Retinoids interfere with the AP1 signalling pathway in human breast cancer cells

Cellular Signalling 18 (2006) 889 – 898 www.elsevier.com/locate/cellsig

Retinoids interfere with the AP1 signalling pathway in human breast cancer cells Stephane Dedieu *, Philippe Lefebvre 1 INSERM U459, ‘‘Equipe labellise´e par la Ligue Nationale contre le Cancer’’, Faculte´ de Me´decine Henri Warembourg, 1 Place de Verdun, F-59045 Lille Cedex, France Received 8 July 2005; received in revised form 1 August 2005; accepted 2 August 2005 Available online 19 September 2005

Abstract Retinoic acid and its synthetic analogs exert major effects on many biological processes including cell proliferation and differentiation and are now considered as promising pharmacological agents for prevention and treatment of various cancers. The capacity of retinoids to inhibit AP1-responsive genes seems to be the basis for the chemopreventive and chemotherapeutic effects of these agents against hyperproliferative diseases. However, the molecular basis of retinoid antiproliferative properties remains to this day largely unknown. Here, we showed that retinoids inhibit phorbol ester-induced MMP-1 and MMP-3 expression in human breast cancer cells. Transcriptional interference was observed for both retinoid agonist and antagonist treatments, revealing separated transactivation and transrepression functions of retinoids. In addition, we examined MAP kinases as potential targets of retinoid signalling in human breast cancer cells and demonstrated that retinoids repress AP1-responsive gene expression by inhibiting MKK6/p38 and mainly MEK/ERK signalling pathways. On the contrary, the JNKdependent pathway was not identified as a molecular relay for AP1 activity and was insensitive to retinoid treatments. Finally, we established that overexpressed c-fos and c-jun partially abolished the ability of retinoids to inhibit AP1 activity, suggesting that c-jun and/or c-fos containing dimers may constitute one target of retinoids for transrepression of AP1. All together, our data help to improve our understanding of how retinoids antagonize AP1 activity and may regulate tumoral cell proliferation. D 2005 Elsevier Inc. All rights reserved. Keywords: AP1; Transrepression; Retinoid; Signalling; MEK/ERK; p38 MAP kinase

1. Introduction Retinoids are natural and synthetic substances that regulate many important biological processes, including vision, morphogenesis, differentiation, growth and metabolism. They are now considered as promising agents for prevention and treatment of various cancers through their capacity to suppress cell growth or to stimulate apoptosis of various tumor cells [1]. Retinoids exert their biological activities by binding to nuclear retinoic acid receptors

* Corresponding author. Present address: Laboratoire de Biochimie, UMR CNRS 6198, Moulin de la Housse, B.P. 1039, 51687 Reims Cedex 2, France. Tel.: +33 3 2691 3269; fax: +33 3 2691 8366. E-mail addresses: [email protected] (S. Dedieu), [email protected] (P. Lefebvre). 1 Tel.: +33 3 2062 6876; fax: +33 3 2062 6884. 0898-6568/$ - see front matter D 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.cellsig.2005.08.001

(RARs) and retinoid X receptors (RXRs) that belong to the hormone nuclear receptor superfamily. Retinoids modulate gene expression by two different ways. First, RAR and RXR may form heterodimers and bind to retinoic acid response elements (RARE) to transactivate target genes. Secondly, RARs were also reported to act as transrepressive factors and negatively affect proliferation-associated genes via their ability to functionally interact with transcriptional factor AP1 [2,3]. The AP1 transcription complex consists of homodimers and heterodimers of members from the fos (c-fos, fosB, fra-1 and fra-2) and jun (c-jun, junB and junD) families and activates target genes by binding with high affinity to particular DNA cis-element, the 12-O-tetradecanoylphorbol13-acetate (TPA) response elements (TRE) [4]. The regulation of AP1 activity is complex and occurs at different levels. First, recent data supported the hypothesis of the

890

S. Dedieu, P. Lefebvre / Cellular Signalling 18 (2006) 889 – 898

modulation of AP1 activity through differential expression of individual members from jun and fos families [5,6]. Secondly, AP1 activity is regulated at transcriptional and post-translational levels by several external stimuli mainly involving mitogen-activated protein kinase (MAPK) cascades. Extracellular-signal-regulated kinases (ERKs) phosphorylate ternary complex factors (TCFs) that stimulate c-fos expression through serum response elements (SREs) and subsequently c-jun gene expression [7]. In a recent study, the authors provided evidence for the existence of a TCFindependent c-fos induction through ERK pathway [8]. Posttranslational modifications of c-jun on Ser-63/73 residues through c-jun N-terminal kinase (JNK)-dependent phosphorylations are directly responsible for stimulating the transactivation function of c-jun [9]. Although Minden et al. [10] have indicated that neither ERK1 nor ERK2 phosphorylate these residues but instead phosphorylate one of the inhibitory sites of c-jun located near the DNA binding domain, a more recent paper has interestingly reported an ERK-dependent phosphorylation of c-jun on several sites including Ser-63/73 [11]. Furthermore, p38 MAPKs were reported to activate substrates such as ATF-2, MEF-2 or Elk-1 and to cooperate with the ERK signalling module to activate TCFs and c-fos transcription, notably in response to U.V. light [12,13]. Moreover, glycogen-synthase-kinase-3h and ribosomal S6 kinase 2 are capable of phosphorylating both fos and jun proteins, thus regulating their DNA-binding activity and transactivation potential [14]. The capacity of retinoids to inhibit AP1-responsive genes seems to be the basis for the chemopreventive and chemotherapeutic effects of these agents against hyperproliferative diseases. Previous studies suggested several possible mechanisms for AP1 inhibition by retinoid receptors. It was suggested that the RAR/AP1 mutual antagonism could depend on competition for a common coactivator such as CBP or p300 [15]. Subsequently, it was proposed that RAR may prevent c-jun phosphorylation on Ser-63/73 and concomitantly AP1 activation by blocking JNK phosphorylation and activity [16 – 18]. The ability of retinoids to alter JNK signalling seems to involve an increased expression of MAPkinase phosphatase-1 (MKP-1) [18 – 20]. Besides, others have reported that DNA binding domain of the RAR is required for the anti-AP1 properties [21,22]. However, each of the previously quoted hypothesis to explain the mechanisms by which retinoids antagonize AP1 activity remains to this day widely discussed and debated [23,24]. Here, we report the characterization of AP1 activation and transrepression processes and investigated the mechanisms whereby retinoid acid receptors repress AP1 activity in human breast cancer cells. Our investigation provides additional insight on the nature of the signal cascades activated in breast cancer cells and revealed that p38 and especially MEK/ERK pathways regulate AP1 responsive genes and are sensitive to retinoid treatment. In addition, we suggest that only c-fos and/or c-jun-containing dimers may constitute one important target of atRA for transrepression of AP1.

2. Materials and methods 2.1. Retinoids and chemicals All-trans-retinoic acid (atRA) and 12-O-tetradecanoylphorbol-13-acetate (TPA) were purchased from Sigma. RAR agonists (Am580, TTNN, CD666 and TTNPB), RAR antagonists (CD2665, CD3106) and the dissociated anti-AP1 ligand CD2409 were kindly provided by U. Reichert (CIRD-Galderma). Go¨6983 (PKCs inhibitor), PD98059 and U0126 (selective inhibitors of MEK-1/-2), SB230580 (p38 MAPKs specific inhibitor), SP600125 (specific inhibitor of JNK-1/2), Wortmmanin and LY294002 (phosphatidylinositol 3-kinase inhibitors) were purchased from Calbiochem. All these compounds were dissolved in dimethyl sulfoxide (DMSO) and used at concentrations for which no obvious cytotoxicity was observed. Media containing pharmacological agents were replaced every 24 h. All other chemicals were from Sigma. 2.2. Cell culture and transfection Human breast cancer cell lines MCF-7 were maintained in Dubelcco’s modified Eagle medium (Glutamax-1, GibcoBRL) plus 10% fetal bovine serum under 5% CO2 atmosphere at 37 -C. Plasmids were transiently transfected using an optimized Lipofectamine-2000 procedure (Invitrogen Life Technologies) and luciferase assays were performed using the Bright-Glo Luciferase Assay System from Promega. The relative luciferase activity was measured with a LumiCount plate reader (Packard). Data were normalized on the basis of beta-galactosidase activity (Galacto-Star system, Applied Biosystems) and cell viability was determined using the CellTiter-Glo luminescent cell viability assay (Promega). 2.3. Plasmids ColA-luc and Strm1-luc containing the 5V upstream sequence of collagenase-1 (MMP-1) and stromelysin-1 (MMP-3), respectively, were gifts from K.R. Yamamoto (UCSF, CA) and P. Aumercier (IBL, Lille). The AP1tk-uc containing four repeats of the consensus AP1 site upstream of the thymidine kinase promoter and the AP1(mut)tk-luc were described previously [23]. Constitutively active MEK1 (HA-tagged), pcDNA3-FLAG-MKK6, wild-type MKK7 and JNK1 (FLAG-tagged) vectors were generous gifts from R. Davis (HHMI, University of Massachusetts Medical School). Constitutively active ERK-2 (HA-tagged) and wild-type Akt were from N.G. Ahn (HHMI, University of Colorado) and M. Greenberg (Harvard Medical School, Boston). The kinase-dead forms of Akt (HA-tagged), MEK1 and JNK1 (HA-tagged) were from J.R. Testa (Fox Chase Cancer Center, PA), R. Davis and J.M. Blanchard (IGM, CNRS Montpellier), respectively. The FLAG-tagged dominant negative forms of human p38a, p38h and p38g were

S. Dedieu, P. Lefebvre / Cellular Signalling 18 (2006) 889 – 898

kindly provided by J. Han (The Scripps Research Institute, CA). pRSV-fra-1, pRSV-fra-2, pRSV-fosB were provided by M. Yaniv (Institut Pasteur, Paris), pRSV-junB and pRSVjunD were gifts from M. Nemer (IRCM, Canada), pBK-cfos from I. Verma (Salk Institute, CA) and pSG5-c-jun from B. Wasylyk (IGBMC, Illkirch). 2.4. Western analysis Whole-cell lysates were prepared as follows: cells were scraped in ice-cold lysis buffer (25 mM Tris pH 7.8, 2 mM DTT, 5 mM EGTA, 1 mM PMSF, 0.5% Triton X-100), sonicated and clarified by centrifugation at 13,000g for 15 min. Proteins were separated by electrophoresis on a dodecyl-sulfate-polyacrylamide gel, transferred to nitrocellulose membrane (Amersham Biosciences) and Western-blotted overnight at 4 -C with primary antibodies. Antic-jun (sc-45), junB (sc-74), junD (sc-8059), c-fos (sc-52), fosB (sc-48), fra1 (sc-605), fra2 (sc-177), JNK (sc-474), MEK (sc-436) and anti-FLAG (sc-807) were purchased from Santa-Cruz Biotechnology. Antibodies that recognize p38 MAP kinases (9212) and Akt (9272) were purchased from Cell Signaling Technology. The anti-HA antibody was purchased from Roche Diagnostics. Corresponding peroxidase-coupled antibodies were obtained from Sigma and binding was detected by using chemiluminescence kit from Pierce. h-actin was used as an internal control (the antibody was from Sigma) and each membrane was stained for total protein to ensure equal loading of each well. 2.5. IP kinase assays The amount of activated ERK-1/-2, JNK-1/-2 and p38 MAP kinases was determined by immunoprecipitation (IP)kinase assays with kits purchased from Cell Signal Technologies. Briefly, total cell lysates was prepared under nondenaturing conditions and equal amounts of total protein were used per sample. Active phosphorylated ERK-1/-2 and p38 kinases were selectively immunoprecipitated from cell lysates using immobilized, dual phospho-specific monoclonal antibodies. JNK/SAPK activity was selectively precipitated from cell lysates using c-jun fusion protein glutathione – sepharose beads. Precipitated kinases were then allowed to phosphorylate their major substrate proteins (Elk-1 for ERK1/-2, ATF-2 for p38, and c-jun for JNK/SAPK) in a kinase reaction performed in the presence of ATP. Phosphorylation of substrate proteins was assessed by immunoblot using the corresponding phospho-specific antibody.

891

of cycles were adjusted to ensure that amplification reactions were in a linear range. Reverse Transcriptase (RT)PCR detection of GAPDH (glyceraldehyde-3-phosphate dehydrogenase) and/or h2-microglobulin was used as a control for RNA integrity and loading. Primers for PCR were synthesized by Eurogentec as follows, MMP-1 primers: ATTGGAGCAGCAAGAGGCTGGG and TTCCAGGTATTTCTGGACTAAGTCC; MMP-3 primers: CTTTCCTGGCATCCCGAAGTG and GGAGGTCCATAGAGGGACTG; MKP-1 primers: GCTGTGCAGCAAACAGTCGA and CGATTAGTCCTCATAAGGTA; GAPDH primers: CCATCACCATCTTCCAGGAG and CCTGCTTCACCACCTTCTTG; h2-microglobulin: CTCGCGCTACTCTCTCTTTCTG and GCTTACATGTCTCGATCCCACTT. 2.7. Data analysis Statistical analyses were based on Student’s t-test using Prism software (GraphPAD Inc., CA).

3. Results 3.1. Retinoids transrepress TPA-induced AP1 activity in MCF-7 cells We first investigated whether atRA (all-trans retinoid) was capable of inhibiting AP1 activity in MCF-7 cells. AP1 activity induced by TPA was determined using the synthetic reporter AP1-tk-luc containing four repeats of the consensus AP1 site and especially using the more relevant ColA-luc and Strm1-luc reporter genes, containing the 5V upstream sequence of collagenase-1 (MMP-1) or of stromelysin-1 (MMP-3), respectively (Fig. 1A). A reporter gene containing a mutated AP1site and displaying no activity upon TPA treatment was used as negative control (data not shown). The activity of these luciferase reporter genes increased 5to 8-fold after a 100 nM TPA treatment and the TPAinduced luciferase activity was inhibited by 1 AM atRA. In addition, MMP-1 and MMP-3 expression were analyzed at the mRNA level in MCF-7 cells after TPA and/or atRA treatment (Fig. 1B). The data showed that retinoids downregulate the TPA-induced endogenous expression of MMP1 and MMP-3 in MCF-7 cancer cells, by 2- and 8-fold respectively. 3.2. Characterization of AP1 repression by retinoids in human breast cancer cells

2.6. RNA isolation and RT-PCR Total RNAs were isolated from cultured breast cancer cells by using a RNeasy kit (Qiagen) and stored at 80 -C until use. RNAs were reverse-transcribed using oligo(dT) primers as recommended by the manufacturer (Promega). PCR conditions were optimized for each gene and numbers

We then attempted to characterize which receptor isotype control the retinoid-dependent AP1 antagonism in MCF-7 cells by using highly selective synthetic retinoids. The RAR-selective agonists used were Am580, TTNN and CD666 for RARa, RARh and RARg, respectively, whereas TTNPB is used as a non-selective RAR agonist [25 – 28].

892

S. Dedieu, P. Lefebvre / Cellular Signalling 18 (2006) 889 – 898

A 6

9

6

8

5

5

4 3 2

Fold induction

Fold induction

Fold induction

7 6 5 4 3

4 3 2

2 1

1

1

AP1tk-luc

Strm1-luc

at R TP A A +a T tR TP PA A A +a (1 0 tR nM TP A (1 ) 00 A +a nM tR ) A (1 µM )

D M SO

0 at R TP A A +a T tR TP PA A A +a (1 0 tR nM TP A (1 ) 00 A +a nM tR ) A (1 µM )

D M SO

0 at R TP A A +a T tR TP PA A A +a (1 0 tR nM TP A (1 ) 00 A +a nM tR ) A (1 µM )

D M SO

0

ColA-luc

at A+ TP

TP

A

A R at

D

M

SO

R

A

B

MMP-3 1

0.12

1

0.48

MMP-1

GAPDH

β2-µglobulin

Fig. 1. Inhibition of AP1-dependent gene expression by retinoids in MCF-7 breast cancer cells. (A) MCF-7 breast cancer cells were transfected with AP1tk-luc, ColA-luc or Strm1-luc. Cells were treated during 6 h with DMSO (control), atRA (1 AM) or with TPA (100nM) T atRA at the indicated concentration. Cells were then harvested and the luciferase signal was determined. The luciferase signal from DMSO-treated cells was scaled up to 1 and served as control. Data represent the mean T S.D. of at least four separate experiments, each performed in triplicate. (B) MCF-7 cells were treated by TPA (100 nM) and/or atRA (1 AM) or with DMSO (control). RNAs were isolated and used for detection of MMP-1, MMP-3, GAPDH (control 1) or h2-microglobulin (control 2) species by reverse transcriptase-PCR as described in Experimental procedures. The gels shown are representatives of three independent experiments. Numbers under the gels indicate the fold induction over the reference set to 1.

CD2665 and CD3106 are both RAR antagonists and CD2409 is a dissociated anti-AP1 molecule [23,29,30]. The biological properties of RAR agonists and RAR antagonists were controlled in a standard transactivation assay using a RARE-driven reporter gene (data not shown), as already described [23]. The ability of these retinoids to promote AP1 antagonism was assessed by using the ColAluc (Fig. 2) reporter gene. Transcriptional interference was observed for each compound tested, thus indicating that RARa, -h and -g are directly involved in AP1 inhibition and that RAR-dependent transactivation and transrepression are two distinct events, as previously reported for the less

relevant Hela cellular model [23]. Identical results were obtained with the Strm1-luc reporter gene (unpublished data). 3.3. Retinoids repress AP1 activation by inhibiting MKK6/ p38 and mainly MEK/ERK pathways To identify which signalling module mediates TPAinduced AP1 activity in MCF-7 cells, the luciferase signal from the ColA-luc was measured after treatment by 100 nM TPA combined with different specific MAPK inhibitors (Fig. 3). The stimulation of the luciferase activity by TPA

S. Dedieu, P. Lefebvre / Cellular Signalling 18 (2006) 889 – 898

2 1

- - - - - - - - - + + + + + + + + +

Retinoids:

0 atRA TTNPB Am580 TTNN CD666 CD2665 CD3106 CD2409 0 atRA TTNPB Am580 TTNN CD666 CD2665 CD3106 CD2409

0 TPA:

Fig. 2. Characterization of retinoid-dependent transrepression of AP1 activity. MCF-7 cells were transfected with the ColA-luc reporter construct and treated during 6 h with TPA (100 nM) and/or the indicated ligand. Cells were then harvested and the luciferase activity was determined. Luciferase activity from DMSO-treated cells served as control and was scaled up to 1. The presented results were obtained from three separated experiments, each performed in triplicate. S.D. values between replicate samples are indicated. Identical results were obtained by using AP1-tk-luc or Strm-1-luc as reporter constructs.

was reversed by Go¨6983, thus confirming that TPA acts in this cell line as a stimulator of DAG-sensitive PKCs. PD98059 and U0126, used as selective inhibitors of MEK-1 and -2, allowed a significant reduction of TPA-increased AP1 activity by 3- to 4-fold, in a dose-dependent fashion. Moreover, the p38 specific inhibitor SB230580 was able to reduce the TPA-induced AP1 activity by about 45%. However, neither incubation with SP600125, a specific inhibitor of JNKs, nor treatments with wortmmanin or LY294002, that selectively inhibit the PI3-kinase signalling pathway, were capable of significantly reducing AP1 activity stimulated by TPA. The above results argue that the TPA-mediated activation of AP1 is only dependent on the activation of MEK/ERK and MKK6/p38 pathways. In an attempt to corroborate these data, constitutively active and dominant negative kinases were expressed in MCF-7 cells (Fig. 4). The level of expression of overexpressed protein was controlled by Western-blot (Fig. 4 A, C and E). A dominant negative mutant of MEK-1 completely abolished the TPA-induced luciferase response while constitutively-active MEK-1 or ERK-2 increased the basal AP1 activity by about 13-fold and 18-fold respectively (Fig. 4B). Moreover, overexpressed MKK6 led to a 3-fold increase in luciferase activity that was dramatically decreased in the presence of each dominant negative mutant of p38 (Fig. 4D), thus confirming that the MKK6 signal transduction pathway is coupled to p38 MAPKs. In contrast, overexpression of Akt or coexpression of MKK7 and JNK1 did not increase the basal luciferase activity and the kinase-dead forms of Akt or JNK1 did not inhibit the TPA-induced ColA-luc activation (Fig. 4F). To assess the ability of retinoids to function as MAPK regulators, retinoid treatments were performed after over-

6 5 4 3 2 1 0

TPA TPA +PD +UO

1µ 2µM 5µM M 2µ 5µM 10 M µM 0. 1 0. µM 5µ 1µ M 5 M 10µM µM 0. 1µ 0. M 3µ M

3

Fold induction

4

M S a O TP tRA A TP +a A tR A 5µ 10 M µ 5 M 10µM µM

Fold induction

5

expression of activated MKK6 or constitutively active mutants of MEK-1 or ERK-2. Such a treatment is capable of repressing the MEK-1/ERK-2-induced luciferase response and led to a decrease of about 40% of MKK6induced AP1 activity (Fig. 4B and D). In addition, endogenous MMP-1 and MMP-3 expression were induced when overexpressing the constitutively active mutant of MEK-1 and retinoids were able to down regulate this induction at the transcriptional level (Fig. 4G). However, no detectable induction of these metalloproteases was observed after coexpression of MKK7 and JNK1 or transfection by pcDNA3-MKK6. In parallel, to further assess the role of these kinases during AP1 transrepression by retinoids, different in vitro kinase assays were carried out. As shown in Fig. 5A, TPA treatment markedly induced ERK-1/-2 activities, as measured by Elk-1 phosphorylation, and increased p38 MAPK activity, assayed by the ability of p38 to phosphorylate ATF2. Retinoid acid was capable of counteracting these two upregulations, and most prominently for phospho-Elk-1. In contrast, JNK-1/-2 activities, as measured by c-jun phosphorylation, showed no increase during TPA treatment and revealed no significant effect of retinoids. To confirm that these changes were due to altered kinase activities and not to changes in kinase levels, p38, MEK-1/-2 and JNK-1/-2 expression levels were determined by immunoblotting. Our

D

6

893

TPA +SB

TPA +SP

TPA+ Wo

TPA +LY

TPA .. +Go

Fig. 3. MEK and p38 pathways are molecular relays for TPA-mediated activation of AP1-dependent genes in MCF-7. MCF-7 were transiently transfected with ColA-luc reporter gene and treated during 6 h with DMSO, atRA (1 AM), TPA (100 nM) + DMSO, TPA (100 nM) + atRA (1 AM) or TPA (100 nM) + kinase inhibitors. 0.1 or 0.3 AM Go¨6983 (Go¨) were used to inhibit PKCs. 5 or 10 AM PD98059 (PD) and 5 or 10 AM U0126 (UO) were used as selective inhibitors of MEK-1/-2. Inhibition of p38 MAPKs was obtained by using 1, 2 or 5 AM SB230580 (SB). 2, 5 or 10 AM SP600125 (SP) allowed inhibition of the JNK/SAPK pathway. 0.1, 0.5 or 1 AM Wortmmanin (Wo) and 5 or 10 AM LY294002 (LY) were used as phosphatidylinositol 3-kinase inhibitors. The luciferase activity was assayed as described in Experimental procedures and the basal signal measured in DMSO-treated cells was scaled up to 1 and served as a reference. Data represent the mean T S.D. of at least four separate experiments, each performed in quadruplicate. Identical results were obtained by using AP1tk-luc or Strm-1-luc as reporter constructs.

S. Dedieu, P. Lefebvre / Cellular Signalling 18 (2006) 889 – 898

B

dnMEK

25

Fold induction

20

15

10

5

R A TP dnM A +d EK nM EK E ER RK 2+ 2 at R A

1 EK

at

M M

EK

1+

A

A

tR

TP

A

3+

TP 3+

N

A

pc

+a

A R at

3+

A N

D

N D

Anti-FLAG

D 2.5

Fold induction

2.0

1.5

1.0

0.5

M MK K K K 6+ 6 M K at K R 6 A M +dn K p K 3 6 8 M +dn a K p3 K 6+ 8b d TP np 3 A +d 8g np 38 s

R A at

3+ A N

N

A 3+

D

M SO

0.0

dnp38γ

dnp38β

dnp38α

MKK6

pcDNA3

C

pcDNA3

pc

D

pc

pc

D

N

A

A

3+

D

M

SO

0

D

The concept that retinoids directly control AP1-dependent gene transcription has attracted much attention from medical scientists and researchers interested in altering the behavior of cancer cells. However, despite extensive studies in the last years, how retinoids specifically antagonize AP1 activity remains largely unknown. In this paper, we report a characterization of AP1 activation and transrepression processes and investigated the mechanisms whereby retinoid acid receptors repress AP1 activity in human breast cancer cells. We first observed in the MCF-7 cells that the AP1 responsive reporter genes driven by three distinct promoters as well as the corresponding endogenous MMP-1 and MMP-3 genes were equally sensitive to retinoid treatments. Inhibition of expression of these MMPs is considered to contribute to the prevention of tumor progression and spreading via the reduction of the extracellular matrix components proteolysis in basement mem-

pcDNA3

Anti-MEK

pc

4. Discussion

ERK2

Anti-HA

3.4. c-fos and c-jun levels are critical for retinoid-mediated inhibition of AP1 activity To check whether AP1 activity could be regulated by modulation of the expression of AP1 factors, overexpression of each component of the AP1 complex was performed and the retinoid-mediated inhibition of AP1 was measured. Controls were done to ensure that transfections of each AP1 factor were efficient (Fig. 6A). Overexpressed c-fos and c-jun increased AP1 activity by about 3.6-fold and 2-fold respectively (Fig. 6B), indicating that these AP1 factors have a fundamental contribution to AP1 activity. Co-expression experiments confirmed these results and brought no additional information (unpublished results). In addition, our data indicate that overexpressed c-fos or c-jun was capable of reducing from 2 to 4 times respectively the ability of retinoids to inhibit AP1 activity (Fig. 6C). This suggests that the level of expression of these proteins under retinoid treatment could be rate-limiting for AP1 activity.

MEK1

pcDNA3

A

pcDNA3

brane and stroma tissues [31,32]. This underlies the properties of these agents to target the invasive behavior of human breast cancer cells. Other authors have reported an atRA-mediated negative production of collagenase and stromelysin active forms by fibroblasts, monocytes, macrophages or keratinocytes [33 –35]. In contrast, a stimulation of the stromelysin-3 gene by retinoic acid in fibroblasts has

D

data indicate that these kinases were expressed at a steady state level under transactivating or transrepressive conditions (Fig. 5B). In addition, since retinoids were reported to modulate MAPK activities through transactivation of MKP1 [19,20], we tested whether retinoids are capable of regulating expression of this MAP kinase phosphatase in MCF-7 breast cancer cells. In our experimental conditions, atRA failed to stimulate MKP-1 expression (Fig. 5C). All together, these data demonstrate that AP1 response and regulation of both MMP-1 and MMP-3 expression in MCF-7 cells were mediated mainly by MEK/ERK pathway and also by the MKK6/p38 module, albeit to a lesser extent. The retinoid-dependent transrepressive activity seems to be directly and mainly correlated to their capacity to regulate the MEK/ERK activity.

pc

894

S. Dedieu, P. Lefebvre / Cellular Signalling 18 (2006) 889 – 898

895

Akt

SO M D

M

A R

MKK6

SO

JNK

D

D

M

A R

M D

MEK SO

pcDNA3

at

G

6

Fold induction

pcDNA3

dnAkt

pcDNA3

dnJNK

pcDNA3

7

Anti-Akt

at

F

Anti-HA

SO

Anti-FLAG

JNK1

pcDNA3

E

5 4

MMP-3

3 2

0.42

1

0.57

MMP-1

1

GAPDH

pc

D N pc A3 D +D N M pc pc A3+ SO D DN a N A A3 tRA 3+ + TP T P M M A+a A K K KK tR 7/ 7/ A JN JN K 1+ K1 at TP dn RA J A +d NK nJ 1 N K 1 A kt Akt +a tR A TP dn A Ak +d t nA kt

0

1

Fig. 4. Retinoids function as individual MAPK regulators and allowed inhibition of MEK/ERK- and MKK6-induced AP1 activity. MCF-7 were transiently transfected with ColA-luc reporter gene and expression vectors coding for constitutively active MEK-1 (MEK1), constitutively active ERK-2 (ERK2), wildtype Akt (Akt), activated MKK6 (MKK6), wild-type MKK7 and JNK1 (MKK7/JNK1), dominant negative mutant of MEK-1 (dnMEK), dominant negative mutant of JNK-1 (dnJNK1), dominant negative form of Akt (dnAkt), dominant negative forms of human p38a (dnp38a), p38h (dnp38b) and p38g (dnp38 g) or pcDNA3 as control. (A), (C) and (E). The level of expression of overexpressed protein was controlled by Western-blot, as described in Experimental procedures. (B), (D) and (F). The basal signal measured in pcDNA3-transfected DMSO-treated cells was scaled up to 1 and served as reference. S.D. values between replicate samples are indicated. Experiments were obtained from at least four separate experiments, each performed in quadruplicate. Identical data were obtained by using AP1-tk-luc or Strm-1-luc as reporter constructs. (G) MCF-7 cells were transiently transfected by pcDNA3 (control), constitutively active MEK-1 (MEK1), wild-type MKK7 and JNK1 (JNK) or activated MKK6 (MKK6) and treated during 6 h with DMSO or atRA (1 AM). RNAs were then isolated from MCF-7 cells and used for detection of MMP-1, MMP-3 and GAPDH species by RT-PCR. The gels were representative of at least three separate experiments. Results were quantified and expressed as in Fig. 1B.

Fig. 5. Retinoid agents inhibit ERK-1/-2 and p38 activities but not JNK activity. MCF-7 cells were treated for 6 h with the corresponding compounds as previously detailed. (A) Kinase activities were assayed by IP-kinase assay for ERK-1/-2 (P-Elk), p38 (ATF-2) and JNK-1/-2 (P-c-jun) activities. Representative results from three separate experiments were shown. Results were quantified and expressed as described for Fig. 1B. (B) Cells extracts were resolved by SDSPAGE and an immunodetection was performed using specific antibodies against p38, JNK and MEK MAPKs. Representative results from three separated experiments are shown. (C) RNAs were isolated from MCF-7 and used for detection of MKP-1 and GAPDH transcripts by reverse transcriptase-PCR as described in Experimental procedures. Gels shown are representative of three independent experiments.

896

S. Dedieu, P. Lefebvre / Cellular Signalling 18 (2006) 889 – 898

A

B AP-1 activity (RLU)

100000 75000 50000 25000

pcDNA 3

fra-1

fra-2

c-fos

fosB

junB

junD

c-jun

pcDNA3

fra-1

fra-2

c-fos

fosB

junB

junD

cjun

C

Inhibition by retinoids of TPA-induced AP-1 activity (%)

0

50 40 30 20 10 0

Fig. 6. Overexpression of c-fos or c-jun is capable of partially rescuing the AP1 activity. Expression vectors coding for c-fos, fosB, fra-1, fra-2, c-jun, junB and junD or pcDNA3 as a control were transiently co-transfected with the ColA-luc reporter construct into MCF-7 cells. (A) Overexpressed AP1 members were controlled by Western-blot by using antibodies against fra-1, fra-2, c-fos, fosB, junB, junD or c-jun, respectively. (B) The resulting AP1 luciferase activity was measured. (C) The AP1 inhibition by retinoids was quantified as described for Fig. 4. Results were obtained from at least six independent experiments, each performed in quadruplicate. *Significantly different from control ( p < 0.05). Experiments were carried out in parallel with AP1tk-luc and Strm1-luc with equivalent results. Identical results were equally obtained by using CD2665 instead of atRA.

been evoked, which could be explained by the absence of a functional AP1 site and the presence of a RARE sequence in its proximal region [34]. Retinoid-dependent inhibition of AP1 in MCF7 cells is associated to inhibition of cell cycle progression and entry into S phase but not to induced

apoptosis (unpublished data), thus confirming the tumor growth suppressor properties of retinoids especially by targeting cyclinD3, cdk4, p21 and pRB [1]. In our experimental conditions, RAR antagonists are able to alter RAR-dependent transactivation properties without inhibiting AP1 transrepression. These findings support the concept of separated transactivation and AP1 antagonism functions of retinoid acid receptors in human cancer cells, as previously evoked for less relevant COS-7 or Hela cellular models [3,23]. Consistent with this, using various mutants of hRARa, we observed that the integrity of the DNAbinding domain, essential for RAR dependent transactivation, is not required for the antagonism of AP1 dependent gene expression (unpublished data) whereas this region was previously suggested to be crucial for transrepression of AP1 [21,22]. The ability of overexpressed c-fos and c-jun to significantly induce basal AP1 activity suggests that these AP1 factors have a fundamental contribution to AP1 activity and seems to be the major AP1 dimer assembled on AP1 dependent promoter. This result was supported by siRNA experiments directed against c-jun and c-fos leading to a significant decrease of AP1 activity (unpublished data). Furthermore, the amounts of available c-jun and c-fos appear to be critical under transrepressive conditions since overexpression of c-fos or c-jun partially abolished the ability of retinoids to inhibit AP1 activity. Contrary to what was reported for Hela cells [23], our data identified c-jun and/or c-fos containing dimers as targets of atRA for transrepression of AP1. Our observation could be explained, at least in part, by a c-jun/c-fos sequestration mechanism through physical interactions between RAR and c-jun and/ c-fos, as previously evoked [33,36]. Indeed, by using an in vitro protein – protein interaction assay, we detected tight RAR/c-jun and RAR/c-fos interactions under transrepressive conditions (unpublished data). Finally, we examined the role of MAP kinase pathways in AP1 target genes regulation and MAP kinases as potential targets of retinoid signalling. In MCF-7, we identified the MEK/ERK module as the dominant pathway regulating AP1 and driving the production of MMP-1 and MMP-3. These data are consistent with recent observations [23,37], suggesting that blocking the MEK/ERK activity may inhibit cancer cell proliferation and abrogate MMPdependent extracellular components degradation, thus decreasing their metastatic potential. Although several reports have shown that atRA did not interrupt early mitogenic signals upstream of MAPKs and did not block ERK activation by TPA [24,38,39], our experiments clearly indicated that retinoids block AP1 activity, and consequently transcription of endogenous AP1 target genes, by interfering mainly with induction of the MEK/ERK pathway. Such interference could lead to a decreased phosphorylated-Elk-1 level and therefore to an inhibition of Elk1-target gene transactivation, thus explaining the reduced level of c-fos observed under atRA treatment in MCF-7

S. Dedieu, P. Lefebvre / Cellular Signalling 18 (2006) 889 – 898

(data not shown) and in other cell types [7,8,23]. Moreover, since c-jun is a downstream target for ERK, inhibition of MEK/ERK activity by retinoids could decrease c-jun phosphorylation at Ser63/73 residues and reduce its affinity for CBP, thus leading to CBP exclusion from the promoter and to inhibition of AP1 transactivation [9,11,15,23]. By this mean, retinoid-dependent inhibition of MEK/ERK could result in the inhibition of c-jun/c-fos activities. Additionally, our data shed light on the MKK6/p38dependent regulation of AP1 activity and metalloproteinases expression that is also sensitive to inhibition by retinoids. Consistent with our data, Johansson et al. [40] have suggested that the p38 MAPK pathway plays a crucial role during invasiveness and that p38 MAPK may be an interesting target to specifically inhibit cancer cell invasion. Furthermore, our results are to be correlated to recent observations suggesting that the MKK6 signalling module participate to AP1 stimulation in mammary cells [41,42] and that p38 MAPKs are capable of influencing MMP expression, probably by stabilization of their transcripts [37,43]. Opposing effects of p38 beta with p38 gamma isoform on AP1 dependent transcription were reported [42], but were not observed in our experimental conditions. However, we observed that in contrast to the ERK-1/2 pathway, activation of the MKK6/p38 pathway alone is not sufficient to markedly detect endogenous MMP-1/MMP-3 gene transcription, suggesting that activation of p38 MAPKs had only minimal effect as compared to MEK/ERK [37]. As for the MEK/ERK signalling module, retinoids have been shown to differentially regulate p38 MAPK activity according to the cellular type. Indeed, contrary to what takes place in the mammary cell environment, Alsayed et al. [44] have reported, in human acute promyelocytic leukemia cells, the activation of the p38 MAPK pathway by retinoids associated to a negative regulation of cell growth. Surprisingly, in our experimental conditions, atRA failed to influence the expression of MAPK-specific dual phosphatases such as MKP-1 found to inhibit not only ERK but especially p38 MAPKs with high sensitivity [19,20]. All together, these data confirm that regulation of MAPK activities by retinoids is dependent on cellular context and therefore on dose and nuclear receptor selectivity. The interplay between these various MAPK pathways in the regulation of metalloproteinase gene expression is not clear and also seems to be highly dependent of the cellular environment. For example, Westermarck et al. [45] reported in human skin fibroblasts that p38 alpha inhibits the collagenase-1 expression through MEK-1/2 inactivation, whereas, on the contrary, we observed in mammary cells that TPA-induced ColA-luc activity was inhibited by a dominant negative mutant of p38 alpha. A cooperation between p38 and JNK modules that transactivates vitamin D receptor through stimulation of c-jun and AP1 activity has recently been described [41] and the inhibition of the c-jun N-terminal kinase-dependent signalling pathway by retinoids has been suggested to be the basis of AP1 trans-

897

repression by retinoid acid receptors [16 – 18]. However, here, we clearly show that the JNK-dependent pathway does not participate to TPA-induced AP1 activity, and that atRA do not alter JNK activity.

5. Conclusion All together, our data provide additional insights into the nature of the signal cascades activated in breast cancer cells and regulating AP1 responsive genes. Having reviewed the potential mechanisms governing AP1 transrepression, we shed light on the capacity of retinoids to antagonize AP1 activity by inhibiting the MEK/ERK signalling pathway and targeting c-jun and/or c-fos containing dimers.

Acknowledgments This work was supported by grants from INSERM and Ligue Nationale contre le Cancer. We thank A. Guedin for technical assistance and C. Brand, P. Martin and P. Sacchetti for helpful discussions.

References [1] L. Altucci, H. Gronemeyer, Nat. Rev., Cancer 1 (2001) 181. [2] A. Fanjul, M.I. Dawson, P.D. Hobbs, L. Jong, J.F. Cameron, E. Harlev, G. Graupner, X.P. Lu, M. Pfahl, Nature 372 (1994) 107. [3] S. Nagpal, J. Athanikar, R.A.S. Chandraratna, J. Biol. Chem. 270 (1995) 923. [4] E.F. Wagner, Oncogene 20 (2001) 2334. [5] H. van Dam, M. Castellazzi, Oncogene 20 (2001) 2453. [6] L. Bakiri, K. Matsuo, M. Wisniewska, E.F. Wagner, M. Yaniv, Mol. Cell. Biol. 22 (2002) 4952. [7] R. Treisman, R. Marais, J. Wynne, EMBO J. 11 (1992) 4631. [8] S. Schuck, A. Soloaga, G. Schratt, J.S. Arthur, A. Nordheim, BMC Mol. Biol. 4 (2003) 6. [9] A.J. Bannister, T. Oehler, D. Wilhelm, P. Angel, T. Kouzarides, Oncogene 11 (1995) 2509. [10] A. Minden, A. Lin, T. Smeal, B. Derijard, M. Cobb, R. Davis, M. Karin, Mol. Cell. Biol. 14 (1994) 6683. [11] S. Leppa, R. Saffrich, W. Ansorge, D. Bohmann, EMBO J. 17 (1998) 4404. [12] M.A. Price, F.H. Cruzalegui, R. Treisman, EMBO J. 15 (1996) 6552. [13] K. Onoand, J. Han, Cell. Signal. 12 (2000) 1. [14] E. Nikolakaki, P.J. Coffer, R. Hemelsoet, J.R. Woodgett, L.H.K. Defize, Oncogene 8 (1993) 833. [15] Y. Kamei, L. Xu, T. Heinzel, J. Torchia, R. Kurokawa, B. Gloss, S.C. Lin, R.A. Heyman, D.W. Rose, C.K. Glass, M.G. Rosenfeld, Cell 85 (1996) 403. [16] C. Caelles, J.M. Gonzalez-Sancho, A. Munoz, Genes Dev. 11 (1997) 3351. [17] H.Y. Lee, G.L. Walsh, M.I. Dawson, W.K. Hong, J.M. Kurie, J. Biol. Chem. 273 (1998) 7066. [18] H.Y. Lee, N. Sueoka, W.K. Hong, D.J. Mangelsdorf, F.X. Claret, J.M. Kurie, Mol Cell. Biol. 19 (1999) 1973. [19] Q. Xu, T. Konta, A. Furusu, K. Nakayama, J. Lucio-Cazana, L.G. Fine, M. Kitamura, J. Biol. Chem. 277 (2002) 41693. [20] A. Palm-Leis, U.S. Singh, B.S. Herbelin, G.D. Olsovsky, K.M. Baker, J. Pan, J. Biol. Chem. 279 (2004) 54905.

898

S. Dedieu, P. Lefebvre / Cellular Signalling 18 (2006) 889 – 898

[21] D. DiSepio, M. Sutter, A.T. Johnson, R.A. Chandraratna, S. Nagpal, Mol. Cell. Biol. Res. Commun. 1 (1999) 7. [22] Q. Xu, T. Konta, A. Furusu, K. Nakayama, J. Lucio-Cazana, L.G. Fine, M. Kitamura, J. Biol. Chem. 277 (2002) 41693. [23] M. Benkoussa, C. Brand, M.H. Delmotte, P. Formstecher, P. Lefebvre, Mol. Cell. Biol. 22 (2002) 4522. [24] K. Suzukawa, N.H. Colburn, Oncogene 21 (2002) 2181. [25] M.F. Boehm, L. Zhang, B.A. Badea, S.K. White, D.E. Mais, E. Berger, C.M. Suto, M.E. Goldman, R.A. Heyman, J. Med. Chem. 37 (1994) 2930. [26] R.P. Bissonnette, T. Brunner, S.B. Lazarchik, N.J. Yoo, M.F. Boehm, D.R. Green, R.A. Heyman, Mol. Cell. Biol. 15 (1995) 5576. [27] R. Lotan, M.I. Dawson, C.C. Zou, L. Jong, D. Lotan, C.P. Zou, Cancer Res. 55 (1995) 232. [28] K. Million, F. Tournier, O. Houcine, P. Ancian, U. Reichert, F. Marano, Am. J. Respir. Cell Mol. Biol. 25 (2001) 744. [29] E.S. Klein, M.E. Pino, A.T. Johnson, P.J. Davies, S. Nagpal, S.M. Thacher, G. Krasinski, R.A. Chandraratna, J. Biol. Chem. 271 (1996) 22692. [30] B. Vega-Diaz, M.C. Lenoir, A. Ladoux, C. Frelin, M. Demarchez, S. Michel, J. Biol. Chem. 275 (2000) 642. [31] K. Airola, T. Karonen, M. Vaalamo, K. Lehti, J. Lohi, A.L. Kariniemi, J. Keski-Oja, U.K. Saarialho-Kere, Br. J. Cancer 80 (1999) 733. [32] J. Nikkola, P. Vihinen, T. Vlaykova, M. Hahka Kemppinen, V.M. Kahari, S. Pyrhonen, Int. J. Cancer 97 (2002) 432.

[33] R. Schule, P. Rangarajan, N. Yang, S. Kliewer, L.J. Ransone, J. Bolado, I.M. Verma, R.M. Evans, Proc. Natl. Acad. Sci. U. S. A. 88 (1991) 6092. [34] E. Guerin, M.G. Ludwig, P. Basset, P. Anglard, J. Biol. Chem. 272 (1997) 11088. [35] H. Lateef, M.J. Stevens, J. Varani, Am. J. Pathol. 165 (2004) 167. [36] X.F. Zhou, X.Q. Shen, L. Shemshedini, Mol. Endocrinol. 13 (1999) 276. [37] P. Kunapuli, C.S. Kasyapa, L. Hawthorn, J.K. Cowell, J. Biol. Chem. 279 (2004) 23151. [38] A. Agadir, G. Chen, F. Bost, Y. Li, D. Mercola, X. Zhang, J. Biol. Chem. 274 (1999) 29779. [39] A. Yen, M.S. Roberson, S. Varvayanis, In Vitro Cell. Dev. Biol., Anim. 35 (1999) 527. [40] N. Johansson, R. Ala-aho, V. Uitto, R. Grenman, N.E. Fusenig, C. Lopez-Otin, V.M. Kahari, J. Cell Sci. 113 (2000) 227. [41] X. Qi, R. Pramanik, J. Wang, R.M. Schultz, R.K. Maitra, J. Han, H.F. DeLuca, G. Chen, J. Biol. Chem. 277 (2002) 25884. [42] R. Pramanik, X. Qi, S. Borowicz, D. Choubey, R.M. Schultz, J. Han, G. Chen, J. Biol. Chem. 278 (2003) 4831. [43] N. Reunanen, S.P. Li, M. Ahonen, M. Foschi, J. Han, V.M. Kahari, J. Biol. Chem. 277 (2002) 32360. [44] Y. Alsayed, S. Uddin, N. Mahmud, F. Lekmine, D.V. Kalvakolanu, S. Minucci, G. Bokoch, L.C. Platanias, J. Biol. Chem. 276 (2001) 4012. [45] J. Westermarck, S.P. Li, T. Kallunki, J. Han, V.M. Kahari, Mol. Cell. Biol. 7 (2001) 2373.