- Email: [email protected]
Retinoic acid receptor-α messenger RNA expression is increased and retinoic acid receptor-γ expression is decreased in Barrett's intestinal metaplasia, dysplasia, adenocarcinoma sequence
Retinoic acid receptor-α messenger RNA expression is increased and retinoic acid receptor-γ expression is decreased in Barrett’s intestinal metaplasia, dysplasia, adenocarcinoma sequence Reginald V. N. Lord, MD, Peter I. Tsai, MD, Kathleen D. Danenberg, MS, Jeffrey H. Peters, MD, Tom R. DeMeester, MD, Denice D. Tsao-Wei, PhD, Susan Groshen, PhD, Dennis Salonga, MS, Ji Min Park, MS, Peter F. Crookes, MD, Milton Kiyabu, MD, Para Chandrasoma, MD, and Peter V. Danenberg, PhD, Los Angeles, Calif
Background. Expression levels of the retinoic acid receptors (RAR-α, RAR-β, and RAR-γ) are significantly different in neoplastic tissues compared with non-neoplastic tissues for some tumors. This study investigated whether retinoic acid receptor messenger RNA (mRNA) expression levels are altered in Barrett’s esophagus and Barrett’s adenocarcinoma tissues. Methods. Relative mRNA expression levels of the RARs were quantified by using the ABI 7700 Sequence Detector (Taqman) system in Barrett’s intestinal metaplasia (n = 15), dysplasia (n = 6), adenocarcinoma (n = 17), and matching normal esophagus tissues (n = 36). Results. RAR-α expression was significantly increased, and RAR-γ expression was significantly decreased, at higher stages in the Barrett’s sequence. There was almost complete loss of RAR-γ expression (relative expression level ≤ 1) in a majority (70%) of the dysplasia and adenocarcinoma tissues. There were significant differences in RAR-α and RAR-γ expression in histopathologically normal tissues in patients with cancer versus patients without cancer. RAR-β expression levels were significantly elevated in adenocarcinoma versus normal esophagus tissues. The RAR expression profile was similar for cancers arising within the esophagus and for cancers arising at the gastroesophageal junction. Conclusions. RAR mRNA expression levels are significantly different in Barrett’s tissues compared with normal esophagus tissues, and these levels are significantly different in Barrett’s dysplasia and adenocarcinoma tissues compared with nondysplastic tissues. These results suggest that RAR mRNA levels may be useful biomarkers for this disease and that gastroesophageal junction adenocarcinomas are genetically similar to esophageal adenocarcinomas. These results also suggest that a cancer field is present in the esophagus in patients with cancer and that genetic alterations can precede histopathologic alterations in this disease. (Surgery 2001;129:267-76.) From the Departments of Surgery, Biochemistry and Molecular Biology, Preventive Medicine, and Pathology, University of Southern California Keck School of Medicine and USC/Norris Cancer Center, Los Angeles, Calif
BARRETT’S ESOPHAGUS (BE) is a condition in which the normal squamous lining of the distal esophagus is replaced with columnar epithelium in Presented in part at the 90th Annual Meeting of the American Association for Cancer Research, Philadelphia, April 1999. Supported by National Institutes of Health/National Cancer Institute grant RO1 CA 71716 to P. V. D and National Institutes of Health grant P30 CA 14089 to S. G. and D. D. T-W. Accepted for publication August 5, 2000. Reprint requests: P. V. Danenberg, 1303 N Mission Road, Los Angeles, CA 90033. Copyright © 2001 by Mosby, Inc. 0039-6060/2001/$35.00 + 0 11/56/110856 doi:10.1067/msy.2001.110856
response to chronic gastroesophageal reflux. BE is a multistage disease in which Barrett’s intestinal metaplasia (IM) progresses in some cases to lowgrade dysplasia (LGD), high-grade dysplasia (HGD), and eventually adenocarcinoma. Unfortunately, current tests are unable to accurately identify either the stage of disease or the likelihood of disease progression in individuals with BE. Studies investigating the molecular biology of the multistage Barrett’s sequence attempt to identify genetic markers that are reliably associated with each stage and with an increased likelihood of progression to more advanced stages. Identification of genetic markers would hopefully provide the basis SURGERY 267
268 Lord et al
for a combined molecular and histopathologic system for staging and treating patients according to their risk of developing advanced disease. Vitamin A (retinol) and its natural and synthetic analogues (retinoids) have effects on epithelial cell growth, differentiation, and apoptosis, and retinoids have been shown to have chemopreventive and chemotherapeutic activity for some malignant and premalignant diseases. Retinoid effects are mediated through 2 classes of ligand-dependent, DNA response element-binding nuclear receptors: the RARs (nuclear receptor group 1B)1 and retinoid X receptors (RXRs, nuclear receptor group 2B).1 Both receptor classes have α, β, and γ subclasses with numerous isoforms. The expression profiles of the RARs are significantly different in neoplastic compared with nonneoplastic tissues for some tumors,2-6 indicating that RAR expression levels may be useful biomarkers for the detection of malignancy in those cases. Furthermore, response to retinoid administration for several cancers and in experimental systems is closely associated with retinoid receptor expression patterns.7,8 Knowledge of these expression patterns in normal and tumor states for a particular tissue may thus be important for studies of response to retinoid treatment for that tissue. Most retinoid-related research for esophageal cancer has studied squamous cell carcinoma (SCC) rather than Barrett’s adenocarcinoma. This may reflect the similarity of esophageal SCC to other aerodigestive tract cancers such as oral cavity SCC and lung SCC, for which important roles for retinoids and their receptors have been shown. In esophageal SCC cells, expression and up-regulation of RAR-β is associated with retinoid sensitivity, and RAR-β expression is commonly lost in esophageal SCC surgical specimens.9 In experimental animal studies, it has been reported that retinoids protect against the development of esophageal papillomas, dysplastic areas, and carcinogen-induced cancers.10 A similar protective effect in human populations has not been confirmed.8,11-14 This study investigated whether RAR mRNA expression levels are significantly altered in BE and Barrett’s adenocarcinomas, and whether such alterations, if present, might serve as biomarkers of disease stage. A second aim of this study was to use the tissue and tumor specificity of retinoid receptor expression to investigate the genetic similarity of adenocarcinomas arising in the esophagus and at the esophagogastric junction.
Surgery March 2001 MATERIALS AND METHODS Tissue samples. Tissue samples from 75 endoscopic biopsy and 39 surgical resection specimens from patients with BE or adenocarcinoma of the esophagus or gastroesophageal junction were collected and immediately frozen in liquid nitrogen. Endoscopic biopsies were obtained according to a protocol that required biopsy at 2-cm intervals from each quadrant (anterior, posterior, and right and left lateral positions) of the visible length of Barrett’s mucosa and an additional biopsy from the normal appearing squamous mucosa of the esophagus. Normal esophagus biopsy specimens were taken from the proximal margin of the operative resection specimens or from an area at least 4 cm proximal to the macroscopically abnormal epithelium on endoscopy. Part of the specimen or an adjacent specimen was fixed in formalin and paraffin for histopathologic examination by 1 of 2 expert Barrett’s pathologists. Frozen section examination of the study tissue was performed if the diagnosis was uncertain. Only the highest grade lesion present in the esophagus and a matching normal squamous esophagus tissue were studied from each patient. Dysplasia specimens were thus not included from patients with cancer, and IM specimens were not included from patients with either cancer or dysplasia. The site of origin of the cancers was classified as esophageal if the epicenter of the tumor was above the anatomic gastroesophageal junction, and as esophagogastric junction-gastric cardia cancers if the epicenter was at or within 1 cm distal to the gastroesophageal junction. Specimens were classified as IM if IM but not dypslasia or cancer was present on histopathologic examination of all endoscopic biopsy specimens taken from the same level as the study specimen. Specimens were classified as dysplastic if either LGD or HGD was present. Dysplastic tissues were not divided into HGD and LGD groups because areas of LGD and HGD were commonly present in the same biopsy. By using these criteria, samples included were Barrett’s IM (n = 15), Barrett’s dysplasia (n = 6), esophageal adenocarcinoma (n = 10), esophagogastric junction-cardia adenocarcinoma (n = 7), and normal esophagus tissues (n = 37). Matching normal esophagus and pathologic tissues were collected for all but 3 patients (2 patients with adenocarcinoma for whom no normal esophagus tissue was available, and 1 patient with IM for whom a pathologic tissue specimen was not collected). Approval for this study was obtained from the Institutional Review Board of the University of
Surgery Volume 129, Number 3
Lord et al 269
Table I. PCR primers and probes RAR-α1 amplicon length: 147 bp RAR-α1-forward: 60F RAR-α1-reverse: 206R RAR-α1-hybridization probe 118 sense strand RAR-β2 amplicon length: 147 bp RAR-β2-forward: 419F RAR-β2-reverse: 565R RAR-β2-hybridization probe: 457 complimentary strand RAR-γ1 amplicon length: 138 bp RAR-γ1-forward: 579F RAR-γ1-reverse: 716R RAR-γ1-hybridization probe: 661 complimentary strand
Southern California School of Medicine and written informed consent was obtained from participating patients. RNA extraction and complementary DNA synthesis. A guanidinium thiocyanate method of mRNA isolation15 was used (QuickPrep Micro mRNA Purification Kit; Amersham Pharmacia Biotech Inc, Piscataway, NJ). Isolated mRNA was solved in 60 µL diethyl pyrocarbonate-treated water. For complementary DNA (cDNA) synthesis, 20 µL 5 × Moloney murine leukemia virus buffer (containing 250 mmol/L Tris-hydrogen chloride, pH 8.3; 375 mmol/L potassium chloride; 15 mmol/L magnesium chloride; Life Technologies, Gaithersburg, MD), 10 µL dithiothreitol (100 mmol/L; Life Technologies), 10 µL deoxyribonucleoside triphosphate (each 10 mmol/L; Amersham Pharmacia Biotech), 0.5 µL random hexamers (50 OD dissolved in 550 µL of 10 mmol/L Tris-hydrogen chloride pH 7.5, and 1 mmol/L EDTA; Amersham Pharmacia Biotech), 2.5 µL bovine serum albumin (3 mg/mL in 10 mmol/L Tris-hydrogen chloride pH 7.5; Amersham Pharmacia Biotech), 2.5 µL RNAse inhibitor (5 × 1000 units; Amersham Pharmacia Biotech), and 5 µL Moloney murine leukemia virus reverse transcriptase (200 U/µL; Life Technologies) were added to a total volume of 50.5 µL. Polymerase chain reaction quantification of mRNA expression. mRNA levels of RAR cDNA sequences of interest and an internal reference cDNA (β-actin) were quantified by using a fluorescence detection method (ABI PRISM 7700 Sequence Detection System, [Taqman] Perkin Elmer [PE] Applied Biosystems, Foster City, Calif) as described.16,17 In brief, this method uses a dual labeled fluorogenic oligonucleotide probe that anneals specifically within the forward and reverse primers.
GAGCCGGTCCTTTGGTCAA CTGCGAGCATCACAGGACAT 6FAM5′-AGCTGGCCTTCAGGGCACCAAAA-3′TAMRA CCGCAAATAAAAAGGCGTAAAG CACAAGCCGGCGTTTTCTT 6FAM5′-ACGCTGCTCCTGGCTCACGTTGA-3′TAMRA ACCGCGACAAAAACTGTATCATC CCTTCACCTCTTTCTTCTTCTTGTTC 6FAM5′-TCATTTCGCACAGCTTCCTTGGACATG-3′TAMRA
Laser stimulation within the capped wells containing the reaction mixture causes emission of a 3′ quencher dye (TAMRA) until the probe is cleaved by the 5′ to 3′ nuclease activity of the DNA polymerase during polymerase chain reaction extension, causing the release of a 5′ reporter dye (6FAM). Production of an amplicon thus causes emission of a fluorescent signal that is detected by the Taqman’s charge-coupled device detection camera, and the amount of signal produced at a threshold cycle within the purely exponential phase of the polymerase chain reaction reflects the starting copy number of the sequence of interest. Comparison of the starting copy number of the sequence of interest with the starting copy number of the reference gene provides a relative gene expression level. The polymerase chain reaction mixture consisted of 600 nmol/L of each primer (RAR-α1, RAR-β2, and RAR-γ1, Table I), 200 nmol/L probe (Table I), 5 units AmpliTaq Gold Polymerase, 200 µmol/L each deoxyadenosine triphosphate, deoxycytidine triphosphate, deoxyguanosine triphosphate, 400 µmol/L deoxyuridine triphosphate, 5.5 mmol/L magnesium chloride, 1 unit AmpErase uracil N-glycosylase, and 1 × Taqman Buffer A containing a reference dye, to a final volume of 25 µL (all reagents from Perkin Elmer [PE] Applied Biosystems, Foster City, Calif). Cycling conditions were 50°C for 2 minutes, 95°C for 10 minutes, followed by 40 cycles at 95°C for 15 seconds and 60°C for 1 minute. Significant contamination with genomic DNA was excluded by amplifying non-reverse-transcribed RNA. RAR-γ expression was measured on 2 separate occasions for the patients with adenocarcinoma. Statistical analysis. The RAR-α, -β, and -γ expression was measured in each specimen of normal and pathologic (IM, dypslasia, adenocarcinoma) tissue. For all measurements, the logarithm transforma-
270 Lord et al
Surgery March 2001
A
B
C Fig 1. Plots of relative mRNA expression measurements for (A) RAR-α, (B) RAR-β, and (C) RAR-γ. Actual measurements are shown. The boxes show the 25th and 75th percentiles of the data. The median values are shown as horizontal lines within the boxes. See tables for statistical analysis. There are 2 extreme values in panel A (A = 33.75, B = 38.87) and in panel B (A =141.99, B = 155.31). There are 4 extreme values in panel C (A = 60.49, B = 46.58, C = 39.81, D = 32.54).
tion was taken before analysis. An analysis of variance was performed to test for differences between RAR expression levels in tissues from patients with IM, dysplasia, and adenocarcinoma by using the transformed RAR values. The analysis was done for the normal and abnormal esophagus tissues sepa-
rately. The overall P values were based on the F test from the analysis of variance. If the overall F test P value was less than .05, the least significant difference method was used for multiple comparisons. Paired t tests were used to test for differences in RAR expression levels in matched normal and
Lord et al 271
Surgery Volume 129, Number 3
Table II. Comparison of RAR expression levels in matching histopathologically normal esophagus tissues and abnormal tissues Geometric mean RAR and patient diagnosis
Ratio of normal to abnormal tissues
95% CI* of difference
N
Normal tissues
Abnormal tissues
Adenocarcinoma Dysplasia IM
15 6 15
2.62 1.99 1.12
7.69 6.86 4.61
0.34 0.29 0.24
(0.24, 0.48) (0.08, 1.01) (0.14, 0.41)
.0001 .051 .0001
Adenocarcinoma Dysplasia IM
15 5‡ 15
3.80 8.02 6.33
9.92 7.68 8.97
0.38 1.04 0.71
(0.20, 0.72) (0.31, 3.51) (0.15, 3.27)
.006 .93 .63
Adenocarcinoma Dysplasia IM
15 6 15
4.99 11.18 13.30
0.86 0.32 2.63
5.84 34.68 5.05
(2.23, 15.26) (2.23, 538.77) (2.32, 10.97)
.002 .021 .0005
P value†
α
β
γ
*95% confidence interval. †P values based on paired t test. ‡One patient with an extremely high value (2669) for dysplasia tissue was excluded from the analysis.
abnormal tissues. Three patients with no matching tissues were excluded from the paired t test calculations. RESULTS There were significant differences in the RAR mRNA expression levels at different stages in the Barrett’s IM, dysplasia, adenocarcinoma sequence (Tables II and III and Fig 1). In patients with adenocarcinoma, the expression of all 3 RARs was significantly different in cancer tissues compared with matching normal esophagus tissues from the same patients, with RAR-α and RAR-β expressions significantly higher and RAR-γ expressions significantly lower in cancer compared with normal tissues. There was almost complete loss of RAR-γ expression (relative expression level ≤ 1) in a majority (70%) of the dysplasia and adenocarcinoma tissues. In addition to being significantly higher in cancer tissues, RAR-α expression was significantly higher in IM tissues compared with matching normal esophagus tissues (P = .0001), and RAR-α levels in dysplasia samples were higher than in matching normal tissues, with the difference almost achieving statistical significance (P = .051). In contrast to this up-regulation in RAR-α expression in pathologic tissues, the expression of RAR-γ was significantly down-regulated at all Barrett’s stages (IM, dysplasia, and adenocarcinoma) compared with matching normal esophagus tissues from the same patients (Table II). RAR-γ expression was also sig-
nificantly lower in adenocarcinoma and dysplasia tissues compared with IM tissues (P = .023 and .003, respectively; Table III). Both RAR-α and RAR-γ expression levels were significantly different in histologically normal squamous esophagus tissues from patients with cancer compared with histologically normal squamous esophagus tissues from patients without cancer (Table III). Although there was some difference in RAR-β expression, the pattern of RAR-α and -γ expression in the esophagus and gastroesophageal junction cancers was similar (Table IV). The RAR mRNA expression levels were “mapped” in one case by taking biopsy specimens at 1-cm intervals from the mucosa in the lower esophagus from an adenocarcinoma esophagectomy specimen. The RAR-γ expression levels in different areas in this patient are illustrated in Fig 2, showing that low or “cancerlike” RAR-γ expression is found in some histopathologically nonmalignant areas adjacent to the cancer. DISCUSSION This study demonstrates that there are significant alterations in RAR mRNA expression levels in BE and Barrett’s adenocarcinoma tissues. Analyzing the grouped results for each histopathologic stage, we found that RAR-α expression is significantly increased in both cancer and IM tissues compared with matching normal esophagus tissues, that RAR-β expression is significantly higher in can-
272 Lord et al
Surgery March 2001
Table III. Comparison of RAR expression levels in histopathologically abnormal and normal esophagus tissues
Abnormal tissue RAR and tissue diagnosis α Adenocarcinoma Dysplasia IM β Adenocarcinoma Dysplasia IM γ Adenocarcinoma Dysplasia IM Normal tissues RAR and patient diagnosis α Adenocarcinoma Nonadenocarcinoma β Adenocarcinoma Nonadenocarcinoma γ Adenocarcinoma Nonadenocarcinoma
N
Geometric mean
95% CI*
P value†
17 6 15
7.82 6.86 4.61
(5.21, 11.73) (3.46, 13.58) (2.99, 7.10)
17 5‡ 15
8.76 7.68 8.97
(3.68, 20.89) (1.55, 38.14) (3.56, 22.62)
17 6 15
0.83 0.32 2.63
(0.42, 1.63)§ (0.10, 1.01)§ (1.28, 5.41)§
15 22
2.62 1.25
(1.79, 3.83) (0.91, 1.71)
.004
15 22
3.80 6.76
(1.73, 8.38) (3.52, 12.98)
.26
15 22
4.99 12.51
(2.84, 8.79) (7.85, 19.95)
.016
.20
.99
.007 .023§ .003§
*95% confidence interval. †P values based on F test from analysis of variance. ‡One patient with an extremely high value (2669) for the dysplasia tissue was excluded from the analysis. §Statistically significant based on LSD method.
cer compared with the normal esophagus, and that RAR-γ expression, in contrast, is significantly lower in IM, Barrett’s dysplasia, and adenocarcinoma tissues compared with normal esophagus. RAR-γ mRNA expression is also significantly lower in adenocarcinoma and dysplasia tissues compared with IM tissues. These results suggest that up-regulation in RAR-α expression and down-regulation in RARγ expression may be associated with the development of BE and with the progression of BE to adenocarcinoma. A reduction in RAR-γ expression has also been found in human teratocarcinoma cells,18 advanced neuroblastoma tumor cells,19,20 and oral and epidermal SCC cells.21 The loss of RAR-γ expression at the dysplastic and adenocarcinoma stages in our study is likely to represent tumor-associated downregulation of a differentiation marker. In head and neck SqCC/Y1 SCC cells, transfection of RAR-γ sense expression vectors increased the expression of squamous differentiation markers,22 which is interesting in the current context because the development of BE resembles a squamous dedif-
ferentiation process in which the normal replacement of columnar epithelium with squamous epithelium that occurs in utero is reversed in adults with BE. It is also possible that RAR-γ has a role as a tumor suppressor gene in Barrett’s carcinogenesis. In human epidermoid lung cancers, both in vitro and in vivo results support the hypothesis that RARβ, which is significantly down-regulated in tumors compared with normal tissues, is functioning as a tumor suppressor gene in that cancer.23 Although during mouse development RAR-γ is specifically expressed in differentiating squamous keratinizing epithelia, including esophageal epithelium,24 the esophagus is normal in RAR-γ -/- mice.25 The associations between different Barrett’s stages and RAR expression levels indicate that expression levels of these genes might be useful biomarkers for following the progression of this disease. It seems plausible that BE patients with more abnormal expression profiles are at greater risk of progression to higher disease stages, but this needs to be demonstrated in studies of sequential
Surgery Volume 129, Number 3
Lord et al 273
Fig 2. The anatomy of a normal distal esophagus (E), esophagogastric junction (EGJ), proximal stomach (S), and the right and left leaves of the diaphragm (D) is shown on the left. “Mapping” of RAR-γ expression levels from a patient with esophageal adenocarcinoma is shown on the right. The quantity of relative RAR-γ mRNA is shown by the height of the colored shapes. The shapes are colored according to the histopathology at each biopsy site: yellow, normal gastric mucosa; green, cardiac mucosa; pink, BE with LGD; red, adenocarcinoma; blue, normal squamous esophageal mucosa. The variability in the carcinoma expression levels shows that even within the same patient, the range of gene expression measurements may be large. Although there is high RAR-γ expression in most of the normal esophagus areas, one normal esophagus specimen shows low expression and there is low expression in histopathologically nonmalignant areas near the tumor. This patient was classified as 1 of the 2 patients without significant loss of RAR-γ expression, and a high RARγ expression measurement was used for the statistical analysis.
biopsies in individual patients. There was considerable variability in the expression levels for different patients within each histopathologic group, however, indicating that the predictive power of expression measurement for these genes is limited. For example, there were adenocarcinoma tissues in this study that had not lost RAR-γ expression or had low RAR-α expression. Molecular diagnosis and staging using expression quantification will therefore probably need to use a panel of genes rather than single genes or small families of genes such as the retinoid receptors. There is no evidence at present to support the introduction of RAR expression measurement as an adjunct to routine clinical decision making for patients with BE. Both RAR-α and RAR-γ expression levels were significantly different in histologically normal squamous esophagus tissues from patients with cancer compared with histologically normal squamous
esophagus tissues from patients without cancer. These histopathologically normal esophagus biopsy specimens were from areas that were well separated from macroscopic disease, indicating that there is a widespread oncogenic field effect in the esophagus in cancer patients. The extent of this field change was mapped in 1 adenocarcinoma esophagectomy patient by taking multiple biopsies from the distal esophageal mucosa (Fig 2). Abnormal or “cancer-like” RAR mRNA expression levels were found in histopathologically nonmalignant biopsy specimens up to several centimeters away from the cancer. The presence of a field of abnormal epithelium at risk for cancer development is supported by histopathologic studies that demonstrated multiple separate foci of dysplasia or cancer within individual segments of BE.26,27 Evidence for a field effect has also been shown in other gene expression stud-
274 Lord et al
Surgery March 2001
Table IV. Comparison of RAR expression levels in adenocarcinoma tissues according to esophageal or esophagogastric junction site of origin RAR
N
Geometric mean
95% CI*
Esophagogastric junction Esophagus
7 10
9.21 6.97
(5.80, 14.62) (4.73, 10.26)
Esophagogastric junction Esophagus
7 10
14.04 6.30
(3.98, 49.56) (2.19, 18.09)
Esophagogastric junction Esophagus
7 10
0.76 0.88
(0.28, 2.05) (0.39, 2.02)
α β γ
P value†
.34
.32
.81
*95% confidence interval. †P values based on F test from analysis of variance.
ies,28-30 in DNA methylation analyses,31 and in a tumor suppressor gene inactivation study.32 One explanation for this field change is that an injurious environmental agent (which could be present, for example, in the gastroesophageal refluxate) is acting on a wide area of mucosa. The alternative (but not mutually exclusive) explanation is that a clone or clones of abnormal cells have expanded widely throughout the mucosa to replace previously normal cells. In either case, it is apparent that genetic changes can precede the appearance of morphologic changes in this disease. Only a small portion of the Barrett’s epithelium is usually taken as a biopsy specimen at endoscopy in routine clinical practice. Sampling error refers to the failure to detect pathology because of failure to biopsy the area containing the pathology. As evidenced by the high frequency of cancer found in esophagectomy specimens from patients with a preoperative maximum diagnosis of Barrett’s HGD, small areas or cancer are commonly not detected with endoscopic screening and conventional histopathologic methods. If some histopathologically nonmalignant areas have the expression profiles of malignancy in patients with cancer, it may not be necessary to perform a biopsy of the cancer itself to make a diagnosis of probable malignancy. Using molecular methods to assist the diagnostic process could thus theoretically reduce the risk of sampling error. The RAR expression profile for adenocarcinomas found in this study is markedly different from that reported for esophageal SCC.9,33 These RAR expression differences in esophageal adenocarcinoma compared with esophageal SCC demonstrate that, as shown by others, retinoid receptor expression in adults can be tumor specific.7,8 It is uncertain whether adenocarcinomas of the gastroesophageal junction (here also termed car-
dia cancers) should be grouped with the Barrett’srelated esophageal adenocarcinomas or with gastric cancers. In support of classifying them as Barrett’s cancers, areas of BE are frequently found adjacent to gastroesophageal junction cancers34 and incidence trends and risk factors for esophagus and esophagogastric junction-cardia adenocarcinomas are similar, whereas they are very different for gastric body-noncardia tumors.35 In the current study, the tissue and tumor specificity of retinoid receptor expression was used to investigate whether adenocarcinomas arising in the esophagus and at the gastroesophageal junction are biologically similar. Although there was some difference in RAR-β expression, the pattern of RAR-α and -γ expression in the esophagus and esophagogastric junction cancers was very similar. Furthermore, other reports indicate that the RAR expression profiles of gastric cancers are very different from the expressions that we found for esophagogastric junction-cardia cancers. 33,36-38 RAR expression patterns thus support the hypothesis that gastroesophageal junction adenocarcinomas are similar to esophageal adenocarcinomas rather than gastric cancers. Other studies have found significant differences between esophageal and cardia adenocarcinomas.39-41 Unfortunately, differing classification systems for cardia cancers in different studies make comparison and interpretation of these reports difficult. For example, in a study by van Dekken et al39 that used comparative genomic hybridization to discriminate between esophageal and gastric cardia adenocarcinomas, cardia cancers were located in the proximal stomach, and gastroesophageal junction cancers were classified as junctional cancers. In many North American centers such as ours, the junctional tumors would be classified as cardia cancers, and the tumors located distal to this would be
Lord et al 275
Surgery Volume 129, Number 3
termed proximal stomach cancers. Our findings are thus not dissimilar to those of van Dekken et al.39 BE is a common premalignant disease that is theoretically suitable for retinoid-based chemoprevention strategies. Although an in vitro study demonstrated inhibition of Barrett’s cell growth with both 13-cis-retinoic acid and β-carotene if relatively high concentrations of the drugs were used,42 there were no observed benefits in a small trial of 13-cis-retinoic acid in patients with BE.43 We have not investigated the effect of RAR expression levels on the effectiveness of different retinoid agents, but studies of other tumor types2,18,44-46 suggest that these investigations might be helpful for designing future retinoid chemoprevention trials for BE. One interesting chemoprevention approach for BE would be to combine retinoids and inhibitors of cyclooxygenase. The rationale for this (possibly synergistic47) approach is that cyclooxygenase-2 transcription is significantly upregulated in BE and Barrett’s adenocarcinomas,30,48,49 and cyclooxygenase-2 transcription can be suppressed by retinoids.50,51 REFERENCES 1. Nuclear Receptors Nomenclature Committee. A unified nomenclature system for the nuclear receptor superfamily. Cell 1999;97:161-3. 2. Lotan R. Roles of retinoids and their nuclear receptors in the development and prevention of upper aerodigestive tract cancers. Environ Health Perspect 1997;105:985-8. 3. Xu XC, Ro JY, Lee JS, et al. Differential expression of nuclear retinoid receptors in normal, premalignant, and malignant head and neck tissues. Cancer Res 1994;54: 3580-7. 4. Xu XC, Sneige N, Liu X, et al. Progressive decrease in nuclear retinoic acid receptor-β messenger RNA level during breast carcinogenesis. Cancer Res 1997;57:4992-6. 5. Gudas LJ. Retinoids, retinoid-responsive genes, cell differentiation, and cancer. Cell Growth Differ 1992;3:655-62. 6. Xu XC, Sozzi G, Lee JS, et al. Suppression of retinoic acid receptor-β in non-small–cell lung cancer in vivo: implications for lung cancer development. J Natl Cancer Inst 1997;89:624-9. 7. Lippman SM, Davies PJ. Retinoids, neoplasia and differentiation therapy. In: Pinedo HM, Longo DL, Chabner BA, editors. Cancer chemotherapy & biological response modifiers. New York: Elsevier Science BV; 1997. p. 349-622. 8. Hong WK, Itri LM. Retinoids and human cancer. In: Sporn MB, Roberts AB, Goodman DS, editors. The retinoids. New York: Raven Press; 1994. p. 597-630. 9. Xu X-C, Liu X, Tahara E, et al. Expression and up-regulation of retinoic acid receptor-β is associated with retinoid sensitivity and colony formation in esophageal cancer cell lines. Cancer Res 1999;59:2477-83. 10. Moon RC, Mehta RG, Rao KVN. Retinoids and cancer in experimental animals. In: Sporn MB, Roberts AB, Goodman DS, editors. The retinoids. New York: Raven Press; 1994. p. 573-96. 11. Dawsey SM, Wang GQ, Taylor PR, et al. Effects of vitamin/mineral supplementation on the prevalence of histo-
12.
13.
14.
15.
16. 17. 18.
19.
20.
21.
22.
23.
24.
25. 26.
27.
28.
29.
logical dysplasia and early cancer of the esophagus and stomach: results from the Dysplasia Trial in Linxian, China. Cancer Epidemiol Biomarkers Prev 1994;3:167-72. Li JY, Taylor PR, Li B, et al. Nutrition intervention trials in Linxian, China: multiple vitamin/mineral supplementation, cancer incidence, and disease-specific mortality among adults with esophageal dysplasia. J Natl Cancer Inst 1993;85:1492-8. Taylor PR, Li B, Dawsey SM, et al. Prevention of esophageal cancer: the nutrition intervention trials in Linxian, China. Linxian Nutrition Intervention Trials Study Group. Cancer Res 1994;54:2029s-31s. Wang GQ, Dawsey SM, Li JY, et al. Effects of vitamin/mineral supplementation on the prevalence of histological dysplasia and early cancer of the esophagus and stomach: results from the General Population Trial in Linxian, China. Cancer Epidemiol Biomarkers Prev 1994;3:161-6. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987;162:156-9. Heid CA, Stevens J, Livak KJ, et al. Real time quantitative PCR. Genome Res 1996;6:986-94. Gibson UE, Heid CA, Williams PM. A novel method for real time quantitative RT-PCR. Genome Res 1996;6:995-1001. Moasser MM, DeBlasio A, Dmitrovsky E. Response and resistance to retinoic acid are mediated through the retinoic acid nuclear receptor gamma in human teratocarcinomas. Oncogene 1994;9:833-40. Marshall GM, Cheung B, Stacey KP, et al. Increased retinoic acid receptor gamma expression suppresses the malignant phenotype and alters the differentiation potential of human neuroblastoma cells. Oncogene 1995;11:485-91. Meister B, Fink FM, Hittmair A, et al. Antiproliferative activity and apoptosis induced by retinoic acid receptor-gamma selectively binding retinoids in neuroblastoma. Anticancer Res 1998;18:1777-86. Hu L, Crowe DL, Rheinwald JG, et al. Abnormal expression of retinoic acid receptors and keratin 19 by human oral and epidermal squamous cell carcinoma cell lines. Cancer Res 1991;51:3972-81. Oridate N, Esumi N, Lotan D, et al. Implication of retinoic acid receptor gamma in squamous differentiation and response to retinoic acid in head and neck SqCC/Y1 squamous carcinoma cells. Oncogene 1996;12:2019-28. Houle B, Rochette-Egly C, Bradley WEC. Tumor-suppressive effect of the retinoic acid receptor β in human epidermoid lung cancer cells. Proc Natl Acad Sci U S A 1993;90:985-9. Ruberte E, Dolle P, Krust A, et al. Specific spatial and temporal distribution of retinoic acid receptor gamma transcripts during mouse embryogenesis. Development 1990;108:213-22. Lohnes D, Kastner P, Dierich A, et al. Function of retinoic acid receptor gamma in the mouse. Cell 1993;73:643-58. Cameron AJ, Carpenter HA. Barrett’s esophagus, highgrade dysplasia, and early adenocarcinoma: a pathological study. Am J Gastroenterol 1997;92:586-91. Witt TR, Bains MS, Zaman MB, et al. Adenocarcinoma in Barrett’s esophagus. J Thorac Cardiovasc Surg 1983;85:33745. Lord RV, Salonga D, Danenberg KD, et al. Telomerase reverse transcriptase expression is increased early in the Barrett’s metaplasia, dysplasia, adenocarcinoma sequence. J Gastrointest Surg 2000;4:135-42. Park JM, Danenberg K, Lord RV, et al. Induction of vascular endothelial growth factor and basic fibroblast growth factor
276 Lord et al
30.
31.
32.
33.
34.
35. 36.
37.
38.
39.
40.
expression in Barrett’s esophagus and Barrett’s-associated adenocarcinomas. Proc Annu Meet Am Assoc Cancer Res 1999;40:A1519. Lord RV, Danenberg K, Peters JH, et al. Increased COX-2 and iNOS expression and decreased COX-1 expression in Barrett’s esophagus and Barrett’s associated adenocarcinomas. Proc Annu Meet Am Assoc Cancer Res 1999;40:A2109. Eads CE, Lord RV, Kurumboor SK, et al. Fields of aberrant CpG island hypermethylation in Barrett’s esophagus and associated adenocarcinomas. Cancer Res 2000;60:5021-6. Prevo LJ, Sanchez CA, Galipeau PC, et al. p53-mutant clones and field effects in Barrett’s esophagus. Cancer Res 1999;59:4784-7. Liu G, Wu M, Levi G, et al. Inhibition of cancer cell growth by all-trans retinoic acid and its analog N-(4-hydroxyphenyl) retinamide: a possible mechanism of action via regulation of retinoid receptors expression. Int J Cancer 1998;78:248-54. Clark GW, Smyrk TC, Burdiles P, et al. Is Barrett’s metaplasia the source of adenocarcinomas of the cardia? Arch Surg 1994;129:609-14. Blot WJ, McLaughlin JK. The changing epidemiology of esophageal cancer. Semin Oncol 1999;26:2-8. Chao TY, Jiang SY, Shyu RY, Yeh MY, Chu TM. All-trans retinoic acid decreases susceptibility of a gastric cancer cell line to lymphokine-activated killer cytotoxicity. Br J Cancer 1997;75:1284-90. Naka K, Yokozaki H, Domen T, et al. Growth inhibition of cultured human gastric cancer cells by 9-cis-retinoic acid with induction of cdk inhibitor Waf1/Cip1/Sdi1/p21 protein. Differentiation 1997;61:313-20. Shyu RY, Jiang SY, Huang SL, et al. Growth regulation by alltrans-retinoic acid and retinoic acid receptor messenger ribonucleic acids expression in gastric cancer cells. Eur J Cancer 1995;31A:237-43. van Dekken H, Geelen E, Dinjens WNM, et al. Comparative genomic hybridization of cancer of the gastroesophageal junction: deletion of 14q31-32.1 discriminates between esophageal (Barrett’s) and gastric cardia adenocarcinomas. Cancer Res 1999;59:748-52. Farrow DC, Vaughan TL, Hansten PD, et al. Use of aspirin
Surgery March 2001
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
and other nonsteroidal anti-inflammatory drugs and risk of esophageal and gastric cancer. Cancer Epidemiol Biomarkers Prev 1998;7:97-102. Lagergren J, Bergstrom R, Lindgren A, Nyren O. Symptomatic gastroesophageal reflux as a risk factor for esophageal adenocarcinoma. N Engl J Med 1999;340:825-31. Garewal HS, Prabhala R, Sampliner R, et al. Effect of potential differentiating agents on the growth of Barrett’s esophagus-derived epithelial cell cultures [abstract]. Clin Res 1988;36:131A. Sampliner RE, Garewal HS. A phase II trial of 13-cis retinoic acid (isotretinoin) in Barrett’s esophagus [abstract]. Gastroenterology 1988;94:A396. Lotan R, Xu XC, Lippman SM, et al. Suppression of retinoic acid receptor-beta in premalignant oral lesions and its upregulation by isotretinoin. N Engl J Med 1995;332:1405-10. Kaiser A, Herbst H, Fisher G, et al. Retinoic acid receptor b regulates growth and differentiation in human pancreatic carcinoma cells. Gastroenterology 1997;113:920-9. Fanjul AN, Bouterfa H, Dawson M, et al. Potential role for retinoic acid receptor-gamma in the inhibition of breast cancer cells by selective retinoids and interferons. Cancer Res 1996;56:1571-7. Spingarn A, Sacks PG, Kelley D, et al. Synergistic effects of 13-cis retinoic acid and arachidonic acid cascade inhibitors on growth of head and neck squamous cell carcinoma in vitro. Otolaryngol Head Neck Surg 1998;118:159-64. Wilson KT, Fu S, Ramanujam KS, et al. Increased expression of inducible nitric oxide synthase and cyclooxygenase-2 in Barrett’s esophagus and associated adenocarcinomas. Cancer Res 1998;58:2929-34. Zimmerman KC, Sarbia M, Weber A-A, et al. Cyclooxygenase-2 expression in human esophageal carcinoma. Cancer Res 1999;59:198-204. Mestre JR, Subbaramaiah K, Sacks PG, et al. Retinoids suppress epidermal growth factor-induced transcription of cyclooxygenase-2 in human oral squamous carcinoma cells. Cancer Res 1997;57:2890-5. Mestre JR, Subbaramaiah K, Sacks PG, et al. Retinoids suppress phorbol ester-mediated induction of cyclooxygenase2. Cancer Res 1997;57:1081-5.
Background. Expression levels of the retinoic acid receptors (RAR-α, RAR-β, and RAR-γ) are significantly different in neoplastic tissues compared with non-neoplastic tissues for some tumors. This study investigated whether retinoic acid receptor messenger RNA (mRNA) expression levels are altered in Barrett’s esophagus and Barrett’s adenocarcinoma tissues. Methods. Relative mRNA expression levels of the RARs were quantified by using the ABI 7700 Sequence Detector (Taqman) system in Barrett’s intestinal metaplasia (n = 15), dysplasia (n = 6), adenocarcinoma (n = 17), and matching normal esophagus tissues (n = 36). Results. RAR-α expression was significantly increased, and RAR-γ expression was significantly decreased, at higher stages in the Barrett’s sequence. There was almost complete loss of RAR-γ expression (relative expression level ≤ 1) in a majority (70%) of the dysplasia and adenocarcinoma tissues. There were significant differences in RAR-α and RAR-γ expression in histopathologically normal tissues in patients with cancer versus patients without cancer. RAR-β expression levels were significantly elevated in adenocarcinoma versus normal esophagus tissues. The RAR expression profile was similar for cancers arising within the esophagus and for cancers arising at the gastroesophageal junction. Conclusions. RAR mRNA expression levels are significantly different in Barrett’s tissues compared with normal esophagus tissues, and these levels are significantly different in Barrett’s dysplasia and adenocarcinoma tissues compared with nondysplastic tissues. These results suggest that RAR mRNA levels may be useful biomarkers for this disease and that gastroesophageal junction adenocarcinomas are genetically similar to esophageal adenocarcinomas. These results also suggest that a cancer field is present in the esophagus in patients with cancer and that genetic alterations can precede histopathologic alterations in this disease. (Surgery 2001;129:267-76.) From the Departments of Surgery, Biochemistry and Molecular Biology, Preventive Medicine, and Pathology, University of Southern California Keck School of Medicine and USC/Norris Cancer Center, Los Angeles, Calif
BARRETT’S ESOPHAGUS (BE) is a condition in which the normal squamous lining of the distal esophagus is replaced with columnar epithelium in Presented in part at the 90th Annual Meeting of the American Association for Cancer Research, Philadelphia, April 1999. Supported by National Institutes of Health/National Cancer Institute grant RO1 CA 71716 to P. V. D and National Institutes of Health grant P30 CA 14089 to S. G. and D. D. T-W. Accepted for publication August 5, 2000. Reprint requests: P. V. Danenberg, 1303 N Mission Road, Los Angeles, CA 90033. Copyright © 2001 by Mosby, Inc. 0039-6060/2001/$35.00 + 0 11/56/110856 doi:10.1067/msy.2001.110856
response to chronic gastroesophageal reflux. BE is a multistage disease in which Barrett’s intestinal metaplasia (IM) progresses in some cases to lowgrade dysplasia (LGD), high-grade dysplasia (HGD), and eventually adenocarcinoma. Unfortunately, current tests are unable to accurately identify either the stage of disease or the likelihood of disease progression in individuals with BE. Studies investigating the molecular biology of the multistage Barrett’s sequence attempt to identify genetic markers that are reliably associated with each stage and with an increased likelihood of progression to more advanced stages. Identification of genetic markers would hopefully provide the basis SURGERY 267
268 Lord et al
for a combined molecular and histopathologic system for staging and treating patients according to their risk of developing advanced disease. Vitamin A (retinol) and its natural and synthetic analogues (retinoids) have effects on epithelial cell growth, differentiation, and apoptosis, and retinoids have been shown to have chemopreventive and chemotherapeutic activity for some malignant and premalignant diseases. Retinoid effects are mediated through 2 classes of ligand-dependent, DNA response element-binding nuclear receptors: the RARs (nuclear receptor group 1B)1 and retinoid X receptors (RXRs, nuclear receptor group 2B).1 Both receptor classes have α, β, and γ subclasses with numerous isoforms. The expression profiles of the RARs are significantly different in neoplastic compared with nonneoplastic tissues for some tumors,2-6 indicating that RAR expression levels may be useful biomarkers for the detection of malignancy in those cases. Furthermore, response to retinoid administration for several cancers and in experimental systems is closely associated with retinoid receptor expression patterns.7,8 Knowledge of these expression patterns in normal and tumor states for a particular tissue may thus be important for studies of response to retinoid treatment for that tissue. Most retinoid-related research for esophageal cancer has studied squamous cell carcinoma (SCC) rather than Barrett’s adenocarcinoma. This may reflect the similarity of esophageal SCC to other aerodigestive tract cancers such as oral cavity SCC and lung SCC, for which important roles for retinoids and their receptors have been shown. In esophageal SCC cells, expression and up-regulation of RAR-β is associated with retinoid sensitivity, and RAR-β expression is commonly lost in esophageal SCC surgical specimens.9 In experimental animal studies, it has been reported that retinoids protect against the development of esophageal papillomas, dysplastic areas, and carcinogen-induced cancers.10 A similar protective effect in human populations has not been confirmed.8,11-14 This study investigated whether RAR mRNA expression levels are significantly altered in BE and Barrett’s adenocarcinomas, and whether such alterations, if present, might serve as biomarkers of disease stage. A second aim of this study was to use the tissue and tumor specificity of retinoid receptor expression to investigate the genetic similarity of adenocarcinomas arising in the esophagus and at the esophagogastric junction.
Surgery March 2001 MATERIALS AND METHODS Tissue samples. Tissue samples from 75 endoscopic biopsy and 39 surgical resection specimens from patients with BE or adenocarcinoma of the esophagus or gastroesophageal junction were collected and immediately frozen in liquid nitrogen. Endoscopic biopsies were obtained according to a protocol that required biopsy at 2-cm intervals from each quadrant (anterior, posterior, and right and left lateral positions) of the visible length of Barrett’s mucosa and an additional biopsy from the normal appearing squamous mucosa of the esophagus. Normal esophagus biopsy specimens were taken from the proximal margin of the operative resection specimens or from an area at least 4 cm proximal to the macroscopically abnormal epithelium on endoscopy. Part of the specimen or an adjacent specimen was fixed in formalin and paraffin for histopathologic examination by 1 of 2 expert Barrett’s pathologists. Frozen section examination of the study tissue was performed if the diagnosis was uncertain. Only the highest grade lesion present in the esophagus and a matching normal squamous esophagus tissue were studied from each patient. Dysplasia specimens were thus not included from patients with cancer, and IM specimens were not included from patients with either cancer or dysplasia. The site of origin of the cancers was classified as esophageal if the epicenter of the tumor was above the anatomic gastroesophageal junction, and as esophagogastric junction-gastric cardia cancers if the epicenter was at or within 1 cm distal to the gastroesophageal junction. Specimens were classified as IM if IM but not dypslasia or cancer was present on histopathologic examination of all endoscopic biopsy specimens taken from the same level as the study specimen. Specimens were classified as dysplastic if either LGD or HGD was present. Dysplastic tissues were not divided into HGD and LGD groups because areas of LGD and HGD were commonly present in the same biopsy. By using these criteria, samples included were Barrett’s IM (n = 15), Barrett’s dysplasia (n = 6), esophageal adenocarcinoma (n = 10), esophagogastric junction-cardia adenocarcinoma (n = 7), and normal esophagus tissues (n = 37). Matching normal esophagus and pathologic tissues were collected for all but 3 patients (2 patients with adenocarcinoma for whom no normal esophagus tissue was available, and 1 patient with IM for whom a pathologic tissue specimen was not collected). Approval for this study was obtained from the Institutional Review Board of the University of
Surgery Volume 129, Number 3
Lord et al 269
Table I. PCR primers and probes RAR-α1 amplicon length: 147 bp RAR-α1-forward: 60F RAR-α1-reverse: 206R RAR-α1-hybridization probe 118 sense strand RAR-β2 amplicon length: 147 bp RAR-β2-forward: 419F RAR-β2-reverse: 565R RAR-β2-hybridization probe: 457 complimentary strand RAR-γ1 amplicon length: 138 bp RAR-γ1-forward: 579F RAR-γ1-reverse: 716R RAR-γ1-hybridization probe: 661 complimentary strand
Southern California School of Medicine and written informed consent was obtained from participating patients. RNA extraction and complementary DNA synthesis. A guanidinium thiocyanate method of mRNA isolation15 was used (QuickPrep Micro mRNA Purification Kit; Amersham Pharmacia Biotech Inc, Piscataway, NJ). Isolated mRNA was solved in 60 µL diethyl pyrocarbonate-treated water. For complementary DNA (cDNA) synthesis, 20 µL 5 × Moloney murine leukemia virus buffer (containing 250 mmol/L Tris-hydrogen chloride, pH 8.3; 375 mmol/L potassium chloride; 15 mmol/L magnesium chloride; Life Technologies, Gaithersburg, MD), 10 µL dithiothreitol (100 mmol/L; Life Technologies), 10 µL deoxyribonucleoside triphosphate (each 10 mmol/L; Amersham Pharmacia Biotech), 0.5 µL random hexamers (50 OD dissolved in 550 µL of 10 mmol/L Tris-hydrogen chloride pH 7.5, and 1 mmol/L EDTA; Amersham Pharmacia Biotech), 2.5 µL bovine serum albumin (3 mg/mL in 10 mmol/L Tris-hydrogen chloride pH 7.5; Amersham Pharmacia Biotech), 2.5 µL RNAse inhibitor (5 × 1000 units; Amersham Pharmacia Biotech), and 5 µL Moloney murine leukemia virus reverse transcriptase (200 U/µL; Life Technologies) were added to a total volume of 50.5 µL. Polymerase chain reaction quantification of mRNA expression. mRNA levels of RAR cDNA sequences of interest and an internal reference cDNA (β-actin) were quantified by using a fluorescence detection method (ABI PRISM 7700 Sequence Detection System, [Taqman] Perkin Elmer [PE] Applied Biosystems, Foster City, Calif) as described.16,17 In brief, this method uses a dual labeled fluorogenic oligonucleotide probe that anneals specifically within the forward and reverse primers.
GAGCCGGTCCTTTGGTCAA CTGCGAGCATCACAGGACAT 6FAM5′-AGCTGGCCTTCAGGGCACCAAAA-3′TAMRA CCGCAAATAAAAAGGCGTAAAG CACAAGCCGGCGTTTTCTT 6FAM5′-ACGCTGCTCCTGGCTCACGTTGA-3′TAMRA ACCGCGACAAAAACTGTATCATC CCTTCACCTCTTTCTTCTTCTTGTTC 6FAM5′-TCATTTCGCACAGCTTCCTTGGACATG-3′TAMRA
Laser stimulation within the capped wells containing the reaction mixture causes emission of a 3′ quencher dye (TAMRA) until the probe is cleaved by the 5′ to 3′ nuclease activity of the DNA polymerase during polymerase chain reaction extension, causing the release of a 5′ reporter dye (6FAM). Production of an amplicon thus causes emission of a fluorescent signal that is detected by the Taqman’s charge-coupled device detection camera, and the amount of signal produced at a threshold cycle within the purely exponential phase of the polymerase chain reaction reflects the starting copy number of the sequence of interest. Comparison of the starting copy number of the sequence of interest with the starting copy number of the reference gene provides a relative gene expression level. The polymerase chain reaction mixture consisted of 600 nmol/L of each primer (RAR-α1, RAR-β2, and RAR-γ1, Table I), 200 nmol/L probe (Table I), 5 units AmpliTaq Gold Polymerase, 200 µmol/L each deoxyadenosine triphosphate, deoxycytidine triphosphate, deoxyguanosine triphosphate, 400 µmol/L deoxyuridine triphosphate, 5.5 mmol/L magnesium chloride, 1 unit AmpErase uracil N-glycosylase, and 1 × Taqman Buffer A containing a reference dye, to a final volume of 25 µL (all reagents from Perkin Elmer [PE] Applied Biosystems, Foster City, Calif). Cycling conditions were 50°C for 2 minutes, 95°C for 10 minutes, followed by 40 cycles at 95°C for 15 seconds and 60°C for 1 minute. Significant contamination with genomic DNA was excluded by amplifying non-reverse-transcribed RNA. RAR-γ expression was measured on 2 separate occasions for the patients with adenocarcinoma. Statistical analysis. The RAR-α, -β, and -γ expression was measured in each specimen of normal and pathologic (IM, dypslasia, adenocarcinoma) tissue. For all measurements, the logarithm transforma-
270 Lord et al
Surgery March 2001
A
B
C Fig 1. Plots of relative mRNA expression measurements for (A) RAR-α, (B) RAR-β, and (C) RAR-γ. Actual measurements are shown. The boxes show the 25th and 75th percentiles of the data. The median values are shown as horizontal lines within the boxes. See tables for statistical analysis. There are 2 extreme values in panel A (A = 33.75, B = 38.87) and in panel B (A =141.99, B = 155.31). There are 4 extreme values in panel C (A = 60.49, B = 46.58, C = 39.81, D = 32.54).
tion was taken before analysis. An analysis of variance was performed to test for differences between RAR expression levels in tissues from patients with IM, dysplasia, and adenocarcinoma by using the transformed RAR values. The analysis was done for the normal and abnormal esophagus tissues sepa-
rately. The overall P values were based on the F test from the analysis of variance. If the overall F test P value was less than .05, the least significant difference method was used for multiple comparisons. Paired t tests were used to test for differences in RAR expression levels in matched normal and
Lord et al 271
Surgery Volume 129, Number 3
Table II. Comparison of RAR expression levels in matching histopathologically normal esophagus tissues and abnormal tissues Geometric mean RAR and patient diagnosis
Ratio of normal to abnormal tissues
95% CI* of difference
N
Normal tissues
Abnormal tissues
Adenocarcinoma Dysplasia IM
15 6 15
2.62 1.99 1.12
7.69 6.86 4.61
0.34 0.29 0.24
(0.24, 0.48) (0.08, 1.01) (0.14, 0.41)
.0001 .051 .0001
Adenocarcinoma Dysplasia IM
15 5‡ 15
3.80 8.02 6.33
9.92 7.68 8.97
0.38 1.04 0.71
(0.20, 0.72) (0.31, 3.51) (0.15, 3.27)
.006 .93 .63
Adenocarcinoma Dysplasia IM
15 6 15
4.99 11.18 13.30
0.86 0.32 2.63
5.84 34.68 5.05
(2.23, 15.26) (2.23, 538.77) (2.32, 10.97)
.002 .021 .0005
P value†
α
β
γ
*95% confidence interval. †P values based on paired t test. ‡One patient with an extremely high value (2669) for dysplasia tissue was excluded from the analysis.
abnormal tissues. Three patients with no matching tissues were excluded from the paired t test calculations. RESULTS There were significant differences in the RAR mRNA expression levels at different stages in the Barrett’s IM, dysplasia, adenocarcinoma sequence (Tables II and III and Fig 1). In patients with adenocarcinoma, the expression of all 3 RARs was significantly different in cancer tissues compared with matching normal esophagus tissues from the same patients, with RAR-α and RAR-β expressions significantly higher and RAR-γ expressions significantly lower in cancer compared with normal tissues. There was almost complete loss of RAR-γ expression (relative expression level ≤ 1) in a majority (70%) of the dysplasia and adenocarcinoma tissues. In addition to being significantly higher in cancer tissues, RAR-α expression was significantly higher in IM tissues compared with matching normal esophagus tissues (P = .0001), and RAR-α levels in dysplasia samples were higher than in matching normal tissues, with the difference almost achieving statistical significance (P = .051). In contrast to this up-regulation in RAR-α expression in pathologic tissues, the expression of RAR-γ was significantly down-regulated at all Barrett’s stages (IM, dysplasia, and adenocarcinoma) compared with matching normal esophagus tissues from the same patients (Table II). RAR-γ expression was also sig-
nificantly lower in adenocarcinoma and dysplasia tissues compared with IM tissues (P = .023 and .003, respectively; Table III). Both RAR-α and RAR-γ expression levels were significantly different in histologically normal squamous esophagus tissues from patients with cancer compared with histologically normal squamous esophagus tissues from patients without cancer (Table III). Although there was some difference in RAR-β expression, the pattern of RAR-α and -γ expression in the esophagus and gastroesophageal junction cancers was similar (Table IV). The RAR mRNA expression levels were “mapped” in one case by taking biopsy specimens at 1-cm intervals from the mucosa in the lower esophagus from an adenocarcinoma esophagectomy specimen. The RAR-γ expression levels in different areas in this patient are illustrated in Fig 2, showing that low or “cancerlike” RAR-γ expression is found in some histopathologically nonmalignant areas adjacent to the cancer. DISCUSSION This study demonstrates that there are significant alterations in RAR mRNA expression levels in BE and Barrett’s adenocarcinoma tissues. Analyzing the grouped results for each histopathologic stage, we found that RAR-α expression is significantly increased in both cancer and IM tissues compared with matching normal esophagus tissues, that RAR-β expression is significantly higher in can-
272 Lord et al
Surgery March 2001
Table III. Comparison of RAR expression levels in histopathologically abnormal and normal esophagus tissues
Abnormal tissue RAR and tissue diagnosis α Adenocarcinoma Dysplasia IM β Adenocarcinoma Dysplasia IM γ Adenocarcinoma Dysplasia IM Normal tissues RAR and patient diagnosis α Adenocarcinoma Nonadenocarcinoma β Adenocarcinoma Nonadenocarcinoma γ Adenocarcinoma Nonadenocarcinoma
N
Geometric mean
95% CI*
P value†
17 6 15
7.82 6.86 4.61
(5.21, 11.73) (3.46, 13.58) (2.99, 7.10)
17 5‡ 15
8.76 7.68 8.97
(3.68, 20.89) (1.55, 38.14) (3.56, 22.62)
17 6 15
0.83 0.32 2.63
(0.42, 1.63)§ (0.10, 1.01)§ (1.28, 5.41)§
15 22
2.62 1.25
(1.79, 3.83) (0.91, 1.71)
.004
15 22
3.80 6.76
(1.73, 8.38) (3.52, 12.98)
.26
15 22
4.99 12.51
(2.84, 8.79) (7.85, 19.95)
.016
.20
.99
.007 .023§ .003§
*95% confidence interval. †P values based on F test from analysis of variance. ‡One patient with an extremely high value (2669) for the dysplasia tissue was excluded from the analysis. §Statistically significant based on LSD method.
cer compared with the normal esophagus, and that RAR-γ expression, in contrast, is significantly lower in IM, Barrett’s dysplasia, and adenocarcinoma tissues compared with normal esophagus. RAR-γ mRNA expression is also significantly lower in adenocarcinoma and dysplasia tissues compared with IM tissues. These results suggest that up-regulation in RAR-α expression and down-regulation in RARγ expression may be associated with the development of BE and with the progression of BE to adenocarcinoma. A reduction in RAR-γ expression has also been found in human teratocarcinoma cells,18 advanced neuroblastoma tumor cells,19,20 and oral and epidermal SCC cells.21 The loss of RAR-γ expression at the dysplastic and adenocarcinoma stages in our study is likely to represent tumor-associated downregulation of a differentiation marker. In head and neck SqCC/Y1 SCC cells, transfection of RAR-γ sense expression vectors increased the expression of squamous differentiation markers,22 which is interesting in the current context because the development of BE resembles a squamous dedif-
ferentiation process in which the normal replacement of columnar epithelium with squamous epithelium that occurs in utero is reversed in adults with BE. It is also possible that RAR-γ has a role as a tumor suppressor gene in Barrett’s carcinogenesis. In human epidermoid lung cancers, both in vitro and in vivo results support the hypothesis that RARβ, which is significantly down-regulated in tumors compared with normal tissues, is functioning as a tumor suppressor gene in that cancer.23 Although during mouse development RAR-γ is specifically expressed in differentiating squamous keratinizing epithelia, including esophageal epithelium,24 the esophagus is normal in RAR-γ -/- mice.25 The associations between different Barrett’s stages and RAR expression levels indicate that expression levels of these genes might be useful biomarkers for following the progression of this disease. It seems plausible that BE patients with more abnormal expression profiles are at greater risk of progression to higher disease stages, but this needs to be demonstrated in studies of sequential
Surgery Volume 129, Number 3
Lord et al 273
Fig 2. The anatomy of a normal distal esophagus (E), esophagogastric junction (EGJ), proximal stomach (S), and the right and left leaves of the diaphragm (D) is shown on the left. “Mapping” of RAR-γ expression levels from a patient with esophageal adenocarcinoma is shown on the right. The quantity of relative RAR-γ mRNA is shown by the height of the colored shapes. The shapes are colored according to the histopathology at each biopsy site: yellow, normal gastric mucosa; green, cardiac mucosa; pink, BE with LGD; red, adenocarcinoma; blue, normal squamous esophageal mucosa. The variability in the carcinoma expression levels shows that even within the same patient, the range of gene expression measurements may be large. Although there is high RAR-γ expression in most of the normal esophagus areas, one normal esophagus specimen shows low expression and there is low expression in histopathologically nonmalignant areas near the tumor. This patient was classified as 1 of the 2 patients without significant loss of RAR-γ expression, and a high RARγ expression measurement was used for the statistical analysis.
biopsies in individual patients. There was considerable variability in the expression levels for different patients within each histopathologic group, however, indicating that the predictive power of expression measurement for these genes is limited. For example, there were adenocarcinoma tissues in this study that had not lost RAR-γ expression or had low RAR-α expression. Molecular diagnosis and staging using expression quantification will therefore probably need to use a panel of genes rather than single genes or small families of genes such as the retinoid receptors. There is no evidence at present to support the introduction of RAR expression measurement as an adjunct to routine clinical decision making for patients with BE. Both RAR-α and RAR-γ expression levels were significantly different in histologically normal squamous esophagus tissues from patients with cancer compared with histologically normal squamous
esophagus tissues from patients without cancer. These histopathologically normal esophagus biopsy specimens were from areas that were well separated from macroscopic disease, indicating that there is a widespread oncogenic field effect in the esophagus in cancer patients. The extent of this field change was mapped in 1 adenocarcinoma esophagectomy patient by taking multiple biopsies from the distal esophageal mucosa (Fig 2). Abnormal or “cancer-like” RAR mRNA expression levels were found in histopathologically nonmalignant biopsy specimens up to several centimeters away from the cancer. The presence of a field of abnormal epithelium at risk for cancer development is supported by histopathologic studies that demonstrated multiple separate foci of dysplasia or cancer within individual segments of BE.26,27 Evidence for a field effect has also been shown in other gene expression stud-
274 Lord et al
Surgery March 2001
Table IV. Comparison of RAR expression levels in adenocarcinoma tissues according to esophageal or esophagogastric junction site of origin RAR
N
Geometric mean
95% CI*
Esophagogastric junction Esophagus
7 10
9.21 6.97
(5.80, 14.62) (4.73, 10.26)
Esophagogastric junction Esophagus
7 10
14.04 6.30
(3.98, 49.56) (2.19, 18.09)
Esophagogastric junction Esophagus
7 10
0.76 0.88
(0.28, 2.05) (0.39, 2.02)
α β γ
P value†
.34
.32
.81
*95% confidence interval. †P values based on F test from analysis of variance.
ies,28-30 in DNA methylation analyses,31 and in a tumor suppressor gene inactivation study.32 One explanation for this field change is that an injurious environmental agent (which could be present, for example, in the gastroesophageal refluxate) is acting on a wide area of mucosa. The alternative (but not mutually exclusive) explanation is that a clone or clones of abnormal cells have expanded widely throughout the mucosa to replace previously normal cells. In either case, it is apparent that genetic changes can precede the appearance of morphologic changes in this disease. Only a small portion of the Barrett’s epithelium is usually taken as a biopsy specimen at endoscopy in routine clinical practice. Sampling error refers to the failure to detect pathology because of failure to biopsy the area containing the pathology. As evidenced by the high frequency of cancer found in esophagectomy specimens from patients with a preoperative maximum diagnosis of Barrett’s HGD, small areas or cancer are commonly not detected with endoscopic screening and conventional histopathologic methods. If some histopathologically nonmalignant areas have the expression profiles of malignancy in patients with cancer, it may not be necessary to perform a biopsy of the cancer itself to make a diagnosis of probable malignancy. Using molecular methods to assist the diagnostic process could thus theoretically reduce the risk of sampling error. The RAR expression profile for adenocarcinomas found in this study is markedly different from that reported for esophageal SCC.9,33 These RAR expression differences in esophageal adenocarcinoma compared with esophageal SCC demonstrate that, as shown by others, retinoid receptor expression in adults can be tumor specific.7,8 It is uncertain whether adenocarcinomas of the gastroesophageal junction (here also termed car-
dia cancers) should be grouped with the Barrett’srelated esophageal adenocarcinomas or with gastric cancers. In support of classifying them as Barrett’s cancers, areas of BE are frequently found adjacent to gastroesophageal junction cancers34 and incidence trends and risk factors for esophagus and esophagogastric junction-cardia adenocarcinomas are similar, whereas they are very different for gastric body-noncardia tumors.35 In the current study, the tissue and tumor specificity of retinoid receptor expression was used to investigate whether adenocarcinomas arising in the esophagus and at the gastroesophageal junction are biologically similar. Although there was some difference in RAR-β expression, the pattern of RAR-α and -γ expression in the esophagus and esophagogastric junction cancers was very similar. Furthermore, other reports indicate that the RAR expression profiles of gastric cancers are very different from the expressions that we found for esophagogastric junction-cardia cancers. 33,36-38 RAR expression patterns thus support the hypothesis that gastroesophageal junction adenocarcinomas are similar to esophageal adenocarcinomas rather than gastric cancers. Other studies have found significant differences between esophageal and cardia adenocarcinomas.39-41 Unfortunately, differing classification systems for cardia cancers in different studies make comparison and interpretation of these reports difficult. For example, in a study by van Dekken et al39 that used comparative genomic hybridization to discriminate between esophageal and gastric cardia adenocarcinomas, cardia cancers were located in the proximal stomach, and gastroesophageal junction cancers were classified as junctional cancers. In many North American centers such as ours, the junctional tumors would be classified as cardia cancers, and the tumors located distal to this would be
Lord et al 275
Surgery Volume 129, Number 3
termed proximal stomach cancers. Our findings are thus not dissimilar to those of van Dekken et al.39 BE is a common premalignant disease that is theoretically suitable for retinoid-based chemoprevention strategies. Although an in vitro study demonstrated inhibition of Barrett’s cell growth with both 13-cis-retinoic acid and β-carotene if relatively high concentrations of the drugs were used,42 there were no observed benefits in a small trial of 13-cis-retinoic acid in patients with BE.43 We have not investigated the effect of RAR expression levels on the effectiveness of different retinoid agents, but studies of other tumor types2,18,44-46 suggest that these investigations might be helpful for designing future retinoid chemoprevention trials for BE. One interesting chemoprevention approach for BE would be to combine retinoids and inhibitors of cyclooxygenase. The rationale for this (possibly synergistic47) approach is that cyclooxygenase-2 transcription is significantly upregulated in BE and Barrett’s adenocarcinomas,30,48,49 and cyclooxygenase-2 transcription can be suppressed by retinoids.50,51 REFERENCES 1. Nuclear Receptors Nomenclature Committee. A unified nomenclature system for the nuclear receptor superfamily. Cell 1999;97:161-3. 2. Lotan R. Roles of retinoids and their nuclear receptors in the development and prevention of upper aerodigestive tract cancers. Environ Health Perspect 1997;105:985-8. 3. Xu XC, Ro JY, Lee JS, et al. Differential expression of nuclear retinoid receptors in normal, premalignant, and malignant head and neck tissues. Cancer Res 1994;54: 3580-7. 4. Xu XC, Sneige N, Liu X, et al. Progressive decrease in nuclear retinoic acid receptor-β messenger RNA level during breast carcinogenesis. Cancer Res 1997;57:4992-6. 5. Gudas LJ. Retinoids, retinoid-responsive genes, cell differentiation, and cancer. Cell Growth Differ 1992;3:655-62. 6. Xu XC, Sozzi G, Lee JS, et al. Suppression of retinoic acid receptor-β in non-small–cell lung cancer in vivo: implications for lung cancer development. J Natl Cancer Inst 1997;89:624-9. 7. Lippman SM, Davies PJ. Retinoids, neoplasia and differentiation therapy. In: Pinedo HM, Longo DL, Chabner BA, editors. Cancer chemotherapy & biological response modifiers. New York: Elsevier Science BV; 1997. p. 349-622. 8. Hong WK, Itri LM. Retinoids and human cancer. In: Sporn MB, Roberts AB, Goodman DS, editors. The retinoids. New York: Raven Press; 1994. p. 597-630. 9. Xu X-C, Liu X, Tahara E, et al. Expression and up-regulation of retinoic acid receptor-β is associated with retinoid sensitivity and colony formation in esophageal cancer cell lines. Cancer Res 1999;59:2477-83. 10. Moon RC, Mehta RG, Rao KVN. Retinoids and cancer in experimental animals. In: Sporn MB, Roberts AB, Goodman DS, editors. The retinoids. New York: Raven Press; 1994. p. 573-96. 11. Dawsey SM, Wang GQ, Taylor PR, et al. Effects of vitamin/mineral supplementation on the prevalence of histo-
12.
13.
14.
15.
16. 17. 18.
19.
20.
21.
22.
23.
24.
25. 26.
27.
28.
29.
logical dysplasia and early cancer of the esophagus and stomach: results from the Dysplasia Trial in Linxian, China. Cancer Epidemiol Biomarkers Prev 1994;3:167-72. Li JY, Taylor PR, Li B, et al. Nutrition intervention trials in Linxian, China: multiple vitamin/mineral supplementation, cancer incidence, and disease-specific mortality among adults with esophageal dysplasia. J Natl Cancer Inst 1993;85:1492-8. Taylor PR, Li B, Dawsey SM, et al. Prevention of esophageal cancer: the nutrition intervention trials in Linxian, China. Linxian Nutrition Intervention Trials Study Group. Cancer Res 1994;54:2029s-31s. Wang GQ, Dawsey SM, Li JY, et al. Effects of vitamin/mineral supplementation on the prevalence of histological dysplasia and early cancer of the esophagus and stomach: results from the General Population Trial in Linxian, China. Cancer Epidemiol Biomarkers Prev 1994;3:161-6. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987;162:156-9. Heid CA, Stevens J, Livak KJ, et al. Real time quantitative PCR. Genome Res 1996;6:986-94. Gibson UE, Heid CA, Williams PM. A novel method for real time quantitative RT-PCR. Genome Res 1996;6:995-1001. Moasser MM, DeBlasio A, Dmitrovsky E. Response and resistance to retinoic acid are mediated through the retinoic acid nuclear receptor gamma in human teratocarcinomas. Oncogene 1994;9:833-40. Marshall GM, Cheung B, Stacey KP, et al. Increased retinoic acid receptor gamma expression suppresses the malignant phenotype and alters the differentiation potential of human neuroblastoma cells. Oncogene 1995;11:485-91. Meister B, Fink FM, Hittmair A, et al. Antiproliferative activity and apoptosis induced by retinoic acid receptor-gamma selectively binding retinoids in neuroblastoma. Anticancer Res 1998;18:1777-86. Hu L, Crowe DL, Rheinwald JG, et al. Abnormal expression of retinoic acid receptors and keratin 19 by human oral and epidermal squamous cell carcinoma cell lines. Cancer Res 1991;51:3972-81. Oridate N, Esumi N, Lotan D, et al. Implication of retinoic acid receptor gamma in squamous differentiation and response to retinoic acid in head and neck SqCC/Y1 squamous carcinoma cells. Oncogene 1996;12:2019-28. Houle B, Rochette-Egly C, Bradley WEC. Tumor-suppressive effect of the retinoic acid receptor β in human epidermoid lung cancer cells. Proc Natl Acad Sci U S A 1993;90:985-9. Ruberte E, Dolle P, Krust A, et al. Specific spatial and temporal distribution of retinoic acid receptor gamma transcripts during mouse embryogenesis. Development 1990;108:213-22. Lohnes D, Kastner P, Dierich A, et al. Function of retinoic acid receptor gamma in the mouse. Cell 1993;73:643-58. Cameron AJ, Carpenter HA. Barrett’s esophagus, highgrade dysplasia, and early adenocarcinoma: a pathological study. Am J Gastroenterol 1997;92:586-91. Witt TR, Bains MS, Zaman MB, et al. Adenocarcinoma in Barrett’s esophagus. J Thorac Cardiovasc Surg 1983;85:33745. Lord RV, Salonga D, Danenberg KD, et al. Telomerase reverse transcriptase expression is increased early in the Barrett’s metaplasia, dysplasia, adenocarcinoma sequence. J Gastrointest Surg 2000;4:135-42. Park JM, Danenberg K, Lord RV, et al. Induction of vascular endothelial growth factor and basic fibroblast growth factor
276 Lord et al
30.
31.
32.
33.
34.
35. 36.
37.
38.
39.
40.
expression in Barrett’s esophagus and Barrett’s-associated adenocarcinomas. Proc Annu Meet Am Assoc Cancer Res 1999;40:A1519. Lord RV, Danenberg K, Peters JH, et al. Increased COX-2 and iNOS expression and decreased COX-1 expression in Barrett’s esophagus and Barrett’s associated adenocarcinomas. Proc Annu Meet Am Assoc Cancer Res 1999;40:A2109. Eads CE, Lord RV, Kurumboor SK, et al. Fields of aberrant CpG island hypermethylation in Barrett’s esophagus and associated adenocarcinomas. Cancer Res 2000;60:5021-6. Prevo LJ, Sanchez CA, Galipeau PC, et al. p53-mutant clones and field effects in Barrett’s esophagus. Cancer Res 1999;59:4784-7. Liu G, Wu M, Levi G, et al. Inhibition of cancer cell growth by all-trans retinoic acid and its analog N-(4-hydroxyphenyl) retinamide: a possible mechanism of action via regulation of retinoid receptors expression. Int J Cancer 1998;78:248-54. Clark GW, Smyrk TC, Burdiles P, et al. Is Barrett’s metaplasia the source of adenocarcinomas of the cardia? Arch Surg 1994;129:609-14. Blot WJ, McLaughlin JK. The changing epidemiology of esophageal cancer. Semin Oncol 1999;26:2-8. Chao TY, Jiang SY, Shyu RY, Yeh MY, Chu TM. All-trans retinoic acid decreases susceptibility of a gastric cancer cell line to lymphokine-activated killer cytotoxicity. Br J Cancer 1997;75:1284-90. Naka K, Yokozaki H, Domen T, et al. Growth inhibition of cultured human gastric cancer cells by 9-cis-retinoic acid with induction of cdk inhibitor Waf1/Cip1/Sdi1/p21 protein. Differentiation 1997;61:313-20. Shyu RY, Jiang SY, Huang SL, et al. Growth regulation by alltrans-retinoic acid and retinoic acid receptor messenger ribonucleic acids expression in gastric cancer cells. Eur J Cancer 1995;31A:237-43. van Dekken H, Geelen E, Dinjens WNM, et al. Comparative genomic hybridization of cancer of the gastroesophageal junction: deletion of 14q31-32.1 discriminates between esophageal (Barrett’s) and gastric cardia adenocarcinomas. Cancer Res 1999;59:748-52. Farrow DC, Vaughan TL, Hansten PD, et al. Use of aspirin
Surgery March 2001
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
and other nonsteroidal anti-inflammatory drugs and risk of esophageal and gastric cancer. Cancer Epidemiol Biomarkers Prev 1998;7:97-102. Lagergren J, Bergstrom R, Lindgren A, Nyren O. Symptomatic gastroesophageal reflux as a risk factor for esophageal adenocarcinoma. N Engl J Med 1999;340:825-31. Garewal HS, Prabhala R, Sampliner R, et al. Effect of potential differentiating agents on the growth of Barrett’s esophagus-derived epithelial cell cultures [abstract]. Clin Res 1988;36:131A. Sampliner RE, Garewal HS. A phase II trial of 13-cis retinoic acid (isotretinoin) in Barrett’s esophagus [abstract]. Gastroenterology 1988;94:A396. Lotan R, Xu XC, Lippman SM, et al. Suppression of retinoic acid receptor-beta in premalignant oral lesions and its upregulation by isotretinoin. N Engl J Med 1995;332:1405-10. Kaiser A, Herbst H, Fisher G, et al. Retinoic acid receptor b regulates growth and differentiation in human pancreatic carcinoma cells. Gastroenterology 1997;113:920-9. Fanjul AN, Bouterfa H, Dawson M, et al. Potential role for retinoic acid receptor-gamma in the inhibition of breast cancer cells by selective retinoids and interferons. Cancer Res 1996;56:1571-7. Spingarn A, Sacks PG, Kelley D, et al. Synergistic effects of 13-cis retinoic acid and arachidonic acid cascade inhibitors on growth of head and neck squamous cell carcinoma in vitro. Otolaryngol Head Neck Surg 1998;118:159-64. Wilson KT, Fu S, Ramanujam KS, et al. Increased expression of inducible nitric oxide synthase and cyclooxygenase-2 in Barrett’s esophagus and associated adenocarcinomas. Cancer Res 1998;58:2929-34. Zimmerman KC, Sarbia M, Weber A-A, et al. Cyclooxygenase-2 expression in human esophageal carcinoma. Cancer Res 1999;59:198-204. Mestre JR, Subbaramaiah K, Sacks PG, et al. Retinoids suppress epidermal growth factor-induced transcription of cyclooxygenase-2 in human oral squamous carcinoma cells. Cancer Res 1997;57:2890-5. Mestre JR, Subbaramaiah K, Sacks PG, et al. Retinoids suppress phorbol ester-mediated induction of cyclooxygenase2. Cancer Res 1997;57:1081-5.