- Email: [email protected]
Retarded and Aberrant Splicings Caused by Single Exon Mutation in a Phosphoglycerate Kinase Variant
ARCHIVES OF BIOCHEMISTRY AND BIOPHYSICS
Vol. 327, No. 1, March 1, pp. 35–40, 1996 Article No. 0089
Retarded and Aberrant Splicings Caused by Single Exon Mutation in a Phosphoglycerate Kinase Variant1 Tomomi Ookawara,* Vibha Dave´,* Patrick Willems,† Jean-Jacques Martin,‡ Thierry de Barsy,§ Erve´ Matthys,Ø and Akira Yoshida*,2 *Department of Biochemical Genetics, Beckman Research Institute of the City of Hope, Duarte, California, 91010; Departments of †Medical Genetics and ‡Neurology and Laboratory of Neuropathology of the Born-Bunge Foundation, University of Antwerp, Antwerp, Belgium; §International Institute of Cellular and Molecular Pathology, Universite´ Catholique de Louvain, Brussels, Belgium; and ØDepartment of Nephrology, St. Jan Hospital, Brugge, Belgium
Received September 22, 1995, and in revised form December 15, 1995
The molecular abnormality of a phosphoglycerate kinase variant which was associated with severe tissue enzyme deficiency and episodes of muscle contractions and myoglobinuria was examined. Analysis of the patient’s DNA showed the existence of a nucleotide transversion A/T r C/G in exon 7. No other nucleotide change was detected in the coding region of the variant gene. The mutation should produce a single amino acid substitution Glu r Ala at protein position 251 counting from the NH2-terminal acetyl serine residue. The protein abnormality caused by the amino acid substitution cannot explain the enzyme deficiency. Northern blot hybridization indicated that the PGK mRNA content of the patient’s lymphoblastoid cells was only about 10% of that of normal. Nucleotide sequence analysis revealed the existence of two PGK mRNA components in the patient’s cells. The major component corresponds to the normal PGK mRNA except for A r C change at nucleotide position 755 counting from adenine of the chain initiation codon. The minor component contains 5* region (52 bases) of intron 7 between exon 7 and exon 8. An inframe chain termination codon exists in the minor mRNA component, and the COOHterminal half is expected to be deleted in the translation product. These results indicate that the low PGK activity in the patient’s tissues is mainly due to retarded and aberrant pre-mRNA splicings caused by the change of the consensus 5* splice sequence AGgt to a nonconsensus sequence CGgt at the junction between exon 7 and intron 7 of the variant gene. q 1996 Academic Press, Inc.
Key Words: phosphoglycerate kinase variant; enzyme deficiency; mRNA splicing; exon mutation.
Phosphoglycerate kinase (ATP: 3-phosphoglycerate 1-phosphotransferase, EC 2.7.2.3: PGK)3 is a key enzyme involved in ATP generation in the glycolytic pathway. The matured human PGK, which is encoded by an X-chromosome-linked gene, consists of 416 amino acid residues with acetyl-serine at the NH2-terminal and isoleucine at the COOH-terminal, and the monomeric enzyme (MW about 48,000 dalton) is catalytically active (1). The complete amino acid sequence (1), cDNA sequence (2), genomic organization (3), and regional location on the X-chromosome (4) have been elucidated. Genetic deficiency of PGK activity is associated with various degrees of hemolytic anemia, neurologic abnormalities, and rhabdomyolysis. The specific nucleotide base changes of nine deficient variants have been reported (Ref. 5). Single missense nucleotide base changes causing single amino acid substitutions were found in all these variants, except for PGK-North Carolina which is associated with a 10 amino acid insertion resulting from a splice-junction mutation (6) and PGKAlabama which is associated with a deletion of codon AAG for Lys in exon 7 (7). The enzyme deficiency of these variant PGKs can be readily explained by structural instability or diminished catalytic activity of the variant proteins. This paper reports the molecular abnormality of a
1
This work was supported by the U.S. Public Health Service Grant HL-29515. 2 To whom correspondence should be addressed. Fax: (818) 3571929.
3 Abbreviation used: bp, nucleotide base pair(s); mRNA, messenger RNA; nt, nucleotide number; PCR, polymerase chain reaction; PGK, phosphoglycerate kinase; RT, reverse transcription.
35
0003-9861/96 $18.00 Copyright q 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.
6B10
/ 6b13$$9322
01-24-96 08:16:36
arcas
AP: Archives
36
OOKAWARA ET AL.
novel PGK variant found in a patient with occasional muscular contractures and myoglobinuria episodes. The enzyme deficiency of the present variant was found to be mainly due to retarded splicing caused by single exon mutation, rather than the protein defect resulting from the amino acid substitution. EXPERIMENTAL PROCEDURES Propositus. The propositus was born on January 7, 1968 from unrelated Belgian parents. His personal history was unremarkable until the age of 16 when he experienced muscular cramps and contractures with dark red urine after a short but vigorous physical exercise (a sprint of 100 meters). A second episode of rhabdomylosis with muscle cramps, dark urine, and inability to continue physical activity was noticed at the age of 25 when he was exposed to an intense training. A number of days after the onset of the symptoms, the laboratory examination showed an elevation of serum creatine kinase (58,200 u/liter, normal 10 Ç 80 u/liter), creatine kinase-MB (990 u/liter), ureum, and creatinine. At Day 13, the creatine kinase level had decreased to 103 u/liter. Apart from these two acute episodes, the patient had always experienced muscle cramps during or after intense physical activity. Intermittent creatinine kinase levels were always elevated between 82 and 710 u/liter. The patient did not have any further complaints. Physical examination could not reveal any abnormality. Histological examination of the various lateral muscles revealed a few dispersed atrophic fibers with faint sarcoplasmatic basophilia and enlarged nuclei. There were no ragged-red fibers, and the amount of neutral fats was normal in type 1 fibers. Electron microscopy showed a normal sarcomeric organization within the muscle fibers and a subsarcolemmal area filled with free b-glycogen particles. There was also an increase of the intermyofibrillar b-glycogen particles but no limiting membrane was found. Muscle glycogen, phosphorylase, phosphoglycerate mutase, carnitine, and carnitine palmitoyl transferase levels were normal. PGK activity was severely diminished in the patient’s muscle (about 8% of control mean). The patient had 4.7 1 106 red blood cell/ml blood, slightly decreased hemoglobin (13.2 g/100 ml) and hematocrit (39.5%), normal levels of platelets, and mean cell hemoglobin concentration (MCHC). Intermittently, however, the patient’s hematological values were completely normal, and no anemia was present. Red cell phosphoglycerate mutase, phosphofructokinase, pyruvate kinase, and aldolase activities were normal, but PGK activity was diminished (5.6% of the control mean). DNA and RNA samples. Peripheral blood samples were obtained from the patient and his relatives (parents, a brother, and three sisters) with informed consent. Genomic DNAs were prepared from blood by the established method (8). Lymphocytes were prepared from the patient’s and control blood and the cell lines were established by transforming the cells with Epstein–Barr virus. The culture was grown in RPMI 1640 medium (Gibco) with 20% (V/V) fetal calf serum (Gibco) and antibiotics (100 units of penicillin and 100 mg of streptomycin per ml) at 377C in 5% CO2/95% air. The total cellular RNA was prepared from the cultured cells by the standard method (8). Analysis of genomic DNA. The entire eleven coding exons of the normal and patient’s PGK genes were amplified by the polymerase chain reaction (PCR) using eleven sets of sense and antisense oligonucleotide primers (Table I). These primers correspond to the intron sequences adjacent to each exon (3). The PCR products were separated by agarose gel (2%) electrophoresis, and the fragments were purified by the Prep-A-Gene DNA purification kit (Bio-Rad, Hercules, CA). The purified PCR products were subjected to direct PCR cycle sequencing using an Applied Bio-
6B10
/ 6b13$$9322
01-24-96 08:16:36
arcas
systems Model 373 A (Foster City, CA). The sequences were determined in both directions. In order to determine genotypes of the patient’s relatives, DNA samples (approximately 1 mg each) from the family members were amplified by PCR using a pair of primers 7 and 7* (Table I). The product is expected to contain the mutation site at nt 755 counting from the adenine residue of the initiation codon of the cDNA. The PCR products were purified by agarose gel (low melting, 2%) electrophoresis. Single nucleotide extension analysis was carried out using the PCR products (approximately 30 ng each) as templates and 5* TTAAGGTGCTCAACAACATGG 3* (nt 734 to 754) as a primer in the presence of [32P]dATP (incorporated into the normal product) or [32P]dCTP (incorporated into the variant product). 32P-labeled oligonucleotides produced were separated from the unincorporated mononucleotides by acrylamide gel electrophoresis, and the products were detected by autoradiography. Details of the method have been described (9). Northern blot hybridization. Total cellular RNAs (2.5 Ç 10 mg per channel), prepared from the normal and variant lymphoblasts, were electrophoresed on a 1% agarose gel containing 2.2 M formamide, transferred onto a nitrocellulose filter, and hybridized with the fulllength human PGK cDNA probe (10) and the mouse b-actin cDNA probe (Stratagene, CA) which served as an internal reference. Hybridization was carried out in 50% formamide, 31 SSC (11 SSC is 0.15 M NaCl, 15 mM sodium citrate, pH 7.4) 51 Denhardt’s solution, 5% dextran sulfate, and 100 mg/ml salmon sperm DNA at 427C. Determination of mRNA Sequence. The entire coding sequences of the normal and variant PGKs were produced in six overlapped segments by reverse transcription (RT) and PCR using total cellular RNAs (approximately one mg each) as templates and six sets of sense and antisense primers. The details of the procedure and the sequences of primers were previously described (11). The PCR products were electrophoresed on a 2% agarose gel, and the sizes of the normal and variant products were compared. One of the six PCR products, which was produced from the variant RNA using 5* primer nt 648 to 671 and 3* primer nt 978 to 1001, contained two fragments, while the normal RNA generated only one fragment. These normal and variant components were purified by the Gelase (Epicentre Technologies, Madison, WI) DNA purification kit and further amplified by a second round of PCR using a pair of internal 5* primer nt 648 to 671 and 3* primer nt 880 to 899. The nucleotide sequences of the normal and the variant products were determined in both directions by the direct PCR cycle sequencing as described above.
RESULTS
Nucleotide base change in the propositus PGK gene and genotypes of family members. Nucleotide sequence analysis of eleven PCR products generated from the propositus DNA revealed a nucleotide base transversion A/T r C/G in exon 7. No other nucleotide change was found in the coding regions of the variant PGK gene. Single nucleotide extension of the PCR products of exon 7 generated from DNA samples of the propositus and his relatives revealed that [32P]CTP instead of [32P]ATP was incorporated into the PCR products of the propositus and his brother, i.e., they are variant hemizygous (Fig. 1). Both [32P]CTP and [32P]ATP were incorporated into the PCR product of the propositus’ mother, while only [32P]ATP was incorporated into the products of the propositus’ father and three sisters.
AP: Archives
RETARDED AND ABERRANT SPLICINGS CAUSED BY AN EXON MUTATION
37
TABLE I
Primers Used for Amplification of Exons Exons
5*-Primer
3*-Primer
1 2 3 4 5 6 7 8 9 10 11
ATCACCGACCTCTCTCCCCAGC GTCTTTGATGGAACAGTAAGTTG GAGGTTACAATAAGCTAGTCCC GTCAAGCACGTTGTTACTGGT CCACCTACTCAGGGTCTTTAG GGAGGAATGATAGGGAATTGAC CCACTTCTCTAGTCCATTCTTC GTCTGGTTCCTGTCTGCTTTGT AGCTCATCTTCTCTTTCACC CACACTGCCTTACAGTTTTGGTGC GCTGTCTATGTATGTGTGCTCTC
CGACAGAGCACAGAGAGCACGC ACCCAGCCCAAGGATTAGCAG GCCACAAAGTCTACCAGCACCAG GCTTTCTCTATTCTTCAACCAC CTGTTCTCAGTGTGGTAGTCT CCTACTACCAGGCAAACAATAC GCTATTTCACATCCACTTGGCA CTCACACTACCAACCCACTCAA TTAGCTTTGTATAGGACCGC CCACCCTTATCCCAAACAAGCC GCCAAGTGGAGATGCAGAAAATGC
Note. Primer sequences are derived from the reported intron sequences adjacent to each exon (3).
Thus, the mother is variant heterozygous, while the father and the sisters are normal. The genomic mutation found in this family is at nt 755 of cDNA counting from adenine of the initiation codon, and a single amino acid substitution Glu r Ala should be produced at protein position 251 counting from the NH2-terminal acetyl-serine. The amino acid substitution is not expected to cause severe instability or catalytic defect in the mutant protein. However, in the variant pre-mRNA, the consensus splice sequence AGgt at 3* end of exon 7 must be converted into a nonconsensus sequence CGgt. Abnormalities of the variant mRNA. Northern blot hybridization analysis of total cellular RNA using the full-length normal PGK cDNA and the reference b-actin cDNA as hybridization probes indicated that the content of PGK mRNA was severely diminished (about 10% of normal by visual comparison) in the propositus’
FIG. 1. Autoradiogram of the nucleotides produced by the single nucleotide extension. Using exon 7 produced by PCR from genomic DNA samples as template, the primer (nt 733 to 754) was extended by a single step in the presence of [32P]dATP or [32P]dCTP. Incorporation of P32-labeled nucleotide (ATP or CTP or both) was determined by autoradiography. Origins of DNA samples are: 1, propositus; 2, brother; 3, father; 4–6, sisters; 7, mother.
6B10
/ 6b13$$9322
01-24-96 08:16:36
arcas
cells. The size (approximately 2 kb) of the variant PGK mRNA was comparable to that of normal PGK mRNA (Fig. 2). Amplification of the total cellular RNA by RT-PCR using six sets of sense and antisense oligonucleotide primers produced six overlapping cDNA fragments which covered the entire coding sequences. Sizes of the fragments produced from the normal and variant RNAs matched the expected sizes. However, the variant PCR product produced by using 5* primer nt 648 to 671 and 3* primer nt 978 to 1001 contained two fragments (Fig. 3). The size of the major fragment (about 350 bp) was identical to that of the normal product, while the size
FIG. 2. Analysis of PGK mRNA expressed in variant and normal cells. Total cellular RNAs from the variant and normal cells were electrophoresed in denatured agarose gel and transferred onto the nitrocellulose filter. The filter was hybridized with a 32P-labeled cDNA probe (top) and after deprobing it was hybridized with a 32Plabeled b-actin cDNA probe (bottom). The size of the marker is indicated on the left in kilobases (kb). Lane 1, 5 mg RNA from variant cells; lane 2, 10 mg RNA from variant cells; Lane 3, 2.5 mg RNA from normal cells; lane 4, 5 mg RNA from normal cells.
AP: Archives
38
OOKAWARA ET AL.
ing Ala in various organisms (14). Therefore, it is unlikely that the Glu r Ala substitution could induce molecular instability and/or catalytic defect in the variant PGK protein. The mutation position is adjacent to the 3* end of exon 7, and consequently the consensus 5* splicing sequence AGgt is changed to a nonconsensus sequence CGgt (Fig. 5). Usage of the nonconsensus junction CGgt sequence is observed in various mammalia genes. To our knowledge, however, the relative splicing efficiency of the FIG. 3. RT-PCR products produced from normal and variant PGK mRNAs. The total cellular RNAs were reverse transcribed and amplified by PCR in six overlapped segments using six sets of sense and antisense primers. The products were analyzed by electrophoresis in agarose gel. (A) Products from normal PGK; (B) Products from variant PGK. Primers used for amplification were: lanes 1, nt 051/27 and 262/287; lanes 2, 224/248 and 532/557; lanes 3, 450/474 and 752/776; lanes 4, 648/671 and 978/1001; lanes 5, 955/976 and 1188/ 1208; and lanes 6, 1116/1141 and 1350/1376. (nt counted from the adenine residue of the initiation codon of the cDNA.) Note that the variant mRNA produced two fragments by using primers 648/671 and 987/1001 while normal mRNA produced a single fragment (lane 4).
of the minor fragment was about 400 bp. Nucleotide sequence analysis of the major and minor fragment generated from the normal and variant mRNAs revealed the existence of single nucleotide transversion A/T r C/G in the major variant fragment (Fig. 4), whereas the minor variant fragment contained 5* region (52 bases) of intron 7 between exon 7 and exon 8 (Figs. 4 and 5). DISCUSSION
We report here a novel PGK variant in a patient associated with occasional muscle contractures and myoglobinuria after vigorous exercise. Although the patient is associated with severe tissue PGK deficiency, no neurological abnormalities and no remarkable hematological problems were observed. The variant gene had been transmitted from the heterozygous mother to the propositus and his brother. The nucleotide sequence analysis of genomic DNA and mRNA indicated the existence of A/T r C/G transversion at nt 755 position of the variant. The mutation should cause an amino acid substitution Glu r Ala at position 251 of the enzyme. Based on the available information of the X-ray crystallographic analysis of yeast (12) and horse PGK (13), the substitution position is located between a helix-9 and a helix-10, and the region is not involved in substrate and ATP binding of PGK (13). The region is not evolutionary conserved from bacteria to humans, and the Glu at 251 is replaced by other amino acids includ-
6B10
/ 6b13$$9322
01-24-96 08:16:36
arcas
FIG. 4. Splice junction exon 7/intron 7/exon 8 sequences of the normal and variant PGK cDNAs. The targeted region of mRNAs were amplified by RT-PCR using a pair of primers nt 648/671 and nt 880/899. A major product (about 250 bp) from the variant and normal RNAs and a minor product (about 300 bp) from the variant RNA were purified and sequenced in both directions. The substitution sites are indicated by asterisks. The legitimate splice junctions between exon 7/exon 8 are indicated by double arrows, and aberrant junctions exon 7/intron 7 and intron 7/exon 8, existing in the minor variant product, are indicated by single arrows. Complete nucleotide sequences of the normal and variant PCR products are shown in Fig. 5.
AP: Archives
RETARDED AND ABERRANT SPLICINGS CAUSED BY AN EXON MUTATION
39
FIG. 5. Nucleotide sequence of normal and variant PGK cDNAs. PCR products were produced and analyzed as described in the text and the legend of Fig. 4. Exon sequences are numbered (shown in parenthesis) starting from adenine at the translation initiation. Deduced amino acid residues are numbered starting from the NH2-terminal acetyl-Ser. Primers used for RT-PCR are indicated by horizontal arrows. The mutation site is boxed, and the junction exon 7/exon 8 is indicated by a double headed arrow. Intron 7 sequence (and deduced amino acid sequence), which is inserted between exon 7 and exon 8 in the minor PCR product of the variant RNA, is shown in shadowed box. The aberrant junctions, exon 7/intron 7 and intron 7/exon 8, are indicated by single-headed arrow. In-frame chain termination signal existing in the intron sequence is indicated by an asterisk.
nonconsensus versus consensus junction in vivo has not been evaluated. Judging from the amount of mRNA estimated from the Northern blot hybridization patterns (Fig. 2), the splicing efficiency of the nonconsensus C G g t sequence is only about 10% of the original consensus A G g t sequence in the PGK pre-mRNA. In addition to this legitimate but retarded splicing, an alternative splicing occurred in the variant pre-mRNA. The aberrant mRNA contained 5* region of intron 7 between exon 7 and exon 8 (Fig. 5). The consensus splice site, ag, existing in intron 7 must have been spliced and conjugated to 5* end of exon 8 in the aberrant mRNA. An inframe chain termination codon exists in the minor aberrant mRNA produced by the alternative splicing (Fig. 5). Therefore, the variant protein produced by the aberrant mRNA lacks COOH-terminal 165 amino acid residues encoded by exons from 8 to 11 and is expected to be catalytically inactive. Exon mutation resulting in aberrant or alternative splicing was seldom observed (15–17). It was suggested
6B10
/ 6b13$$9322
01-24-96 08:16:36
arcas
that the exon mutation might alter the secondary structure of pre-mRNA and consequently, the mode of splicing could be altered. The present observation may provide us additional information on the problem. For most genetic enzyme deficiencies associated with amino acid substitutions, not only PGK but also other enzymes, the primary cause of deficiency is diminished catalytic activity or instability of variant enzymes, not reduction in mRNA. The present PGK variant is unique in this aspect. The variant is designated as PGK-Antwerp, based on the regional origin. REFERENCES 1. Huang, I-Y., Welch, C. D., and Yoshida, A. (1980) J. Biol. Chem. 255, 6412–6420. 2. Michelson, A. M., Markham, A. F., and Orkin, S. H. (1983) Proc. Natl. Acad. Sci. USA 80, 476–477. 3. Michelson, A. M., Blake, C. C., Evans, S. T., and Orkin, S. H. (1985) Proc. Natl. Acad. Sci. USA 82, 6965–6992. 4. Willard, H. F., Gross, S. J., Holmes, M. T., and Munrose, D. L. (1985) Hum. Genet. 71, 138–143.
AP: Archives
40
OOKAWARA ET AL.
5. Cohen-Solal, M., Valentin, C., Plassa, F., Guillemin, C. T., Dange, F., Jaisson, F., and Rosa, R. (1994) Blood Suppl. 84, 898– 903. 6. Tsujino, S., Tonin, P., Shanke, S., Nohria, V., Bustang, R-M., Lewis, D., Chen, Y-T., and DiMauro, S. (1994) Ann. Neurol. 35, 349–353.
11. 12.
7. Yoshida, A., Twele, T. W., Dave´, V., and Beutler, E. (1995) Blood Cells Mol. Dis. 21, 179–181.
13.
8. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Cold Spring Harbor, NY.
14.
9. Kuppuswamy, M. N., Hoffman, J. W., Kasper, C. K., Spritzer, S. Q., Groce, S. L., and Bajaj, S. P. (1991) Proc. Natl. Acad. Sci. USA 88, 1143–1147. 10. Singer-Sam, J., Keith, P. H., Tani, K., Simmer, R. L., Shively, L., Lindsay, S., Yoshida, A., and Riggs, A. (1984) Sequence of
6B10
/ 6b13$$9322
01-24-96 08:16:36
arcas
15. 16. 17.
the promoter region of the gene for human X-linked phosphoglycerate kinase. Gene 32, 409–417. Maeda, M., and Yoshida, A. (1991) Blood 77, 1348–1352. Watson, H. C., Walker, N. P. C., Shaw, P. J., Bryant, T. N., Wendell, P. L., Fothergill, L. A., Perkins, R. E., Conroy, S. C., Dobson, J. J., Tuite, M. F., Kingsman, A. J., and Kingsman, S. M. (1982) EMBO J. 1, 1635–1640. Banks, R. D., Blake, C. C. F., Evans, P. R., Haser, R., Rice, D. W., Hardy, G. W., Marrett, M., and Philipps, A. W. (1979) Nature 279, 773–777. Vohra, G. B., Godling, G. B., Tsao, N., and Pearlman, R. E. (1992) J. Mol. Evol. 34, 383–395. Ligtenberg, J. J. L., Gennissen, A. M. C., Vos, H. L., and Hilkens, J. (1991) Nucleic Acids Res. 19, 297–301. Wakamatsu, N., Kobayashi, H., Miyatake, T., and Tsuji, S. (1992) J. Biol. Chem. 267, 2406–2413. Hasegawa, Y., Kawame, H., Ida, H., Ohashi, T., and Eto, Y. (1994) Hum. Genet. 93, 415–420.
AP: Archives
Vol. 327, No. 1, March 1, pp. 35–40, 1996 Article No. 0089
Retarded and Aberrant Splicings Caused by Single Exon Mutation in a Phosphoglycerate Kinase Variant1 Tomomi Ookawara,* Vibha Dave´,* Patrick Willems,† Jean-Jacques Martin,‡ Thierry de Barsy,§ Erve´ Matthys,Ø and Akira Yoshida*,2 *Department of Biochemical Genetics, Beckman Research Institute of the City of Hope, Duarte, California, 91010; Departments of †Medical Genetics and ‡Neurology and Laboratory of Neuropathology of the Born-Bunge Foundation, University of Antwerp, Antwerp, Belgium; §International Institute of Cellular and Molecular Pathology, Universite´ Catholique de Louvain, Brussels, Belgium; and ØDepartment of Nephrology, St. Jan Hospital, Brugge, Belgium
Received September 22, 1995, and in revised form December 15, 1995
The molecular abnormality of a phosphoglycerate kinase variant which was associated with severe tissue enzyme deficiency and episodes of muscle contractions and myoglobinuria was examined. Analysis of the patient’s DNA showed the existence of a nucleotide transversion A/T r C/G in exon 7. No other nucleotide change was detected in the coding region of the variant gene. The mutation should produce a single amino acid substitution Glu r Ala at protein position 251 counting from the NH2-terminal acetyl serine residue. The protein abnormality caused by the amino acid substitution cannot explain the enzyme deficiency. Northern blot hybridization indicated that the PGK mRNA content of the patient’s lymphoblastoid cells was only about 10% of that of normal. Nucleotide sequence analysis revealed the existence of two PGK mRNA components in the patient’s cells. The major component corresponds to the normal PGK mRNA except for A r C change at nucleotide position 755 counting from adenine of the chain initiation codon. The minor component contains 5* region (52 bases) of intron 7 between exon 7 and exon 8. An inframe chain termination codon exists in the minor mRNA component, and the COOHterminal half is expected to be deleted in the translation product. These results indicate that the low PGK activity in the patient’s tissues is mainly due to retarded and aberrant pre-mRNA splicings caused by the change of the consensus 5* splice sequence AGgt to a nonconsensus sequence CGgt at the junction between exon 7 and intron 7 of the variant gene. q 1996 Academic Press, Inc.
Key Words: phosphoglycerate kinase variant; enzyme deficiency; mRNA splicing; exon mutation.
Phosphoglycerate kinase (ATP: 3-phosphoglycerate 1-phosphotransferase, EC 2.7.2.3: PGK)3 is a key enzyme involved in ATP generation in the glycolytic pathway. The matured human PGK, which is encoded by an X-chromosome-linked gene, consists of 416 amino acid residues with acetyl-serine at the NH2-terminal and isoleucine at the COOH-terminal, and the monomeric enzyme (MW about 48,000 dalton) is catalytically active (1). The complete amino acid sequence (1), cDNA sequence (2), genomic organization (3), and regional location on the X-chromosome (4) have been elucidated. Genetic deficiency of PGK activity is associated with various degrees of hemolytic anemia, neurologic abnormalities, and rhabdomyolysis. The specific nucleotide base changes of nine deficient variants have been reported (Ref. 5). Single missense nucleotide base changes causing single amino acid substitutions were found in all these variants, except for PGK-North Carolina which is associated with a 10 amino acid insertion resulting from a splice-junction mutation (6) and PGKAlabama which is associated with a deletion of codon AAG for Lys in exon 7 (7). The enzyme deficiency of these variant PGKs can be readily explained by structural instability or diminished catalytic activity of the variant proteins. This paper reports the molecular abnormality of a
1
This work was supported by the U.S. Public Health Service Grant HL-29515. 2 To whom correspondence should be addressed. Fax: (818) 3571929.
3 Abbreviation used: bp, nucleotide base pair(s); mRNA, messenger RNA; nt, nucleotide number; PCR, polymerase chain reaction; PGK, phosphoglycerate kinase; RT, reverse transcription.
35
0003-9861/96 $18.00 Copyright q 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.
6B10
/ 6b13$$9322
01-24-96 08:16:36
arcas
AP: Archives
36
OOKAWARA ET AL.
novel PGK variant found in a patient with occasional muscular contractures and myoglobinuria episodes. The enzyme deficiency of the present variant was found to be mainly due to retarded splicing caused by single exon mutation, rather than the protein defect resulting from the amino acid substitution. EXPERIMENTAL PROCEDURES Propositus. The propositus was born on January 7, 1968 from unrelated Belgian parents. His personal history was unremarkable until the age of 16 when he experienced muscular cramps and contractures with dark red urine after a short but vigorous physical exercise (a sprint of 100 meters). A second episode of rhabdomylosis with muscle cramps, dark urine, and inability to continue physical activity was noticed at the age of 25 when he was exposed to an intense training. A number of days after the onset of the symptoms, the laboratory examination showed an elevation of serum creatine kinase (58,200 u/liter, normal 10 Ç 80 u/liter), creatine kinase-MB (990 u/liter), ureum, and creatinine. At Day 13, the creatine kinase level had decreased to 103 u/liter. Apart from these two acute episodes, the patient had always experienced muscle cramps during or after intense physical activity. Intermittent creatinine kinase levels were always elevated between 82 and 710 u/liter. The patient did not have any further complaints. Physical examination could not reveal any abnormality. Histological examination of the various lateral muscles revealed a few dispersed atrophic fibers with faint sarcoplasmatic basophilia and enlarged nuclei. There were no ragged-red fibers, and the amount of neutral fats was normal in type 1 fibers. Electron microscopy showed a normal sarcomeric organization within the muscle fibers and a subsarcolemmal area filled with free b-glycogen particles. There was also an increase of the intermyofibrillar b-glycogen particles but no limiting membrane was found. Muscle glycogen, phosphorylase, phosphoglycerate mutase, carnitine, and carnitine palmitoyl transferase levels were normal. PGK activity was severely diminished in the patient’s muscle (about 8% of control mean). The patient had 4.7 1 106 red blood cell/ml blood, slightly decreased hemoglobin (13.2 g/100 ml) and hematocrit (39.5%), normal levels of platelets, and mean cell hemoglobin concentration (MCHC). Intermittently, however, the patient’s hematological values were completely normal, and no anemia was present. Red cell phosphoglycerate mutase, phosphofructokinase, pyruvate kinase, and aldolase activities were normal, but PGK activity was diminished (5.6% of the control mean). DNA and RNA samples. Peripheral blood samples were obtained from the patient and his relatives (parents, a brother, and three sisters) with informed consent. Genomic DNAs were prepared from blood by the established method (8). Lymphocytes were prepared from the patient’s and control blood and the cell lines were established by transforming the cells with Epstein–Barr virus. The culture was grown in RPMI 1640 medium (Gibco) with 20% (V/V) fetal calf serum (Gibco) and antibiotics (100 units of penicillin and 100 mg of streptomycin per ml) at 377C in 5% CO2/95% air. The total cellular RNA was prepared from the cultured cells by the standard method (8). Analysis of genomic DNA. The entire eleven coding exons of the normal and patient’s PGK genes were amplified by the polymerase chain reaction (PCR) using eleven sets of sense and antisense oligonucleotide primers (Table I). These primers correspond to the intron sequences adjacent to each exon (3). The PCR products were separated by agarose gel (2%) electrophoresis, and the fragments were purified by the Prep-A-Gene DNA purification kit (Bio-Rad, Hercules, CA). The purified PCR products were subjected to direct PCR cycle sequencing using an Applied Bio-
6B10
/ 6b13$$9322
01-24-96 08:16:36
arcas
systems Model 373 A (Foster City, CA). The sequences were determined in both directions. In order to determine genotypes of the patient’s relatives, DNA samples (approximately 1 mg each) from the family members were amplified by PCR using a pair of primers 7 and 7* (Table I). The product is expected to contain the mutation site at nt 755 counting from the adenine residue of the initiation codon of the cDNA. The PCR products were purified by agarose gel (low melting, 2%) electrophoresis. Single nucleotide extension analysis was carried out using the PCR products (approximately 30 ng each) as templates and 5* TTAAGGTGCTCAACAACATGG 3* (nt 734 to 754) as a primer in the presence of [32P]dATP (incorporated into the normal product) or [32P]dCTP (incorporated into the variant product). 32P-labeled oligonucleotides produced were separated from the unincorporated mononucleotides by acrylamide gel electrophoresis, and the products were detected by autoradiography. Details of the method have been described (9). Northern blot hybridization. Total cellular RNAs (2.5 Ç 10 mg per channel), prepared from the normal and variant lymphoblasts, were electrophoresed on a 1% agarose gel containing 2.2 M formamide, transferred onto a nitrocellulose filter, and hybridized with the fulllength human PGK cDNA probe (10) and the mouse b-actin cDNA probe (Stratagene, CA) which served as an internal reference. Hybridization was carried out in 50% formamide, 31 SSC (11 SSC is 0.15 M NaCl, 15 mM sodium citrate, pH 7.4) 51 Denhardt’s solution, 5% dextran sulfate, and 100 mg/ml salmon sperm DNA at 427C. Determination of mRNA Sequence. The entire coding sequences of the normal and variant PGKs were produced in six overlapped segments by reverse transcription (RT) and PCR using total cellular RNAs (approximately one mg each) as templates and six sets of sense and antisense primers. The details of the procedure and the sequences of primers were previously described (11). The PCR products were electrophoresed on a 2% agarose gel, and the sizes of the normal and variant products were compared. One of the six PCR products, which was produced from the variant RNA using 5* primer nt 648 to 671 and 3* primer nt 978 to 1001, contained two fragments, while the normal RNA generated only one fragment. These normal and variant components were purified by the Gelase (Epicentre Technologies, Madison, WI) DNA purification kit and further amplified by a second round of PCR using a pair of internal 5* primer nt 648 to 671 and 3* primer nt 880 to 899. The nucleotide sequences of the normal and the variant products were determined in both directions by the direct PCR cycle sequencing as described above.
RESULTS
Nucleotide base change in the propositus PGK gene and genotypes of family members. Nucleotide sequence analysis of eleven PCR products generated from the propositus DNA revealed a nucleotide base transversion A/T r C/G in exon 7. No other nucleotide change was found in the coding regions of the variant PGK gene. Single nucleotide extension of the PCR products of exon 7 generated from DNA samples of the propositus and his relatives revealed that [32P]CTP instead of [32P]ATP was incorporated into the PCR products of the propositus and his brother, i.e., they are variant hemizygous (Fig. 1). Both [32P]CTP and [32P]ATP were incorporated into the PCR product of the propositus’ mother, while only [32P]ATP was incorporated into the products of the propositus’ father and three sisters.
AP: Archives
RETARDED AND ABERRANT SPLICINGS CAUSED BY AN EXON MUTATION
37
TABLE I
Primers Used for Amplification of Exons Exons
5*-Primer
3*-Primer
1 2 3 4 5 6 7 8 9 10 11
ATCACCGACCTCTCTCCCCAGC GTCTTTGATGGAACAGTAAGTTG GAGGTTACAATAAGCTAGTCCC GTCAAGCACGTTGTTACTGGT CCACCTACTCAGGGTCTTTAG GGAGGAATGATAGGGAATTGAC CCACTTCTCTAGTCCATTCTTC GTCTGGTTCCTGTCTGCTTTGT AGCTCATCTTCTCTTTCACC CACACTGCCTTACAGTTTTGGTGC GCTGTCTATGTATGTGTGCTCTC
CGACAGAGCACAGAGAGCACGC ACCCAGCCCAAGGATTAGCAG GCCACAAAGTCTACCAGCACCAG GCTTTCTCTATTCTTCAACCAC CTGTTCTCAGTGTGGTAGTCT CCTACTACCAGGCAAACAATAC GCTATTTCACATCCACTTGGCA CTCACACTACCAACCCACTCAA TTAGCTTTGTATAGGACCGC CCACCCTTATCCCAAACAAGCC GCCAAGTGGAGATGCAGAAAATGC
Note. Primer sequences are derived from the reported intron sequences adjacent to each exon (3).
Thus, the mother is variant heterozygous, while the father and the sisters are normal. The genomic mutation found in this family is at nt 755 of cDNA counting from adenine of the initiation codon, and a single amino acid substitution Glu r Ala should be produced at protein position 251 counting from the NH2-terminal acetyl-serine. The amino acid substitution is not expected to cause severe instability or catalytic defect in the mutant protein. However, in the variant pre-mRNA, the consensus splice sequence AGgt at 3* end of exon 7 must be converted into a nonconsensus sequence CGgt. Abnormalities of the variant mRNA. Northern blot hybridization analysis of total cellular RNA using the full-length normal PGK cDNA and the reference b-actin cDNA as hybridization probes indicated that the content of PGK mRNA was severely diminished (about 10% of normal by visual comparison) in the propositus’
FIG. 1. Autoradiogram of the nucleotides produced by the single nucleotide extension. Using exon 7 produced by PCR from genomic DNA samples as template, the primer (nt 733 to 754) was extended by a single step in the presence of [32P]dATP or [32P]dCTP. Incorporation of P32-labeled nucleotide (ATP or CTP or both) was determined by autoradiography. Origins of DNA samples are: 1, propositus; 2, brother; 3, father; 4–6, sisters; 7, mother.
6B10
/ 6b13$$9322
01-24-96 08:16:36
arcas
cells. The size (approximately 2 kb) of the variant PGK mRNA was comparable to that of normal PGK mRNA (Fig. 2). Amplification of the total cellular RNA by RT-PCR using six sets of sense and antisense oligonucleotide primers produced six overlapping cDNA fragments which covered the entire coding sequences. Sizes of the fragments produced from the normal and variant RNAs matched the expected sizes. However, the variant PCR product produced by using 5* primer nt 648 to 671 and 3* primer nt 978 to 1001 contained two fragments (Fig. 3). The size of the major fragment (about 350 bp) was identical to that of the normal product, while the size
FIG. 2. Analysis of PGK mRNA expressed in variant and normal cells. Total cellular RNAs from the variant and normal cells were electrophoresed in denatured agarose gel and transferred onto the nitrocellulose filter. The filter was hybridized with a 32P-labeled cDNA probe (top) and after deprobing it was hybridized with a 32Plabeled b-actin cDNA probe (bottom). The size of the marker is indicated on the left in kilobases (kb). Lane 1, 5 mg RNA from variant cells; lane 2, 10 mg RNA from variant cells; Lane 3, 2.5 mg RNA from normal cells; lane 4, 5 mg RNA from normal cells.
AP: Archives
38
OOKAWARA ET AL.
ing Ala in various organisms (14). Therefore, it is unlikely that the Glu r Ala substitution could induce molecular instability and/or catalytic defect in the variant PGK protein. The mutation position is adjacent to the 3* end of exon 7, and consequently the consensus 5* splicing sequence AGgt is changed to a nonconsensus sequence CGgt (Fig. 5). Usage of the nonconsensus junction CGgt sequence is observed in various mammalia genes. To our knowledge, however, the relative splicing efficiency of the FIG. 3. RT-PCR products produced from normal and variant PGK mRNAs. The total cellular RNAs were reverse transcribed and amplified by PCR in six overlapped segments using six sets of sense and antisense primers. The products were analyzed by electrophoresis in agarose gel. (A) Products from normal PGK; (B) Products from variant PGK. Primers used for amplification were: lanes 1, nt 051/27 and 262/287; lanes 2, 224/248 and 532/557; lanes 3, 450/474 and 752/776; lanes 4, 648/671 and 978/1001; lanes 5, 955/976 and 1188/ 1208; and lanes 6, 1116/1141 and 1350/1376. (nt counted from the adenine residue of the initiation codon of the cDNA.) Note that the variant mRNA produced two fragments by using primers 648/671 and 987/1001 while normal mRNA produced a single fragment (lane 4).
of the minor fragment was about 400 bp. Nucleotide sequence analysis of the major and minor fragment generated from the normal and variant mRNAs revealed the existence of single nucleotide transversion A/T r C/G in the major variant fragment (Fig. 4), whereas the minor variant fragment contained 5* region (52 bases) of intron 7 between exon 7 and exon 8 (Figs. 4 and 5). DISCUSSION
We report here a novel PGK variant in a patient associated with occasional muscle contractures and myoglobinuria after vigorous exercise. Although the patient is associated with severe tissue PGK deficiency, no neurological abnormalities and no remarkable hematological problems were observed. The variant gene had been transmitted from the heterozygous mother to the propositus and his brother. The nucleotide sequence analysis of genomic DNA and mRNA indicated the existence of A/T r C/G transversion at nt 755 position of the variant. The mutation should cause an amino acid substitution Glu r Ala at position 251 of the enzyme. Based on the available information of the X-ray crystallographic analysis of yeast (12) and horse PGK (13), the substitution position is located between a helix-9 and a helix-10, and the region is not involved in substrate and ATP binding of PGK (13). The region is not evolutionary conserved from bacteria to humans, and the Glu at 251 is replaced by other amino acids includ-
6B10
/ 6b13$$9322
01-24-96 08:16:36
arcas
FIG. 4. Splice junction exon 7/intron 7/exon 8 sequences of the normal and variant PGK cDNAs. The targeted region of mRNAs were amplified by RT-PCR using a pair of primers nt 648/671 and nt 880/899. A major product (about 250 bp) from the variant and normal RNAs and a minor product (about 300 bp) from the variant RNA were purified and sequenced in both directions. The substitution sites are indicated by asterisks. The legitimate splice junctions between exon 7/exon 8 are indicated by double arrows, and aberrant junctions exon 7/intron 7 and intron 7/exon 8, existing in the minor variant product, are indicated by single arrows. Complete nucleotide sequences of the normal and variant PCR products are shown in Fig. 5.
AP: Archives
RETARDED AND ABERRANT SPLICINGS CAUSED BY AN EXON MUTATION
39
FIG. 5. Nucleotide sequence of normal and variant PGK cDNAs. PCR products were produced and analyzed as described in the text and the legend of Fig. 4. Exon sequences are numbered (shown in parenthesis) starting from adenine at the translation initiation. Deduced amino acid residues are numbered starting from the NH2-terminal acetyl-Ser. Primers used for RT-PCR are indicated by horizontal arrows. The mutation site is boxed, and the junction exon 7/exon 8 is indicated by a double headed arrow. Intron 7 sequence (and deduced amino acid sequence), which is inserted between exon 7 and exon 8 in the minor PCR product of the variant RNA, is shown in shadowed box. The aberrant junctions, exon 7/intron 7 and intron 7/exon 8, are indicated by single-headed arrow. In-frame chain termination signal existing in the intron sequence is indicated by an asterisk.
nonconsensus versus consensus junction in vivo has not been evaluated. Judging from the amount of mRNA estimated from the Northern blot hybridization patterns (Fig. 2), the splicing efficiency of the nonconsensus C G g t sequence is only about 10% of the original consensus A G g t sequence in the PGK pre-mRNA. In addition to this legitimate but retarded splicing, an alternative splicing occurred in the variant pre-mRNA. The aberrant mRNA contained 5* region of intron 7 between exon 7 and exon 8 (Fig. 5). The consensus splice site, ag, existing in intron 7 must have been spliced and conjugated to 5* end of exon 8 in the aberrant mRNA. An inframe chain termination codon exists in the minor aberrant mRNA produced by the alternative splicing (Fig. 5). Therefore, the variant protein produced by the aberrant mRNA lacks COOH-terminal 165 amino acid residues encoded by exons from 8 to 11 and is expected to be catalytically inactive. Exon mutation resulting in aberrant or alternative splicing was seldom observed (15–17). It was suggested
6B10
/ 6b13$$9322
01-24-96 08:16:36
arcas
that the exon mutation might alter the secondary structure of pre-mRNA and consequently, the mode of splicing could be altered. The present observation may provide us additional information on the problem. For most genetic enzyme deficiencies associated with amino acid substitutions, not only PGK but also other enzymes, the primary cause of deficiency is diminished catalytic activity or instability of variant enzymes, not reduction in mRNA. The present PGK variant is unique in this aspect. The variant is designated as PGK-Antwerp, based on the regional origin. REFERENCES 1. Huang, I-Y., Welch, C. D., and Yoshida, A. (1980) J. Biol. Chem. 255, 6412–6420. 2. Michelson, A. M., Markham, A. F., and Orkin, S. H. (1983) Proc. Natl. Acad. Sci. USA 80, 476–477. 3. Michelson, A. M., Blake, C. C., Evans, S. T., and Orkin, S. H. (1985) Proc. Natl. Acad. Sci. USA 82, 6965–6992. 4. Willard, H. F., Gross, S. J., Holmes, M. T., and Munrose, D. L. (1985) Hum. Genet. 71, 138–143.
AP: Archives
40
OOKAWARA ET AL.
5. Cohen-Solal, M., Valentin, C., Plassa, F., Guillemin, C. T., Dange, F., Jaisson, F., and Rosa, R. (1994) Blood Suppl. 84, 898– 903. 6. Tsujino, S., Tonin, P., Shanke, S., Nohria, V., Bustang, R-M., Lewis, D., Chen, Y-T., and DiMauro, S. (1994) Ann. Neurol. 35, 349–353.
11. 12.
7. Yoshida, A., Twele, T. W., Dave´, V., and Beutler, E. (1995) Blood Cells Mol. Dis. 21, 179–181.
13.
8. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Cold Spring Harbor, NY.
14.
9. Kuppuswamy, M. N., Hoffman, J. W., Kasper, C. K., Spritzer, S. Q., Groce, S. L., and Bajaj, S. P. (1991) Proc. Natl. Acad. Sci. USA 88, 1143–1147. 10. Singer-Sam, J., Keith, P. H., Tani, K., Simmer, R. L., Shively, L., Lindsay, S., Yoshida, A., and Riggs, A. (1984) Sequence of
6B10
/ 6b13$$9322
01-24-96 08:16:36
arcas
15. 16. 17.
the promoter region of the gene for human X-linked phosphoglycerate kinase. Gene 32, 409–417. Maeda, M., and Yoshida, A. (1991) Blood 77, 1348–1352. Watson, H. C., Walker, N. P. C., Shaw, P. J., Bryant, T. N., Wendell, P. L., Fothergill, L. A., Perkins, R. E., Conroy, S. C., Dobson, J. J., Tuite, M. F., Kingsman, A. J., and Kingsman, S. M. (1982) EMBO J. 1, 1635–1640. Banks, R. D., Blake, C. C. F., Evans, P. R., Haser, R., Rice, D. W., Hardy, G. W., Marrett, M., and Philipps, A. W. (1979) Nature 279, 773–777. Vohra, G. B., Godling, G. B., Tsao, N., and Pearlman, R. E. (1992) J. Mol. Evol. 34, 383–395. Ligtenberg, J. J. L., Gennissen, A. M. C., Vos, H. L., and Hilkens, J. (1991) Nucleic Acids Res. 19, 297–301. Wakamatsu, N., Kobayashi, H., Miyatake, T., and Tsuji, S. (1992) J. Biol. Chem. 267, 2406–2413. Hasegawa, Y., Kawame, H., Ida, H., Ohashi, T., and Eto, Y. (1994) Hum. Genet. 93, 415–420.
AP: Archives