I.S. Lee, Y.S. Park, M.H. Ryu, M.J. Song, J.H. Yook, S.T. Oh, et al., Impact of extranodal extension on prognosis in lymph node-positive gastric cancer, Br. J. Surg. 101 (2014) 1576–1584. [6] N. Johansson, M. Ahonen, V.M. Kahari, Matrix metalloproteinases in tumor invasion, Cell. Mol. Life Sci. 57 (2000) 5–15. [7] Y. Ichikawa, T. Ishikawa, K. Tanaka, S. Togo, H. Shimada, Extracellular matrix degradation enzymes: important factors in liver metastasis of colorectal cancer and good targets for anticancer metastatic therapy, Nihon Geka Gakkai Zasshi 102 (2001) 376–380. [8] G.T. Brown, G.I. Murray, Current mechanistic insights into the roles of matrix metalloproteinases in tumour invasion and metastasis, J. Pathol. 237 (2015) 273–281. [9] M. Rokavec, M.G. Öner, H. Li, R. Jackstadt, L. Jiang, D. Lodygin, et al., IL-6R/ STAT3/miR-34a feedback loop promotes EMT-mediated colorectal cancer invasion and metastasis, J. Clin. Invest. 125 (2015) 1362. [10] S. Renaud, M. de Lorgeril, Wine, alcohol, platelets, and the French paradox for coronary heart disease, Lancet 339 (1992) 1523–1526.
773
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha
Resveratrol inhibits Interleukin-6 induced invasion of human gastric cancer cells Tingting Yanga,1, Jianmei Zhangb,1, Junting Zhoua, Meixiao Zhua, Li Wanga, Lianhe Yana, a b
T
⁎
Division of Chinese Medicine, The Sixth Affiliated Hospital of Wenzhou Medical College, People's Hospital of Lishui City, Lishui, Zhejiang, China Division of Gastroenterology, The Sixth Affiliated Hospital of Wenzhou Medical College, People's Hospital of Lishui City, Lishui, Zhejiang, China
A R T I C L E I N F O
A B S T R A C T
Keywords: Interleukin-6 Resveratrol Raf/MAPK Gastric cancer Metastasis
Previous studies show that migration and invasion are the primary causes of death in patients with gastric carcinoma. Increasing evidences have been shown Interleukin-6 could stimulate cancer cells invasion and be associated with cancer development. However, its role in gastric cancer has never been investigated. As an anticancer drug isolated from Chinese medicine, resveratrol was reported to inhibit cancer cells growth and induce apoptosis, but its roles in gastric cancer have not been well understood. In this study, we found that Interleukin-6 was upregulated in blood of gastric cancer patients by enzyme-linked immunosorbent assay. In gastric cancer cell line model, we found that non-cytotoxic concentration of resveratrol inhibited the Interleukin6 induced SGC7901 cell invasion and matrix metalloproteinases activation. Our studies showed that IL-6 induced SGC7901 cell invasion depends on the Raf/MAPK pathway activation, resveratrol could inhibit this pathway activation. We further showed that resveratrol inhibits the IL-6 induced metastasis by vein injection of luciferaselabeled cancer cells. In conclusion, these results indicate that Interleukin-6 promotes tumor growth and metastasis in gastric cancer, resveratrol has the potential to prevent the Interleukin-6 induced gastric cancer metastasis by blocking the Raf/MAPK signaling activation.
1. Introduction Gastric cancer is one of the most common malignancy cancers occurred in China even all around the world, causing approximately one million deaths per year [1]. The incidence of gastric cancer is decreasing in the last decade due to the early diagnose and effective therapy skills [2,3]. Delayed diagnosis and recurrence are the main cause for death [4,5]. Therefore, it is necessary for establishing new methods to predictive the gastric cancer at the early stage for enhancing the outcome of gastric cancer patients. Gastric cancer is a kind of cancer with high motility mainly due to its strong invasion and metastasis ability. The first step for cancer cell invasion and metastasis is the secretion of matrix metalloproteinases (MMPs) to degrade the extracellular matrix, which is natural barrier for preventing tumor cell escape from the original lesions [6–8]. Previous studies have shown that Interleukin-6 (IL-6) is a multifunctional cytokine which was produced by a wide range of cells, and plays a central role in host defense mechanisms and growth of various cancer cells [7,9]. IL-6 has the ability to protect cells from apoptosis induced by a wide variety of extracellular stimulates, such as UV irradiation, free
radical generation, or even anticancer drugs by activating the AKT and NF-kB pathways, both pathways are essential for supporting cancer cell survival and invasion [8]. Thus, inhibiting the IL-6 induced those pathways activation may serve as potential strategy for gastric cancer therapy. Resveratrol (3, 4′, 5-trihydroxystilbene, RSV) is most notably in skin of red grapes, peanuts, red wine, polygonum cuspidatum and many other Chinese medicines [10,11]. RSV has been studied extensively for its anticancer properties in various types of cancers [12–15]. Resveratrol has been broadly reported to be an effective anticancer drug through multiple pathways, including p53 [16], AMPK/mTOR [17], JNK/ERK [18]. Although it was reported that RSV has the ability to inhibit the gastric cancer proliferation [19,20], however, the actual mechanisms are not fully understood. Our study aims to explore the roles of IL-6 in gastric cancer cells progression, and to build a theoretical basis for developing new therapeutic strategies by using resveratrol. Our results demonstrate that IL6 was upregulated in serum of gastric cancer patient compared with those healthy people. Non-cytotoxic concentration of resveratrol inhibits the IL-6 induced SGC7901 cell invasion and MMPs activation by
Abbreviations: RSV, resveratrol; IL-6, Interleukin-6; MMP, matrix metalloproteinases; ELISA, enzyme-linked immunosorbent assay ⁎ Corresponding author at: Division of Chinese Medicine, The Sixth Affiliated Hospital of Wenzhou Medical College, People's Hospital of Lishui City, Lishui, Zhejiang 323000, China. E-mail address: [email protected] (L. Yan). 1 These authors contributed equally. https://doi.org/10.1016/j.biopha.2018.01.153 Received 29 October 2017; Received in revised form 29 January 2018; Accepted 29 January 2018 0753-3322/ © 2018 Elsevier Masson SAS. All rights reserved.
Biomedicine & Pharmacotherapy 99 (2018) 766–773
T. Yang et al.
Plate Auto-Reader (Labsystems). The percentage of cell viability was calculated as follows: cell viability (%) = OD treatment / OD con-
blocking the Raf/MAPK pathway. 2. Methods and materials
trol × 100%.
2.1. Materials and antibodies
2.6. Transwell invasion assay
RSV, IL-6 and MTT were purchased from Sigma (St. Louis, MO, USA). RSV was dissolved in DMSO (0.1% v/v final concentration) to a 100 mM stock solution. Antibody against IL-6, Raf, p-ERK1/2, ERK and β-actin were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Dulbecco's modified Eagle’s medium (DMEM) was obtained from Invitrogen Biotechnology (Camarillo, USA). Fetal bovine serum was purchased from Hyclone (Utah, USA). Inhibitors for ERK (U0126) was purchased from Santa Cruz Biotechnology. Transwell chamber, Matrigel and gelatin were purchased from BD Biosciences (San Jose, USA).
Transwell cell invasion assay was performed in 12 well plates with 8 μm diameter chamber inserts. The invasion chamber was pre-coated with Matrigel, 1 × 104 cells were suspended in 500 μL serum free DMEM and seeded in the upper well and DMEM medium with 10% FBS in the lower well. After 72 h incubation, remove the inside contents, and stain with crystal violet. At least 6 representative images of each well were taken, and cell numbers were counted using ImageJ. The experiments were performed in triplicate.
2.2. Cell line
Equal numbers of cells were seeded and treated IL-6 or RSV as indicated in figures in serum-free conditions. The conditioned medium was then harvested and concentrated by ultra-filtration centrifugation. The sample (30 μg) was mixed with loading buffer and subjected to gelatin zymogram gel (10% SDS-polyacrylamide gel, 0.1% gelatin). Electrophoresis was performed at 100 V for 3 h at 4 °C. The gels were then washed with washing buffer (2.5% Triton X-100 in ddH2O) at room temperature to remove SDS, followed by incubation overnight at 37 °C in reaction buffer (40 mM Tris-HCl, pH 8.0, 10 mM CaCl2). After incubation, the gels were stained with Coomassie blue R-250 (0.125% Coomassie blue R-250, 50% methanol, 10% acetic acid) for 4 h and destained with destaining solution (20% methanol, 10% acetic acid, 70% ddH2O) until the clear bands were visualized. MMP-2 and MMP-9 (gelatinase) activity was visible as clear bands against the dark blue background, then the gel was scanned and analyzed with ImageJ software.
2.7. Gelatin zymography to detect the MMPs level
The human gastric cancer cell lines were obtained from the American Type Culture Collection (ATCC, USA), and cultured in full DMEM medium supplemented with 10% (v/v) heat-inactivated fetal bovine serum, 100 U/ml penicillin and 100 U/ml streptomycin at 37 ◦C in a humidified atmosphere with 5% CO2. All experiments were performed during the exponential phase of cell growth and the concentration for IL-6 is 20 pg/μl. 2.3. Enzyme-linked immunosorbent assay The IL-6 levels of the patients and cell culture medium were determined by using commercially available enzyme-linked immunosorbent assay (ELISA) kits (R&D Systems, Minneapolis, MN) following the manufacturer’s instructions. All samples (50 non-tumor and 50 tumor samples) were used after obtaining informed consent. The Ethics Committee approved all protocols according to the Declaration of Helsinki (as revised in Tokyo 2004). Each measurement was repeated in triplicate, and the average value was recorded (pg/mL).
2.8. qPCR for the quantification of IL-6 RNA was extracted from 25 pairs of patient tissues by Trizol following the manufacturer's instructions. After extraction, RNA quantity was measured using nanodrop mechanism based on the absorbance ratio of A260/A280. Then 2 μg of total mRNA was converted to cDNA and gene expression quantified by Takara MasterMix kit. IL-6 (Forward primer CCAGCTATGAACTCCTTCTC and reverse primer GCTTGTTCCTCACATCTCTC) expression levels were normalized by GAPDH (Forward primer TGAAGGTCGGAGTCAACGGA and reverse primer CATGTGGGCCATGAGGTC). Data were analyzed with the Sequence detector software (v1.9, Applied Biosystems) and analyzed using the 2−ΔΔCT method. Bars represent average expression of three biological replicates and error bars represent standard deviation.
2.4. Western blot analysis Cells were treated with the conditions as indicated, cells were harvested, washed with PBS and lysed in ice-cold RIPA lysis buffer for 30 min. After protein quantitation, totally 30 μg protein was boiled in sample loading buffer for 5 min before separation by SDS-PAGE. Proteins were transferred onto a nitrocellulose membrane, and blocked with 10% non-fat milk for 30 min at room temperature. Membranes (Millipore, Billerica, USA) were incubated overnight at 4◦C with the indicated antibodies. The dilution ratio of the antibodies is 1:1000 for IL-6, p-ERK1/2 and ERK, 1:500 for p-Raf and Raf and 1:2000 for βactin. Blots were rinsed with TBST for three times, followed by incubating with secondary antibody for 1 h at room temperature. Transferred proteins were visualized with ECL and exposed to X-ray film. Results were analyzed with ImageJ software. Each value represents the mean of triple experiments, and is presented as the relative density of protein bands normalized to β-actin.
2.9. Immunohistochemical staining Immunohistochemistry was performed on paraformaldehyde fixed paraffin sections. Briefly, paraffin sections were deparaffinized in xylene, followed by a graded series of alcohols (100, 95 and 75%) and rehydrated in water followed by Tris-buffered saline. Following antigen retrieval, slides were incubated with 3% H2O2 to inhibit endogenous peroxidase. Slides were then blocked with 3% BSA and incubated with indicated antibodies (1:300 for MMP2 MMP9 and 1:200 for IL-6 p-Raf). After washing, the tissue sections were treated with biotinylated antirabbit secondary antibody (Zymed Laboratories Inc., South San Francisco, CA, USA), followed by further incubation with streptavidinhorseradish peroxidase complex (Zymed). Tissue sections were then immersed in 3,3′-diaminobenzidine and counterstained with 10% Mayer's hematoxylin, dehydrated and mounted. The percentage of positive cells was graded as per the following criteria: 0, less than 10%; 1, 10–30%; 2, 31–50%; 3, more than 50%.
2.5. Cell viability assay The exponentially growing cells (7 × 103 cells) were plated into 96well plate, after attaching, the cells were treated with as indicated in the figures for 24 h. After incubation, 20 μl 3-(4,5-dimethylthiazol-2yl)- 2,5-diphenyltetrazolium bromide (MTT, Sigma, USA) (1 mg/ml final concentration) was added to each well, followed by 4 h incubation at 37◦C, then medium was removed and 150 μl DMSO was added to each well. The plate was then shaken for 10 min in the dark at room temperature. The absorbance value at 490 nm was read using a Micro767
Biomedicine & Pharmacotherapy 99 (2018) 766–773
T. Yang et al.
amount of IL-6 secretion, as shown in Fig. 1D and E. Taken together, the result showed a significant correlation that IL-6 level was much higher in gastric cancer patients compared with normal control group, suggesting that IL-6 might play an important role for gastric cancer progression.
2.10. Metastasis model HSC-39_Luciferase cells (1 × 106/100 μl DMEM) were subcutaneously implanted into the thighs of 6-week-old male NOD/SCID mice. The antibodies and resveratrol were administered via intratumorally injection and bioluminescent images were measured using an IVIS Spectrum (Xenogen IVIS 100; Caliper). Bioluminescent signals were quantified from ROIs using the Living Image software (Xenogen). Mice were maintained under specific pathogen–free conditions approved by the Wenzhou Medical University at the Laboratory Animal Center.
3.2. IL-6 induces gastric cancer cells invasion in vitro To investigate the role of IL-6 in gastric cancer invasion, we add extra human recombinant IL-6 into the culture medium for SGC-7901 cells, since this cell line secrete lower IL-6 compared with the other cell lines. Transwell invasion assays were performed to test the effect of altering IL-6 on cell invasion. We found that human recombinant IL-6 led to a significant increase of cell invasion in SGC-7901 cells (P < .05, Fig. 2B (a–b) and 2C), the result showed that IL-6 treatment increased SGC-7901 invasion reach to about 40.2% compared with the control group. As cell invasion also related with matrix metalloproteinases secretion, thus we further detected the MMPs in culture medium after cells treated with IL-6 for 48 h, as shown in Fig. 3A (a–b) and 3B, IL-6 treated cells have a high level of both MMP2 and MMP9 in conditional medium. Thus, IL-6 may exert a pro-metastatic effect on gastric cancer cells. To further validate our conclusion, we used Anti-IL-6 neutralize antibody to diminish the effect of IL-6 in culture medium, as shown in Fig. 2D (a–b) and E, when we use anti-IL-6 antibody pretreated with the HSC-39 cells, which secrete more IL-6 compared with the other cell lines. The cell invasive ability was dramatically decreased about 60% compared with the Anti-IgG group. Similarly, we also showed that neutralizing the IL-6 in HSC-39 cells decreased the MMP2 and MMP9 secretion, as shown in Fig. 3C (a–b) and Fig. 3D. Taken together, these data suggested that IL-6 secretion is essential for gastric cancer cells invasion in vitro.
2.11. Statistical analysis Results are expressed as Mean ± SEM. Significance was calculated with the SPSS13.0 statistical software (SPSS, Chicago, IL, USA). Comparisons between 2 groups were performed with an unpaired 2tailed Student’s t-test and multiple group comparisons were performed ANOVA. Difference were considered significant when P < .05. 3. Results 3.1. Highly expression of IL-6 in blood is correlated with gastric cancer To know the expression level of IL-6 in gastric cancer, the ELISA technique was used to determine the IL-6 level in plasma from 50 gastric cancer patients and 50 normal control patients randomly. As shown in Fig. 1A, the amount of IL-6 in tumor patients was higher compared with the control group. We further extracted the RNA from both gastric cancer tissue as well as its conjuncted tissues, we then performed real-time PCR to analysis the mRNA level between the two groups, as shown in Fig.1B, the IL-6 expression level in cancer tissue was higher in comparison with the paracancer tissue. Similarity, we shown in Fig. 1C that the protein expression in cancer tissue and paracancer tissue was further confirmed our conclusion. We next detected the IL-6 secretion in supernatant and protein expression of different gastric cancer cell lines, the data showed that SGC-7901 cell lines with a lower level of IL-6 expression but HSC-39 cells with a high
3.3. Non-toxicity dose of Resveratrol inhibits IL-6 induced invasion Resveratrol has been studied extensively for its anticancer properties in various types of cancers [12]. In this study, we are considering whether RSV could reverse the IL-6 induced cell invasion and MMPs Fig. 1. The levels of IL-6 was significantly higher in gastric cancer patients than those in control normal groups (P < .001, Student's t-test). (A) ELISA assay to show the level of IL-6 in gastric patients. Horizontal lines represent the mean values for IL-6 between the noncancer and cancer patients. (B) IL-6 mRNA expression level and (C) protein expression level in gastric cancer and its associated conjuncted tissue. (D) IL-6 mRNA expression level and (E) protein expression level in different gastric cancer cell lines. *p < .05, **p < .01, ***p < .005.
768
Biomedicine & Pharmacotherapy 99 (2018) 766–773
T. Yang et al.
Fig. 2. IL-6 induces invasion activity of gastric cancer SGC7901 cells. (A) The cell viability of SGC7901 cell were measured by MTT assay after cells treated with different doses of RSV. (B) SGC7901 cells were seeded to the upper Boyden chamber and human recombinant IL-6 was added into the culture medium and placed cover the cells. After 48 h, the invasive cells were stained, and photos were taken under microscope. (C) The invasion activity of SGC7901 cell was measured by counting the staining positive cells. (D) HSC-39 cells were seeded to the upper Boyden chamber and IL-6 neutralizing antibody or resveratrol were added into the culture medium and placed in the upper chamber. After 48 h, the invasive cells were stained, and photos were taken under microscope. (E) The invasion activity of HSC-39 cell was measured by counting the staining positive cells. Columns show mean number of cells harvested for 3 experiments done in triplicate (*p < .05, ***p < .005).
769
Biomedicine & Pharmacotherapy 99 (2018) 766–773
T. Yang et al.
Fig. 3. RSV treatment suppress IL-6 induced MMP-2 and -9 expressions. (A and C) Cell supernatant were harvested from different treatment and then subjected to Gelatinase zymograms assay. (B and D) Relative intensity (MMP/no treatment group) of data from Gelatinase zymograms analysis was shown into a histogram. Columns show mean number of cells harvested for 3 experiments done in triplicate (*p < .05, ***p < .005).
secretion. We firstly detected different dose of RSV on cell viability, as shown in Fig. 2A, we used 10 and 20 μM for this study since the concentration lower than 20 μM has no effective role for cell viability. We then combined treatment the SGC-7901 cells with both RSV and IL-6, the data in Fig. 2B (c–d) and 2C showed that RSV could reverse the IL-6 induced invasion, the inhibition ratio for 10 μM and 20 μM of resveratrol reached to 18.3% and 37%, respectively, as well as the MMPs secretion as shown in Fig. 3A (c–d) and 3B. Similarly, in HSC-39 cell line, which has a high level of IL-6, we observed that treatment with resveratrol significantly decreased the cell invasion as well as the MMP2 and MMP9 secretion, as shown in Fig. 2D (c–d), Fig. 2E, Fig. 3C (c–d) and Fig. 3D. Taken together, these data demonstrate that RSV mediates in preventing the IL-6 induced cancer cell invasion and metastasis.
found that blocking the MAPK activation also inhibited the IL-6 induced MAPK signaling activation, as well as the IL-6 induced cell invasion (Fig. 4C) and MMPs secretion (Fig. 4D). Taken together, these data showed that IL-6 induced SGC-7901 cell invasion through the RafMAPK signaling. Our data showed RSV reversed the IL-6 induced cancer cell invasion, however, the mechanisms is not fully understood. In this study, as shown in Fig. 4A (d–e) and 4B, the data showed that RSV blocked the activation of Raf/MAPK signaling induced by IL-6, as indicated by the phosphorylation of Raf/ERK, which indicated that RSV could reverse the IL-6 induced Raf/MAPK signaling activation to block the cancer cell invasion and MMPs secretion.
3.5. Resveratrol has the potential to inhibit the IL-6 induced metastasis of gastric cancer cell
3.4. Resveratrol inhibits IL-6 induced invasion and MMPs secretion through Raf/MAPK pathway
To validate the correlation of IL-6, p-Raf, MMP2 and MMP9, we stained the clinical gastric cancer tissue with the specific antibodies, as shown in Fig. 5A, the data showed that IL-6 high expression tissues with a high expression of p-Raf, MMP2 and MMP9, which indicated there is a positive correlation among IL-6, p-Raf and MMPs. Next, we are wondering whether resveratrol could inhibit the IL-6 associated cell metastasis in vivo, we transfected and selected a stable luciferase labelled HSC-39 cells, we injected the cells into vein tail of nude-mice. We then measured the metastasis ability under bioluminescence three weeks later. As shown in Fig. 5B, we injected the HSC-39 cells into 5 mice each group through vein tail, we treated the mice with anti-IL-6 antibody or resveratrol every four days for 3 weeks, the data showed that resveratrol or Anti-IL-6 treated mice has a significant inhibition of cancer cell metastasis.
IL-6 is a secreted cytokine with multiple functions, previous studies showed that IL-6 binds to its receptors to trigger many distinct pathways activation, including Jak/STAT, Raf/MAPK, and PI3-K/Akt pathways in different types of cancer [21]. In gastric cancer cell lines, the detailed pathways invasion induced by IL-6 is still unclear. To investigate whether Raf/MAPK signaling was involved in IL-6 stimulation, we first checked the expression levels of phosphorylated-Raf, phosphorylated-ERK pathways after cells incubation with IL-6. As shown in Fig. 4 A (a–b) and 4B, IL-6 induced Raf/MAPK signaling activation as indicated by the phosphorylation of Raf and ERK. To further confirm the Raf-ERK pathway activation induced by IL-6 involved in SGC-7901 cell invasion, we used MAPK pathway inhibitors, U0126, to block the activation of ERK signaling. As shown in Fig. 4A(c) and 4B we 770
Biomedicine & Pharmacotherapy 99 (2018) 766–773
T. Yang et al.
Fig. 4. Activation of Raf/MAPK pathway by IL-6 stimulation. (A) Phosphorylated Raf and phosphorylated ERK proteins were measured after cells were treatment with different condition for 48 h. Total Raf, ERK and β-actin were used as the internal loading control. (B) Relative intensity (p-Raf/Raf and p-ERK/ERK) of data from western blot were analyzed and showed into a histogram. (C) SGC7901 cells were seeded to the upper Boyden chamber, human recombinant IL-6 and different dose of U0126 was added into the culture medium and placed cover the cells. After 48 h, the invasive cells were stained, and photos were taken under microscope. (D) Cell treated with IL-6 and U0126, then supernatant were harvested from different treatment and then subjected to Gelatinase zymograms assay. Relative intensity (MMP/no treatment group) of data from Gelatinase zymograms analysis was shown under the bands. Columns show mean number of cells harvested for 3 experiments done in triplicate (*p < .05, **p < .005).
4. Discussion
transformation [26,27]. It has been applied as a potential therapy target by interfering the cytokines in clinician [28]. Malignant tumor cell invasive into surrounding tissues should overcome three main barriers, namely the extracellular matrix (extracellular matrix, ECM) degradation, invasion and metastasis, and cell proliferation [6,29]. It is necessary that secretion of MMPs, like MMP2 and MMP9 by cancer cells to degradation the barrier is the initial step for cancer migration and invasion [23,30], resulting in gastric cancer cell metastasis to other tissues [31]. This process may dependent on distinct pathways activation. In this study, we found that activation of Ras-MAPK pathway induced by IL-6 was involved in gastric cancer invasion, even though there was a report documenting that IL-6 activation of MAPK pathways in prostate cancer cells to induce tumor cell proliferation and the total activation of ERK can improve athletic ability of tumor cells to reduce adhesion between cells [32,33], the involvement of Raf-MAPK pathway activation contributes to invasion of gastric cancer is still need further studied. It’s quite interesting to find potential drugs for invasive cancer treatment. In recent years, the anti-tumor activities of Chinese herbal have attracted more and more laboratory workers as well as clinicals [13,34–36]. However, due to the complexity ingredients of Chinese herbal medicine, the anticancer properties of the ingredients extracted from herbal need further elaboration [35]. Previous studies have shown
Clinical studies have shown that tumor metastasis and migration of human gastric cancer is the leading cause of death. IL-6 is an important inflammatory cytokine. Previous studies have reported that there is abundant pro-inflammatory cytokines including IL-6 secreted by cancer cells. Previous studies have shown that increased secretion of IL-6 plays an important role in promoting cancer cell proliferation, adhesion and metastasis [22,23]. In this study, we initially detected the expression status of IL-6 in samples of surgical resected gastric cancer tissues. Our data indicated that the level of IL-6 expression in gastric cancer was significantly higher than that in normal tumor-adjacent tissues. Until now, the functions of IL-6 in gastric cancer is not fully understand, even though it has been reported that in vitro cultured cells, IL-6 is usually established as a chemo-attractive to induce tumor cell migration and invasion [24,25]. Importantly, our data demonstrated that high level of IL-6 was correlated with a significant cancer invasion and metastasis. We further showed that resveratrol has the potential to reverse IL-6 enhanced cancer malignance. Altogether, these results suggest that IL-6 expression is critical for prognosis determination in gastric cancer patients. In cancer cell model or cancer patients, cytokines continues secretion in special condition is one of the reasons for cancer malignant 771
Biomedicine & Pharmacotherapy 99 (2018) 766–773
T. Yang et al.
Fig. 5. Resveratrol has the potential to inhibit the IL-6 induced metastasis of gastric cancer cell. (A) IHC staining showed that IL-6 has a positive correlation with p-Raf signaling and MMP2/9 in clinical samples. (B) Metastasis model showed that anti-IL-6 antibodies and resveratrol treatment has the potential to inhibit the HSC-39 cells metastasis in mice.
inhibition of the Raf/ERK pathway, this will provide a theoretical basis for the use of resveratrol in applicating as an anticancer drug. Based on the above indicated properties of resveratrol, it will be a bright future for the coming trail of RSV in clinical. In summary, as shown in Fig. 6, the studies showed that the invasion of human gastric cancer cells induced by IL-6 via activation of the Raf-MAPK signaling activation, and further study showed the RSV could block the IL-6 induced invasion through the blocking of this pathway. These findings will be providing a theoretical basis for designing cancer prevention strategies.
that resveratrol, the major ingredient from Polygonum herbal, is a natural phytoalexin, have the ability to inhibit tumor growth, induce tumor cell apoptosis as well as block tumor metastasis [12,34]. Resveratrol has been reported to induce esophageal cancer, liver cancer, stomach cancer, breast cancer, cervical cancer, prostate cancer and other tumor cells growth inhibition and apoptosis through district mechanisms [37–39]. In agreement with these reports, in our study, we are using human gastric cancer cells as a model, we found that low dose of RSV inhibits human gastric cancer cell invasion induced by IL-6, majority by blocking the IL-6 induced Raf-MAPK pathway activation. Interesting, RSV was also reported to reduce the IL-6 production and secretion, which is important for tumor microenvironment changes and inflammation. On the other hand, using mouse model, our study further showed that both resveratrol treatment and IL-6 neutralize antibody could block the gastric cancer cell metastasis in vivo. Therefore, we suggest that IL-6-induced gastric cancer invasion and metastasis is mediated through a Raf/ERK-dependent pathway. Then, resveratrol suppresses IL-6 induced cell migration and metastasis through
Authors contributions TTY and JMZ performed experiments, data analysis and contributed to the manuscript preparation. JMZ contributed towards collecting the patients’ samples from the division of Gastroenterology of the hospital. JTZ, MXZ and LW contributed to discussion and proofreading. TTY and LHY were responsible for the conception and design of the study, data 772
Biomedicine & Pharmacotherapy 99 (2018) 766–773
T. Yang et al.
[11] J. Burns, T. Yokota, H. Ashihara, M.E. Lean, A. Crozier, Plant foods and herbal sources of resveratrol, J. Agric. Food Chem. 50 (2002) 3337–3340. [12] M. Athar, J.H. Back, L. Kopelovich, D.R. Bickers, A.L. Kim, Multiple molecular targets of resveratrol: anti-carcinogenic mechanisms, Arch. Biochem. Biophys. 486 (2009) 95–102. [13] T. Yang, L. Wang, M. Zhu, L. Zhang, L. Yan, Properties and molecular mechanisms of resveratrol: a review, Die Pharm.-Int. J. Pharm. Sci. 70 (2015) 501–506. [14] M. Hasan, H. Bae, An overview of stress-induced resveratrol synthesis in grapes: perspectives for resveratrol-enriched grape products, Molecules 22 (2017) 294. [15] R. Frazzi, M. Guardi, Cellular and molecular targets of resveratrol on lymphoma and leukemia cells, Molecules (2017) 22. [16] D.C. Ferraz da Costa, E. Fialho, J.L. Silva, Cancer chemoprevention by resveratrol: the p53 tumor suppressor protein as a promising molecular target, Molecules 22 (2017) 1014. [17] J. Zhang, J. Chiu, H. Zhang, T. Qi, Q. Tang, K. Ma, et al., Autophagic cell death induced by resveratrol depends on the Ca(2+)/AMPK/mTOR pathway in A549 cells, Biochem. Pharmacol. 86 (2013) 317–328. [18] Q. Xie, Y. Yang, Z. Wang, F. Chen, A. Zhang, C. Liu, Resveratrol-4-OD-(2’-galloyl)glucopyranoside isolated from Polygonum cuspidatum exhibits anti-hepatocellular carcinoma viability by inducing apoptosis via the JNK and ERK pathway, Molecules 19 (2014) 1592–1602. [19] Q. Yang, B. Wang, W. Zang, X. Wang, Z. Liu, W. Li, et al., Resveratrol inhibits the growth of gastric cancer by inducing G1 phase arrest and senescence in a Sirt1dependent manner, PLoS One 8 (2013) e70627. [20] Z. Wang, W. Li, X. Meng, B. Jia, Resveratrol induces gastric cancer cell apoptosis via reactive oxygen species, but independent of sirtuin1, Clin. Exp. Pharmacol. Physiol. 39 (2012) 227–232. [21] T. Hirano, K. Nakajima, M. Hibi, Signaling mechanisms through gp130: a model of the cytokine system, Cytokine Growth Fact. Rev. 8 (1997) 241–252. [22] A. Eltweri, L. Howells, A. Thomas, A. Dennison, D. Bowrey, PWE-169 treatment of oesophageal cell lines with docosahexaenoic fatty acid (DHA) and oxaliplatin: effects on proliferation, expression of vascular endothelial growth factor and IL-6, Gut 64 (2015) A286–A287. [23] M.T. Lin, B.R. Lin, C.C. Chang, C.Y. Chu, H.J. Su, S.T. Chen, et al., IL-6 induces AGS gastric cancer cell invasion via activation of the c-Src/RhoA/ROCK signaling pathway, Int. J. Cancer 120 (2007) 2600–2608. [24] M. Rokavec, M.G. Oner, H. Li, R. Jackstadt, L. Jiang, D. Lodygin, et al., IL-6R/ STAT3/miR-34a feedback loop promotes EMT-mediated colorectal cancer invasion and metastasis, J. Clin. Invest. 124 (2014) 1853–1867. [25] K. Taniguchi, M. Karin, IL-6 and related cytokines as the critical lynchpins between inflammation and cancer, Seminars in Immunology, Elsevier, 2014. [26] M.C. Patra, S. Choi, Recent progress in the molecular recognition and therapeutic importance of Interleukin-1 receptor-associated Kinase 4, Molecules (2016) 21. [27] F. Rusolo, B. Pucci, G. Colonna, F. Capone, E. Guerriero, M.R. Milone, et al., Evaluation of selenite effects on selenoproteins and cytokinome in human hepatoma cell lines, Molecules 18 (2013) 2549–2562. [28] G. Dranoff, Cytokines in cancer pathogenesis and cancer therapy, Nat. Rev. Cancer 4 (2004) 11–22. [29] D.E. Kleiner, W.G. Stetler-Stevenson, Matrix metalloproteinases and metastasis, Cancer Chemother. Pharmacol. 43 (Suppl) (1999) S42–51. [30] M. Zou, X. Zhang, C. Xu, IL6-induced metastasis modulators p-STAT3, MMP-2 and MMP-9 are targets of 3, 3′-diindolylmethane in ovarian cancer cells, Cell. Oncol. 39 (2016) 47–57. [31] Y. Yonemura, Y. Endou, H. Fujita, S. Fushida, E. Bandou, K. Taniguchi, et al., Role of MMP-7 in the formation of peritoneal dissemination in gastric cancer, Gastric Cancer 3 (2000) 63–70. [32] M. Sano, K. Fukuda, T. Sato, H. Kawaguchi, M. Suematsu, S. Matsuda, et al., ERK and p38 MAPK, but not NF-κB, are critically involved in reactive oxygen species–mediated induction of IL-6 by angiotensin II in cardiac fibroblasts, Circ. Res. 89 (2001) 661–669. [33] A.P. Costa-Pereira, Regulation of IL-6-type cytokine responses by MAPKs, Biochem. Soc. Trans. 42 (2014) 59–62. [34] M. Athar, J.H. Back, X. Tang, K.H. Kim, L. Kopelovich, D.R. Bickers, et al., Resveratrol: a review of preclinical studies for human cancer prevention, Toxicol. Appl. Pharmacol. 224 (2007) 274–283. [35] T. Efferth, P.C. Li, V.S. Konkimalla, B. Kaina, From traditional Chinese medicine to rational cancer therapy, Trends Mol. Med. 13 (2007) 353–361. [36] C.K. Singh, M.A. Ndiaye, N. Ahmad, Resveratrol and cancer: challenges for clinical translation, Biochim. Biophys. Acta, Mol. Basis Dis. 1852 (2015) 1178–1185. [37] A.K. Joe, H. Liu, M. Suzui, M.E. Vural, D. Xiao, I.B. Weinstein, Resveratrol induces growth inhibition, S-phase arrest, apoptosis, and changes in biomarker expression in several human cancer cell lines, Clin. Cancer Res. 8 (2002) 893–903. [38] M.A. Seyed, I. Jantan, S.N.A. Bukhari, K. Vijayaraghavan, A comprehensive review on the chemotherapeutic potential of piceatannol for cancer treatment, with mechanistic insights, J. Agric. Food. Chem. (2016). [39] J. Zhang, K. Ma, T. Qi, X. Wei, Q. Zhang, G. Li, et al., P62 regulates resveratrolmediated Fas/Cav-1 complex formation and transition from autophagy to apoptosis, Oncotarget 6 (2015) 789–801.
Fig. 6. A short diagram shown IL-6 induced SGC7901 cancer cell invasion through the activation of Raf/MAPK pathway, RSV has the ability to reduce the IL-6 production and secretion, which played an important role for inducing cancer invasion by through activation of the Raf/MAPK pathway.
presentation and manuscript preparation. All authors read and approved the final manuscript. Conflict of interest The authors declare no conflict of interest. Acknowledgement This work was supported by High-Level Personal Special Support Fund of Lishui City (2014RC27) to Dr. YAN. References [1] J.W. Morgan, L. Ji, G. Friedman, M. Senthil, C. Dyke, S.S. Lum, The role of the cancer center when using lymph node count as a quality measure for gastric cancer surgery, JAMA Surg. 150 (2015) 37–43. [2] X.Z. Chen, W.H. Zhang, J.K. Hu, A difficulty in improving population survival outcome of gastric cancer in mainland China: low proportion of early diseases, Med. Oncol. 31 (2014) 315. [3] L. Ye, Z.Y. Zhang, W.D. Du, M.E. Schneider, Y. Qiu, Y. Zhou, et al., Genetic analysis of ADIPOQ variants and gastric cancer risk: a hospital-based case-control study in China, Med. Oncol. 30 (2013) 658. [4] J. Deng, R. Zhang, L. Wu, L. Zhang, X. Wang, Y. Liu, et al., Superiority of the ratio between negative and positive lymph nodes for predicting the prognosis for patients with gastric cancer, Ann. Surg. Oncol. 22 (2015) 1258–1266. [5] I.S. Lee, Y.S. Park, M.H. Ryu, M.J. Song, J.H. Yook, S.T. Oh, et al., Impact of extranodal extension on prognosis in lymph node-positive gastric cancer, Br. J. Surg. 101 (2014) 1576–1584. [6] N. Johansson, M. Ahonen, V.M. Kahari, Matrix metalloproteinases in tumor invasion, Cell. Mol. Life Sci. 57 (2000) 5–15. [7] Y. Ichikawa, T. Ishikawa, K. Tanaka, S. Togo, H. Shimada, Extracellular matrix degradation enzymes: important factors in liver metastasis of colorectal cancer and good targets for anticancer metastatic therapy, Nihon Geka Gakkai Zasshi 102 (2001) 376–380. [8] G.T. Brown, G.I. Murray, Current mechanistic insights into the roles of matrix metalloproteinases in tumour invasion and metastasis, J. Pathol. 237 (2015) 273–281. [9] M. Rokavec, M.G. Öner, H. Li, R. Jackstadt, L. Jiang, D. Lodygin, et al., IL-6R/ STAT3/miR-34a feedback loop promotes EMT-mediated colorectal cancer invasion and metastasis, J. Clin. Invest. 125 (2015) 1362. [10] S. Renaud, M. de Lorgeril, Wine, alcohol, platelets, and the French paradox for coronary heart disease, Lancet 339 (1992) 1523–1526.
773