Resveratrol mediated cancer cell apoptosis, and modulation of multidrug resistance proteins and metabolic enzymes

Phytomedicine 55 (2019) 269–281

Contents lists available at ScienceDirect

Phytomedicine journal homepage: www.elsevier.com/locate/phymed

Original Article

Resveratrol mediated cancer cell apoptosis, and modulation of multidrug resistance proteins and metabolic enzymes

T

Mahmoud Zaki El-Readia,b,d, , SafaaYehia Eida,d, Ahmed Ali Abdelghanyb, Hiba Saeed Al-Amoudia, Thomas Efferthc, Michael Winkd ⁎

a

Department of Biochemistry, Faculty of Medicine, Umm Al-Qura University, Makkah, Saudi Arabia Department of Biochemistry, Faculty of Pharmacy, Al-Azhar University, 71524, Assiut, Egypt c Department of Pharmaceutical Biology, Institute of Pharmacy and Biochemistry, University of Mainz, Staudinger Weg 5, 55128, Mainz, Germany d Department of Pharmaceutical Biology, Institute of Pharmacy and Molecular Biotechnology, Heidelberg University, Im Neuenheimer Feld 364, 69120, Heidelberg, Germany b

ARTICLE INFO

ABSTRACT

Keywords: Resveratrol Multidrug resistance Chemoprevention of cancer

Background: The degree of intracellular drug accumulation by specific membrane transporters, i.e., MDR1, BCRP, and MRP, and the degree of detoxification by intracellular metabolic enzymes, i.e., CYP3A4 and GST, provide control for cancer chemotherapy through diminishing the propensity of cancer cells to undergo apoptosis which in turn modulates the unresolved and complex phenomenon of multidrug resistance (MDR) for the cancer cells. Hypothesis/Purpose: This study dwells into the interaction details involving ABC-transporters, CYP3A4, GST and cytotoxic effects of resveratrol on different cell lines. Methods: Resveratrol was evaluated for its ability modulating the expression and efflux functions of P-gp /MDR1, MRP1, and BCRP in the multidrug-resistant human colon carcinoma cell line, Caco-2, and CEM/ADR5000 cells through flow cytometry and RTPCR technique. Results: The resveratrol influenced P-gp and MRP1 efflux functions whereby it increased rhodamine 123 with calcein accumulation in concentration-dependent manner (1 – 500 µM) in the Caco-2 cell lines and inhibited the effluxes of both the substrates also as concentration-dependent phenomenon (10 – 100 µM) in the p-gp overexpressing CEM/ADR5000 cells through FACS (full form). The treatment of drug-resistant Caco-2, and CEM/ ADR5000 cells with doxorubicin (DOX) along with 20 µM of resveratrol in the mixture. It increased the cell sensitivity DOX towards the DOX and enhanced the cytotoxicity. The resveratrol inhibited both CYP3A4 and GST enzymatic activity in a concentration-dependent way and induced apoptosis in the resistance cell lines because of increased levels of caspase-3, -8,-6/9 and incremental phosphatidyl serine (PS) exposure as detected by flow cytometry. The treatment of Caco-2 cells with resveratrol showed significantly lower p-gp, MRP1, BCRP, CYP3A4, GST, and hPXR mRNA levels in a 48 h observation. Conclusion: The result confirmed resveratrol mediated inhibition of ABC-transporters’ overall efflux functions, and its expression, and apoptosis as well as metabolic enzymes GST and CYP3A4 activity.

Introduction One of the major problems of cancer chemotherapy concerns with

the unpredictability of therapeutic effects due to cancer cells acquiring resistance to drugs and natural products which have been in use for the purpose, e.g. anthracyclines, Vinca alkaloids, podophyllotoxins based

Abbreviations: BCRP, breast cancer resistance protein; CASP, Caspase; DMSO, dimethyl sulfoxide; DNA, deoxyribonucleic acid; DNase, deoxy ribonuclease; dNTP, 2´-Deoxy ribonucleoside 5´-triphosphate; DSMZ, German collection of microorganism and cell cultures; EDTA, ethylene diamine tetraacetic acid; FACS, fluorescence activated cell sorter; GSH, glutathione; GST, glutathione-S-transferase; hPXR, human pregnane X receptor; IC50, half maximal inhibitory concentration; MDR, multidrug resistance; mRNA, messenger-RNA; MRP, multidrug resistance associated protein; MTT, 3-[4,5-Dimethyl thiazol-2-yl]-2,5-diphenyl tetrazolium bromide; NBD, nucleotide binding domain; NEAA, non essential amino acids; NF-kB, nuclear factor-kappa B; P53, tumor suppressor protein p53; PBS, phosphate buffer saline; PCR, polymerase chain reaction; Pen/Strep, penicillin/streptomycin; P-gp, P-glycoprotein; Pl, propidium iodide; Rho123, rohdamin 123; RT, reverse transcription; β 2mg, β2 microglobulin; ΔFU, difference in fluorescence unit ⁎ Corresponding author. Department of Clinical Biochemistry, Faculty of Medicine, Umm Al-Qura University, Abdia, Makkah, Saudia Arabia. E-mail address: [email protected] (M.Z. El-Readi). https://doi.org/10.1016/j.phymed.2018.06.046 Received 18 November 2017; Received in revised form 11 June 2018; Accepted 19 June 2018 0944-7113/ © 2018 Published by Elsevier GmbH.

Phytomedicine 55 (2019) 269–281

M.Z. El-Readi et al.

drugs. The phenomenon is known as multidrug resistance (MDR) (Ling, 1997). The MDR is considered a multifactorial response determined by various inter-dependent and independent biomechanistic pathways involving certain cell lines. One of the most common ways a tumour acquires resistance is the induction and activation of efflux transporter proteins such as ATP-binding cassettes (ABC) transporter. This mechanism affects the drug transmembrane equilibrium at the plasma-membrane level. The increased expression of these transporters lead to a decrease in drug accumulation in the cell (Meijerman et al., 2008). Several membrane transport proteins are involved in MDR including P-glycoprotein/MDR1, Multidrug Resistance Protein (MRP1), and Breast Cancer Resistance Protein (BCRP) genes products (Chen et al., 1986). The most common type is the P-glycoprotein (P-gp) which acts as an efflux pump for cytotoxic agents results in decreased intracellular concentrations of the drug. The sites of expression indicates that the P-gp is involved in the detoxification of xenobiotics in order to protect specific organs (Johnstone et al., 2000) also. Moreover, the increased MDR1 gene transcription and translation activities pushes to an increased doxorubicin efflux and therefore reduceing the drug uptake in cancer cells. The second mechanism confers drug-resistance to cancer cell, and exerts its effects at the intracellular levels. The gene systems are thought to be related to intracellular drug resistance involving CYP3A4 (Gupta et al., 2008), and glutathione-S-transferase (Kano et al., 1987). These enzymes are involved in cellular detoxification and the potential xenobiotics are avoided for the accumulation of the products in the cancer cells. Additionally, it has been suggested that the inability of cells to undergo apoptosis leads to further initiation and progression of cancers with critical cause for the tumors acquiring drug resistance. The induction of apoptosis is a major modality through which anti-cancer agents eliminate the cell targets and the relevant biomechanism for cellular protection is represented by loss of pro-apoptotic factors, and the overexpression of the anti-apoptotics (Gillet and Gottesman, 2010). The resveratrol (3, 4′,5‐trihydroxy‐trans‐stilbene (Fig. 1) is a polyphenol, naturally occurring in grapes, peanuts and several other plants. It has been reported for anticancer, antiaging, and anti‐inflammatory properties (Zordoky et al., 2015). In the present study, we investigated the inhibitory effect of resveratrol to understand the interaction of resveratrol in cancer cells. The potential modulation of MDR proteins (MDR1, MRP1, and BCRP), metabolic enzymes (GST and CYP3A4), and their ability to induce apoptosis in cancer cells was studied.

(CDNB), reduced glutathione, and glutathione S-transferase, verapamil (98%), ketoconazole (99%), resveratrol (99%), doxorubicin (98%) (Dox.), propidium iodide, rhodamine123 (Rho123), and calcein acetoxymethyl ester (CAM) were provided by Sigma-Aldrich® (Taufkirchen, Germany). Annexin-V-FLUOS, First Strand cDNA Synthesis Kit for PCR (AMV), LightCycler-FastStart DNA Master SYBR Green I Kit were purchased from Roche Applied Science (Mannheim, Germany). The RNeasy Mini Kit was obtained from Qiagen (Hilden, Germany). Caspase-3 substrate; DEVD-AFC, 7-amino-4-trifluoromethyl coumarin (AFC), caspase-8 substrate; IETD-AFC caspase-9/6 substrate; LEHD-AMC 7-amino4-methyl coumarin (AMC) came from BD Biosciences (Heidelberg, Germany). DMSO, methanol (p.a.), HPLC-grade water were purchased from VWR® (Darmstadt, Germany). Cell culture The following cell lines were grown in DMEM medium: human hepatocellular carcinoma HepG-2, human cervical carcinoma HeLa and colorectal adenocarcinoma Caco-2 cell lines. Adriamycin resistance leukemia cell CEM/ADR5000 and its parent sensitive cells CCRF-CEM were maintained in RPMI-1640. The Caco-2 cells overexpress MDR1, MRP1, and BCRP. All the cell cultures were supplemented with 10% fetal calf serum (v/v), 1% L-glutamine, streptomycin (100 µg/ml) and penicillin (100 IU/ml). Sodium pyruvate 1% and non-essential amino acid 1% added in case of Caco-2. Cells were grown at 37 °C, 100% humidity and 5% CO2 and were routinely tested for mycoplasma. Cells were harvested from confluent cultures, using 0.01% w/v trypsin, and 0.001% w/v EDTA, after washed three times in phosphate buffered saline (PBS). CEM/ADR5000 cells are maintained in RPMI-1640 media supplemented with 5 µg/ml doxorubicin (adriamycin) to sustain its P-gp expression and doxorubicin resistance. Experiments were carried out with cells cultured 7 – 10 days out of drug. Cytotoxicity and cell proliferation MTT assay The response of exponentially growing Caco-2, HepG-2, and HeLa cell lines to resveratrol was studied using MTT cell viability assay (Carmichael et al., 1987). Cell lines were grown for this assay in complete media as described above and seeded in 96-well plates in density of 2 × 103, 5 × 103, and 1 × 103 cells/well for each cell lines, respectively. The cells were treated with various concentrations of resveratrol (up to 500 µM) for 24 h. 0.5 mg/ml MTT was added in each well and incubation was continued for 4 h. The formazan formed crystals were dissolved in DMSO. Absorbance was detected at 570 nm using Tecan Safire II™ (Crailsheim, Germany). In case of CCRF-CEM, and CEM/ADR5000, the cells were incubated with resveratrol for 48 h.

Materials and methods Chemicals Media and supplements for cell culture were obtained from Gibco® (Invitrogen, Karlsruhe, Germany) or Oxoid® (Wesel, Germany), and Becton Dickinson® (Heidelberg, Germany). FBS was obtained from Biochrome® (Berlin, Germany). 3-(4,5-dimethylthiazol-2-yl)−2,5-diphenyl-tetrazolium bromide (MTT), 1‑chloro‑2, 4-dinitrobenzene

CYP3A4 activity assay CYP450-Glo™ CYP 3A4 Assay (Promega®, Mannheim, Germany) was used to detect the effects of resveratrol on recombinant human CYP3A4 enzyme according to the protocol of the manufacturer (Cali et al., 2006). Briefly: equal volumes of different concentration of resveratrol (final concentration 100 µM) and the reaction mixture containing the specific substrate and one picomolar of microsomal CYP3A4 enzyme, were incubated in 96-well white plate for 10 min. A NADPH regeneration system containing NADP+, glucose-6-phosphate and glucose-6-phosphate dehydrogenase was added and left for 30 min. Luciferin detecting reagent was added and the luminescence was detected using ELISA reader after 20 min. The amount of light emitted was proportional to the CYP3A4 activity. The effects of resveratrol were evaluated relative to blank control and 10 µM ketoconazole as a positive control.

Fig. 1. Chemical structures of resveratrol. 270

Phytomedicine 55 (2019) 269–281

M.Z. El-Readi et al.

Glutathione-S-transferase assay

Efflux of Rhodamine123

The HepG-2 cell lines were treated with several concentrations of resveratrol for 24 h; the cells were sonicated in GST sample buffer, and centrifuged for 15 min at 10,000 × g and 4 °C. The supernatant was collected and used for this assay. GST activity was measured in triplicate at 37 °C using 1 mM L‑chloro‑2,4-dinitrobenzene (CDNB) as substrate (Habig et al., 1974). This assay is based upon the GST-catalyzed reaction between GSH and GST substrate; CDNB. Under certain conditions the interaction between glutathione and CDNB is totally dependent on the presence of active GST. The GST-catalyzed formation of GSDNB produces a dinitrophenyl thioether, which can be detected by spectrophotometer at 340 nm. One unit of GST activity is defined as the amount of enzyme producing 1 µmol of GS-DNB conjugate/min under the conditions of the assay.

Cell seeding and growth conditions were identical to those utilized in accumulation experiments. At confluence, Caco-2 cells in 96-well plates were washed twice with PBS and incubated 60 min at 37 °C with 1 µg/ml Rho123 in order to load the cells with Rho123. Cells were then washed 2 times with PBS, following which medium containing 100 µM of resveratrol. After incubation at 37 °C for 0 – 120 min, cells were washed 2 times with cold PBS. The fluorescence of Rho123 in cells was measured, as described above, to determine the time dependent effect of tested samples. Measurement of doxorubicin cytotoxicity (reversal assay) Reversal of resistance was determined in cytotoxicity assays using the MTT assay previously described (Carmichael et al., 1987). Briefly, fully differentiated cells were harvested and seeded at a density of 2 × 104 cells/well for the colon cancer (Caco-2) cell lines and 3 × 104 cells/well for the leukaemia cancer (CEM/ADR5000) cell lines in flatbottom 96-well plates. The cells were incubated for 24 h at 37 °C to allow attachment prior to addition of the drugs in case of Caco-2 (while in CEM/ADR5000, the cells were direct incubated with doxorubicin). Doxorubicin at various concentrations was added to the cells, with or without the reversal agent (20 µM of resveratrol), and was incubated at 37 °C in a fully humidified atmosphere of 5% CO2 for 24 h. The doxorubicin cytotoxicity was estimated by using MTT assay as mention above. The reversal ratio was calculated by using the equation in section of statistical analysis section.

Accumulation assay The MDR inhibitory activity of resveratrol was determined using one probe, Rho123, which is very efficiently transported by P-gp, resulting in a larger accumulation deficit than that for doxorubicin and daunorubicin. Rhol23 is a known substrate, not only for P-gp but also for MRP (Twentyman et al., 1994).The use of Rhol23 has, therefore, been suggested to be a useful approach for the determination of P-gp and MRP activity in human cancer cells. Briefly, Caco-2 cells were seeded at 2 × 103 cells/well in 96-well plates and cultured at 37 °C and 5% CO2. The culture medium was changed every other day after seeding until a confluent monolayer was formed (by day 6), as determined by light microscopy. At confluence, cells were washed twice with PBS, at 37 °C. Cells were pre-incubated 30 min at 37 °C with tested compounds 100 µg/ml. Rho123 (1 µg/ml) was then added and further incubation of 90 min at 37 °C. Rho123 accumulation was stopped by washing the cells 2 times with cold phosphate buffer saline (PBS). Rho123 and calcein fluorescence was measured at excitation/emission wavelengths of 500/535 and 485/538 nm, respectively using a spectrofluorometer Tecan Safire II™ (Crailsheim, Germany). Calcein-AM 150 nM was used instead of Rho123 to evaluate the effect of resveratrol on MDR activity.

Measurement of caspase −3, −8, and −6/9 proteolytic activities Caspases are intracellular proteases activated early during apoptosis of mammalian cells and initiated cellular breakdown by degrading specific structural, regulatory, and DNA repair proteins (CasciolaRosen et al., 1996). ApoAlert™ Caspase-fluorescence assay kit BD Biosciences (Heidelberg, Germany) were used to quantify caspase-3, −8, and −6/9 enzyme activity. The enzyme activity was measured by proteolytic cleavage of the fluorogenic specific substrates of each caspases, DEVD-AFC, IETD-AFC, and LEHD-AMC, respectively. CEM/ ADR5000 1 × 106 cells for each probe were treated with or without 20 µM resveratrol for 24 h. Then, cells were collected, washed in PBS and lysed in lysis buffer in the above kit. For the assay, a solution of cell lysates containing 50 µM of caspase-3 or caspase-8 substrate or 250 µM of caspase-6/9 substrate was incubated at 37 °C for 1 h. The release of AFC or AMC from the substrates was measured fluorimetrically using Tecan Safire II™ (Crailsheim, Germany) with an emission/excitation wavelength of 400/505 nm for AFC and with 380/460 nm for AMC. The caspase activities were calculated from slope of standard curve of AFC and AMC using this equation:

FACS flow cytometry Fluorescence measurements of individual cells were performed using FACSCalibur™ (Becton-Dickinson) fluorescence- activated cell sorter (San Jose. CA), equipped with an ultraviolet argon laser (excitation at 488 nm, emission at 530/30 and 570/30 nm band-pass filters). Analysis was gated to include single viable cells on the basis of forward and side light-scatter and based on acquisition of data from 10.000 cells. Log fluorescence was collected and displayed as singleparameter histograms. A modified inhibition assay for the MDR efflux pump in viable resistance leukemia cell lines CEM/ADR5000 was performed with the flow cytometer as previously described (Ashour et al., 2014). The efflux was applied by incubation the cells with marker substrates; 10 µg/ml Rho123 or 2 µM CAM at 37 °C for 2 h, followed by 2 h with the tested substances. The fluorescence intensity of individual cells was recorded as histograms. The mean fluorescence intensity of 10.000 cells was used for comparison among different conditions. Verapamil was selected as a positive control because it can significantly inhibit the P-gp-mediated active efflux of fluorescent substrate markers. For quantization and comparison the result of different concentration, the fluorescence intensity of treated cells was normalizing by calculated the relative fluorescence intensity (inhibitory efficiency) as the percentage of the positive (verapamil) and negative untreated control (Statistical section).

Caspase activity = ( FU/h) ×

1 Curve Slope

Where ΔFU/h = the difference in FU between an uninduced control and an induced sample. Annexin-V/PI double-staining analysis of apoptosis Annexin V, a calcium-dependent phospholipid-binding protein with a high affinity for phosphatidylserine (PS), was used to detect early stage apoptosis (van Engeland et al., 1998). The annexin-V-FLUOS-labeled Apoptosis Detection Kit I was used to detect and quantify apoptosis by flow cytometry according to the manufacturer's instructions. In brief, CEM/ADR5000 cells (1 × 106 cells/ml) were seeded in 6 well plate and cultured overnight in RPMI-1640 medium containing 10% FBS. Then cells were treated with 20 µM resveratrol for 24 h. After that, 271

Phytomedicine 55 (2019) 269–281

M.Z. El-Readi et al.

Table 1 Primers used for real-time RT-PCR. Gene

Accession

Forward primer 5′–3′

Reverse primer 5′–3′

Design

MDR1/ABCB1

NM_001348946.1 GI: 1,149,123,048 NM_004996.3 GI: 134,142,336 NM_004827.2 GI: 62,526,032 NM_033358.3 GI: 122,056,472 NM_004346.3 GI: 73,622,121 M99422.1 GI: 183,662 NM_017460.5 GI: 322,960,990 NM_003889.3 GI: 148,536,875 X07621.1 GI: 29,298

CCCATCATTGCAATAGCAGG

TGTTCAAACTTCTGCTCCTGA

Albermann et al. (2005)

ATGTCACGTGGAATACCAGC

GAAGACTGAACTCCCTTCCT

Gutmann et al. (1999)

AGATGGGTTTCCAAGCGTTCAT

CCAGTCCCAGTACGACTGTGACA

Sauerbrey et al. (2002)

CGGGATCCGCCACCATGGACTTCAGCAGAAATC

TCCCCCGGGCACCATCAATCAGAAGGG

Liu et al. (2002)

TTAATAAAGGTATCCATGGAGAACACT

TTAGTGATAAAAATAGAGTTCTTTTGTGAG

Devarajan et al. (2002)

TACCTGGGCAAGAAGCACGG

AGAGCCCAGAGCAGGTCGTTG

Nijhof et al. (2009)

CTAGCACATCATTTGGACTG

ACAGAGCTTTGTGGGACT

Chen et al. (2007)

TGTCATGACATGTGAAGGATG

TTGAAATGGGAGAAGGTAGTG

Chen et al. (2007)

CCAGCAGAGAATGGAAAGTC

CATGTCTCGATCCCACTTAAC

Oselin et al. (2003)

MRP1/ABCC1 BCRP/ABCG2 Caspase-8 Caspase-3 GST CYP3A4 hPXR β2mg

1. Albermann, N., et al., Expression of the drug transporters MDR1/ABCB1, MRP1/ABCC1, MRP2/ABCC2, BCRP/ABCG2, and PXR in peripheral blood mononuclear cells and their relationship with the expression in intestine and liver. Biochem Pharmacol, 2005. 70(6): p. 949–58. 2. Gutmann, H., et al., Evidence for different ABC-transporters in Caco-2 cells modulating drug uptake. Pharm Res, 1999. 16(3): p. 402–7. 3. Sauerbrey, A., et al., Expression of the BCRP gene (ABCG2/MXR/ABCP) in childhood acute lymphoblastic leukaemia. Br J Haematol, 2002. 118(1): p. 147–50. 4. Liu, B., et al., A novel single amino acid deletion caspase-8 mutant in cancer cells that lost proapoptotic activity. J Biol Chem, 2002. 277(33): p. 30,159–64. 5. Devarajan, E., et al., Down-regulation of caspase 3 in breast cancer: a possible mechanism for chemoresistance. Oncogene, 2002. 21(57): p. 8843–51. 6. Nijhof, A.M., et al., Selection of reference genes for quantitative RT-PCR studies in Rhipicephalus (Boophilus) microplus and Rhipicephalus appendiculatus ticks and determination of the expression profile of Bm86. Bmc Molecular Biology, 2009. 10: p. -. 7. Chen, Y., et al., Human pregnane X receptor and resistance to chemotherapy in prostate cancer. Cancer Res, 2007. 67(21): p. 10,361–7. 8. Oselin, K., et al., Quantitative determination of MDR1 mRNA expression in peripheral blood lymphocytes: a possible role of genetic polymorphisms in the MDR1 gene. Eur J Clin Invest, 2003. 33(3): p. 261–7.

they were harvested in cold PBS and collected by centrifugation for 10 min at 500 × g. Camptothecin was used as a positive control. Cells were then resuspended at a density of 1 × 106 cells/ml in 100 µl binding buffer (HEPES buffer, 10 mM, pH 7.4, 140 mM NaCl, 5 mM KCl, 1 mM MgCl2, and 1.8 mM CaCl2) and stained simultaneously with 5 µl annexin –V-FLUOS (25 ng/ml green fluorescence) and incubated at room temperature for 15 min, in the dark, on ice. Directly before measurement, 2 µl propidium iodide (PI) (50 ng/ml) was added and incubated at room temperature for 5 min, in the dark, on ice then add 400 ul 1X Binding Buffer to each tube. Analyze the cells by flow cytometry within 30 min of staining. Cells were analyzed with a fluorescence-activated cell sorter (FACS) flow cytometer (BectoneDickinson) use 488 nm excitation and measure the fluorescence emission using 530 nm. The data were analyzed with CellQuest software. Annexin Vpositive, PI-negative cells were scored as early apoptotic. Doublestained cells were considered as late apoptotic and PI-positive cells were considered necrosis.

and isolated RNA was stored at −80 °C. First strand cDNA synthesis was performed according to the protocol of the Reverse Transcription System (Promega Corporation; Madison, WI, USA) with OIigo(dT)16 primers (Pharmacia Biotech; Uppsala, Sweden). Quantification of mRNA expression by real-time reverse transcription (RT)-PCR Expressions of mRNAs of the MDR1, MRP1, BCRP, CYP3A4, GST, Caspase-3, and Caspase-8 and of the PXR gene were quantified by realtime RT-PCR with the Light-Cycler™ technology (Roche Applied Science; Mannheim, Germany) using β2-microglobulin (β2mg) as housekeeping gene (Albermann et al., 2005). All primer pairs were synthesized by MWG Biotech (Ebersberg, Germany) and were designed to span intron/exon junctions or to yield larger products with DNA. Therefore, possibly contaminated genomic DNA was either not amplified or could be detected by additional peaks during melting point analysis. Primer sequences and references are specified in Table 1. PCR amplification was carried out in 20 µl reaction volume containing 5 µl 1:5 diluted cDNA, 1 × LightCycler FastStart DNA Master SYBR Green I (Roche Applied Science; Mannheim, Germany), 0.5 µM of each primer and 3.25 mM MgCl2. All samples were analyzed in triplicate. Data analysis was performed with the LightCycler3 data analysis Software Version 3.5.28 (Roche Applied Science; Mannheim, Germany) using a calibrator and standard curve. REST 2008 Relative Expression Software Tool Version 2.0.7 (Corbett Research Pty. Ltd.) was used for analysis of gene expression data from quantitative real-time PCR experiments (Table 2).

Isolation of mRNA and cDNA synthesis Caco-2 cells were seeded in 24-well plate culture dishes at 5 × 104 cells/well. After one week, the medium was replaced by fresh medium containing 20 µM of resveratrol. After 48 h incubation with tested samples cells were harvested and total RNA was isolated with the RNeasy Mini Kit (Qiagen; Hilden, Germany) according to the manufacturer's instruction and treated with DNase (RNase-Free DNase Set. Qiagen; Hilden, Germany). Quality and purity of RNA were verified by gel electrophoresis, its concentration was measured spectrophotometrically,

Table 2 The cytotoxicity IC50 and relative resistance (RR) values of resveratrol (µM) determined with the MTT assay. Data represented as mean ± SD. IC50 values µM Caco-2 179.29 ± 4.17

HepG-2 126.70 ± 5.78

HeLa 121.24 ± 10.21

CEM/ADR5000 252.28 ± 27.95

272

CCRF-CEM 60.42 ± 6.84

RR* 4.18

Phytomedicine 55 (2019) 269–281

M.Z. El-Readi et al.

Confocal microscopy

expressing CEM/ADR5000 cells, resveratrol appears to be a good P-gp substrate, with a relative resistance 4.18 fold. These numbers can be considered as evidence for substrate potency. The co-incubation of doxorubicin with very low concentrations of non-toxic concentrations 20 µM of resveratrol resulted in a significant increase in the cytotoxicity of doxorubicin on multidrug resistance Caco-2 cells (Fig 2). Doxorubicin cytotoxicity in cells treated with resveratrol had the following IC50 values 1.23 µM as compared with doxorubicin alone 4.15 µM. To confirm this reversal interaction in MDR Caco-2 cells, we selected the highly P-gp expressing cell line; CEM/ ADR5000. Fig. 2 shows the synergistic interaction of resveratrol with doxorubicin in leukemia cells, IC50 values were 33.67 µM for doxorubicin alone and 1.81 µM for doxorubicin with resveratrol. In order to visualize this potential synergistic interaction, the IC50 values of these combinations were normalized with doxorubicin to IC50 value of doxorubicin alone by using reversal ratio equations as mention in data statistic section (Table 3). Resveratrol significantly enhanced doxorubicin cytotoxicity in Caco-2 and CEM/ADR5000 cells, resulting in a 3.36 -fold sensitization of MDR-expressing Caco-2 cell (p < 0.001) and 18.60 fold in CEM/ ADR5000 cells (p < 0.001), respectively.

Caco-2 cells were seeded in 12-well plates at a density of 2 × 104 cells/well and incubated for 24 h in phenol red-free DMEM, supplemented with 10% FCS. Subsequently, the medium was removed and 1.5 ml DMEM (with or without 20, 50 µM of resveratrol) was added. Following a 24 h preincubation period, 150 nM CAM and 0.5 µg/ml PI were added. Accumulation was allowed for 30 – 60 min at 37 °C in a fully humidified atmosphere of 5% CO2 in the air. The cells were analyzed using a Zeiss LSM 410 confocal laser scanning microscope equipped with a 15 mV argon laser, exciting at 568 nm and 488. Emitted light passed through a 590 nm and 530 nm long-pass filters. Statistical analysis All assays were done in triplicate. All data are expressed as mean ± standard deviation. The concentration of tested compounds required to inhibit 50% of the enzyme activity under the assay conditions was determined from dose–response curves and defined as the IC50 value. The dose–response curves were calculated with a four parameters logistic curve (SigmaPlot® 11.0), graphs were drawn using GraphPad Prism® software (Version 5, graph- Pad software Inc., San Diego, CA, USA). One-way analysis of variance and Bonferroni's post hoc test was used to analyze differences between the sets of data. A pvalue less than 0.05 was considered significant. Inhibitory efficiency was calculated using the following equation: Inhibitory efficiency =

(RFU compound (RFU verapamil

Concentration dependent Rho123 and CAM accumulation assay The cytotoxicity and reversal data suggested that the resveratrol is effective in inhibiting the drug transport. To rhodamine123 and calcein-AM accumulation assays were performedWherein the rhodamine 123 is a fluorescent dye which is a known substrate for MDR1 and MRP1. The Calcein-AM was used to detect both P-gp and MRP-mediated effluxes. The Calcein permeates the cell in its neutral form as an acetomethoxyester, calcein AM and the esterase activity cleaves the AM group leaving calcein as a fluorescent organic anion. Both, calcein-AM and calcein have been shown to be substrates for MRP while only calcein-AM is a substrate for P-gp (Feller et al., 1995). The Calcein-AM and rhodamine 123 are readily efflux in the MDR-overexpressing Caco-2 cells. The Fluorescence of calcein and Rho123, after an accumulation and efflux period was quantified by fluoro-spectrometry. The results are depicted in Fig. 3. The tested samples were immunw to fluorescent at the concentrations examined where verapamil was used as a positive control for P-gp inhibition. The resveratrol at concentration range 1 – 500 µM increased the Rho123 and Calcein AM accumulations in concentration dependent manner in Caco-2 cells (Fig. 3) where it showed significant inhibitory effects on MDR efflux pump with 0.3 – 1.67 x old (Rho123) and 0.05 – 3.61x (CAM) increase (Fig. 3). The IC50 values were 6.64 and 42.34 µM of resveratrol for Rho123, and CAM accumulation, respectively (Fig. 3). To further confirm the resveratrol P-glycoprotein-modulatory effect, the Rho123 and CAM efflux assays were carried out with CEM/ ADR5000 cells. After the efflux period, Rho123 and CAM fluorescence were quantified by flow cytometric analysis. The results are presented in Table 4. The resveratrol (10–100 µM) significantly increased the intracellular fluorescence in a dose-dependent manner in CEM/ ADR5000 cells wherein the resveratrol was most the active inhibitor of P-gp in comparison to verapamil as represented in FACS histograms (Fig. 4). The P-gp inhibitory effect of resveratrol tested by Rho123 efflux was 2.11–3.90-fold of verapamil effects (Table 4). By using calceinAM, resveratrol was more potent than Rho123 and the inhibitory effect were 1.64 – 4.6-fold of verapamil effects (Table 4). These differences in results could be due to differences in specificity or the affinity of fluorescence substrate to interact with the active site of P-gp or the sensitivity of CAM, and also more than the Rho123 because CAM has no fluorescence character; it is only cleaved by cell membrane esterase activity leaving calcein as a fluorescent organic anion wherein the Rho123 outside and inside the cells has fluorescence property.

RFU untreated control) % RFU untreated control)

RFUcompound = fluorescence in the presence of test compound, RFUverpamil = fluorescence in the presence of verapamil, and RFUuntreated control = fluorescence in the absence of the drug. A drug was determined to inhibit MDR when the percentage of maximum was > 10%. We introduced inhibitory efficiency as indication of relative potency corrected by the potency of verapamil to normalize the effects of tested compound. Relative resistance for each tested compound was calculated using the following equation: Relative resistance =

IC50 value obtained for the resistant cell line (CEM/ADR5000) IC50 value obtained for the sensitive parental cell line (CCRF CEM)

Combination index (CI): The nature of the interaction (synergy, additivity, or antagonism) between resveratrol and doxorubicin as a function of their concentrations and cell growth inhibition (IC50) was assessed by the combination index method (CI) (Chou, 2006).

CI =

CDOX,50 CRes + IC50,DOX IC50,Res

Where CDOX,50 is the IC50 value for cytotoxic agent in two-drug combination and CRes is the fixed concentration of a resveratrol. IC50,DOX and IC50,RES correspond to the IC50 for doxorubicin and resveratrol alone. The combination index (CI) helps to identify synergistic (CI < 1), additive (CI = 1), and antagonistic interactions (CI > 1) (Chou, 2010). Results Effects of resveratrol on cell growth and on the cytotoxicity of doxorubicin (reversal assay) The cytotoxicity of resveratrol was initially tested in the resistant cell lines Caco-2 and CEM/ADR5000 followed by sensitive cell lines; HepG-2, HeLa and CCRF-CEM. According to the different cell lines tested, CCRF-CEM cells had the lowest IC50 value (60.42 µM) on resveratrol-induced cytotoxicity. The CEM/ADR5000 cell lines were the most resistant cell lines for resveratrol (252 µM). For the P-gp273

Phytomedicine 55 (2019) 269–281

M.Z. El-Readi et al.

Fig. 2. Dose response curve of doxorubicin on viability of Caco-2 (A) and CEM/ADR5000 (B) cells with and without 20 µM resveratrol. Doxorubicin cytotoxicity was enhanced significantly by resveratrol (p < 0.001).

Table 3 The cytotoxicity IC50 and relative resistance values of resveratrol using MTT assay. Data represented as mean ± SD and combination index as indication of synergism. Sample

Caco-2

Reversal ratio

CI

CEM/ADR5000

Reversal ratio

CI

Doxorubicin Resveratrol

4.15 ± 0.11 1.23 ± 0.14

1.00 3.36

0.41

33.67 ± 5.21 1.81 ± 0.20

1.00 18.60

0.13

Metabolic enzymes activities CYP3A4 and GST

and the results were calculated as percentage from untreated control. The resveratrol showed a dose dependent inhibitory activity on GST with IC50 value 30.73 (µM) (Fig. 5B).

To confirm the predicted cross inhibitory activities on MDR efflux pump and CYP3A4, which provides additional mechanistic possibilities concerning the anti-MDR activity, we monitored the effects of resveratrol on CYP3A4 activity by the luminescence P450-Glo™ CYP 3A4 assay. The resveratrol caused considerable inhibition of CYP3A4 activity which was dependent on concentrations. All the tested concentration levels significantly inhibited CYP3A4 as compared to the untreated control (p < 0.001) and IC50 values of 9.32 (µM) (Fig. 5A). The GST levels in MDR-overexpressing Caco-2 cells using a 1‑chloro‑2,4-dinitrobenzene substrate was also assayed wherein the one unit of GST was found to conjugate to 1.0 µmole of 1‑chloro‑2,4- dinitrobenzene with reduced glutathione per minute at pH 6.5 at 25 °C

Detection of apoptosis The Caco-2 and CEM/ADR5000 cells were exposed to resveratrol and the apoptotic response was studied by determining caspase activation and phosphatidyl serine exposure, respectively. In parallel, the cells were treated with camptothecin, as a positive control for apoptosis. The caspase response is shown in Fig. 6. There was a significant increase in caspase-3, caspase-8 and caspase-6/9 in Caco-2 cells by treatment with resveratrol similar to positive control camptothecin. The 274

Phytomedicine 55 (2019) 269–281

M.Z. El-Readi et al.

To study the effect of metabolic enzymes on MDR through in more detail, we performed quantitative PCR on GST, hPXR, and CYP3A4 mRNA levels in Caco-2 exposed to 20 µM resveratrol. Fig. 8 shows down-regulation in GST, hPXR, and CYP3A4 mRNA when Caco-2 cells were treated with tested samples. GST mRNA expression was 0.84-fold of control levels (p < 0.01). The most down-regulated is CYP3A4 mRNA by 0.03-fold of control levels with highly significant (p < 0.001). hPXR mRNA highly significant decreased by 0.02-fold of control levels. In order to determine the significance of caspase-3, and −8 upregulations in treatment of MDR colon cancer, we compared the expression of caspase-3-and caspase-8 in Caco-2 cells after exposition to 20 µM resveratrol. Fig. 8 shows up-regulation in caspase-3and caspase-8 mRNA when Caco-2 cells were treated with resveratrol. Caspase-3 and −8 mRNA expression was 4.68- (p < 0.001) and 3.94-fold (p < 0.001) of control levels, respectively. These findings were in agreement with the results of caspase level assay where the order of activity was caspase-3 followed by caspase-8. Moreover, the prominent induction effect of resveratrol was higher in caspase-3 than in caspase-8 as shown in cellular and molecular level assays. The results presented in Table 5 showed the summarized information from correlation coefficient (r) analysis of each pair of genes expression using Pearson's coefficient and the statistical significance of this correlation coefficient (p value). There is a highly significant negative correlation between each gene pairs BCRP and caspase-8 mRNA r = - 0.99 (p < 0.001), gene pairs MRP1 and caspase-3 mRNA r = - 0.98 (p < 0.001), gene pairs MRP1 and caspase-8 mRNA r = - 0.91 (p < 0.001). This data suggests that by decreasing BCRP and/or MRP1increase caspase-3 and/or caspase-8 mRNA expression and vice versa. We can say in general that ABC-transporters inhibitors can be induce apoptosis through caspase-3 dependent pathway. Moreover, the hPXR with a highly significant positive correlation with CYP3A4 r = 0.99 (p < 0.001), with MDR1 r = 0.71 (p < 0.05), and with BCRP r = 0.70 (p < 0.05). The data indicated that the decrease in hPXR lead to the decrease in the CYP3A4, MDR, and BCRP. This modulation in hPXR suggested that hPXR controls the metabolism and transport of xenophobic and drugs. The GST positively correlated with BCRP r = 0.83 (p < 0.05) and negatively connected with the caspase-8, r = −0.78 (p < 0.05). The GST has very important roles in detoxification and excretion of xenobiotics cytotoxic drugs, by decreasing its expression, decreasing BCRP, and the potentiate effect of cytotoxic drug, which may be targeted by induced apoptosis and increased caspase-8. MDR1 positively correlated with CYP3A4, r = −0.70 (p < 0.05). There was highly positively significant correlation between caspase-3 and caspase-8 as a mediator for apoptosis.

Fig. 3. Effect of different concentrations 1 – 500 µM of resveratrol on Rho123 and calcein-AM accumulation in Caco-2 cells. Rho123 and CAM fluorescence intensity was measured using spectrofluorometry. Data are represented as means ± SD of inhibitory efficiency related to verapamil (100%). All tested concentrations were significant different from the control (p < 0.001).

results show that resveratrol stimulates a high apoptotic response, including effector caspases and suggest that tumor cell death mainly relies on caspase dependent mechanisms. The apoptosis action was detected by Annexin V/PI staining. . The human anticoagulant, annexin V, is a 35 kD Ca2 + -dependent phospholipid protein with a high affinity for PS. Annexin V labeled with FLUOS identified the apoptotic cells in green by binding to PS exposed on the outer lipid monolayer. The PI is impermeable to living cells and apoptotic cells, but it stains necrotic cells with red fluorescence (λabs/λem with DNA = 535/ 617 nm). The Phosphatidyl serine (PS) exposure was detected by flow cytometry using - FLUOS labeled annexin (Fig. 7). The cells in the lower right quadrant indicated Annexin-positive early apoptotic cells. The cells in the upper right quadrant indicated Annexin-positive/PI-positive, late apoptotic cells and the number on each quadrant represent the apoptosis %. All tested samples were significantly active related to the control. The early/late apoptosis % of resveratrol was 24.91/23.26% compared with 28.10/37.37% for camptothecin as positive control, respectively. Resveratrol -treated cells, the total PS exposure was 0.74fold increase compared with camptothecin. Resveratrol (24%) is active in early stage induction of apoptosis compared with positive (28.10%) as represented in Fig. 7. Gene expression

Confocal microscopy

There are many important MDR target, i. e.,ABC-transporters genes; MDR1, MRP1, and BCRP. This regulated the accumulation of chemotherapeutical agents in target cancer cells. We determined whether the mRNA levels of corresponded genes were decreased in Caco-2 cells exposed to resveratrol. Fig. 8 shows down-regulation in MDR1 (0.24), MRP1 (0.15), and BCRP (0.19) mRNA when Caco-2 cells were exposition to resveratrol (20 µM) (p < 0.001). The most down-regulated is MRP1 mRNA by 0.15-fold of control levels (p < 0.001).

In the light microscope, significant changes in morphology of Caco2 cells were observed already under the influence of 20 and 50 µM resveratrol. Resveratrol at higher concentrations caused a concentration-dependent change in morphology of the cells of both lines. In fluorescence microscopy, after 24 h from treatment of Caco-2 cells with tested samples and staining with calcein-AM (30 min) and propidium iodide (direct before imaging), calcein-AM is converted to calcein by cellular esterases. Calcein is a bright green fluorescent compound. The

Table 4 Inhibitory efficiency of resveratrol (10–100 µM) on Rho123 and CAM efflux in CEM/ADR5000 cells related to verapamil as positive control (100%). Concentrations

Rho123 CAM

Inhibitory efficiency % 10

25

50

100

211.03 ± 2.56 164.24 ± 6.25

267.89 ± 10.29 235.51 ± 5.68

356.01 ± 5.18 268.35 ± 4.36

390.58 ± 9.85 460.86 ± 31.41

275

Phytomedicine 55 (2019) 269–281

M.Z. El-Readi et al.

Fig. 5. Dose-response curves of resveratrol on cytochrome inhibition using luminescence P450-Glo™ CYP 3A4 assay (A) and on GST activity using 1‑chloro‑2,4-dinitrobenzene substrate assay (B). Data are represented as means ± SD of inhibitory % related to untreated control. IC50 values were 9.32 (µM) and 30.73 (µM), respectively. .

Fig. 6. Caspase response to resveratrol (µM) or camptothecin. Caco-2 cells were treated with 20 µM of tested compounds for 24 h and caspase-3, −8 and −6/9 activity was monitored as the release of AFC or AMC from the specific substrates were measured fluorimetrically. Results are given in activity unit calculated from the standard curve slop of fluorescence substrate and uninduced control. All results show highly significantly from control (p < 0.001).

Fig. 4. Flow cytometry histograms of resveratrol at different concentrations: 0 – 100 µM. The fluorescence intensity was shifted to the right side indicting the resistance CEM/ADR5000 cell lines retain the Rho123 after treatment with P-gp inhibitors.

276

Phytomedicine 55 (2019) 269–281

M.Z. El-Readi et al.

Fig. 7. In vitro assessment of apoptosis in exponentially growing CEM/ADR5000 cells after 24 h culture in the absence (control) or presence of 20 µM resveratrol. FACS analysis via Annexin V- FLUOS /PI staining was used to observe the induction of apoptosis by reveratrol. Camptothecin was used as a positive control. Cells in the lower right quadrant indicate Annexin-positive, early apoptotic cells. The cells in the upper right quadrant indicate Annexin-positive/PI-positive, late apoptotic cells and the number on each quadrant represented the apoptosis %.

277

Phytomedicine 55 (2019) 269–281

M.Z. El-Readi et al.

effects on cell growth. This encouraged us to further research for the potency of this active substance on the different mechanisms of MDR; ABC-transporters, metabolic enzymes, and apoptosis. Multiple inhibitory activities with variable degree on ABC-transporters were observed for resveratrol (Fig. 3-4) and (Table 4), indicating that the resveratrol can reverse MDR by inhibiting P-gp and MRP1 efflux function in resistant cell lines using different independent types of substrates (Rho123 or CAM). In addition, resveratrol can restore the sensitivity of Caco-2 and CEM/ADR5000 cell lines to doxorubicin, through enhancing significantly doxorubicin cytotoxicity (Fig. 2). Thus, the combination between resveratrol at very low concentrations (20 µM) with the doxorubicin, resulted in a dose-reduction for doxorubicin, which gave the same cytotoxic effect (IC50 value), thus overcoming the most common side effects combined by treating the cancer patient with a high concentration of chemotherapeutical drug (Table 3). The combination of doxorubicin with resveratrol at the tested dose enhanced doxorubicin cytotoxicity and decreased its effective dose 34.42-fold and 18.60-fold in Caco-2 and CEM/ADR5000 cells, respectively. Resveratrol might be useful as an adjuvant chemosensitizer in chemotherapeutical formula to potentiate the cytotoxic effect of the chemotherapeutical agent, especially in resistance types of cancer patients. At the molecular levels, we found that resveratrol inhibited the ABC-transporter mRNA expression levels; MDR1, MRP1, and PCRP with variable degree in Caco-2 cells, which is one of the most common models used for the study of drug transporters and MDR in cancer (Fig. 8), mRNA expression of the studied genes was normalized to B2M housekeeping genes to eliminate a false interpretation, potentially caused by non-specific up-/down-regulation of these housekeeping genes. The most prominent inhibitory effect was on MRP1 and BCRP mRNA expression. There is a high correlation between MRP1 and BCRP1, as show in Table 5. ABC-transporter inhibitors, classified according to their action on ABC-transporters proteins into: 1. Function inhibitors, 2. Expression inhibitors, and 3. Functional and expression inhibitors, which have an ideal characters of ABC-transporters inhibitors. Our results indicate that resveratrol falls into the class 3 inhibitors. Many drugs which are metabolized by CYP isoenzymes of family 3, particularly CYP3A4, are also substrates for P-gp and a broad overlap in substrate and inhibitor specificities was demonstrated for both proteins (van de Waterbeemd, 2000). The simultaneous expression of CYP3A4 and P-gp in the small intestine is of particular importance for the primary adsorption of orally administered drugs. Both proteins act in concert to form a barrier to drug adsorption (Wandel et al., 1999). Thus, simultaneous induction or inhibition of CYP3A4-mediated metabolism and P-gp transport will alter bioavailability of their substrates (El-Readi et al., 2013). In this study, resveratrol was a significant inhibitor of CYP3A4 enzyme activity with IC50 value 9.32 (µM) (Fig 5). Moreover, the CYP3A4 mRNA levels were reduced after treatment with resveratrol 0.03-fold of the control levels with high significance

Fig. 8. mRNA expression of ABC transporters, metabolic enzymes, and proteases genes in Caco-2 exposed to 20 µM of resveratrol. mRNA expression in untreated control represented by dashed line (control = 1). Data are expressed as normalized fold change relative to the control. Each data point represents mean ± SD from three independent experiments. MDR1, MRP1, BCRP, GST, hPXR, and CYP3A4 genes were significantly lower than the control. Caspase-3 and caspase-8 genes were highly significantly greater than the control. ⁎⁎⁎ (p < 0.001) and ⁎⁎ (p < 0.01).

living cell membrane keeps calcein inside cells. In this regard, calceinAM works opposite to the way the PI works: live cells take up calcein AM, convert it to a fluorescent compound and retain it, whereas dead cells, due to holes in their membranes, cannot retain it. Dead cells also do not have sufficient quantities (or no quantities at all) of functioning esterases to convert calcein-AM to calcein. Recall that PI (Red) can passes through holes in the membranes of dead cells, and intercalates between nucleic acid bases. It is retained by the force of its binding to these molecules (Fig. 9). Furthermore, this assay can be used as a viability assay, allowing its use as functional assay to evaluate the effects of some drugs on ABC-transporters efflux pump. If sample inhibits the efflux lead to enhanced permeability of PI to binding in the cells. Discussion Multidrug resistance to chemotherapeutic drugs is a major problem in tumour treatment. Synergistic interaction between the MDR mechanisms; ABC-transporters, metabolic enzymes (CYP3A4 and GST), and apoptosis was observed (Eid et al., 2015). In this study, resveratrol was an active inhibitor for ABC-transporter efflux function; in addition, it showed significant inhibition of metabolic enzymes activity with little

Table 5 Correlation between the expression of mRNA of ABC-transports (MDR1, MRP, and BCRP), metabolic enzymes and receptor (GST, hPXR, and CYP3A4), and protease (caspase-3 and caspase-8) were represented as correlation coefficient (r). The assume data were sampled from Gaussian populations and correlation coefficients (r) were calculated by used Pearson's coefficient. Significant differences between each gene expression were calculated and assign as *, **, *** for p < 0.05, p < 0.01, and p < 0.001. MDR1 MDR1 MRP1 BCRP GST hPXR CYP3A4 Caspase-3 Caspase-8

0.46 0.21 −0.23 0.71* 0.70* −0.56 −0.23

MRP1

BCRP

GST

hPXR

CYP3A4

Caspase-3

Caspase-8

0.46

0.21 0.87⁎⁎

−0.23 0.45 0.83⁎⁎

0.71* 0.60 0.70* 0.50

0.70* 0.45 0.59 0.45 0.99⁎⁎⁎

−0.56 −0.98⁎⁎⁎ −0.73* −0.24 −0.54 −0.39

−0.23 −0.91⁎⁎⁎ −0.99⁎⁎⁎ −0.78* −0.67 −0.54 0.80⁎⁎

0.87⁎⁎ 0.45 0.60 0.45 −0.98⁎⁎⁎ −0.91⁎⁎⁎

0.83⁎⁎ 0.70* 0.59 −0.73* −0.99⁎⁎⁎

0.50 0.45 −0.24 −0.78*

278

0.99⁎⁎⁎ −0.54 −0.67

−0.39 −0.54

0.80⁎⁎

Phytomedicine 55 (2019) 269–281

M.Z. El-Readi et al.

Fig. 9. Calcein and PI accumulation in Caco-2 cells with and without resveratrol at a concentration of 20, 50 µM for 24 h observed in the fluorescence microscope (10 × ). 50 µM Camptothecin treated cells used as positive control. The calcein in viable cells emits green fluorescence, while PI emits red fluorescence.

(p < 0.001). These findings agree with different previous studies on resveratrol (Guthrie et al., 2017). Reversitall®, which contains resveratrol as a main active constituent has been reported to inhibit the activity of cytochrome P450 3A4 (CYP3A4) in vitro (Piver et al., 2003). Although this interaction has been reported in humans, high intakes of resveratrol (e.g., from supplements) could theoretically increase the bioavailability and the risk of toxicity of drugs that undergo extensive first-pass metabolism by CYP3A4 (Mouria et al., 2002). The Glutathione-S-transferases (GSTs) are a multigene family of dimeric proteins which play a central role in the detoxification of electrophilic xenobiotics and catalyze their conjugation with GSH to electrophilic metabolites, thus rendering them more water soluble. GSTs protect cells from cytotoxic and carcinogenic chemicals (Cervi et al., 1999). GST mediated conjugation of some anti-cancer drugs, thereby detoxifying these drugs (van Bladeren and van Ommen, 1991). There is a growing body of evidence which indicates that GST plays an important role in both carcinogenesis and drug resistance. For example, certain compounds which inhibit chemical carcinogenesis are often inducers of the GST in the target tissue (Benson and Barretto, 1985). These proteins are also over-expressed in preneoplastic lesions (Buchmann et al., 1985). In addition, it has been demonstrated to increase in both normal and tumour cells exposed to cytotoxic drugs (Batist et al., 1986). It is likely that glutathione-Stransferase levels and isoenzyme composition will play a role in both the intrinsic and acquired resistance to cancer chemotherapy (Wolf et al., 1987). The contribution of GST to drug resistance is likely to vary with cell type and drug, as well as with the expression profile of other enzymes and transporters. However, it is still widely accepted that the GST can contribute directly to drug resistance in some cell types via their catalytic activity, so inhibitors of GST catalytic activity are considered as a potential therapeutic tool. It has been previously, reported that the exposure of cells to a specific inhibitor of GST, buthionine sulfoximine (BSO), decreases multidrug resistance to doxorubicin (Dusre et al., 1989). The results of the present study do support this idea because GST activity was decreased by resveratrol in a dose dependent manner, (Fig. 5). IC50 value was 30.73 µM. This results were confirmed by RT-PCR data (Fig. 8), where the tested samples changed the GST mRNA level by 0.79-fold (p < 0.01) of control level.

Furthermore, the expression of these enzymes was shown to have a possible a synergistic interaction between the processes that cause MDR, as observed by the metabolizing CYP3A4, GST, and MRP1. In colon cancer cells, primary hepatocytes, and liver cell lines, MRP and CYP3A4 show a coordinated co-expression regulated by nuclear receptors like the pregnane X receptor (PXR) and the constitutive androstane receptor (CAR) (Cerveny et al., 2007). This co-regulation of MRP1 and CYP3A4 forms an integral part of the defence system to protect the body against xenobiotics, like oncolytic drugs. The increased levels of MRP1 will regulate the intracellular concentrations of the oncolytic drugs, so that they will stay within the linear range of the detoxifying capacity of CYP3A4 (Harmsen et al., 2007). In the intestine this coordinated action between MRP1 and CYP3A4 leads to a decrease in the oral uptake of drugs, while in the liver, drugs will be more rapidly excreted and detoxified (Larsen et al., 2001). Although, CYP3A4, MRP1, and PXR are affected by phase II enzymes glutathione-S-transferase enzymes. We predicted that down-expression of these genes could be caused by interaction of resveratrol with human pregnane X receptor (hPXR). PXR are ligand-activated nuclear receptors that act as heterodimers with retinoid X receptor α (RXRα) and up-regulate the transcription of their target genes, such as CYP3A4, GST, MRP1 and MDR1, by interaction with specific promoter-binding motifs (Goodwin et al., 1999). PXR has been shown to be activated by many structurally and chemically diverse ligands. Examples of human PXR activators include xenobiotics such as rifampicin (Pascussi et al., 2000) and the herbal compound hyperforin (Moore et al., 2000). PXR-mediated regulation of CYP3A4, GST, MRP1 and MDR1, gene expression was subsequently analyzed by real-time RT-PCR in resveratrol treated Caco-2 cells. We observed resveratrol was significantly down regulated of hPXR mRNA decreased by 0.02-fold of control levels (p < 0.001) (Fig. 8). This downregulation was positively correlated with CYP3A4 r = 0.99 (p < 0.001), with MDR1 r = 0.71 (p < 0.05), and with BCRP r = 0.70 (p < 0.05). The data indicated that by decreasing hPXR decreasing CYP3A4, MDR1, and BCRP and suggested that hPXR controls metabolism and efflux transport of xenobiotics and chemotherapeutical drug and it modulation important target in overcome MDR in cancer cells (Table 5). The changes in cellular morphology including cell shrinkage, nuclear condensation, and pyknosis, along with biochemical events 279

Phytomedicine 55 (2019) 269–281

M.Z. El-Readi et al.

leading to loss of plasma membrane asymmetry, loss of mitochondrial membrane potential, and DNA cleavage between nucleosomes, and increase level of proteases enzymes especially caspase-3, caspase-8, and caspase-9, characterize apoptosis. It is well established that almost all chemotherapeutic agents exert anticancer activity by inducing apoptosis (Wink et al., 2007). Generally, MDR tumor cells are resistant to apoptosis induction (Hanahan and Weinberg, 2000). Previous studies show that P-gp plays a drug efflux-independent role in augmenting cell survival (Pallis and Russell, 2000) and delays the apoptotic cascade in Chinese hamster ovary fibroblasts (Robinson et al., 1997). In addition, the protein protects drug-resistant tumor cells from multiple forms of caspase-dependent apoptosis (Johnstone et al., 1999). Moreover, functional P-gp inhibits the activation of caspase-3 and −8 by some apoptotic stimuli (Shtil et al., 2000). These lines of evidence indicate a close association between P-gp and apoptosis. Accordingly, we propose that down-regulation of P-gp expression facilitates the induction of apoptosis in MDR tumor cells by anticancer drugs. In our study, resveratrol induced apoptosis by caspase-3 and −8,−6/9 dependent in MDR Caco-2 cells (Fig. 6). Where the 20 µM of resveratrol exhibit significant induction of the caspase-3,−8, and −6/9 enzymes activity compare to positive control camptothecin (p < 0.001). RT-PCR results of effect of these tested samples on caspase-3 and caspase-8 mRNA levels in Caco-2 refer to the extremely up-regulation in caspase-3and caspase-8 mRNA when Caco-2 cells were treated with tested samples. Caspase-3 and −8 mRNA expression was 4.38- (p < 0.001) and 3.94fold (p < 0.001) of control levels. The study confirmed that the resveratrol inhibits MDR1, MRP1, and BCRP gene expression in Caco-2 cells. The MDR1 has previously been shown to inhibit apoptosis induced by certain stimuli via suppressing the activation of caspase-3 and −8 (Ruefli et al., 2000). We found out that the up-regulation of caspase-3 and caspase-8 were correlated with each other and with the down-regulation of MRP1 and BCRP expression in RT-PCR results (Table 5). Based on these findings, the reduction of MDR1, MRP1, and BCRP expression by tested samples most probably contributed to the cytotoxicity and apoptotic induction. The study showed that resveratrol possesses the ability to activate caspases and decrease ABC-transporters expression levels in MDR cells simultaneously.

References Albermann, N., Schmitz-Winnenthal, F.H., Z'Graggen, K., Volk, C., Hoffmann, M.M., Haefeli, W.E., Weiss, J., 2005. Expression of the drug transporters MDR1/ABCB1, MRP1/ABCC1, MRP2/ABCC2, BCRP/ABCG2, and PXR in peripheral blood mononuclear cells and their relationship with the expression in intestine and liver. Biochem. Pharmacol. 70, 949–958. Ashour, M.L., El-Readi, M.Z., Hamoud, R., Eid, S.Y., El Ahmady, S.H., Nibret, E., Herrmann, F., Youns, M., Tahrani, A., Kaufmann, D., Wink, M., 2014. Anti-infective and cytotoxic properties of Bupleurum marginatum. Chin. Med. 9, 4. Batist, G., Tulpule, A., Sinha, B.K., Katki, A.G., Myers, C.E., Cowan, K.H., 1986. Overexpression of a novel anionic glutathione transferase in multidrug-resistant human breast cancer cells. J. Biol. Chem. 261, 15544–15549. Benson, A.M., Barretto, P.B., 1985. Effects of disulfiram, diethyldithiocarbamate, bisethylxanthogen, and benzyl isothiocyanate on glutathione transferase activities in mouse organs. Cancer Res. 45, 4219–4223. Buchmann, A., Kuhlmann, W., Schwarz, M., Kunz, W., Wolf, C.R., Moll, E., Friedberg, T., Oesch, F., 1985. Regulation and expression of four cytochrome P-450 isoenzymes, NADPH-cytochrome P-450 reductase, the glutathione transferases B and C and microsomal epoxide hydrolase in preneoplastic and neoplastic lesions in rat liver. Carcinogenesis 6, 513–521. Cali, J.J., Ma, D., Sobol, M., Simpson, D.J., Frackman, S., Good, T.D., Daily, W.J., Liu, D., 2006. Luminogenic cytochrome P450 assays. Expert Opin. Drug Metab. Toxicol. 2, 629–645. Carmichael, J., DeGraff, W.G., Gazdar, A.F., Minna, J.D., Mitchell, J.B., 1987. Evaluation of a tetrazolium-based semiautomated colorimetric assay: assessment of chemosensitivity testing. Cancer Res. 47, 936–942. Casciola-Rosen, L., Nicholson, D.W., Chong, T., Rowan, K.R., Thornberry, N.A., Miller, D.K., Rosen, A., 1996. Apopain/CPP32 cleaves proteins that are essential for cellular repair: a fundamental principle of apoptotic death. J. Exp. Med. 183, 1957–1964. Cerveny, L., Svecova, L., Anzenbacherova, E., Vrzal, R., Staud, F., Dvorak, Z., Ulrichova, J., Anzenbacher, P., Pavek, P., 2007. Valproic acid induces CYP3A4 and MDR1 gene expression by activation of constitutive androstane receptor and pregnane X receptor pathways. Drug Metab. Dispos. 35, 1032–1041. Cervi, L., Rossi, G., Masih, D.T., 1999. Potential role for excretory-secretory forms of glutathione-S-transferase (GST) in Fasciola hepatica. Parasitology 119 (Pt 6), 627–633. Chen, C.J., Chin, J.E., Ueda, K., Clark, D.P., Pastan, I., Gottesman, M.M., Roninson, I.B., 1986. Internal duplication and homology with bacterial transport proteins in the mdr1 (P-glycoprotein) gene from multidrug-resistant human cells. Cell 47, 381–389. Chou, T.C., 2006. Theoretical basis, experimental design, and computerized simulation of synergism and antagonism in drug combination studies. Pharmacol. Rev. 58, 621–681. Chou, T.C., 2010. Drug combination studies and their synergy quantification using the Chou-Talalay method. Cancer Res. 70, 440–446. Dusre, L., Mimnaugh, E.G., Myers, C.E., Sinha, B.K., 1989. Potentiation of doxorubicin cytotoxicity by buthionine sulfoximine in multidrug-resistant human breast tumor cells. Cancer Res. 49, 511–515. Eid, S.Y., El-Readi, M.Z., Ashour, M.L., Wink, M., 2015. Fallopia japonica, a natural modulator, can overcome multidrug resistance in cancer cells. Evidence-based complementary and alternative medicine : eCAM 2015, 868424. El-Readi, M.Z., Eid, S., Ashour, M.L., Tahrani, A., Wink, M., 2013. Modulation of multidrug resistance in cancer cells by chelidonine and Chelidonium majus alkaloids. Phytomedicine 20, 282–294. Feller, N., Broxterman, H.J., Wahrer, D.C., Pinedo, H.M., 1995. ATP-dependent efflux of calcein by the multidrug resistance protein (MRP): no inhibition by intracellular glutathione depletion. FEBS Lett. 368, 385–388. Gillet, J.P., Gottesman, M.M., 2010. Mechanisms of multidrug resistance in cancer. Methods Mol. Biol. 596, 47–76. Goodwin, B., Hodgson, E., Liddle, C., 1999. The orphan human pregnane X receptor mediates the transcriptional activation of CYP3A4 by rifampicin through a distal enhancer module. Mol. Pharmacol. 56, 1329–1339. Gupta, A., Mugundu, G.M., Desai, P.B., Thummel, K.E., Unadkat, J.D., 2008. Intestinal human colon adenocarcinoma cell line LS180 is an excellent model to study pregnane X receptor, but not constitutive androstane receptor, mediated CYP3A4 and multidrug resistance transporter 1 induction: studies with anti-human immunodeficiency virus protease inhibitors. Drug Metab. Dispos. 36, 1172–1180. Guthrie, A.R., Chow, H.S., Martinez, J.A., 2017. Effects of resveratrol on drug- and carcinogen-metabolizing enzymes, implications for cancer prevention. Pharmacol. Res. Perspect. 5, e00294. Habig, W.H., Pabst, M.J., Fleischner, G., Gatmaitan, Z., Arias, I.M., Jakoby, W.B., 1974. The identity of glutathione S-transferase B with ligandin, a major binding protein of liver. Proc. Natl. Acad. Sci. U S A 71, 3879–3882. Hanahan, D., Weinberg, R.A., 2000. The hallmarks of cancer. Cell 100, 57–70. Harmsen, S., Meijerman, I., Beijnen, J.H., Schellens, J.H., 2007. The role of nuclear receptors in pharmacokinetic drug-drug interactions in oncology. Cancer Treat. Rev. 33, 369–380. Johnstone, R.W., Cretney, E., Smyth, M.J., 1999. P-glycoprotein protects leukemia cells against caspase-dependent, but not caspase-independent, cell death. Blood 93, 1075–1085. Johnstone, R.W., Ruefli, A.A., Smyth, M.J., 2000. Multiple physiological functions for multidrug transporter P-glycoprotein? Trends Biochem. Sci. 25, 1–6. Kano, T., Sakai, M., Muramatsu, M., 1987. Structure and expression of a human class pi glutathione S-transferase messenger RNA. Cancer Res. 47, 5626–5630. Larsen, L.A., Christiansen, M., Vuust, J., Andersen, P.S., 2001. Recent developments in

Conclusion The resveratrol causes inhibition of ABC-transporters, GST, and CYP3A4 to a different extent and affects the bioavailability of concomitantly administered drug. The resveratrol provided very promising results in cancer treatment taking into consideration that it inhibited the enzyme CYP3A4 significantly and thus prevented the first pass effect on the main anticancer drug and that it has its own cytotoxic effects on cancer cells. The treatment of cancer with regimens of chemotherapy invariably failed due to the development of MDR. In some cases, the attempts to sensitize multidrug-resistant cancers resulted in initial success but inevitably failed due to the multi-factorial nature of acquired MDR. In this study, the resveratrol showed multi-factorial inhibition of MDR, the inhibition of the efflux function and expression of ABC-transporters proteins (MDR1, MRP1, and BCRP) with inhibition of metabolic enzymes (GST and CYP3A4) and their regulatory gene (hPXR), along with caspase dependent induction of apoptosis in MDR cell lines. Thus, the resveratrol could be a promising adjuvant in chemotherapeutical regimens to overcome the MDR in cancer cells. Conflict of interest All authors stated that no conflict interest to any financial and personal relationships with other people or organizations that could inappropriately influence the outcome of this study. 280

Phytomedicine 55 (2019) 269–281

M.Z. El-Readi et al. high-throughput mutation screening. Pharmacogenomics 2, 387–399. Ling, V., 1997. Multidrug resistance: molecular mechanisms and clinical relevance. Cancer Chemother. Pharmacol. 40 (Suppl), S3–S8. Meijerman, I., Beijnen, J.H., Schellens, J.H., 2008. Combined action and regulation of phase II enzymes and multidrug resistance proteins in multidrug resistance in cancer. Cancer Treat. Rev. 34, 505–520. Moore, L.B., Goodwin, B., Jones, S.A., Wisely, G.B., Serabjit-Singh, C.J., Willson, T.M., Collins, J.L., Kliewer, S.A., 2000. St. John's wort induces hepatic drug metabolism through activation of the pregnane X receptor. Proc. Natl. Acad. Sci. U S A 97, 7500–7502. Mouria, M., Gukovskaya, A.S., Jung, Y., Buechler, P., Hines, O.J., Reber, H.A., Pandol, S.J., 2002. Food-derived polyphenols inhibit pancreatic cancer growth through mitochondrial cytochrome C release and apoptosis. Int. J. Cancer 98, 761–769. Pallis, M., Russell, N., 2000. P-glycoprotein plays a drug-efflux-independent role in augmenting cell survival in acute myeloblastic leukemia and is associated with modulation of a sphingomyelin-ceramide apoptotic pathway. Blood 95, 2897–2904. Pascussi, J.M., Drocourt, L., Fabre, J.M., Maurel, P., Vilarem, M.J., 2000. Dexamethasone induces pregnane X receptor and retinoid X receptor-alpha expression in human hepatocytes: synergistic increase of CYP3A4 induction by pregnane X receptor activators. Mol. Pharmacol. 58, 361–372. Piver, B., Berthou, F., Dreano, Y., Lucas, D., 2003. Differential inhibition of human cytochrome P450 enzymes by epsilon-viniferin, the dimer of resveratrol: comparison with resveratrol and polyphenols from alcoholized beverages. Life Sci. 73, 1199–1213. Robinson, L.J., Roberts, W.K., Ling, T.T., Lamming, D., Sternberg, S.S., Roepe, P.D., 1997. Human MDR 1 protein overexpression delays the apoptotic cascade in Chinese hamster ovary fibroblasts. Biochemistry 36, 11169–11178.

Ruefli, A.A., Smyth, M.J., Johnstone, R.W., 2000. HMBA induces activation of a caspaseindependent cell death pathway to overcome P-glycoprotein-mediated multidrug resistance. Blood 95, 2378–2385. Shtil, A.A., Grinchuk, T.M., Tee, L., Mechetner, E.B., Ignatova, T.N., 2000. Overexpression of P-glycoprotein is associated with a decreased mitochondrial transmembrane potential in doxorubicin-selected K562 human leukemia cells. Int. J. Oncol. 17, 387–392. Twentyman, P.R., Rhodes, T., Rayner, S., 1994. A comparison of rhodamine 123 accumulation and efflux in cells with P-glycoprotein-mediated and MRP-associated multidrug resistance phenotypes. Eur. J. Cancer 30A, 1360–1369. van Bladeren, P.J., van Ommen, B., 1991. The inhibition of glutathione S-transferases: mechanisms, toxic consequences and therapeutic benefits. Pharmacol. Ther. 51, 35–46. van de Waterbeemd, H., 2000. Role of human CYP3A and P-glycoprotein on the absorption of drugs. Eur. J. Pharm. Sci. 12, 1. van Engeland, M., Nieland, L.J., Ramaekers, F.C., Schutte, B., Reutelingsperger, C.P., 1998. Annexin V-affinity assay: a review on an apoptosis detection system based on phosphatidylserine exposure. Cytometry 31, 1–9. Wandel, C., Kim, R.B., Kajiji, S., Guengerich, P., Wilkinson, G.R., Wood, A.J., 1999. Pglycoprotein and cytochrome P-450 3A inhibition: dissociation of inhibitory potencies. Cancer Res. 59, 3944–3948. Wolf, C.R., Lewis, A.D., Carmichael, J., Adams, D.J., Allan, S.G., Ansell, D.J., 1987. The role of glutathione in determining the response of normal and tumor cells to anticancer drugs. Biochem. Soc. Trans. 15, 728–730. Zordoky, B.N., Robertson, I.M., Dyck, J.R., 2015. Preclinical and clinical evidence for the role of resveratrol in the treatment of cardiovascular diseases. Biochim. Biophys. Acta 1852, 1155–1177.

281