- Email: [email protected]
FoxO1 pathway in osteoporosis mice
Life Sciences 246 (2020) 117422
Contents lists available at ScienceDirect
Life Sciences journal homepage: www.elsevier.com/locate/lifescie
Resveratrol promotes osteogenesis via activating SIRT1/FoxO1 pathway in osteoporosis mice Yixuan Jianga,b, Wenqiong Luoa,b, Bin Wanga,b, Xinyu Wanga, Ping Gonga,b, Yi Xionga,b, a b
T
⁎
State Key Laboratory of Oral Diseases, National Clinical Research Center for Oral Diseases, West China Hospital of Stomatology, Sichuan University, Chengdu, China Department of Implantology, West China Hospital of Stomatology, Sichuan University, Chengdu, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Resveratrol Forkhead transcription factor 1 Sirtuin 1 Osteoporosis Oxidative stress Osteogenesis
Aims: This study aimed to investigate the effects of resveratrol (3, 4′, 5-trihydroxystilbene, RES) on osteoporosis and the role of SIRT1/FoxO1 pathway in the process. Main methods: In vivo, mice were divided into 3 groups, Sham, ovariectomized (OVX) and OVX-RES group. Micro-CT, histology and histomorphometry were conducted to detect details of bone mass and microstructure. The expression of osteoblast markers was tested by Real-time qPCR and serum markers which reflected bone formation and resorption were analyzed by enzyme-linked immunosorbent assay (ELISA). Besides, we assayed sirtuin 1 (SIRT1) expression and the concentration of serum superoxide dismutase (SOD). In vitro, osteoblasts were seperated into 3 groups: control, H2O2 (hydrogen peroxide, H2O2) and H2O2-RES group. Cell proliferation, differentiation and apoptosis were detected. In addition, we tested intracellular reactive oxygen species (ROS) formation and SOD activity detection of osteoblasts. The SIRT1, acetylated FoxO1 (Ac-FoxO1) and nuclear FoxO1 (Nu-FoxO1) expression were detected by western blot. Key findings: Results revealed that RES could ameliorate bone loss and promote osteogenesis by reinforcing resistance of oxidative stress in OVX mice. RES enhanced proliferation, differentiation and suppressed apoptosis of H2O2-treated osteoblasts. In this process, SIRT1 was upregulated and the level of Nu-FoxO1, which had high transcriptional activity to regulate redox balance, significantly increased. Significance: Oxidative stress plays a crucial role in osteoporosis. RES can reinforce resistance to oxidative damage and hence promote osteogenesis via the activation of SIRT1/FoxO1 signaling pathway, which provides a new idea for the prevention and treatment of osteoporosis.
1. Introduction Osteoporosis, one of the most common bone metabolic diseases, impacts millions of people worldwide, especially postmenopausal women and the elderly [1]. The defining characteristics of osteoporosis are loss of bone mass and structural deterioration with a greater tendency to pathological fracture [2]. Thus finding methods to prevent and treat osteoporosis has always been the focus. Resveratrol (trans-3, 4′, 5trihydroxystilbene, RES) is a natural polyphenolic compound found in grapes and several medicinal plants [3]. Studies have confirmed the potential of RES in prevention and treatment of various diseases, such as cancer, cardiovascular diseases, diabetes and Alzheimer's disease [4–6]. In addition, a few researches have suggested that RES may have beneficial effects on osteoporosis [7,8]. Recently, increasing evidences indicated that oxidative stress plays
a key role in the onset and progression of osteoporosis [9]. Oxidative stress is the consequence of overproduced reactive oxygen species (ROS) and decreased endogenous antioxidant defensive enzymes including catalase, superoxide dismutase (SOD) and glutathione peroxidase, thus resulting in the damage of nucleic acids, proteins, and lipids [10,11]. Studies have revealed that excessive generation of ROS has negative effects on bone remodeling through osteoblasts dysfunction and osteoclasts activation [12,13]. RES has antioxidant capacities to resist oxidative stress, thereby activating osteogenic differentiation of bone mesenchymal stem cells (BMSCs) and inhibits osteoclast function [14,15]. Besides, RES alleviates periodontitis-mediated alveolar bone loss by repressing ROS production and promoting SOD expression [16,17]. These observations indicate that RES may prevent bone loss by counteracting oxidative damage, while the underlying mechanisms have not been clarified.
⁎ Corresponding author at: State Key Laboratory of Oral Diseases, National Clinical Research Center for Oral Diseases, and Department of Implantology, West China Hospital of Stomatology, Sichuan University, No 14th, 3rd section, Renmin South Road, Chengdu 610041, China. E-mail address: [email protected] (Y. Xiong).
https://doi.org/10.1016/j.lfs.2020.117422 Received 27 November 2019; Received in revised form 30 January 2020; Accepted 10 February 2020 Available online 11 February 2020 0024-3205/ © 2020 Elsevier Inc. All rights reserved.
Life Sciences 246 (2020) 117422
Y. Jiang, et al.
Sirtuin1 (SIRT1), a nicotinamide adenosine dinucleotide (NAD+)dependent deacetylase enzyme, is a potential therapeutic target of RES [18,19]. SIRT1 regulates the activity of downstream target genes through deacetylation [20,21]. Studies have demonstrated that SIRT1 can attenuate bone loss and promote bone formation in mice, indicating that it is also a novel target for bone metabolism [22,23]. Forkhead box O (FoxO) transcription factor family consists of four members, FoxO1, FoxO3, FoxO4 and FoxO6 [24]. Among them, FoxO1 is widely expressed in bone and could be activated by ROS, which then promotes the expression of downstream antioxidant genes to maintain balance of cellular redox state [25,26]. When FoxO1 was silenced, H2O2-induced oxidative stress was aggravated and cell apoptosis was facilitated [27]. Our previous study also illustrated that deletion of FoxO1 gene caused a high level of ROS and resulted in osteoblasts dysfunction [28]. These data revealed that FoxO1 might be implicated as a key regulator of oxidative stress, but how FoxO1 actively contributes to the oxidative stress under RES treatment remains unclear. Besides, whether RES could regulate the activity of FoxO1 to participate in the modulation of oxidative stress via activated SIRT1 needs to be further studied. Based on the above, we speculate that RES may restrain oxidative stress in osteoporosis via SIRT1/FoxO1 signal pathway. Therefore, we proposed this study to investigate the role of RES in osteoporosis and its intrinsic mechanisms. The results of the study may provide therapeutic implications for osteoporosis.
Table 1 Primers and probes used for PCR. Primers
Forward primer 5′–3′
Reverse primer 5′–3′
ALP Osx Runx2 GAPDH
AACCCAGACACAAGCATTCC ATTCTCCCATTCTCCCTCCCT GGCGTCAAACAGCCTCTTCA AAGGCCGGGGCCCACTTGAA
GCCTTTGAGGTTTTTGGTCA GGAAGGGTGGGTAGTCATTTGC GCTCACGTCGCTCATCTTGC GGACTGTGGTCATGAGCCCTTCCA
2.4. Real-time qPCR and enzyme-linked immunosorbent assay (ELISA) Total RNA was isolated by Trizol Reagent (Invitrogen, Carlsbad, CA, USA). Reverse transcriptions were performed using Prime Script Reverse Transcriptase (Takara, Japan) and real-time qPCR was conducted by SYBR Premix Ex TaqTM kit (Takara, Japan) with ABI 7300 real-time PCR system (Applied Biosystems, USA). Primer sequences were listed in Table 1. Blood serum from mice was harvested and centrifuged. The supernatant of each sample was used for quantitative examination of procollagen type 1 N-terminal propeptide (P1NP) and c-telopeptide of type 1 collagen (CTX) by ELISA kit (Cusabio, China). The serum level of SOD was detected via a specific kit (Jiancheng, Nanjing, China) following the manufacturer's instructions. 2.5. Cell culture and biology
2. Materials and methods
Osteoblasts were taken from newborn mice calvaria, cultured in αMEM supplemented with 10% fetal bovine serum (FBS, Gibco, USA), 100 U/ml penicillin and 100 mg/ml streptomycin sulfate. Cells in passage 3 were used for the following analysis. Firstly, Counting Kit-8 (CCK-8, Dojindo, Japan) assay was performed to detect cell proliferation for selecting optimum dose of RES (Fig. 3A). The optical density (OD) value at 450 nm was measured in each well. Oxidative stress model in osteoblast was established by adding H2O2. There were 3 groups: control, H2O2 (0.2 mM hydrogen peroxide, H2O2, Sigma Aldrich, China), and H2O2-RES (0.1 mM RES, Sigma Aldrich, China). Proliferation of osteoblasts in each group was assayed as described previously. At 14d after culture, alkaline phosphatase (ALP, Beyotime, China) staining was preformed and ALP activity was tested by ALP Assay Kit (Beyotime, China). Total protein concentration was examined by Bradford Protein Assay Kit (Beyotime, China). Results were normalized to total protein concentration as nanomoles of produced p-nitrophenol per min per mg of protein (nmol/min/mg protein). Apoptosis assay was implemented after 7 days of culture by evaluating caspase-3 activity, which was examined by quantifying the degradation of the fluorometric substrate DEVD (Biomol Research Labs). The method of protein concentration was stated above.
2.1. Animals and ovariectomy All animal studies were conducted in accordance with international standards on animal welfare and approved by the Animal Research Committee of Sichuan University (Chengdu, China). Female mice of 8 weeks old were prepared and randomly assigned to 3 groups: Sham, ovariectomized (OVX) and OVX-RES. Mice in the latter two groups were treated with bilateral ovariectomy to establish osteoporosis models, while those in the Sham group were only given laparotomy. RES (40 mg/kg body weight, Sigma-Aldrich, China) was performed intraperitoneally once every day for 8 weeks.
2.2. Micro-CT analysis and HE staining Femurs were harvested and fixed, scanning by micro-CT (SCANCO 50, Swizerland) at 7 μm resolution. Bones were reconstructed and analyzed by the script of bone volume per total volume (BV/TV), the mean trabecular number (Tb.N) and the mean trabecular separation (Tb.Sp). Samples from distal femurs were fixed and decalcified in 15% ethylene diamine tetraacetic acid (EDTA). Then these samples were dehydrated through a graded series of ethanol solutions before they were embedded in paraffin, which were sawn parallel to the long axis into 5 μm sections for HE staining.
2.6. Intracellular ROS formation and SOD activity detection Cells were incubated with 10 μM 2′,7′-dichlorodihydrofluorescin diacetate (DCFH-DA, Molecular Probes, Invitrogen), an oxidation sensitive fluorescent probe dye, for 30 min at 37 °C. Then we used flow cytometry to assay the ROS level. LSR II Flow cytometer (BD biosciences) at an excitation wavelength of 495 nm and emission wavelength of 527 nm was performed to measure fluorescence. After RES treatment at 7d, SOD activity in osteoblasts was examined as stated in 2.4.
2.3. Histomorphometry, TRAP staining and immunohistochemistry Specimens were fixed, dehydrated and embedded without decalcification. Histomorphometric measurements including number of osteoblasts and osteoclasts in the distal femur were performed using the OsteoMeasure Analysis System (OsteoMetrics, Inc.) as previously described [29]. The distal femurs were harvested, decalcified and embedded in paraffin. 5 μm longitudinal sections were obtained for tartrate-resistant acid phosphatase (TRAP)-staining, which was performed to detect the number of osteoclasts. Other sections were detected by immunohistochemistry to evaluate the expressions of SIRT1 and Runx2.
2.7. Western blot analysis Cells were collected and subjected to lysis buffer (Keygen total protein extraction kit, Keygen Biotech, China). Proteins extracts were separated on 10% SDS-PAGE gels and transferred on polyvinylidene 2
Life Sciences 246 (2020) 117422
Y. Jiang, et al.
BV/TV and Tb.N (Fig. 1A, C-E). HE staining also suggested that RES prevented bone loss caused by OVX in OVX-RES group (Fig. 1B). According to Fig. 2A-C, the number of osteoblasts greatly decreased and osteoclasts increased in the OVX group as compared to the Sham group. While RES promoted an increase in osteoblasts number and a decrease in osteoclasts number. Besides, RES enhanced osteogenic differentiation since the expressions of osteogenic makers alkaline phosphatase (ALP), runt-related transcription factor 2 (Runx2) and osterix (Osx) were significantly increased (Fig. 2E-G). Similar results were shown in immunohistochemical analysis for Runx2 (Fig. 2D). As stated previously, SIRT1 has been considered as the therapeutic target of RES. In order to explore the intrinsic mechanisms of RES, immunohistochemical detection was conducted to measure the expression level of SIRT1 in mice. Results showed that SIRT1 expression decreased in the OVX group. In contrast, SIRT1 was at a higher level in the OVXRES group (Fig. 2D).
difluoride membranes (Millipore Corp, Bedford, MA), which were then blocked and probed at 4 °C overnight with primary antibodies. β-actin (ACTB) was used as control for normalization and histone H3 as the loading control in cell nucleus. After horseradish peroxidase-conjugated secondary antibodies were utilized consistently with each primary antibody, immunoreactive proteins were tested by an enhanced chemiluminescence kit (Millipore, USA). 2.8. Statistical analysis Data was analyzed with SPSS 20.0 software (SPSS, Inc., Chicago, IL) and presented as mean ± standard deviation (SD). The values were assessed by one-way analysis of variance (ANOVA) followed by the LSD test for multiple comparisons. A significant difference was assumed at p < 0.05 (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001). 3. Results
3.2. RES enhances antioxidative defense in osteoporosis mice 3.1. RES promotes osteogenesis in osteoporosis mice Data showed that the serum level of SOD decreased considerably in the OVX group as compared to the Sham group. But in the OVX-RES group, SOD level was rebounded (Fig. 2H). In addition, two typical serum markers which reflected bone formation and resorption respectively, P1NP and CTX, were assayed. Results showed that the P1NP content was dramatically lower in the OVX group when compared to
In order to observe the effects of RES on osteoporosis, micro-CT analysis was performed to detect details of bone mass and microstructure. Compared with Sham group, higher Tb.Sp, lower BV/TV and Tb.N were detected in OVX group. RES treatment reversed changes in these parameters caused by OVX, showing decreased Tb.Sp, increased
Fig. 1. RES treatment attenuates deterioration of bone microstructure in OVX mice. Representative photograph of micro-CT reconstruction (A) and HE staining (B) of distal femurs. Scale bar = 200 μm. (C) Bone volume per total volume (BV/TV). (D) Mean trabecular number (Tb.N). (E) Mean trabecular separation (Tb.Sp). Data are means ± SD, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. n = 4 specimens/group. 3
Life Sciences 246 (2020) 117422
Y. Jiang, et al.
Fig. 2. RES improves bone formation and reduces bone resorption over oxidative stress. Number of osteoblasts (A) and osteoclasts (B) in femur bone. (C) TRAP staining of femurs. Scale bar = 20 μm. (D) Immunohistochemical analysis of femurs. Scale bar = 25 μm. (E, F, G) Real-time qPCR analysis of ALP, Runx2 and Osx. The serum level of SOD (H), P1NP(I) and CTX (J). Data are means ± SD, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. n = 4–6 specimens/group.
osteoblasts. Therefore, 0.1 mM RES was selected for following experiments (Fig. 3A). When compared to the control group, H2O2-treated osteoblasts proliferation was reduced significantly as the consequences became more visible at 3d and 5d. With RES treatment, proliferative activity of osteoblasts was improved to some extent (Fig. 3B). ALP activity and staining which could reflect osteogenic differentiation capacity of osteoblasts, revealed that osteoblasts differentiation was restrained by H2O2. But RES reversed the inhibitory effects on osteoblasts differentiation, showing higher ALP activity in H2O2-RES group than H2O2 group (Fig. 3C, G). Caspase-3 activity is the index reflecting cell apoptosis. Compared with control group, there was a prominent increase of caspase-3 activity in H2O2 group, indicating a higher level of osteoblasts apoptosis. While caspase-3 activity in the H2O2-RES group was significantly lower than it in the H2O2 group (Fig. 3D), suggesting that RES could inhibit osteoblasts apoptosis over H2O2-induced oxidative stress.
Sham group, while CTX was at a higher level inversely. However, the OVX-RES group displayed an enhancement of P1NP and a reduction of CTX (Fig. 2I-J). These observations indicated that RES might promote bone formation and prevent bone resorption via resistance to redox imbalance.
3.3. RES enhances osteoblasts activity and inhibits osteoblasts apoptosis over oxidative stress To further investigate the influence of RES on osteogenesis over oxidative stress, we established H2O2-induced oxidative damage model in osteoblasts. Firstly, CCK-8 assay showed that the effect of RES on osteoblasts proliferation was dose-dependent. The proliferative activity of osteoblasts under 0.1 mM RES treatment was the highest. When RES in higher or lower dose compared to 0.1 mM, osteoblasts proliferation was decreased. Moreover, cell proliferation was declined most when RES was at a high dose of 0.2 mM, even had an inhibitory effect on 4
Life Sciences 246 (2020) 117422
Y. Jiang, et al.
Fig. 3. RES decreases H2O2-induced oxidative stress and improves biological functions of osteoblasts. (A) CCK-8 assay for selecting optimum dose of RES. (B) Cell proliferation in each group determined by CCK-8 assay. (C) ALP activity. (D) Caspase-3 activity. AFU, arbitrary fluorescence units. (E) Intracellular ROS level. (F) The level of SOD in osteoblasts. (G) ALP staining. Scale bar = 1 cm. (H) Protein levels of SIRT1, Ac-FoxO1 and Nu-FoxO1 tested by western blot analysis. ACTB: β-actin.
3.4. RES activates SIRT1/FoxO1 signal pathway to attenuate oxidative stress
osteoblasts through SIRT1/FoxO1 signal pathway.
According to Fig. 3E-F, intracellular ROS level increased remarkably, while SOD decreased significantly in H2O2 group as compared to the control. RES treatment reduced ROS and upregulated SOD expression when osteoblasts exposed to H2O2. These data indicated that RES improved osteoblast biological functions by abrogating redox imbalance. To elucidate the mechanisms of RES in oxidative stress, we examined SIRT1, acetylated FoxO1 (Ac-FoxO1) and nuclear FoxO1 (NuFoxO1) in western blot analysis. As shown in Fig. 3H, SIRT1 was upregulated with the treatment of RES when osteoblasts were dealt with H2O2 and the level of Ac-FoxO1 remarkably decreased due to the deacetylation of SIRT1 in H2O2-RES group. But Ac-FoxO1 in H2O2 group was at a high level. Then we observed that Nu-FoxO1 was appreciably enhanced in H2O2-RES group, thus activating downstream targets antioxidative enzymes like SOD to attenuate oxidative stress. These results demonstrated that RES might modulate oxidative stress in
4. Discussion RES, a natural polyphenolic component, has been found beneficial to prevent bone loss. We established OVX mice models to explore the effects of RES on osteoporosis. Results revealed that RES ameliorated bone microstructure deterioration, increased osteoblasts number and decreased osteoblasts number in OVX mice, showing the positive effects of RES on osteoporosis. Li YR et al. illustrated that RES had the potential to prevent and attenuate age-related diseases by modulating oxidative stress [30]. Consistently, we found that RES restored the serum SOD level in the OVX-RES group while it decreased sharply in the OVX group. These data indicated that oxidative stress participated in the development of osteoporosis and RES could prevent bone loss by the inhibition of oxidative stress. To further explore the mechanisms of RES involved in osteogenesis, we then established H2O2-induced oxidative stress model in osteoblasts. Results showed that RES promoted 5
Life Sciences 246 (2020) 117422
Y. Jiang, et al.
Declaration of competing interest
proliferation and differentiation of osteoblasts and reduced cell apoptosis caused by H2O2. In this process, SOD level was elevated to scavenge ROS production under the treatment of RES, suggesting that RES protected from bone resorption and improved bone formation via reinforcement of antioxidative defense. Previous studies have demonstrated that SIRT1 is a latent therapeutic target of RES [31]. Immunohistochemical analysis in our study confirmed that SIRT1 expression was upregulated in OVX mice treated with RES. Wang et al. [7] also found that RES could increase bone density via activated SIRT1 in OVX rats, highlighting its potential as a novel pharmacological target of RES for treating osteoporosis. In addition, SIRT1 overexpression could inhibit apoptosis of osteoblast progenitors by regulating FoxO1-mediated target genes which eventually resulted in cell apoptosis, indicating that SIRT1/FoxO1 factor axis might be one of the pathways involved in osteogenesis [32]. SIRT1 is a deacetylase that regulates its downstream targets such as p53, nuclear factor kappa B (NFkB) through deacetylation [20,33]. Currently, there is a growing body of studies indicating that SIRT1 can catalyze deacetylation of FoxOs. When SIRT1 gene knocked down, FoxOs acetylation increased and enhanced osteoclastgenesis [34,35]. FoxOs is a family of transcription factors depending on the modulation of phosphorylation, acetylation and methylation to affect sorts of physiological and pathological processes [36]. It was mostly studied that dephosphorylated FoxO1 could translocate into nucleus and hence have high transcriptional activity to regulate downstream targets to maintain cellular homeostasis [37]. Considering that, we wondered if acetylation/deacetylation of FoxO1 had the similar effects. Sewastianik T et al. revealed that acetylation of FoxO1 inhibited its nuclear translocation and then downregulated FoxO1 transcriptional activity toward genes involved in oxidative stress [38]. In this work, western blot analysis showed that SIRT1 expression was upregulated by RES treatment and deacetylation was subsequently elevated, leading to a reduced expression level of Ac-FoxO1. Then Nu-FoxO1 level was enhanced considerably in H2O2-RES group as compared to H2O2 group, indicating that the shuttle of deacetylated FoxO1 from cytoplasm to nucleus was promoted. Of note, Nu-FoxO1 had high transcriptional activity to regulate downstream targets. With the above stated, SOD expression was upregulated with RES treatment to attenuate oxidative stress both in OVX mice and H2O2-treated osteoblasts, suggesting that SOD was one of the downstream targets of FoxO1 to be responsible for the cellular redox balance. This was in accordance with Ponugoti B et al., who had also demonstrated that FoxO1 can upregulate the SOD expression level to scavenge overproduced ROS in hyperglycemia-induced oxidative stress [25]. Besides, Mo X et al. also illustrated that SIRT1 upregulated the deacetylation of FoxO1 and promoted its nuclear transportation, thus increasing cell viability to resist oxidative damage in the regulation of glucose metabolism [39]. These findings suggested that deacetylation of FoxO1 by activated SIRT1 was one of the mechanisms through which RES conferred its effects. In this process, NuFoxO1 was upregulated to modulate downstream target antioxidative enzymes including SOD toward oxidative damage. Taken together, these results elucidated that SIRT1/FoxO1 might act as a significant pathway in oxidative stress, indicating its therapeutic implications in osteoporosis or other bone related disorders.
The authors declare that they have no conflict of interest. Acknowledgements This work was supported by China Postdoctoral Science Foundation (0040304153038), China; West China Hospital of Stomatology and West China Hospital Basic and Applied Basic Research Foundation (RD02-201913), China; West China Hospital of Stomatology. References [1] S.C. Manolagas, From estrogen-centric to aging and oxidative stress: a revised perspective of the pathogenesis of osteoporosis, Endocr. Rev. 31 (2010) 266–300. [2] D.L. Glaser, F.S. Kaplan, Osteoporosis. Definition and clinical presentation, Spine 22 (1997) 12s–16s. [3] B.D. Gehm, J.M. McAndrews, P.Y. Chien, J.L. Jameson, Resveratrol, a polyphenolic compound found in grapes and wine, is an agonist for the estrogen receptor, Proc. Natl. Acad. Sci. U. S. A. 94 (1997) 14138–14143. [4] J.H. Ko, G. Sethi, J.Y. Um, M.K. Shanmugam, F. Arfuso, A.P. Kumar, A. Bishayee, K.S. Ahn, The role of resveratrol in cancer therapy, Int. J. Mol. Sci. 18 (2017). [5] S. Cho, K. Namkoong, M. Shin, J. Park, E. Yang, J. Ihm, V.T. Thu, H.K. Kim, J. Han, Cardiovascular protective effects and clinical applications of resveratrol, J. Med. Food 20 (2017) 323–334. [6] C. Sawda, C. Moussa, R.S. Turner, Resveratrol for Alzheimer's disease, Annals of the New York Academy of Sciences 1403 (2017) 142–149. [7] X. Wang, L. Chen, W. Peng, Protective effects of resveratrol on osteoporosis via activation of the SIRT1-NF-kappaB signaling pathway in rats, Experimental and therapeutic medicine 14 (2017) 5032–5038. [8] J.C. Tou, Resveratrol supplementation affects bone acquisition and osteoporosis: pre-clinical evidence toward translational diet therapy, Biochim. Biophys. Acta 1852 (2015) 1186–1194. [9] Q. Zhou, L. Zhu, D. Zhang, N. Li, Q. Li, P. Dai, Y. Mao, X. Li, J. Ma, S. Huang, Oxidative stress-related biomarkers in postmenopausal osteoporosis: a systematic review and meta-analyses, Dis. Markers 2016 (2016) 7067984. [10] S. Ogura, T. Shimosawa, Oxidative stress and organ damages, Curr. Hypertens. Rep. 16 (2014) 452. [11] G. Filomeni, D. De Zio, F. Cecconi, Oxidative stress and autophagy: the clash between damage and metabolic needs, Cell Death Differ. 22 (2015) 377–388. [12] D.A. Callaway, J.X. Jiang, Reactive oxygen species and oxidative stress in osteoclastogenesis, skeletal aging and bone diseases, J. Bone Miner. Metab. 33 (2015) 359–370. [13] P. Vrtacnik, J. Zupan, V. Mlakar, T. Kranjc, J. Marc, B. Kern, B. Ostanek, Epigenetic enzymes influenced by oxidative stress and hypoxia mimetic in osteoblasts are differentially expressed in patients with osteoporosis and osteoarthritis, Sci. Rep. 8 (2018) 16215. [14] T. Zhou, Y. Yan, C. Zhao, Y. Xu, Q. Wang, N. Xu, Resveratrol improves osteogenic differentiation of senescent bone mesenchymal stem cells through inhibiting endogenous reactive oxygen species production via AMPK activation, Redox report: communications in free radical research 24 (2019) 62–69. [15] X. He, G. Andersson, U. Lindgren, Y. Li, Resveratrol prevents RANKL-induced osteoclast differentiation of murine osteoclast progenitor RAW 264.7 cells through inhibition of ROS production, Biochem. Biophys. Res. Commun. 401 (2010) 356–362. [16] G. Bhattarai, S.B. Poudel, S.H. Kook, J.C. Lee, Resveratrol prevents alveolar bone loss in an experimental rat model of periodontitis, Acta Biomater. 29 (2016) 398–408. [17] M.G. Correa, S. Absy, H. Tenenbaum, F.V. Ribeiro, F.R. Cirano, M.Z. Casati, S.P. Pimentel, Resveratrol attenuates oxidative stress during experimental periodontitis in rats exposed to cigarette smoke inhalation, J. Periodontal Res. 54 (2019) 225–232. [18] Z. Deng, Y. Li, H. Liu, S. Xiao, L. Li, J. Tian, C. Cheng, G. Zhang, F. Zhang, The Role of Sirtuin 1 and its Activator, Resveratrol in Osteoarthritis, Bioscience Reports, 39, (2019). [19] W. Cao, Y. Dou, A. Li, Resveratrol boosts cognitive function by targeting SIRT1, Neurochem. Res. 43 (2018) 1705–1713. [20] S. Gonfloni, V. Iannizzotto, E. Maiani, G. Bellusci, S. Ciccone, M. Diederich, P53 and Sirt1: routes of metabolism and genome stability, Biochem. Pharmacol. 92 (2014) 149–156. [21] J.W. Hwang, H. Yao, S. Caito, I.K. Sundar, I. Rahman, Redox regulation of SIRT1 in inflammation and cellular senescence, Free Radic. Biol. Med. 61 (2013) 95–110. [22] K. Zainabadi, C.J. Liu, A.L.M. Caldwell, L. Guarente, SIRT1 is a positive regulator of in vivo bone mass and a therapeutic target for osteoporosis, PLoS One 12 (2017) e0185236. [23] H. Wang, Z. Hu, J. Wu, Y. Mei, Q. Zhang, H. Zhang, D. Miao, W. Sun, Sirt1 promotes osteogenic differentiation and increases alveolar bone mass via Bmi1 activation in mice, Journal of Bone and Mineral Research : The Official Journal of the American Society for Bone and Mineral Research 34 (2019) 1169–1181. [24] D.R. Calnan, A. Brunet, The FoxO code, Oncogene 27 (2008) 2276–2288. [25] B. Ponugoti, G. Dong, D.T. Graves, Role of forkhead transcription factors in diabetes-induced oxidative stress, Exp. Diabetes Res. 2012 (2012) 939751.
5. Conclusions To summarize, we confirmed that oxidative stress played a crucial role in osteoporosis, leading to deterioration of bone loss. But RES treatment could strongly reverse these negative effects through decreasing oxidative stress levels and restoring osteoblasts functions via activated SIRT1 and FoxO1 deacetylation. These consequences proved that RES might promote osteogenesis in oxidative stress-induced osteoporosis through the activation of SIRT1/FoxO1 signaling pathway. Our study provides a new idea for the prevention and treatment of osteoporosis. 6
Life Sciences 246 (2020) 117422
Y. Jiang, et al.
Nutr. Biochem. 26 (2015) 1298–1307. [34] A. Brunet, L.B. Sweeney, J.F. Sturgill, K.F. Chua, P.L. Greer, Y. Lin, H. Tran, S.E. Ross, R. Mostoslavsky, H.Y. Cohen, L.S. Hu, H.L. Cheng, M.P. Jedrychowski, S.P. Gygi, D.A. Sinclair, F.W. Alt, M.E. Greenberg, Stress-dependent regulation of FOXO transcription factors by the SIRT1 deacetylase, Science (New York, N.Y.) 303 (2004) 2011–2015. [35] H.N. Kim, L. Han, S. Iyer, R. de Cabo, H. Zhao, C.A. O’Brien, S.C. Manolagas, M. Almeida, Sirtuin1 suppresses osteoclastogenesis by deacetylating FoxOs, Molecular Endocrinol. (Baltimore, Md.) 29 (2015) 1498–1509. [36] A. Eijkelenboom, B.M. Burgering, FOXOs: signalling integrators for homeostasis maintenance, Nat. Rev. Mol. Cell Biol. 14 (2013) 83–97. [37] J. Cao, Y. Yu, Z. Zhang, X. Chen, Z. Hu, Q. Tong, J. Chang, X.H. Feng, X. Lin, SCP4 promotes gluconeogenesis through FoxO1/3a dephosphorylation, Diabetes 67 (2018) 46–57. [38] T. Sewastianik, M. Szydlowski, E. Jablonska, E. Bialopiotrowicz, P. Kiliszek, P. Gorniak, A. Polak, M. Prochorec-Sobieszek, A. Szumera-Cieckiewicz, T.S. Kaminski, S. Markowicz, E. Nowak, M.A. Grygorowicz, K. Warzocha, P. Juszczynski, FOXO1 is a TXN- and p300-dependent sensor and effector of oxidative stress in diffuse large B-cell lymphomas characterized by increased oxidative metabolism, Oncogene 35 (2016) 5989–6000. [39] X. Mo, X. Wang, Q. Ge, F. Bian, The effects of SIRT1/FoxO1 on LPS induced INS-1 cells dysfunction, Stress (Amsterdam, Netherlands) 22 (2019) 70–82.
[26] M.T. Rached, A. Kode, L. Xu, Y. Yoshikawa, J.H. Paik, R.A. Depinho, S. Kousteni, FoxO1 is a positive regulator of bone formation by favoring protein synthesis and resistance to oxidative stress in osteoblasts, Cell Metab. 11 (2010) 147–160. [27] Y. Ning, Z. Li, Z. Qiu, FOXO1 silence aggravates oxidative stress-promoted apoptosis in cardiomyocytes by reducing autophagy, J. Toxicol. Sci. 40 (2015) 637–645. [28] Y. Zhang, Y. Xiong, J. Zhou, N. Xin, Z. Zhu, Y. Wu, FoxO1 expression in osteoblasts modulates bone formation through resistance to oxidative stress in mice, Biochem. Biophys. Res. Commun. 503 (2018) 1401–1408. [29] D.W. Dempster, J.E. Compston, M.K. Drezner, F.H. Glorieux, J.A. Kanis, H. Malluche, P.J. Meunier, S.M. Ott, R.R. Recker, A.M. Parfitt, Standardized nomenclature, symbols, and units for bone histomorphometry: a 2012 update of the report of the ASBMR Histomorphometry Nomenclature Committee, Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research 28 (2013) 2–17. [30] Y.R. Li, S. Li, C.C. Lin, Effect of resveratrol and pterostilbene on aging and longevity, BioFactors (Oxford, England) 44 (2018) 69–82. [31] K. Zainabadi, Drugs targeting SIRT1, a new generation of therapeutics for osteoporosis and other bone related disorders? Pharmacol. Res. 143 (2019) 97–105. [32] H. Yao, Z. Yao, S. Zhang, W. Zhang, W. Zhou, Upregulation of SIRT1 inhibits H2O2induced osteoblast apoptosis via FoxO1/betacatenin pathway, Mol. Med. Rep. 17 (2018) 6681–6690. [33] P.K. Bagul, N. Deepthi, R. Sultana, S.K. Banerjee, Resveratrol ameliorates cardiac oxidative stress in diabetes through deacetylation of NFkB-p65 and histone 3, J.
7
Contents lists available at ScienceDirect
Life Sciences journal homepage: www.elsevier.com/locate/lifescie
Resveratrol promotes osteogenesis via activating SIRT1/FoxO1 pathway in osteoporosis mice Yixuan Jianga,b, Wenqiong Luoa,b, Bin Wanga,b, Xinyu Wanga, Ping Gonga,b, Yi Xionga,b, a b
T
⁎
State Key Laboratory of Oral Diseases, National Clinical Research Center for Oral Diseases, West China Hospital of Stomatology, Sichuan University, Chengdu, China Department of Implantology, West China Hospital of Stomatology, Sichuan University, Chengdu, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Resveratrol Forkhead transcription factor 1 Sirtuin 1 Osteoporosis Oxidative stress Osteogenesis
Aims: This study aimed to investigate the effects of resveratrol (3, 4′, 5-trihydroxystilbene, RES) on osteoporosis and the role of SIRT1/FoxO1 pathway in the process. Main methods: In vivo, mice were divided into 3 groups, Sham, ovariectomized (OVX) and OVX-RES group. Micro-CT, histology and histomorphometry were conducted to detect details of bone mass and microstructure. The expression of osteoblast markers was tested by Real-time qPCR and serum markers which reflected bone formation and resorption were analyzed by enzyme-linked immunosorbent assay (ELISA). Besides, we assayed sirtuin 1 (SIRT1) expression and the concentration of serum superoxide dismutase (SOD). In vitro, osteoblasts were seperated into 3 groups: control, H2O2 (hydrogen peroxide, H2O2) and H2O2-RES group. Cell proliferation, differentiation and apoptosis were detected. In addition, we tested intracellular reactive oxygen species (ROS) formation and SOD activity detection of osteoblasts. The SIRT1, acetylated FoxO1 (Ac-FoxO1) and nuclear FoxO1 (Nu-FoxO1) expression were detected by western blot. Key findings: Results revealed that RES could ameliorate bone loss and promote osteogenesis by reinforcing resistance of oxidative stress in OVX mice. RES enhanced proliferation, differentiation and suppressed apoptosis of H2O2-treated osteoblasts. In this process, SIRT1 was upregulated and the level of Nu-FoxO1, which had high transcriptional activity to regulate redox balance, significantly increased. Significance: Oxidative stress plays a crucial role in osteoporosis. RES can reinforce resistance to oxidative damage and hence promote osteogenesis via the activation of SIRT1/FoxO1 signaling pathway, which provides a new idea for the prevention and treatment of osteoporosis.
1. Introduction Osteoporosis, one of the most common bone metabolic diseases, impacts millions of people worldwide, especially postmenopausal women and the elderly [1]. The defining characteristics of osteoporosis are loss of bone mass and structural deterioration with a greater tendency to pathological fracture [2]. Thus finding methods to prevent and treat osteoporosis has always been the focus. Resveratrol (trans-3, 4′, 5trihydroxystilbene, RES) is a natural polyphenolic compound found in grapes and several medicinal plants [3]. Studies have confirmed the potential of RES in prevention and treatment of various diseases, such as cancer, cardiovascular diseases, diabetes and Alzheimer's disease [4–6]. In addition, a few researches have suggested that RES may have beneficial effects on osteoporosis [7,8]. Recently, increasing evidences indicated that oxidative stress plays
a key role in the onset and progression of osteoporosis [9]. Oxidative stress is the consequence of overproduced reactive oxygen species (ROS) and decreased endogenous antioxidant defensive enzymes including catalase, superoxide dismutase (SOD) and glutathione peroxidase, thus resulting in the damage of nucleic acids, proteins, and lipids [10,11]. Studies have revealed that excessive generation of ROS has negative effects on bone remodeling through osteoblasts dysfunction and osteoclasts activation [12,13]. RES has antioxidant capacities to resist oxidative stress, thereby activating osteogenic differentiation of bone mesenchymal stem cells (BMSCs) and inhibits osteoclast function [14,15]. Besides, RES alleviates periodontitis-mediated alveolar bone loss by repressing ROS production and promoting SOD expression [16,17]. These observations indicate that RES may prevent bone loss by counteracting oxidative damage, while the underlying mechanisms have not been clarified.
⁎ Corresponding author at: State Key Laboratory of Oral Diseases, National Clinical Research Center for Oral Diseases, and Department of Implantology, West China Hospital of Stomatology, Sichuan University, No 14th, 3rd section, Renmin South Road, Chengdu 610041, China. E-mail address: [email protected] (Y. Xiong).
https://doi.org/10.1016/j.lfs.2020.117422 Received 27 November 2019; Received in revised form 30 January 2020; Accepted 10 February 2020 Available online 11 February 2020 0024-3205/ © 2020 Elsevier Inc. All rights reserved.
Life Sciences 246 (2020) 117422
Y. Jiang, et al.
Sirtuin1 (SIRT1), a nicotinamide adenosine dinucleotide (NAD+)dependent deacetylase enzyme, is a potential therapeutic target of RES [18,19]. SIRT1 regulates the activity of downstream target genes through deacetylation [20,21]. Studies have demonstrated that SIRT1 can attenuate bone loss and promote bone formation in mice, indicating that it is also a novel target for bone metabolism [22,23]. Forkhead box O (FoxO) transcription factor family consists of four members, FoxO1, FoxO3, FoxO4 and FoxO6 [24]. Among them, FoxO1 is widely expressed in bone and could be activated by ROS, which then promotes the expression of downstream antioxidant genes to maintain balance of cellular redox state [25,26]. When FoxO1 was silenced, H2O2-induced oxidative stress was aggravated and cell apoptosis was facilitated [27]. Our previous study also illustrated that deletion of FoxO1 gene caused a high level of ROS and resulted in osteoblasts dysfunction [28]. These data revealed that FoxO1 might be implicated as a key regulator of oxidative stress, but how FoxO1 actively contributes to the oxidative stress under RES treatment remains unclear. Besides, whether RES could regulate the activity of FoxO1 to participate in the modulation of oxidative stress via activated SIRT1 needs to be further studied. Based on the above, we speculate that RES may restrain oxidative stress in osteoporosis via SIRT1/FoxO1 signal pathway. Therefore, we proposed this study to investigate the role of RES in osteoporosis and its intrinsic mechanisms. The results of the study may provide therapeutic implications for osteoporosis.
Table 1 Primers and probes used for PCR. Primers
Forward primer 5′–3′
Reverse primer 5′–3′
ALP Osx Runx2 GAPDH
AACCCAGACACAAGCATTCC ATTCTCCCATTCTCCCTCCCT GGCGTCAAACAGCCTCTTCA AAGGCCGGGGCCCACTTGAA
GCCTTTGAGGTTTTTGGTCA GGAAGGGTGGGTAGTCATTTGC GCTCACGTCGCTCATCTTGC GGACTGTGGTCATGAGCCCTTCCA
2.4. Real-time qPCR and enzyme-linked immunosorbent assay (ELISA) Total RNA was isolated by Trizol Reagent (Invitrogen, Carlsbad, CA, USA). Reverse transcriptions were performed using Prime Script Reverse Transcriptase (Takara, Japan) and real-time qPCR was conducted by SYBR Premix Ex TaqTM kit (Takara, Japan) with ABI 7300 real-time PCR system (Applied Biosystems, USA). Primer sequences were listed in Table 1. Blood serum from mice was harvested and centrifuged. The supernatant of each sample was used for quantitative examination of procollagen type 1 N-terminal propeptide (P1NP) and c-telopeptide of type 1 collagen (CTX) by ELISA kit (Cusabio, China). The serum level of SOD was detected via a specific kit (Jiancheng, Nanjing, China) following the manufacturer's instructions. 2.5. Cell culture and biology
2. Materials and methods
Osteoblasts were taken from newborn mice calvaria, cultured in αMEM supplemented with 10% fetal bovine serum (FBS, Gibco, USA), 100 U/ml penicillin and 100 mg/ml streptomycin sulfate. Cells in passage 3 were used for the following analysis. Firstly, Counting Kit-8 (CCK-8, Dojindo, Japan) assay was performed to detect cell proliferation for selecting optimum dose of RES (Fig. 3A). The optical density (OD) value at 450 nm was measured in each well. Oxidative stress model in osteoblast was established by adding H2O2. There were 3 groups: control, H2O2 (0.2 mM hydrogen peroxide, H2O2, Sigma Aldrich, China), and H2O2-RES (0.1 mM RES, Sigma Aldrich, China). Proliferation of osteoblasts in each group was assayed as described previously. At 14d after culture, alkaline phosphatase (ALP, Beyotime, China) staining was preformed and ALP activity was tested by ALP Assay Kit (Beyotime, China). Total protein concentration was examined by Bradford Protein Assay Kit (Beyotime, China). Results were normalized to total protein concentration as nanomoles of produced p-nitrophenol per min per mg of protein (nmol/min/mg protein). Apoptosis assay was implemented after 7 days of culture by evaluating caspase-3 activity, which was examined by quantifying the degradation of the fluorometric substrate DEVD (Biomol Research Labs). The method of protein concentration was stated above.
2.1. Animals and ovariectomy All animal studies were conducted in accordance with international standards on animal welfare and approved by the Animal Research Committee of Sichuan University (Chengdu, China). Female mice of 8 weeks old were prepared and randomly assigned to 3 groups: Sham, ovariectomized (OVX) and OVX-RES. Mice in the latter two groups were treated with bilateral ovariectomy to establish osteoporosis models, while those in the Sham group were only given laparotomy. RES (40 mg/kg body weight, Sigma-Aldrich, China) was performed intraperitoneally once every day for 8 weeks.
2.2. Micro-CT analysis and HE staining Femurs were harvested and fixed, scanning by micro-CT (SCANCO 50, Swizerland) at 7 μm resolution. Bones were reconstructed and analyzed by the script of bone volume per total volume (BV/TV), the mean trabecular number (Tb.N) and the mean trabecular separation (Tb.Sp). Samples from distal femurs were fixed and decalcified in 15% ethylene diamine tetraacetic acid (EDTA). Then these samples were dehydrated through a graded series of ethanol solutions before they were embedded in paraffin, which were sawn parallel to the long axis into 5 μm sections for HE staining.
2.6. Intracellular ROS formation and SOD activity detection Cells were incubated with 10 μM 2′,7′-dichlorodihydrofluorescin diacetate (DCFH-DA, Molecular Probes, Invitrogen), an oxidation sensitive fluorescent probe dye, for 30 min at 37 °C. Then we used flow cytometry to assay the ROS level. LSR II Flow cytometer (BD biosciences) at an excitation wavelength of 495 nm and emission wavelength of 527 nm was performed to measure fluorescence. After RES treatment at 7d, SOD activity in osteoblasts was examined as stated in 2.4.
2.3. Histomorphometry, TRAP staining and immunohistochemistry Specimens were fixed, dehydrated and embedded without decalcification. Histomorphometric measurements including number of osteoblasts and osteoclasts in the distal femur were performed using the OsteoMeasure Analysis System (OsteoMetrics, Inc.) as previously described [29]. The distal femurs were harvested, decalcified and embedded in paraffin. 5 μm longitudinal sections were obtained for tartrate-resistant acid phosphatase (TRAP)-staining, which was performed to detect the number of osteoclasts. Other sections were detected by immunohistochemistry to evaluate the expressions of SIRT1 and Runx2.
2.7. Western blot analysis Cells were collected and subjected to lysis buffer (Keygen total protein extraction kit, Keygen Biotech, China). Proteins extracts were separated on 10% SDS-PAGE gels and transferred on polyvinylidene 2
Life Sciences 246 (2020) 117422
Y. Jiang, et al.
BV/TV and Tb.N (Fig. 1A, C-E). HE staining also suggested that RES prevented bone loss caused by OVX in OVX-RES group (Fig. 1B). According to Fig. 2A-C, the number of osteoblasts greatly decreased and osteoclasts increased in the OVX group as compared to the Sham group. While RES promoted an increase in osteoblasts number and a decrease in osteoclasts number. Besides, RES enhanced osteogenic differentiation since the expressions of osteogenic makers alkaline phosphatase (ALP), runt-related transcription factor 2 (Runx2) and osterix (Osx) were significantly increased (Fig. 2E-G). Similar results were shown in immunohistochemical analysis for Runx2 (Fig. 2D). As stated previously, SIRT1 has been considered as the therapeutic target of RES. In order to explore the intrinsic mechanisms of RES, immunohistochemical detection was conducted to measure the expression level of SIRT1 in mice. Results showed that SIRT1 expression decreased in the OVX group. In contrast, SIRT1 was at a higher level in the OVXRES group (Fig. 2D).
difluoride membranes (Millipore Corp, Bedford, MA), which were then blocked and probed at 4 °C overnight with primary antibodies. β-actin (ACTB) was used as control for normalization and histone H3 as the loading control in cell nucleus. After horseradish peroxidase-conjugated secondary antibodies were utilized consistently with each primary antibody, immunoreactive proteins were tested by an enhanced chemiluminescence kit (Millipore, USA). 2.8. Statistical analysis Data was analyzed with SPSS 20.0 software (SPSS, Inc., Chicago, IL) and presented as mean ± standard deviation (SD). The values were assessed by one-way analysis of variance (ANOVA) followed by the LSD test for multiple comparisons. A significant difference was assumed at p < 0.05 (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001). 3. Results
3.2. RES enhances antioxidative defense in osteoporosis mice 3.1. RES promotes osteogenesis in osteoporosis mice Data showed that the serum level of SOD decreased considerably in the OVX group as compared to the Sham group. But in the OVX-RES group, SOD level was rebounded (Fig. 2H). In addition, two typical serum markers which reflected bone formation and resorption respectively, P1NP and CTX, were assayed. Results showed that the P1NP content was dramatically lower in the OVX group when compared to
In order to observe the effects of RES on osteoporosis, micro-CT analysis was performed to detect details of bone mass and microstructure. Compared with Sham group, higher Tb.Sp, lower BV/TV and Tb.N were detected in OVX group. RES treatment reversed changes in these parameters caused by OVX, showing decreased Tb.Sp, increased
Fig. 1. RES treatment attenuates deterioration of bone microstructure in OVX mice. Representative photograph of micro-CT reconstruction (A) and HE staining (B) of distal femurs. Scale bar = 200 μm. (C) Bone volume per total volume (BV/TV). (D) Mean trabecular number (Tb.N). (E) Mean trabecular separation (Tb.Sp). Data are means ± SD, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. n = 4 specimens/group. 3
Life Sciences 246 (2020) 117422
Y. Jiang, et al.
Fig. 2. RES improves bone formation and reduces bone resorption over oxidative stress. Number of osteoblasts (A) and osteoclasts (B) in femur bone. (C) TRAP staining of femurs. Scale bar = 20 μm. (D) Immunohistochemical analysis of femurs. Scale bar = 25 μm. (E, F, G) Real-time qPCR analysis of ALP, Runx2 and Osx. The serum level of SOD (H), P1NP(I) and CTX (J). Data are means ± SD, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. n = 4–6 specimens/group.
osteoblasts. Therefore, 0.1 mM RES was selected for following experiments (Fig. 3A). When compared to the control group, H2O2-treated osteoblasts proliferation was reduced significantly as the consequences became more visible at 3d and 5d. With RES treatment, proliferative activity of osteoblasts was improved to some extent (Fig. 3B). ALP activity and staining which could reflect osteogenic differentiation capacity of osteoblasts, revealed that osteoblasts differentiation was restrained by H2O2. But RES reversed the inhibitory effects on osteoblasts differentiation, showing higher ALP activity in H2O2-RES group than H2O2 group (Fig. 3C, G). Caspase-3 activity is the index reflecting cell apoptosis. Compared with control group, there was a prominent increase of caspase-3 activity in H2O2 group, indicating a higher level of osteoblasts apoptosis. While caspase-3 activity in the H2O2-RES group was significantly lower than it in the H2O2 group (Fig. 3D), suggesting that RES could inhibit osteoblasts apoptosis over H2O2-induced oxidative stress.
Sham group, while CTX was at a higher level inversely. However, the OVX-RES group displayed an enhancement of P1NP and a reduction of CTX (Fig. 2I-J). These observations indicated that RES might promote bone formation and prevent bone resorption via resistance to redox imbalance.
3.3. RES enhances osteoblasts activity and inhibits osteoblasts apoptosis over oxidative stress To further investigate the influence of RES on osteogenesis over oxidative stress, we established H2O2-induced oxidative damage model in osteoblasts. Firstly, CCK-8 assay showed that the effect of RES on osteoblasts proliferation was dose-dependent. The proliferative activity of osteoblasts under 0.1 mM RES treatment was the highest. When RES in higher or lower dose compared to 0.1 mM, osteoblasts proliferation was decreased. Moreover, cell proliferation was declined most when RES was at a high dose of 0.2 mM, even had an inhibitory effect on 4
Life Sciences 246 (2020) 117422
Y. Jiang, et al.
Fig. 3. RES decreases H2O2-induced oxidative stress and improves biological functions of osteoblasts. (A) CCK-8 assay for selecting optimum dose of RES. (B) Cell proliferation in each group determined by CCK-8 assay. (C) ALP activity. (D) Caspase-3 activity. AFU, arbitrary fluorescence units. (E) Intracellular ROS level. (F) The level of SOD in osteoblasts. (G) ALP staining. Scale bar = 1 cm. (H) Protein levels of SIRT1, Ac-FoxO1 and Nu-FoxO1 tested by western blot analysis. ACTB: β-actin.
3.4. RES activates SIRT1/FoxO1 signal pathway to attenuate oxidative stress
osteoblasts through SIRT1/FoxO1 signal pathway.
According to Fig. 3E-F, intracellular ROS level increased remarkably, while SOD decreased significantly in H2O2 group as compared to the control. RES treatment reduced ROS and upregulated SOD expression when osteoblasts exposed to H2O2. These data indicated that RES improved osteoblast biological functions by abrogating redox imbalance. To elucidate the mechanisms of RES in oxidative stress, we examined SIRT1, acetylated FoxO1 (Ac-FoxO1) and nuclear FoxO1 (NuFoxO1) in western blot analysis. As shown in Fig. 3H, SIRT1 was upregulated with the treatment of RES when osteoblasts were dealt with H2O2 and the level of Ac-FoxO1 remarkably decreased due to the deacetylation of SIRT1 in H2O2-RES group. But Ac-FoxO1 in H2O2 group was at a high level. Then we observed that Nu-FoxO1 was appreciably enhanced in H2O2-RES group, thus activating downstream targets antioxidative enzymes like SOD to attenuate oxidative stress. These results demonstrated that RES might modulate oxidative stress in
4. Discussion RES, a natural polyphenolic component, has been found beneficial to prevent bone loss. We established OVX mice models to explore the effects of RES on osteoporosis. Results revealed that RES ameliorated bone microstructure deterioration, increased osteoblasts number and decreased osteoblasts number in OVX mice, showing the positive effects of RES on osteoporosis. Li YR et al. illustrated that RES had the potential to prevent and attenuate age-related diseases by modulating oxidative stress [30]. Consistently, we found that RES restored the serum SOD level in the OVX-RES group while it decreased sharply in the OVX group. These data indicated that oxidative stress participated in the development of osteoporosis and RES could prevent bone loss by the inhibition of oxidative stress. To further explore the mechanisms of RES involved in osteogenesis, we then established H2O2-induced oxidative stress model in osteoblasts. Results showed that RES promoted 5
Life Sciences 246 (2020) 117422
Y. Jiang, et al.
Declaration of competing interest
proliferation and differentiation of osteoblasts and reduced cell apoptosis caused by H2O2. In this process, SOD level was elevated to scavenge ROS production under the treatment of RES, suggesting that RES protected from bone resorption and improved bone formation via reinforcement of antioxidative defense. Previous studies have demonstrated that SIRT1 is a latent therapeutic target of RES [31]. Immunohistochemical analysis in our study confirmed that SIRT1 expression was upregulated in OVX mice treated with RES. Wang et al. [7] also found that RES could increase bone density via activated SIRT1 in OVX rats, highlighting its potential as a novel pharmacological target of RES for treating osteoporosis. In addition, SIRT1 overexpression could inhibit apoptosis of osteoblast progenitors by regulating FoxO1-mediated target genes which eventually resulted in cell apoptosis, indicating that SIRT1/FoxO1 factor axis might be one of the pathways involved in osteogenesis [32]. SIRT1 is a deacetylase that regulates its downstream targets such as p53, nuclear factor kappa B (NFkB) through deacetylation [20,33]. Currently, there is a growing body of studies indicating that SIRT1 can catalyze deacetylation of FoxOs. When SIRT1 gene knocked down, FoxOs acetylation increased and enhanced osteoclastgenesis [34,35]. FoxOs is a family of transcription factors depending on the modulation of phosphorylation, acetylation and methylation to affect sorts of physiological and pathological processes [36]. It was mostly studied that dephosphorylated FoxO1 could translocate into nucleus and hence have high transcriptional activity to regulate downstream targets to maintain cellular homeostasis [37]. Considering that, we wondered if acetylation/deacetylation of FoxO1 had the similar effects. Sewastianik T et al. revealed that acetylation of FoxO1 inhibited its nuclear translocation and then downregulated FoxO1 transcriptional activity toward genes involved in oxidative stress [38]. In this work, western blot analysis showed that SIRT1 expression was upregulated by RES treatment and deacetylation was subsequently elevated, leading to a reduced expression level of Ac-FoxO1. Then Nu-FoxO1 level was enhanced considerably in H2O2-RES group as compared to H2O2 group, indicating that the shuttle of deacetylated FoxO1 from cytoplasm to nucleus was promoted. Of note, Nu-FoxO1 had high transcriptional activity to regulate downstream targets. With the above stated, SOD expression was upregulated with RES treatment to attenuate oxidative stress both in OVX mice and H2O2-treated osteoblasts, suggesting that SOD was one of the downstream targets of FoxO1 to be responsible for the cellular redox balance. This was in accordance with Ponugoti B et al., who had also demonstrated that FoxO1 can upregulate the SOD expression level to scavenge overproduced ROS in hyperglycemia-induced oxidative stress [25]. Besides, Mo X et al. also illustrated that SIRT1 upregulated the deacetylation of FoxO1 and promoted its nuclear transportation, thus increasing cell viability to resist oxidative damage in the regulation of glucose metabolism [39]. These findings suggested that deacetylation of FoxO1 by activated SIRT1 was one of the mechanisms through which RES conferred its effects. In this process, NuFoxO1 was upregulated to modulate downstream target antioxidative enzymes including SOD toward oxidative damage. Taken together, these results elucidated that SIRT1/FoxO1 might act as a significant pathway in oxidative stress, indicating its therapeutic implications in osteoporosis or other bone related disorders.
The authors declare that they have no conflict of interest. Acknowledgements This work was supported by China Postdoctoral Science Foundation (0040304153038), China; West China Hospital of Stomatology and West China Hospital Basic and Applied Basic Research Foundation (RD02-201913), China; West China Hospital of Stomatology. References [1] S.C. Manolagas, From estrogen-centric to aging and oxidative stress: a revised perspective of the pathogenesis of osteoporosis, Endocr. Rev. 31 (2010) 266–300. [2] D.L. Glaser, F.S. Kaplan, Osteoporosis. Definition and clinical presentation, Spine 22 (1997) 12s–16s. [3] B.D. Gehm, J.M. McAndrews, P.Y. Chien, J.L. Jameson, Resveratrol, a polyphenolic compound found in grapes and wine, is an agonist for the estrogen receptor, Proc. Natl. Acad. Sci. U. S. A. 94 (1997) 14138–14143. [4] J.H. Ko, G. Sethi, J.Y. Um, M.K. Shanmugam, F. Arfuso, A.P. Kumar, A. Bishayee, K.S. Ahn, The role of resveratrol in cancer therapy, Int. J. Mol. Sci. 18 (2017). [5] S. Cho, K. Namkoong, M. Shin, J. Park, E. Yang, J. Ihm, V.T. Thu, H.K. Kim, J. Han, Cardiovascular protective effects and clinical applications of resveratrol, J. Med. Food 20 (2017) 323–334. [6] C. Sawda, C. Moussa, R.S. Turner, Resveratrol for Alzheimer's disease, Annals of the New York Academy of Sciences 1403 (2017) 142–149. [7] X. Wang, L. Chen, W. Peng, Protective effects of resveratrol on osteoporosis via activation of the SIRT1-NF-kappaB signaling pathway in rats, Experimental and therapeutic medicine 14 (2017) 5032–5038. [8] J.C. Tou, Resveratrol supplementation affects bone acquisition and osteoporosis: pre-clinical evidence toward translational diet therapy, Biochim. Biophys. Acta 1852 (2015) 1186–1194. [9] Q. Zhou, L. Zhu, D. Zhang, N. Li, Q. Li, P. Dai, Y. Mao, X. Li, J. Ma, S. Huang, Oxidative stress-related biomarkers in postmenopausal osteoporosis: a systematic review and meta-analyses, Dis. Markers 2016 (2016) 7067984. [10] S. Ogura, T. Shimosawa, Oxidative stress and organ damages, Curr. Hypertens. Rep. 16 (2014) 452. [11] G. Filomeni, D. De Zio, F. Cecconi, Oxidative stress and autophagy: the clash between damage and metabolic needs, Cell Death Differ. 22 (2015) 377–388. [12] D.A. Callaway, J.X. Jiang, Reactive oxygen species and oxidative stress in osteoclastogenesis, skeletal aging and bone diseases, J. Bone Miner. Metab. 33 (2015) 359–370. [13] P. Vrtacnik, J. Zupan, V. Mlakar, T. Kranjc, J. Marc, B. Kern, B. Ostanek, Epigenetic enzymes influenced by oxidative stress and hypoxia mimetic in osteoblasts are differentially expressed in patients with osteoporosis and osteoarthritis, Sci. Rep. 8 (2018) 16215. [14] T. Zhou, Y. Yan, C. Zhao, Y. Xu, Q. Wang, N. Xu, Resveratrol improves osteogenic differentiation of senescent bone mesenchymal stem cells through inhibiting endogenous reactive oxygen species production via AMPK activation, Redox report: communications in free radical research 24 (2019) 62–69. [15] X. He, G. Andersson, U. Lindgren, Y. Li, Resveratrol prevents RANKL-induced osteoclast differentiation of murine osteoclast progenitor RAW 264.7 cells through inhibition of ROS production, Biochem. Biophys. Res. Commun. 401 (2010) 356–362. [16] G. Bhattarai, S.B. Poudel, S.H. Kook, J.C. Lee, Resveratrol prevents alveolar bone loss in an experimental rat model of periodontitis, Acta Biomater. 29 (2016) 398–408. [17] M.G. Correa, S. Absy, H. Tenenbaum, F.V. Ribeiro, F.R. Cirano, M.Z. Casati, S.P. Pimentel, Resveratrol attenuates oxidative stress during experimental periodontitis in rats exposed to cigarette smoke inhalation, J. Periodontal Res. 54 (2019) 225–232. [18] Z. Deng, Y. Li, H. Liu, S. Xiao, L. Li, J. Tian, C. Cheng, G. Zhang, F. Zhang, The Role of Sirtuin 1 and its Activator, Resveratrol in Osteoarthritis, Bioscience Reports, 39, (2019). [19] W. Cao, Y. Dou, A. Li, Resveratrol boosts cognitive function by targeting SIRT1, Neurochem. Res. 43 (2018) 1705–1713. [20] S. Gonfloni, V. Iannizzotto, E. Maiani, G. Bellusci, S. Ciccone, M. Diederich, P53 and Sirt1: routes of metabolism and genome stability, Biochem. Pharmacol. 92 (2014) 149–156. [21] J.W. Hwang, H. Yao, S. Caito, I.K. Sundar, I. Rahman, Redox regulation of SIRT1 in inflammation and cellular senescence, Free Radic. Biol. Med. 61 (2013) 95–110. [22] K. Zainabadi, C.J. Liu, A.L.M. Caldwell, L. Guarente, SIRT1 is a positive regulator of in vivo bone mass and a therapeutic target for osteoporosis, PLoS One 12 (2017) e0185236. [23] H. Wang, Z. Hu, J. Wu, Y. Mei, Q. Zhang, H. Zhang, D. Miao, W. Sun, Sirt1 promotes osteogenic differentiation and increases alveolar bone mass via Bmi1 activation in mice, Journal of Bone and Mineral Research : The Official Journal of the American Society for Bone and Mineral Research 34 (2019) 1169–1181. [24] D.R. Calnan, A. Brunet, The FoxO code, Oncogene 27 (2008) 2276–2288. [25] B. Ponugoti, G. Dong, D.T. Graves, Role of forkhead transcription factors in diabetes-induced oxidative stress, Exp. Diabetes Res. 2012 (2012) 939751.
5. Conclusions To summarize, we confirmed that oxidative stress played a crucial role in osteoporosis, leading to deterioration of bone loss. But RES treatment could strongly reverse these negative effects through decreasing oxidative stress levels and restoring osteoblasts functions via activated SIRT1 and FoxO1 deacetylation. These consequences proved that RES might promote osteogenesis in oxidative stress-induced osteoporosis through the activation of SIRT1/FoxO1 signaling pathway. Our study provides a new idea for the prevention and treatment of osteoporosis. 6
Life Sciences 246 (2020) 117422
Y. Jiang, et al.
Nutr. Biochem. 26 (2015) 1298–1307. [34] A. Brunet, L.B. Sweeney, J.F. Sturgill, K.F. Chua, P.L. Greer, Y. Lin, H. Tran, S.E. Ross, R. Mostoslavsky, H.Y. Cohen, L.S. Hu, H.L. Cheng, M.P. Jedrychowski, S.P. Gygi, D.A. Sinclair, F.W. Alt, M.E. Greenberg, Stress-dependent regulation of FOXO transcription factors by the SIRT1 deacetylase, Science (New York, N.Y.) 303 (2004) 2011–2015. [35] H.N. Kim, L. Han, S. Iyer, R. de Cabo, H. Zhao, C.A. O’Brien, S.C. Manolagas, M. Almeida, Sirtuin1 suppresses osteoclastogenesis by deacetylating FoxOs, Molecular Endocrinol. (Baltimore, Md.) 29 (2015) 1498–1509. [36] A. Eijkelenboom, B.M. Burgering, FOXOs: signalling integrators for homeostasis maintenance, Nat. Rev. Mol. Cell Biol. 14 (2013) 83–97. [37] J. Cao, Y. Yu, Z. Zhang, X. Chen, Z. Hu, Q. Tong, J. Chang, X.H. Feng, X. Lin, SCP4 promotes gluconeogenesis through FoxO1/3a dephosphorylation, Diabetes 67 (2018) 46–57. [38] T. Sewastianik, M. Szydlowski, E. Jablonska, E. Bialopiotrowicz, P. Kiliszek, P. Gorniak, A. Polak, M. Prochorec-Sobieszek, A. Szumera-Cieckiewicz, T.S. Kaminski, S. Markowicz, E. Nowak, M.A. Grygorowicz, K. Warzocha, P. Juszczynski, FOXO1 is a TXN- and p300-dependent sensor and effector of oxidative stress in diffuse large B-cell lymphomas characterized by increased oxidative metabolism, Oncogene 35 (2016) 5989–6000. [39] X. Mo, X. Wang, Q. Ge, F. Bian, The effects of SIRT1/FoxO1 on LPS induced INS-1 cells dysfunction, Stress (Amsterdam, Netherlands) 22 (2019) 70–82.
[26] M.T. Rached, A. Kode, L. Xu, Y. Yoshikawa, J.H. Paik, R.A. Depinho, S. Kousteni, FoxO1 is a positive regulator of bone formation by favoring protein synthesis and resistance to oxidative stress in osteoblasts, Cell Metab. 11 (2010) 147–160. [27] Y. Ning, Z. Li, Z. Qiu, FOXO1 silence aggravates oxidative stress-promoted apoptosis in cardiomyocytes by reducing autophagy, J. Toxicol. Sci. 40 (2015) 637–645. [28] Y. Zhang, Y. Xiong, J. Zhou, N. Xin, Z. Zhu, Y. Wu, FoxO1 expression in osteoblasts modulates bone formation through resistance to oxidative stress in mice, Biochem. Biophys. Res. Commun. 503 (2018) 1401–1408. [29] D.W. Dempster, J.E. Compston, M.K. Drezner, F.H. Glorieux, J.A. Kanis, H. Malluche, P.J. Meunier, S.M. Ott, R.R. Recker, A.M. Parfitt, Standardized nomenclature, symbols, and units for bone histomorphometry: a 2012 update of the report of the ASBMR Histomorphometry Nomenclature Committee, Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research 28 (2013) 2–17. [30] Y.R. Li, S. Li, C.C. Lin, Effect of resveratrol and pterostilbene on aging and longevity, BioFactors (Oxford, England) 44 (2018) 69–82. [31] K. Zainabadi, Drugs targeting SIRT1, a new generation of therapeutics for osteoporosis and other bone related disorders? Pharmacol. Res. 143 (2019) 97–105. [32] H. Yao, Z. Yao, S. Zhang, W. Zhang, W. Zhou, Upregulation of SIRT1 inhibits H2O2induced osteoblast apoptosis via FoxO1/betacatenin pathway, Mol. Med. Rep. 17 (2018) 6681–6690. [33] P.K. Bagul, N. Deepthi, R. Sultana, S.K. Banerjee, Resveratrol ameliorates cardiac oxidative stress in diabetes through deacetylation of NFkB-p65 and histone 3, J.
7