Retinoic acid regulates Kit translation during spermatogonial differentiation in the mouse

Developmental Biology 397 (2015) 140–149

Contents lists available at ScienceDirect

Developmental Biology journal homepage: www.elsevier.com/locate/developmentalbiology

Retinoic acid regulates Kit translation during spermatogonial differentiation in the mouse Jonathan T. Busada a, Vesna A. Chappell a, Bryan A. Niedenberger a, Evelyn P. Kaye a, Brett D. Keiper b, Cathryn A. Hogarth d, Christopher B. Geyer a,c,n a

Department of Anatomy and Cell Biology, Brody School of Medicine, Greenville, NC, USA Department of Biochemistry and Molecular Biology, Brody School of Medicine, Greenville, NC, USA c East Carolina Diabetes and Obesity Institute, East Carolina University, Greenville, NC, USA d Department of Molecular Biosciences and the Center for Reproductive Biology, Washington State University, Pullman, WA, USA b

art ic l e i nf o

a b s t r a c t

Article history: Received 19 August 2014 Received in revised form 22 October 2014 Accepted 23 October 2014 Available online 4 November 2014

In the testis, a subset of spermatogonia retains stem cell potential, while others differentiate to eventually become spermatozoa. This delicate balance must be maintained, as defects can result in testicular cancer or infertility. Currently, little is known about the gene products and signaling pathways directing these critical cell fate decisions. Retinoic acid (RA) is a requisite driver of spermatogonial differentiation and entry into meiosis, yet the mechanisms activated downstream are undefined. Here, we determined a requirement for RA in the expression of KIT, a receptor tyrosine kinase essential for spermatogonial differentiation. We found that RA signaling utilized the PI3K/AKT/mTOR signaling pathway to induce the efficient translation of mRNAs for Kit, which are present but not translated in undifferentiated spermatogonia. Our findings provide an important molecular link between a morphogen (RA) and the expression of KIT protein, which together direct the differentiation of spermatogonia throughout the male reproductive lifespan. & 2014 Elsevier Inc. All rights reserved.

Keywords: Translation Spermatogonia Retinoic acid Testis Spermatogenesis Kit

Introduction Spermatogenesis begins in the neonatal mouse testis with the transition of quiescent prospermatogonia (also called gonocytes) into a heterogeneous population of undifferentiated and differentiated spermatogonia at approximately 3–4 days postpartum (dpp). A subset of undifferentiated spermatogonia retain stem cell potential, while the rest differentiate to eventually enter meiosis as leptotene spermatocytes by
10 dpp (reviewed in de Rooij and Russell, 2000; Oatley and Brinster, 2012; Yoshida, 2012). It is unclear how spermatogonia make this critical cell fate decision, but afterwards there is a clear demarcation in the expression of specific proteins in undifferentiated (As–Aal) and differentiated (A1-) spermatogonia. One critical cell surface marker that distinguishes differentiated spermatogonia is KIT (also called c-KIT). This receptor tyrosine kinase is required for fertility (Besmer et al., 1993; Loveland and Schlatt, 1997; Kissel et al., 2000), and has been particularly useful in the study of male germ cells; antibodies

n Corresponding author at: Brody School of Medicine at East Carolina University, 600 Moye Boulevard, Greenville, NC 27834, USA. Fax: þ 1 252 744 2850. E-mail address: [email protected] (C.B. Geyer).

http://dx.doi.org/10.1016/j.ydbio.2014.10.020 0012-1606/& 2014 Elsevier Inc. All rights reserved.

raised against KIT enable isolation of differentiated spermatogonia, and KIT expression is used to follow germ cell fate changes in transgenic and knockout mice or following various treatments (Prabhu et al., 2006; Mithraprabhu, and Loveland, 2009). KIT is bound by KIT ligand (KITL), which is expressed by neighboring Sertoli cells in the seminiferous epithelium (Loveland and Schlatt, 1997). This binding activates the PI3K intracellular signaling pathway in spermatogonia, which is required for entry into meiosis (Blume-Jensen et al., 2000; Kissel et al., 2000). KIT is also essential during differentiation of a number of stem cell populations (Edling and Hallberg, 2007), including embryonic stem cells (ESCs) (Bashamboo et al., 2006). There is no consensus as to when KIT is first expressed in spermatogonia in the neonatal testis, although it is clear that Kit mRNA is present in undifferentiated spermatogonia and in prospermatogonia in the neonatal testis without detectable protein (Schrans-Stassen et al., 1999; Prabhu et al., 2006; Oatley et al., 2009; Yang et al., 2013b). The initiation of KIT protein expression in differentiating spermatogonia may involve a change in the utilization of Kit mRNAs. It has been clear for a long time that mRNAs are not all translated with equivalent efficiency (Lodish, 1976); those experiencing greater initiation activity recruit more ribosomes (polyribosomes, or polysomes) will be more efficiently

J.T. Busada et al. / Developmental Biology 397 (2015) 140–149

translated, while those that initiate poorly lack ribosomes and will not produce protein. We recently assessed changes in mRNA translation efficiency during neonatal testis development using translation state array analysis (TSAA). This is a genome-wide microarray approach in which mRNAs are identified based on changes in their association with polysomes (described in Arava, 2003). We identified
3000 mRNAs encoding both germ cellspecific and housekeeping proteins that become Z2-fold enriched in polysomes in the neonatal testis from 1 to 4 dpp without a significant change in overall mRNA abundance (Chappell et al., 2013). We found that Kit mRNAs underwent significant movement (
5-fold) into heavy polysomes over that interval, and this provides a potential mechanism for the initial expression of KIT protein in spermatogonia. The morphogen all-trans retinoic acid (ATRA, hereafter abbreviated as RA) regulates the sex-specific timing of meiotic initiation in mice, and has been implicated in spermatogonial differentiation in the testis (Koshimizu et al., 1995; Gaemers et al., 1998; Bowles et al., 2006; Koubova et al., 2006; Bowles and Koopman, 2007). Evidence supporting a role for RA in regulation of KIT expression has been largely gathered from in vitro experimentation. Although RA can increase Kit mRNA levels in vitro (Pellegrini et al., 2008; Zhou et al., 2008a; Raverdeau et al., 2012), this is not likely the primary mechanism regulating KIT protein production in vivo, as non-translating mRNA is already present in both prospermatogonia and in undifferentiated spermatogonia without detectable protein (Schrans-Stassen et al., 1999; Prabhu et al., 2006; Yang et al., 2013a, 2013b). We recently found that injection of RA into mice at 1 dpp (prior to endogenous exposure to RA at 3–4 dpp) induced precocious KIT protein expression in spermatogonia (Busada et al., 2014). In this study, we identify a novel mechanism by which RA regulates KIT protein synthesis in differentiating spermatogonia. Our results indicate that Kit mRNA translates poorly in the absence of RA, but becomes recruited to polysomes in response to RA in the neonatal testis, resulting in the first appearance of KIT protein in neonatal spermatogonia. We show that the first population of KITþ spermatogonia is also STRA8þ , supporting the concept that RA exposure is required for KIT expression. However, KIT expression is not dependent upon STRA8, which suggests that there are independent RA-directed pathways regulating KIT and STRA8 expression. Importantly, we discovered that RA-activated PI3K and AKT signaling is required for induction of KIT but not STRA8. Taken together, these results suggest a novel non-genomic pathway in which RA activates the PI3K–AKT–mTOR signaling network to regulate KIT expression and spermatogonia differentiation in the neonatal testis.

Materials and methods Animal treatments and tissue collection All animal procedures were performed in accordance with the National Research Council Guide for the Care and Use of Laboratory Animals and approved by the Animal Care and Use Committee of East Carolina University (AUP #A178) and Washington State University (ASAF #1519). All analyses were performed using CD-1 mice (Charles River Laboratories), excepting Stra8 knockout mice, which were congenic C57Bl/6 (Griswold Lab). Administration of exogenous RA was done as previously described (Busada et al., 2014). Briefly, neonatal mice received one subcutaneous injection of 100 μg all-trans RA (Cat# R2625, Sigma-Aldrich) dissolved in 10 μl dimethyl sulfoxide (DMSO) or DMSO alone at 1 dpp, and were euthanized by decapitation 24 h after injection (see Fig. S1A). To generate RA-deficient testes, neonatal mice received daily oral

141

treatments of 100 μg/g body weight WIN 18,446, suspended in 5 μl 1% gum tragacanth, for 4 days, beginning at birth, and were euthanized by decapitation 24 h following the final treatment. Vehicle control animals received 5 μl 1% gum tragacanth alone. Polysome gradient analysis Resolution of polysomes, ribosomal subunits, and initiation complexes was performed with 15–45% sucrose gradients by centrifugation as previously described (Chappell et al., 2013). Testis lysates from 1 dpp and 4 dpp mice, and mice treated with DMSO and RA were prepared as previously described (Chappell et al., 2013). Quantitative RT-PCR Quantitative RT-PCR analyses were performed with RNA isolated whole testis lysate and with RNA from the heavy polysome fractions (fractions 9–14). RNA was isolated from 2 dpp prospermatogonia cultured in serum-free media for 24 h in a previous study (Hogarth et al., 2011). Fifty nanogram of RNA was subjected to reverse transcription and qPCR in the same reaction tube using iScript One-Step RT-PCR kit with SYBR green (BioRad). Amplification and detection of specific gene products were performed using the iCycler IQ real-time PCR detection system. Threshold temperatures were selected automatically, and all amplifications were followed by melt-curve analysis. Primers were designed on either side of exon junctions to avoid amplification of residual genomic DNA. Sequences were as follows: Rpl19 (NM_009078, 5ʹGAAATCGCCAATGCCAACTC and 5ʹ-TCTTAGACCTGCGAGCCTCA), Stra8 (NM_009292, 5ʹ-GAGGTCAAGGAAGAATATGC and 5ʹ-CAGAGACAATAGGAAGTGTC), Kit (NM_001122733, 5ʹ-CATGGCGTTCCTCG CCT and 5ʹ-GCCCGAAATCGCAAATCTTT), and B2m (NM_009735, 5ʹ-CCGTGATCTTTCTGGTT and 5ʹ-CGTAGCAGTTCAGTATGTTCG). The following comparative quantitation equations were used to calculate relative mRNA levels for pooled polysomal fractions: mRNA Δ level ¼(2 CT), where ΔCt ¼(Ct gene of interest)  (Ct min), where Ct min ¼ the minimum Ct value within the gene set and controls. For qRT-PCR on total RNA, Ct values were normalized to either B2m (Figs. 1 and 2) or Rpl19 (Figs. 4 and S1) and relative mRNA ΔΔ quantities were calculated by the 2 Ct, with ΔCt ¼(Ct untreated gene)  (Ct treated gene). Immunoblotting Immunoblotting was performed using conventional methods. Blocking and antibody incubations were done in 1  PBST þ3% BSA. Primary antibodies used were against phospho-mTOR (1:1000, #5536, Cell Signaling Technology), phospho-EIF4EBP1 (1:1000, #2855, Cell Signaling Technology), and RPS6 (1:2000, #2217S, Cell Signaling Technology), and were incubated overnight at 4 1C. Secondary anti-rabbit-HRP (1:3000, #7074S, Cell Signaling Technology) was incubated for 1 h at room temperature. Blots were developed using LumiGlo detection reagent (Cell Signaling Technology). Indirect immunofluorescence Sections from at least 4 testes from different mice were analyzed, and experiments performed at least thrice. Immunolabeling was done using conventional methods. Briefly, testes were fixed for 2 h in 4% PFA and then washed and incubated overnight in 30% sucrose prior to freezing in O.C.T. Five micrometer sections were blocked for 30 min at room temperature and then incubated in primary antibody for 1 h at room temperature or overnight at 4 1C. Primary antibodies used were against the following: KIT (1:1000, #3074, rabbit monoclonal, Cell

142

J.T. Busada et al. / Developmental Biology 397 (2015) 140–149

Fig. 1. KIT protein levels increase during neonatal testis development. (A and B) Immunolabeling for KIT on mouse testis sections at 1 dpp (A) or 4 dpp (B). Sections were stained for KIT protein (green), phalloidin-594 was added to visualize F-Actin and outline the testis cords (red), and DAPI was added to visualize nuclei (blue). White arrows indicate KIT þ interstitial cells, and yellow arrows indicate KITþ germ cells (A and B). (C) Kit amplicons from RT-PCR using total RNA isolated from 2 dpp THY1 þ prospermatogonia (Psg), and whole testis lysate of mice aged 1 dpp and 4 dpp. MW¼ molecular weight ladder, and NT¼ no template control. (D) Kit mRNA abundance was assessed by qRT-PCR using total testis RNA from 1 and 4 dpp mice. (E) Kit mRNA abundance in heavy polysome fractions. Asterisk indicates statistical significance (P r0.01). Scale bar (in A) ¼40 μm.

Signaling Technology) KIT (1:400, #1494, goat polyclonal, Santa Cruz Biotechnology), STRA8 (1:3000, #49602, Abcam), ZBTB16/PLZF (1:500, #22839, Santa Cruz Biotechnology), FOXO1 (1:100, #2880, Cell Signaling Technology), and phospho-mTOR (1:50, #2976, Cell Signaling Technology). Primary antibody was omitted as a negative control. Following stringency washes, sections were incubated in secondary antibody (1:500, Alexa Fluor donkey anti-rabbit-488 or anti-goat-594, Invitrogen) with or without phalloidin-635 or -594 (both at 1:500, Invitrogen) for 1 h at room temperature. Blocking and antibody incubations were done in 1  PBS containing 3% BSAþ0.1% Triton X-100, and stringency washes were done with 1  PBSþ0.1% Triton X-100. Coverslips were mounted with Vectastain containing DAPI (Vector Laboratories), and images obtained using a Fluoview FV1000 confocal laser-scanning microscope (Olympus America). Testis explant cultures Testes isolated from 1 dpp neonatal mice were detunicated, cut in thirds, and washed in Krebs-Ringer Bicarbonate Buffer (SigmaAldrich). Testis pieces were cultured in hanging drops with 30 μl of DMEM/F12 (Life Technology) containing 1  penicillin–streptomycin in a humidified incubator with 5% CO2 at 37 1C. To inhibit PI3K, PDK1, or AKT, explants were pretreated for 2 h with 20 μM Ly294002 (Sigma-Aldrich), for 1 h with 15 μM GSK2334470 (Tocris Bioscience), or for 2 h with 200 μM AKT1/2 inhibitor (Abcam, 142088) followed by culture for 6 hours in DMEM/F12 plus DMSO and inhibitor or 10 μM RA and inhibitor. Controls were pretreated for 2 h with DMSO and then cultured for 6 h in DMSO or RA. Explants were then rinsed in 1  PBS and prepared for immunolabeling as described above. Statistics Statistical analyses of the qRT-PCR results were performed using the Student0 s t-test, and the level of significance was set at P r0.01.

Results KIT protein is induced in spermatogonia in the neonatal testis Cell surface expression of KIT protein is a defining feature of differentiating spermatogonia in the neonatal, pre-pubertal, and adult testis (reviewed in Mithraprabhu and Loveland, 2009). However, there have been differing reports regarding when KIT is first detectable in neonatal spermatogonia (Yoshinaga et al., 1991; Prabhu et al., 2006; Pellegrini et al., 2008). Clarification of the onset of KIT expression will help define the originating population of differentiating spermatogonia during the first wave of spermatogenesis. We detected KIT in the neonatal testis using immunolabeling on cryosections. As shown previously, KIT protein was detectable in a subset of interstitial Leydig cells and peritubular myoid cells (Rothschild et al., 2003) as well as faintly in a small subset (6.0 7 7 2.8%) of prospermatogonia in the newborn testis (Fig. 1A). By 4 dpp, prospermatogonia have transitioned to spermatogonia, and there was a dramatic increase in both the number of germ cells expressing KIT protein (38.6 7 8.3%) and the intensity of the signal in a subset of spermatogonia (Fig. 1B). Kit mRNA becomes more efficiently translated during spermatogonial development Previous studies reported the presence of Kit mRNA in undifferentiated spermatogonia without detectable KIT protein (Prabhu et al., 2006; Yang et al., 2013b). We confirmed these results and found abundant Kit mRNA in isolated 2 dpp THY1þ cell fraction enriched for prospermatogonia, as well as in whole testis lysates of both 1 dpp and 4 dpp neonatal mice (Fig. 1C). We determined that there was a
1.8-fold increase in Kit mRNA abundance in the testis from 1 to 4 dpp (Fig. 1D). This small increase in Kit mRNA was consistent with previous microarray results (Shima et al., 2004), and accompanied an approximate doubling of the germ cell

J.T. Busada et al. / Developmental Biology 397 (2015) 140–149

143

Fig. 2. RA stimulates KIT expression in spermatogonia by increasing mRNA utilization. (A and B) Immunolabeling for KIT on mouse testis sections treated at 1 dpp with DMSO (vehicle (A)) or RA (B) and euthanized 24 h later. Sections were labeled with anti-KIT (green), phalloidin-594 was added to visualize testis cords (red), and DAPI stained nuclei (blue). (C) Kit mRNA levels were assessed by qRT-PCR from DMSO- and RA-treated mice. (D) Kit mRNA abundance in heavy polysomes was assessed by qRTPCR using total testis RNA from DMSO and RA dpp mice. Scale bar (in A) ¼ 40 μm. Asterisks indicate statistical significance with P r 0.01.

population over the same interval (Chappell et al., 2013). Using qRT-PCR, we measured a 10.0-fold increase in Kit mRNA association with heavy polysomes at 4 dpp compared to 1 dpp (Fig. 1E). This robust increase in Kit mRNA translational efficiency accompanied the dramatic increase of KIT protein in spermatogonia at 4 dpp, but was only accompanied by a small increase in total Kit mRNA. Taken together, these findings indicate that Kit mRNAs underwent significant recruitment into polysomes to be translated during spermatogonia development.

examined mRNA levels in vehicle- and RA-treated testes, and found a small 1.6-fold increase in Kit mRNA levels in response to RA (Fig. 2C). We next assessed Kit message utilization in RAtreated testes by quantifying heavy polysome-bound Kit mRNA by qRT-PCR. RA stimulated 25-fold recruitment of Kit mRNA to heavy polysomes in comparison to vehicle controls (Fig. 2D). The precocious stimulation of Kit mRNA translation in response to exogenous RA resembled that affecting Kit mRNA from 1 to 4 dpp (Fig. 1F). These results suggest a novel role for RA in stimulating translation in the neonatal testis.

RA increases KIT protein expression in spermatogonia KIT and STRA8 colocalize in spermatogonia in the neonatal testis The dramatic increase in KIT protein at 4 dpp coincided with the onset of endogenous RA signaling (Zhou et al., 2008b; Snyder et al., 2010), and RA treatment of spermatogonial cell cultures increased KIT protein (Yang et al., 2013b). This suggested that RA might regulate KIT protein synthesis in a similar fashion in vivo. Therefore, we tested the hypothesis that RA stimulated Kit translation in vivo by injecting mice with either vehicle or 100 μg RA at 1 dpp, approximately 2 days before endogenous RA signaling (Fig. S1A). This in vivo model of RA-activated spermatogonial differentiation induced near-physiologic levels of Stra8 mRNA (Fig. S1B) (Busada et al., 2014) and induced STRA8 protein (Fig. S1C and D). In addition, exposure to exogenous RA for 24 h increased the germ cell population by
60% (Fig. S1E) (Busada et al., 2014). In comparison to vehicle-treated control, there was a dramatic increase in KIT protein in response to RA (Fig. 2A and B). We next

In response to RA, the population of STRA8þ spermatogonia increased dramatically from 1 to 4 dpp (Zhou et al., 2008b; Snyder et al., 2011; Busada et al., 2014). Both STRA8 and KIT are markers of differentiating/differentiated spermatogonia, and if both were upregulated in response to RA, then they should colocalize in neonatal spermatogonia. To test this, we performed co-antibody labeling against STRA8 and KIT on testis sections from mice aged 1 and 4 dpp. As shown above in Fig. 1A, KIT was faintly detectable in a very small subset of prospermatogonia at 1 dpp (Fig. 3A), similar to results for STRA8 (Fig. 3B). A subset of spermatogonia became STRA8þ at 4 dpp (Fig. 3E), and we found that 72% of these were also KITþ (Fig. 3D and F, quantitated in Fig. S2). Therefore, initial expression of KIT occurred predominantly in the subset of STRA8þ germ cells, suggesting a shared relationship to RA signaling. To further test the association of RA signaling and KIT protein expression, we performed

144

J.T. Busada et al. / Developmental Biology 397 (2015) 140–149

Fig. 3. KIT and STRA8 colocalize in neonatal germ cells. (A–I) Immunolabeling of mouse testis sections from mice aged 1 dpp (A–C) and 4 dpp (D–F) as well as on those from mice treated at 1 dpp with the vehicle (G–I) or RA (J–L) and euthanized 24 h later. Antibodies were used to detect KIT (green) and STRA8 (red), and F-actin was labeled with phalloidin (blue). Red arrows indicate representative KITþ germ cells. Green arrows indicate representative STRA8þ germ cells, and yellow arrows indicate double KIT þ / STRA8þ germ cells. Scale bar (in A)¼ 50 μm.

co-immunolabeling for STRA8 and KIT on testis sections from 1 dpp mice treated for 24 h with RA. Testes treated with vehicle contained few STRA8þ/KITþ spermatogonia (Fig. 3G and I). In contrast, treatment with RA resulted in a dramatic increase in both KITþ (Fig. 3J) and STRA8þ germ cells (Fig. 3K). Of these, 80% were STRA8þ /KITþ positive (Fig. 3L and Fig. S2). The remaining 20% of labeled cells were positive for one marker only, with 7% single KITþ and 13% single STRA8þ. KIT expression is not dependent upon STRA8 STRA8 is induced in differentiating germ cells in response to RA and is required for fertility in both sexes (Baltus et al., 2006; Koubova et al., 2006; Mark et al., 2008). However, despite years of study, the function of STRA8 in germ cell development remains unknown. Since we found KIT expression was induced by RA in STRA8þ germ cells, we asked whether stimulation of Kit mRNA translation was dependent upon STRA8 function. To address this, we injected Stra8 þ /  and Stra8  /  male pups (Anderson et al., 2008) at 1 dpp with RA and assessed KIT protein expression 24 h later. As expected, RA injection induced STRA8 þ spermatogonia in Stra8 þ /  but not Stra8  /  testes (Fig. 4A–D). In contrast, there were similar numbers of KITþ spermatogonia in testes from both Stra8 þ /  and Stra8  /  pups (Fig. 4E–H), demonstrating that RAstimulated translation of Kit mRNAs was independent of STRA8 function.

KIT is not expressed in the absence of RA signaling Next we tested the requirement for RA in KIT protein expression by blocking RA synthesis in mice at 0 dpp with WIN 18,446, an inhibitor of aldehyde dehydrogenase activity (Amory et al., 2011; Hogarth et al., 2013). Mice were then euthanized at 4 dpp, and we observed a 33% decrease in the germ cell population in response to WIN 18,446 (Fig. 5E–G). As expected, STRA8 protein and mRNA were present in spermatogonia from 4 dpp mice treated with vehicle, but absent in spermatogonia from mice treated with WIN 18,446 (Fig. 5A, B and H). Similar numbers of KITþ Leydig and peritubular myoid cells were observed in both vehicle- and WIN 18,446-treated testes (Fig. 5C and D), indicating that RA signaling did not affect KIT expression in somatic cells. However, compared to controls, WIN 18,446 treatment blocked expression of KIT protein in spermatogonia (Fig. 5C and D), confirming the requirement for RA signaling in germ cell KIT expression. Furthermore, treatment with WIN 18,446 caused a 1.6 fold reduction in Kit mRNA compared to vehicle treated testes (Fig. 5H). This reduction in Kit mRNA is consistent with the small increase in Kit mRNA observed from 1–4 dpp (Fig. 1D) and in response to RA treatment (Fig. 2C). Therefore, we found that inhibition of RA signaling resulted in loss of KIT protein expression in spermatogonia and was accompanied by only a small decrease in mRNA levels and did affect its expression in neighboring somatic cells.

J.T. Busada et al. / Developmental Biology 397 (2015) 140–149

145

Fig. 4. KIT expression is not dependent upon STRA8. Stra8 þ /  and Stra8  /  mice were injected with DMSO (A, C, E, and G) or RA (B, D, F, and H) at 1 dpp and then euthanized 24 h later. (A–H) Immunolabeling was performed to detect STRA8 (green in A, B and E, F) or KIT (green in C, D and G, H). Phalloidin-594 was used in each section to visualize outline of the testis cords (red). (A, B and E, F) As expected, STRA8 was undetectable in spermatogonia in both Stra8 þ /  (C) and Stra8  /  (E) testes from DMSOtreated mice. However, RA induced STRA8 in spermatogonia from Stra8 þ /  (B) but not Stra8  /  (F) mice. (C, D and G, H) KIT protein was undetectable in spermatogonia in both Stra8 þ /  (C) and Stra8  /  (G) testes from DMSO-treated mice. In contrast, RA induced KIT expression in both Stra8 þ /  (D) and Stra8  /  (H) testes. Scale bar (in A)¼ 30 μm.

RA activates the PI3K–AKT–mTOR signaling pathway in spermatogonia Next, we aimed to determine the mechanism by which RA stimulated the translation of Kit mRNAs during spermatogonial differentiation. PI3K–AKT–mTOR signaling is a common way by which cells regulate translation (Shimobayashi and Hall, 2014), and its activation is required for spermatogonial differentiation and entry into meiosis (Goertz et al., 2011). We adapted neonatal testis explant cultures for this purpose (Fig. 6A and B), and we can recapitulate robust STRA8 and KIT expression by 6 h (Fig. 6C and D). We tested whether RA stimulated PI3K/AKT signaling by treating explants with RA and assessing the localization of FOXO1, which becomes phosphorylated following AKT activation and relocates from the nucleus to the cytoplasm in spermatogonia (Brunet et al., 1999; Goertz et al., 2011). We found that FOXO1 was predominantly nuclear in vehicle-treated explants (Fig. 6E), but relocated to the cytoplasm in response to RA treatment (Fig. 6F). We confirmed this activation following in vivo RA treatment, and found increased levels of phospho-mTOR (Fig. S3A). Immunofluorescence labeling revealed that these changes occurred in the cytoplasm of germ cells, while the signal was not detectable in Sertoli or Leydig cells (Fig. S3B and C). To test the requirement for the PI3K–AKT signaling pathway in stimulation of KIT protein expression, we pharmacologically inhibited PI3K, PDK1 (a kinase that acts downstream of PI3K to activate AKT and other substrates), and AKT and then treated with RA for 6 h (Fig. 6B). The exclusive nuclear localization of FOXO1 following treatment with the inhibitors verified successful inhibition (Figs. 6G, H and S3D). The inhibition of PI3K, PDK1 and AKT followed by treatment with RA did not affect induction of STRA8 (Figs. 6I, J and S3E) but blocked induction of KIT (Figs. 6I, J and S3E). Taken together, these results demonstrate that RA-induced activation of the PI3K–AKT–mTOR signaling pathway is required for expression of KIT.

Discussion The newborn mouse testis contains an apparently homogenous population of quiescent prospermatogonia, which transition into type A spermatogonia after birth in the mouse. These type A spermatogonia either remain as SSCs or differentiate during the first wave of spermatogenesis. Currently, little is known about the mechanisms that control these germ cell fate decisions. However, it is known that RA is required for the differentiation of spermatogonia and their entry into meiosis (Bowles et al., 2006; Koubova et al., 2006; Bowles and Koopman, 2007; MacLean et al., 2007; de Rooij and Griswold, 2012). In this study, we examined the relationship between RA signaling and expression of the receptor tyrosine kinase KIT in differentiating spermatogonia in the neonatal testis. We found that RA induced the recruitment of Kit mRNAs into polysomes for efficient translation through activation of the PI3K–AKT–mTOR signaling pathway in differentiating spermatogonia. The results from this study provide a critical link between RA and KIT, two key determinants of spermatogonial differentiation, and demonstrate a novel mechanism by which RA regulates gene expression through translational control. There is currently a great deal of interest in determining the molecular mechanisms by which the mammalian SSC population is established after the initiation of spermatogenesis at 3–4 dpp. It is known that the undifferentiated state is maintained by signals such as glial cell-derived neurotrophic factor (GDNF), which is received from Sertoli cells by the subset of spermatogonia expressing the coreceptors GFRA1 and RET (Meng et al., 2000; Kubota et al., 2004; Naughton et al., 2006). Equally important, however, may be the avoidance of differentiation signals. The only known ligand–receptor interaction required for spermatogonial differentiation is KIT ligand (KITL) and KIT. Sertoli cells provide KITL, which is received by the subset of spermatogonia that express KIT. In this study, we show how RA directs expression of KIT protein, which provides a direct link between RA signaling and spermatogonial cell fate determination.

146

J.T. Busada et al. / Developmental Biology 397 (2015) 140–149

Fig. 5. Loss of RA signaling prevents both STRA8 and KIT expression. (A–F) Immunolabeling of mouse testis sections from 4 dpp mice treated with vehicle (A, C, and E) or WIN 18,446 (B, D, and F). Sections were incubated with antibodies for STRA8 (green in A and B), KIT (green in C and D), or ZBTB16 (green in E and F). Phalloidin-594 was added to visualize testis cords (in red), and nuclei were stained with DAPI (blue). Yellow arrows indicate KIT þ germ cells (C) and white arrows indicate KIT þ interstitial cells (B and D). (G) ZBTB16 þ cells quantitated from E and F. (H) Message levels for Stra8 and Kit were determined by qRT-PCR of RNA isolated from whole testis lysate of vehicleor WIN 18,446-treated mice. Relative mRNA quantities were compared to WIN 18,446-treated samples, which were set at 1. Asterisks indicate statistical significance at Po 0.01. Scale bar (in A)¼ 30 μm.

After 3–4 dpp, testis cords become differentially exposed to RA (Snyder et al., 2010), as shown in Fig. 7 by testis cord-specific STRA8 and KIT expression. It is not clear how specific cords avoid RA exposure, although it may be through continuous expression of the CYP26 enzymes (predominantly CYP26A1 and CYP26B1), which protect prospermatogonia from RA in the fetal testis (Bowles et al., 2006; Koubova et al., 2006; MacLean et al., 2007). The presence of an RA-free environment is likely to be a critical facilitator or determinant of SSC development. KIT is essential for the spermatogonia transition from mitosis to meiosis (Kissel et al., 2000), and KIT expression provides a hallmark to identify differentiated (KITþ) spermatogonia. However, it is currently unclear what regulatory steps direct the expression of this critical differentiation signal. It has been established that Kit mRNA is present in the neonatal testis and in undifferentiated spermatogonia without detectable protein (Schrans-Stassen et al., 1999; Koubova et al., 2006; Oatley and Brinster, 2006; Prabhu et al., 2006; Grasso et al., 2012; Yang et al., 2013b), and our results here support those findings. It is curious

that prospermatogonia and undifferentiated spermatogonia transcribe the Kit gene, only to prevent translation of resulting mRNAs. Importantly, KIT protein regulates survival, proliferation, and migration (reviewed in Mauduit et al., 1999) of male germ cells before (primordial germ cells, or PGCs) and after (differentiated spermatogonia) those in which it is repressed (prospermatogonia and undifferentiated spermatogonia) (Mithraprabhu and Loveland, 2009). It is possible that germ cells lack the requisite controls to alternatively activate Kit transcription in PGCs, repress it for
1 week in prospermatogonia and undifferentiated spermatogonia, and then reactivate it in differentiating spermatogonia. A mechanism has been proposed for the repression of Kit transcription in spermatogonia from 7 dpp mice through an interaction of ZBTB16/PLZF with the Kit promoter (Filipponi et al., 2007; Hobbs et al., 2010). However, this is unlikely to repress Kit in the neonatal testis in vivo, as both molecules are co-expressed in spermatogonia through at least 6 dpp (Busada et al., 2014). In the adult testis, it was recently shown that, in seminiferous tubule sections cultured in the presence of GDNF, Kit mRNA levels

J.T. Busada et al. / Developmental Biology 397 (2015) 140–149

147

Fig. 6. RA signals through PI3K–AKT to stimulate Kit translation. (A) Model of ex vivo testis cultures. Testes are removed from 1 dpp mice cut into pieces and cultured in hanging drops in the presence of the vehicle or RA. (B) Ex vivo testis cultures are pre-treated for 2 h with inhibitors for either PI3K or AKT followed by treatment with vehicle or RA ( þ) the inhibitor for 6 h. (C–F) Immunolabeling was performed on testes cultured with the vehicle or RA for 6 h. Sections were stained for KIT (green, C and D) and STRA8 (red, C and D) or for FOXO1 (green, E and F). Phalloidin was added to visualize testis cords (blue in C, D, and red in E, F). (G–J) Testis cultures were pretreated with inhibitors of PI3K (G and I) or AKT (H and J) for 2 h followed by co-culture with the vehicle or RA and inhibitor for 6 h. Immunolabeling was performed on testis sections stained for FOXO1 (green G and H) or KIT (green, I and J) and STRA8 (red, I and J). Phalloidin was added to visualize testis cords (blue in G, H, and red in Im J). Scale bar (in C)¼ 40 μm.

increased during specific stages II–V but did not result in KIT protein (Grasso et al., 2012). Interestingly, it is inferred from mRNA localization studies that these stages have low levels of endogenous RA exposure (Vernet et al., 2006; Sugimoto et al., 2012). KIT protein is then detectable in stages VII–VIII as spermatogonia differentiate from Aal–A1 (Oakberg, 1971; Schrans-Stassen et al., 1999). Given the results from this current study, it seems likely that the same mechanism of RA-induced translational control is at work in the adult testis in a stage-specific manner, coinciding with hypothesized cyclical changes in RA levels (Hogarth and Griswold, 2013). RA-stimulated KIT protein expression in a subset of cultured undifferentiated spermatogonia was recently shown to involve the microRNAs miR-221/222 (Yang et al., 2013b). We saw a much more robust response in vivo, which may be due in part to the addition of growth factors to the culture medium such as GDNF and bFGF in that study; both factors maintain spermatogonial stem cells (SSCs) in an undifferentiated state (Kubota et al., 2004), and may oppose endogenous mechanisms regulating normal KIT expression, including the upregulation of miR221/222 (Yang et al., 2013b). While it is likely that repression of Kit translation is regulated in part by miRNAs in vivo, they are unlikely to be the primary mechanism, as evidenced by the observation that spermatogonial stem cell renewal and mitotic proliferation appear unaffected in the miRNA-lacking Dicer1-null mice (Romero et al., 2011), which would not be expected if KIT expression was largely misregulated. It has been known for a long time that mRNAs are not all translated with equivalent efficiency (Lodish 1976); those that recruit

more ribosomes (polyribosomes, or polysomes) will be more efficiently translated, while those that lack ribosomes will not produce protein. A recent study reported that mRNA translational efficiency is likely a more accurate predictor of the proteome than mRNA levels (Schwanhausser et al. 2011). In accordance with this, we recently identified a large number of mRNAs that undergo recruitment to polysomes without significant changes in abundance during neonatal germ cell development (Chappell et al. 2013). This suggests that the initial differentiation of neonatal mammalian male germ cells may be regulated in large part by translational control. The most well studied action of RA is genomic, in which transcription is directed through RA receptors (RARs) bound to RA response elements (RAREs) present in the promoters of target genes such as Stra8 (Bowles and Koopman, 2007) (Fig. 7B). However, relatively modest changes in the transcriptome after RA exposure (Shima et al., 2004; Zhou et al., 2008a) suggests other avenues of RA-based regulation may be utilized in the neonatal testis. It has become clear that there are also non-genomic consequences of signaling downstream of RA (reviewed in Al Tanoury et al., 2013), as with other hormone–receptor interactions, examples of which involve signaling through the estrogen receptor (ER) (Levin, 2014), androgen receptor (AR) (Walker, 2003), and glucocorticoid receptor (GR) (Revollo and Cidlowski, 2009). RAR alpha (RARA) was shown in several cell types (SH-SY5Y, NIH3T3, and MEFs) to be bound to the regulatory subunit (p85) of PI3K; addition of RA recruited the catalytic subunit (p110) to induce rapid phosphorylation of ERK and AKT (Lopez-Carballo et al., 2002; Masia et al., 2007). We provide compelling evidence here that

148

J.T. Busada et al. / Developmental Biology 397 (2015) 140–149

Fig. 7. RA may signal spermatogonia differentiation by activating both genomic and non-genomic pathways. (A) Co-immunolabeling was performed for STRA8 (red) and KIT (green) in 4 dpp testes, and phalloidin was added to visualize testis cords (blue). Cords exposed to RA (as indicated by STRA8 þ/KIT þ spermatogonia) are circled in yellow, and those not exposed are encircled in white. (B) A testis cord, such as the ones shown in A, is depicted in longitudinal form. Regional exposure to RA would result in the differentiation of subpopulations of spermatogonia (yellow bands), while the other areas of the cord are unexposed so that those spermatogonia remain undifferentiated (white band). (C) Diagram of the canonical genomic RA signaling pathway, in which RA regulates transcription by binding to retinoic acid receptors (RAR) at retinoic acid response elements (RARE) in the promoter of target genes such as Stra8. (D) In the proposed alternative non-genomic pathway, RA regulates translation by binding to RARs, which activate the PI3K–AKT–mTOR signaling cascade to stimulate translation of mRNAs such as Kit.

RA-induced activation of PI3K/AKT signaling is required for translational control leading to production of KIT protein (Fig. 7D). The PI3K/ AKT signaling network is complex, and has been shown to be involved in both self-renewal of SSCs downstream of GDNF (Lee et al., 2007) as well as in spermatogonial differentiation downstream of KIT (Kissel et al. 2000). PI3K signaling is also required to maintain mouse embryonic stem cells (mESCs) in an undifferentiated state. However, our data suggest that RA activates the mTOR signaling axis, which regulates translation and was not shown to regulate pluripotency in mESCs (Watanabe et al., 2006). Together, this reveals that the PI3K– AKT signaling network interprets a variety of signals to direct multiple different cell fate decisions. Our results reveal an important link between a nearly ubiquitous morphogen (RA) and a molecule (KIT) that is essential for directing spermatogonial differentiation. We identify a novel mechanism by which RA regulates gene expression in the neonatal testis, and this discovery significantly advances our understanding of the molecular mechanisms controlling spermatogonia differentiation.

Author's contributions The experiments were performed by J.T.B., V.A.C., B.A.N., E.P.K., and C.A.H. B.D.K. assisted with data analysis. C.B.G. and J.T.B planned the experiments and wrote the manuscript.

Acknowledgments The authors thank Joani Zary-Oswald for technical assistance. The Stra8  /  mouse line was kindly provided by Dr. David Page (Whitehead Institute, MIT). This work was supported by a Grant from the National Institutes of Health, USA (HD072552) to C.B.G.

Appendix A. Supplementary materials Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.ydbio.2014.10.020.

References Al Tanoury, Z., Piskunov, A., Rochette-Egly, C., 2013. Vitamin A and retinoid signaling: genomic and nongenomic effects. J. Lipid Res. 54, 1761–1775. Amory, J.K., Muller, C.H., Shimshoni, J.A., Isoherranen, N., Paik, J., Moreb, J.S., Amory Sr, D.W., Evanoff, R., Goldstein, A.S., Griswold, M.D., 2011. Suppression of spermatogenesis by bisdichloroacetyldiamines is mediated by inhibition of testicular retinoic acid biosynthesis. J. Androl. 32, 111–119. Anderson, E.L., Baltus, A.E., Roepers-Gajadien, H.L., Hassold, T.J., de Rooij, D.G., van Pelt, A.M., Page, D.C., 2008. Stra8 and its inducer, retinoic acid, regulate meiotic initiation in both spermatogenesis and oogenesis in mice. Proc. Natl. Acad. Sci. USA 105, 14976–14980. Arava, Y., 2003. Isolation of polysomal RNA for microarray analysis. Methods Mol. Biol. 224, 79–87. Baltus, A.E., Menke, D.B., Hu, Y.C., Goodheart, M.L., Carpenter, A.E., de Rooij, D.G., Page, D.C., 2006. In germ cells of mouse embryonic ovaries, the decision to enter meiosis precedes premeiotic DNA replication. Nat. Genet. 38, 1430–1434. Bashamboo, A., Taylor, A.H., Samuel, K., Panthier, J.J., Whetton, A.D., Forrester, L.M., 2006. The survival of differentiating embryonic stem cells is dependent on the SCF-KIT pathway. J. Cell Sci. 119, 3039–3046. Besmer, P., Manova, K., Duttlinger, R., Huang, E.J., Packer, A., Gyssler, C., Bachvarova, R.F., 1993. The kit-ligand (steel factor) and its receptor c-kit/W: pleiotropic roles in gametogenesis and melanogenesis. Dev. Suppl., 125–137. Blume-Jensen, P., Jiang, G., Hyman, R., Lee, K.F., O0 Gorman, S., Hunter, T., 2000. Kit/ stem cell factor receptor-induced activation of phosphatidylinositol 3'-kinase is essential for male fertility. Nat. Genet. 24, 157–162. Bowles, J., Knight, D., Smith, C., Wilhelm, D., Richman, J., Mamiya, S., Yashiro, K., Chawengsaksophak, K., Wilson, M.J., Rossant, J., et al., 2006. Retinoid signaling determines germ cell fate in mice. Science 312, 596–600. Bowles, J., Koopman, P., 2007. Retinoic acid, meiosis and germ cell fate in mammals. Development 134, 3401–3411. Brunet, A., Bonni, A., Zigmond, M.J., Lin, M.Z., Juo, P., Hu, L.S., Anderson, M.J., Arden, K.C., Blenis, J., Greenberg, M.E., 1999. Akt promotes cell survival by phosphorylating and inhibiting a Forkhead transcription factor. Cell 96, 857–868.

J.T. Busada et al. / Developmental Biology 397 (2015) 140–149

Busada, J.T., Kaye, E.P., Renegar, R.H., Geyer, C.B., 2014. Retinoic acid induces multiple hallmarks of the prospermatogonia-to-spermatogonia transition in the neonatal mouse. Biol. Reprod. 90, 64. Chappell, V.A., Busada, J.T., Keiper, B.D., Geyer, C.B., 2013. Translational activation of developmental messenger RNAs during neonatal mouse testis development. Biol. Reprod. 89, 61. de Rooij, D.G., Griswold, M.D., 2012. Questions about spermatogonia posed and answered since 2000. J. Androl. 33, 1085–1095. de Rooij, D.G., Russell, L.D., 2000. All you wanted to know about spermatogonia but were afraid to ask. J. Androl. 21, 776–798. Edling, C.E., Hallberg, B., 2007. c-Kit–a hematopoietic cell essential receptor tyrosine kinase. Int. J. Biochem. Cell Biol. 39, 1995–1998. Filipponi, D., Hobbs, R.M., Ottolenghi, S., Rossi, P., Jannini, E.A., Pandolfi, P.P., Dolci, S., 2007. Repression of kit expression by Plzf in germ cells. Mol. Cell. Biol. 27, 6770–6781. Gaemers, I.C., Sonneveld, E., van Pelt, A.M., Schrans, B.H., Themmen, A.P., van der Saag, P.T., de Rooij, D.G., 1998. The effect of 9-cis-retinoic acid on proliferation and differentiation of a spermatogonia and retinoid receptor gene expression in the vitamin A-deficient mouse testis. Endocrinology 139, 4269–4276. Goertz, M.J., Wu, Z., Gallardo, T.D., Hamra, F.K., Castrillon, D.H., 2011. Foxo1 is required in mouse spermatogonial stem cells for their maintenance and the initiation of spermatogenesis. J. Clini. Invest. 121, 3456–3466. Grasso, M., Fuso, A., Dovere, L., de Rooij, D.G., Stefanini, M., Boitani, C., Vicini, E., 2012. Distribution of GFRA1-expressing spermatogonia in adult mouse testis. Reproduction 143, 325–332. Hobbs, R.M., Seandel, M., Falciatori, I., Rafii, S., Pandolfi, P.P., 2010. Plzf regulates germline progenitor self-renewal by opposing mTORC1. Cell 142, 468–479. Hogarth, C.A., Evanoff, R., Mitchell, D., Kent, T., Small, C., Amory, J.K., Griswold, M.D., 2013. Turning a spermatogenic wave into a tsunami: synchronizing murine spermatogenesis using WIN 18,446. Biol. Reprod. 88, 40. Hogarth, C.A., Evanoff, R., Snyder, E., Kent, T., Mitchell, D., Small, C., Amory, J.K., Griswold, M.D., 2011. Suppression of Stra8 expression in the mouse gonad by WIN 18,446. Biol. Reprod. 84, 957–965. Hogarth, C.A., Griswold, M.D., 2013. Retinoic acid regulation of male meiosis. Curr. Opin. Endocrinol. Diabetes Obes. 20, 217–223. Kissel, H., Timokhina, I., Hardy, M.P., Rothschild, G., Tajima, Y., Soares, V., Angeles, M., Whitlow, S.R., Manova, K., Besmer, P., 2000. Point mutation in kit receptor tyrosine kinase reveals essential roles for kit signaling in spermatogenesis and oogenesis without affecting other kit responses. EMBO J. 19, 1312–1326. Koshimizu, U., Watanabe, M., Nakatsuji, N., 1995. Retinoic acid is a potent growth activator of mouse primordial germ cells in vitro. Dev. Biol. 168, 683–685. Koubova, J., Menke, D.B., Zhou, Q., Capel, B., Griswold, M.D., Page, D.C., 2006. Retinoic acid regulates sex-specific timing of meiotic initiation in mice. Proc. Natl. Acad. Sci. USA 103, 2474–2479. Kubota, H., Avarbock, M.R., Brinster, R.L., 2004. Growth factors essential for selfrenewal and expansion of mouse spermatogonial stem cells. Proc. Natl. Acad. Sci. USA 101, 16489–16494. Lee, J., Kanatsu-Shinohara, M., Inoue, K., Ogonuki, N., Miki, H., Toyokuni, S., Kimura, T., Nakano, T., Ogura, A., Shinohara, T., 2007. Akt mediates self-renewal division of mouse spermatogonial stem cells. Development 134, 1853–1859. Levin, E.R., 2014. Extranuclear estrogen receptor's roles in physiology: lessons from mouse models. Am. J. Physiol. Endocrinol. Metabol. 307, E133–E140. Lodish, H.F., 1976. Translational control of protein synthesis. Annu. Rev. Biochem. 45, 39–72. Lopez-Carballo, G., Moreno, L., Masia, S., Perez, P., Barettino, D., 2002. Activation of the phosphatidylinositol 3-kinase/Akt signaling pathway by retinoic acid is required for neural differentiation of SH-SY5Y human neuroblastoma cells. J. Biol. Chem. 277, 25297–25304. Loveland, K.L., Schlatt, S., 1997. Stem cell factor and c-kit in the mammalian testis: lessons originating from Mother Nature's gene knockouts. J. Endocrinol. 153, 337–344. MacLean, G., Li, H., Metzger, D., Chambon, P., Petkovich, M., 2007. Apoptotic extinction of germ cells in testes of Cyp26b1 knockout mice. Endocrinology 148, 4560–4567. Mark, M., Jacobs, H., Oulad-Abdelghani, M., Dennefeld, C., Feret, B., Vernet, N., Codreanu, C.A., Chambon, P., Ghyselinck, N.B., 2008. STRA8-deficient spermatocytes initiate, but fail to complete, meiosis and undergo premature chromosome condensation. J. Cell Sci. 121, 3233–3242. Masia, S., Alvarez, S., de Lera, A.R., Barettino, D., 2007. Rapid, nongenomic actions of retinoic acid on phosphatidylinositol-3-kinase signaling pathway mediated by the retinoic acid receptor. Mol. Endocrinol. 21, 2391–2402. Mauduit, C., Hamamah, S., Benahmed, M., 1999. Stem cell factor/c-kit system in spermatogenesis. Hum. Reprod. Update 5, 535–545. Meng, X., Lindahl, M., Hyvonen, M.E., Parvinen, M., de Rooij, D.G., Hess, M.W., Raatikainen-Ahokas, A., Sainio, K., Rauvala, H., Lakso, M., et al., 2000. Regulation of cell fate decision of undifferentiated spermatogonia by GDNF. Science 287, 1489–1493. Mithraprabhu, S., Loveland, K.L., 2009. Control of KIT signalling in male germ cells: what can we learn from other systems? Reproduction 138, 743–757.

149

Naughton, C.K., Jain, S., Strickland, A.M., Gupta, A., Milbrandt, J., 2006. Glial cell-line derived neurotrophic factor-mediated RET signaling regulates spermatogonial stem cell fate. Biol. Reprod. 74, 314–321. Oakberg, E.F., 1971. Spermatogonial stem-cell renewal in the mouse. Anat. Rec. 169, 515–531. Oatley, J.M., Brinster, R.L., 2006. Spermatogonial stem cells. Methods Enzymol. 419, 259–282. Oatley, J.M., Brinster, R.L., 2012. The germline stem cell niche unit in mammalian testes. Physiol. Rev. 92, 577–595. Oatley, J.M., Oatley, M.J., Avarbock, M.R., Tobias, J.W., Brinster, R.L., 2009. Colony stimulating factor 1 is an extrinsic stimulator of mouse spermatogonial stem cell self-renewal. Development 136, 1191–1199. Pellegrini, M., Filipponi, D., Gori, M., Barrios, F., Lolicato, F., Grimaldi, P., Rossi, P., Jannini, E.A., Geremia, R., Dolci, S., 2008. ATRA and KL promote differentiation toward the meiotic program of male germ cells. Cell Cycle 7, 3878–3888. Prabhu, S.M., Meistrich, M.L., McLaughlin, E.A., Roman, S.D., Warne, S., Mendis, S., Itman, C., Loveland, K.L., 2006. Expression of c-Kit receptor mRNA and protein in the developing, adult and irradiated rodent testis. Reproduction 131, 489–499. Raverdeau, M., Gely-Pernot, A., Feret, B., Dennefeld, C., Benoit, G., Davidson, I., Chambon, P., Mark, M., Ghyselinck, N.B., 2012. Retinoic acid induces Sertoli cell paracrine signals for spermatogonia differentiation but cell autonomously drives spermatocyte meiosis. Proc. Natl. Acad. Sci. USA 109, 16582–16587. Revollo, J.R., Cidlowski, J.A., 2009. Mechanisms generating diversity in glucocorticoid receptor signaling. Ann. N. Y. Acad. Sci. 1179, 167–178. Romero, Y., Meikar, O., Papaioannou, M.D., Conne, B., Grey, C., Weier, M., Pralong, F., De Massy, B., Kaessmann, H., Vassalli, J.D., et al., 2011. Dicer1 depletion in male germ cells leads to infertility due to cumulative meiotic and spermiogenic defects. PLoS One 6, e25241. Rothschild, G., Sottas, C.M., Kissel, H., Agosti, V., Manova, K., Hardy, M.P., Besmer, P., 2003. A role for kit receptor signaling in Leydig cell steroidogenesis. Biol. Reprod. 69, 925–932. Schrans-Stassen, B.H., van de Kant, H.J., de Rooij, D.G., van Pelt, A.M., 1999. Differential expression of c-kit in mouse undifferentiated and differentiating type A spermatogonia. Endocrinology 140, 5894–5900. Schwanhausser, B., Busse, D., Li, N., Dittmar, G., Schuchhardt, J., Wolf, J., Chen, W., Selbach, M., 2011. Global quantification of mammalian gene expression control. Nature 473, 337–342. Shima, J.E., McLean, D.J., McCarrey, J.R., Griswold, M.D., 2004. The murine testicular transcriptome: characterizing gene expression in the testis during the progression of spermatogenesis. Biol. Reprod. 71, 319–330. Shimobayashi, M., Hall, M.N., 2014. Making new contacts: the mTOR network in metabolism and signalling crosstalk. Nat. Rev. Mol. Cell Biol. 15, 155–162. Snyder, E.M., Davis, J.C., Zhou, Q., Evanoff, R., Griswold, M.D., 2011. Exposure to retinoic acid in the neonatal but not adult mouse results in synchronous spermatogenesis. Biol. Reprod. 84, 886–893. Snyder, E.M., Small, C., Griswold, M.D., 2010. Retinoic acid availability drives the asynchronous initiation of spermatogonial differentiation in the mouse. Biol. Reprod. 83, 783–790. Sugimoto, R., Nabeshima, Y., Yoshida, S., 2012. Retinoic acid metabolism links the periodical differentiation of germ cells with the cycle of Sertoli cells in mouse seminiferous epithelium. Mech. Dev. 128, 610–624. Vernet, N., Dennefeld, C., Guillou, F., Chambon, P., Ghyselinck, N.B., Mark, M., 2006. Prepubertal testis development relies on retinoic acid but not rexinoid receptors in Sertoli cells. EMBO J. 25, 5816–5825. Walker, W.H., 2003. Nongenomic actions of androgen in Sertoli cells. Curr. Top. Dev. Biol. 56, 25–53. Watanabe, S., Umehara, H., Murayama, K., Okabe, M., Kimura, T., Nakano, T., 2006. Activation of Akt signaling is sufficient to maintain pluripotency in mouse and primate embryonic stem cells. Oncogene 25, 2697–2707. Yang, Q.E., Kim, D., Kaucher, A., Oatley, M.J., Oatley, J.M., 2013a. CXCL12–CXCR4 signaling is required for the maintenance of mouse spermatogonial stem cells. J. Cell Sci. 126, 1009–1020. Yang, Q.E., Racicot, K.E., Kaucher, A.V., Oatley, M.J., Oatley, J.M., 2013b. MicroRNAs 221 and 222 regulate the undifferentiated state in mammalian male germ cells. Development 140, 280–290. Yoshida, S., 2012. Elucidating the identity and behavior of spermatogenic stem cells in the mouse testis. Reproduction 144, 293–302. Yoshinaga, K., Nishikawa, S., Ogawa, M., Hayashi, S., Kunisada, T., Fujimoto, T., 1991. Role of c-kit in mouse spermatogenesis: identification of spermatogonia as a specific site of c-kit expression and function. Development 113, 689–699. Zhou, Q., Li, Y., Nie, R., Friel, P., Mitchell, D., Evanoff, R.M., Pouchnik, D., Banasik, B., McCarrey, J.R., Small, C., et al., 2008a. Expression of stimulated by retinoic acid gene 8 (Stra8) and maturation of murine gonocytes and spermatogonia induced by retinoic acid in vitro. Biol. Reprod. 78, 537–545. Zhou, Q., Nie, R., Li, Y., Friel, P., Mitchell, D., Hess, R.A., Small, C., Griswold, M.D., 2008b. Expression of stimulated by retinoic acid gene 8 (Stra8) in spermatogenic cells induced by retinoic acid: an in vivo study in vitamin A-sufficient postnatal murine testes. Biol. Reprod. 79, 35–42.