RETRACTED: Pre-exposures to taro (Colocasia esculenta) leaf volatiles enhance the reproductive behaviors in Spodoptera litura

Journal of Insect Physiology 99 (2017) 39–46

Contents lists available at ScienceDirect

Journal of Insect Physiology journal homepage: www.elsevier.com/locate/jinsphys

Pre-exposures to taro (Colocasia esculenta) leaf volatiles enhance the reproductive behaviors in Spodoptera litura

MARK

⁎

Xinlong Wana, , Jiaxiu Baib, Rui Lub, Daogen Zhangb, Huiyue Lina,c a b c

Institute of Health and Environmental Ecology, Wenzhou Medical University, Wenzhou, Zhejiang 325035, China School of Public Health and Management, Wenzhou Medical University, Wenzhou, Zhejiang 325035, China The First Affiliated Hospital of Wenzhou Medical University, Wenzhou, Zhejiang 325035, China

A R T I C L E I N F O

A B S T R A C T

Keywords: Taro Pre-exposure Reproductive behavior Intracellular recording Wind tunnel Gene expression

Plant volatiles serve as sensory cues for insects to find food and habitats. They are also reported to affect many insect behaviors. In the current study, we determined how exposures to taro (Colocasia esculenta) for 24 h affect reproductive behaviors in Spodoptera litura. Further, we investigated the mechanisms that regulate taro volatilesinduced reproductive behavior in S. litura by recording peripheral, behavioral, and neuronal responses of male moths to sex pheromone components (Z9,E11-14:OAc and Z9,E12-14:OAc) and their mixtures in different ratios, as well as gene expression levels of sex pheromone receptors. The results showed that the exposure to taro volatiles significantly enhanced male mating rate, mating duration, and egg hatching rates, but not mating times and the number of oviposition per female. Consistently, the peripheral and behavioral responses of pre-exposed males to sex pheromone components and their mixtures wherein Z9,E11-14:OAc owned higher proportions, as well as neuronal responses to those at low dosages were significantly increased compared to non-exposed males. The expression levels of sex pheromone receptor genes were also significantly increased in pre-exposed males compared to non-exposed ones. These results suggest that taro volatile pre-exposures could promote the reproductive performance of S. litura by enhancing the competitiveness of male mating and communications between male and females. These findings provide new insights for the management of this insect pest as well as other moths.

1. Introduction Plants constitute a significant proportion of insects’ natural environment and emit diverse volatile compounds that affect insect behavior. Components of plant volatiles vary depending on the species, and even the same individual plant may emit different compounds depending on its physiological state (Niinemets et al., 2004) or circadian rhythm (Kolosova et al., 2001). Host plants may provide cues for food sources, habitats and oviposition sites for insects that are phytophagous (Bruce et al., 2005; Pophof et al., 2005) or are in the third trophic level (Kos et al., 2012). With the varying amount of volatiles produced by individual plants and a highly variable combination of plants in their natural habitats, the olfactory environment of a moth is complex and dynamic. It creates an unpredictable odorant background that can interact in different ways with the perception of specific signals. In some cases, the chemicals emitted from plants can be used as pheromone motivators because these chemicals can induce or enhance the emission of sex pheromones or insect responses. Although insects rely on innate behavior to successfully manage variations of environ-

⁎

ments, pre-exposure to odors may be superior to innate behavior when dealing with features unique to time, place or individuals by affecting learning and memory in organisms (Dukas, 2008). Thus, analyzing plant volatile pre-exposures constitute a unique opportunity to unravel how the olfactory system operates. Thus far, the effects of odor pre-exposure have been investigated in a number of insects. For example, pre-exposures of Drosophila to benzaldehyde or isoamyl acetate caused central adaptation and morphological changes in olfactory glomeruli (Devaud et al., 2001). Preexposure of obliquebanded and redbanded leaf rollers to host-related chemicals enhanced EAG responses to sex pheromones and plant odorants, and evidence suggests that such sensitization is mediated by octopamine (Stelinski et al., 2003). Similarly, the exposure to plant volatile compounds also enhanced EAG responses of male Spodoptera exigua, as well as attractions to sex pheromones (Deng et al., 2004; Wan et al., 2015). These studies indicated that the host plant volatile preexposure can enhance insect EAG and behavioral responses, suggesting that host plant volatiles may contribute to reproductive strategies in insects. In fact, a recent study showed that pre-exposure to guava fruit

Corresponding author. E-mail address: [email protected] (X. Wan).

http://dx.doi.org/10.1016/j.jinsphys.2017.03.007 Received 10 January 2017; Received in revised form 17 March 2017; Accepted 17 March 2017 Available online 20 March 2017 0022-1910/ © 2017 Elsevier Ltd. All rights reserved.

Journal of Insect Physiology 99 (2017) 39–46

X. Wan et al.

volatiles significantly increased the mating success of Anastrepha fraterculus males and their calling pheromone release (Bachmann et al., 2015). The tobacco cutworm, Spodoptera litura (F.) (Lepidoptera: Noctuidae) is a polyphagous pest of more than 120 vegetable and field crops worldwide and affects taro, cabbage, beetroot, etc (Thomas et al., 1969; Knipling, 1980). The components of S. litura sex pheromones have been identified as Z9,E11-14:OAc, Z9,E12-14:OAc, Z9-14:OAc, and E11-14:OAc in the ratio of 100:27:20:27 (Tamaki et al., 1973; Sun et al., 2003). The species is native to Asia and is distributed throughout the tropical and temperate regions including Asia, Australia, Africa, the Middle East, Southern Europe, and the Pacific Islands (Kranz et al., 1977). This pest is considered to have a potentially high economic impact in terms of its direct pest damage and trade implications. Furthermore, the increased amounts of pesticides used to control S. litura in fields has resulted in the development of pesticide resistance strains of this species around the world including China (Tong et al., 2013; Abbas et al., 2014; Saleem et al., 2016) thus making it difficult to control this pest. Thus, it is necessary to find new and more effective ways to manage S. litura. In this study, we studied the effects of pre-exposures of S. litura for 24 h to the host plant, taro (Colocasia esculenta (L.) Schoot) which is one of most common host plants of S. litura in China, and easily cultivated in laboratory on the mating rates, mating times, mating duration, the number of ovipositions, and the egg hatching rates. Further, the effects of plant volatile pre-exposures on sex pheromone receptor gene expression and electrophysiological and behavioral responses of males to the two components of sex pheromones: Z9,E11-14:OAc, Z9,E1214:OAc, and their mixtures in different ratios were evaluated. Considering that Z9-14:OAc, and E11-14:OAc both have been proposed not to attract male S. litura (Sun et al., 2003), the responses of males to these two components were not recorded. Finally, the potential strategies in using taro volatiles to control S. litura and other insects are discussed.

differently colored light threads or rubber bands to their hind legs. Then, each group was transferred to an 8-liter plastic and transparent container (20 cm × 20 cm × 20 cm). Ten minutes later, 10 females (not exposed to any odorants) were placed in each container. All containers were then moved to an insect behavior room where the lights were turned on at 9:30 a.m. to monitor mating occurrences. Whenever a couple was found mating, male marker and mating duration were recorded. After mating ended, females were transferred to the screening containers. All mated females from the same group were put in the same screening container. Meanwhile, the same number of new virgin females was immediately replaced in the tested containers. Each screening container had at least three pieces of hanging gauze for female oviposition. All experiments were conducted under conditions identical to that in the artificial climate chamber (T: 28 ± 1 °C and 75 ± 10% RH). The adults were fed 10% sucrose and the sucrose was changed every day. The mating observations ended when all males died. The proportion of mating males among the total number of males (mating rate), the average mating times of each male, and the average mating duration of all mating males in every plastic container were calculated and analyzed. Eggs laid by females in every plastic container were observed and counted under the microscope at 8:00 a.m. and 8:00 p.m. every day until the females died. The eggs were then transferred to a new glass jar. All eggs laid by females from the same screening containers were put in the same glass jars. Egg hatching was observed and recorded under the microscope at 8:00 a.m. and 8:00 p.m. every day until all eggs hatched. The average number of eggs per female (total number of eggs in a screening container/the total number of females) and the hatching rate (proportion of hatched eggs/total number of eggs in a screening container) were calculated manually.

2. Materials and methods

Recordings of whole-antennae electrical activity in response to volatile stimuli were made according to standard techniques. A male moth was stabilized in a 1-mL plastic pipette with a cut tip to allow only the antennae to protrude through the opening. The tip of one of the antenna was cut, and a recording electrode filled with Beadle-Ephrussi Ringer solution (7.5 g NaCl, 0.35 g KCl, and 0.279 g CaCl2 2H2O dissolved in 1L ultrapure water) was placed in contact with the cut surface of the antenna. An Ag/AgCl wire serving as a ground electrode was inserted into the insect’s abdomen. The antenna was continuously flushed with moistened air stream, which was purified by a charcoal filter in a glass tube (8 mm i.d.). The outlet of the tube was about 20 mm from the antenna. The stimulus was injected into the air stream through a Pasteur glass tube 15 cm upstream from the antenna. The stimulation was delivered at a flow rate of 5 mL/s in 0.5-s puffs using a stimulation device (IDAC-2, Syntech, The Netherlands). The signal was amplified using a high impedance amplifier, as well as stored and analyzed with the EAG2000 software (Syntech, The Netherlands). The low-cutoff frequency and sampling rate were set as 0.1 Hz and 10 kHz, respectively. Antennae of controls and S. litura after 34 h of preexposure (7:00 p.m., the second day after exposures ended) were challenged with a filter paper (4 cm × 1 cm) contained S. litura sex pheromone components (Z9E11-14:OAc and Z9E12-14:OAc) and their mixtures (Z9E11-14:OAc: Z9E12-14:OAc) in different ratios (1:1, 4:1, 9:1, 19:1, 29:1, 39:1, 1:4, 1:9, 1:19, 1:29, and 1:39) with 0.2 ng. Z9E1114:OAc and Z9E12-14:OAc both were synthesized in our lab with the purity ≥95% and dissolved in paraffin oil at 10−2 μg/mL. About 20 μl of paraffin oil on the filter paper was used as the control. The responses of antennae from male moths were individually tested for each stimulus, and each stimulus replicated 10 times. Recordings were performed under red light since the males were in scotophase when the EAG recordings started.

2.4. Recording electroantennogram (EAG) responses after pre-exposure to taro volatiles

2.1. Insects Male S. litura pupae were purchased from Keyun Biological Co. Ltd. in Henan Province, China, and maintained in an artificial climate chamber at 28 °C, 65% humidity and 14:10 light:dark cycle. After emergence, the adults were fed 10% sucrose. 2.2. Pre-exposure procedures Adult male S. litura were raised in two different odorless insect incubators (60 cm × 60 cm × 180 cm) under similar conditions (14:10 light:dark cycle at 28 °C and 65% humidity). The photophase and the scotophase were set from 4:00 am to 6:00 pm and from 6:00 pm to 4:00 am, respectively. One incubator received natural air and was used as the control, and the other incubator received a simulation effect of a healthy and thriving host-plant, taro (Colocasia esculenta (L.) Schoot) in tillering stage (weight: 485.6 g). The host plant was placed in the incubators at 9:00 am, and was removed after 24 h at 9:00 am the next day. The host and moths were partitioned by gauzes in order to prevent moths from landing on the plant. The two incubators were kept far enough from each other to minimize the exchange of gas molecules between them. Then, the following experiments were conducted. 2.3. Estimating male sexual behavior and female oviposition after preexposure to taro volatiles Each 60 exposed and non-exposed males were randomly divided into six groups with ten/group, at 7:00 p.m., the second day after exposures ended. Within each group, the males were marked by tying 40

Journal of Insect Physiology 99 (2017) 39–46

X. Wan et al.

Table 1 List of primers used in qRT-PCR.

Sex pheromone receptors

Reference genes

Primer name

Primer sequence (5′–3′)

References

Slitu-OR1-F Slitu-OR1-R Slitu-OR3-F Slitu-OR3-R Slitu-OR25-F Slitu-OR25-R Slitu-OR6-F Slitu-OR6-R Slitu-OR11-F Slitu-OR11-R Slitu-OR13-F Slitu-OR13-R Slitu-OR16-F Slitu-OR16-R Slitu-GAPDH-F Slitu-GAPDH-R Slitu-ELF-α-F Slitu-ELF-α-R

GTGGGTAATAGATGGATGGC AGGCGGCGATAGCATTCATA GCTGCCAAATCGGTTCATAT AGTCTCCATCGCATGTTCAG CGCCATGTCAGATGTATTCG CTGCCGACCAGTTCAAAAAT TCATTCTATTACTGATGGTGTTC GCACTTGTTACTGTTAATCCT CTGTCTGTTCAATCTGATACC TACCATCCACTGAGAGTTG CAGCAGTTGATTCAGTTGT TGGACACCGACAGTAATC GGATATGTCGTTGCTTGTATT AATGCCTCGTTCTAATTCAC TATCAAGCAGAAGGTCAAGG CGAAGATGGAAGAGTGGTT AATCGGTGGTATTGGTACG TTGACTTCAGTGGTGATGTT

Designed in this study

Zhang et al. (2015)

amplifier (Axon Instruments). The low cut-off frequency and sampling rate were set as 60 Hz and 1 kHz, respectively. Data were digitized using the Digitata 1440A board (Axon Instruments) and Clampex 10.2 software (Axon Instruments). The spikes were sorted using the software Clampfit 10.2 (Axon Instruments). For statistical analysis, four groups of neurons were counted: non-responding, high-threshold (200 and 20 ng), medium threshold (2 and 0.2 ng), and low threshold (0.02 ng) neurons. To further study the effects of pre-exposures on the neuronal responses of S. litura at different dosages, we selected 10 MGC-neurons from the same area in the pre-exposed and non-exposed male antennal lobes, and tested the responses of each neuron to the major sex pheromone component, Z9E11-14:OAc, at five dosages (0.02–200 ng).

2.5. Wind tunnel analysis of S. litura behavioral responses after preexposure to taro volatiles To evaluate the effects of taro volatiles on the behavioral responses of male S. litura to the sex pheromone components and their mixtures in different ratios, a wind tunnel (70 cm × 70 cm × 200 cm) was setup with an air flow of 40 cm·s−1, a red light mounted at the top at 26 °C and an RH of 60–75%. Prior to the experiment, the pre-exposed males were moved into individual glass tubes (10 cm × 2.5 cm), both sides of which were closed with cheese cloth. The filter papers contained the sex pheromone components (Z9E11-14:OAc and Z9E12-14:OAc) and their mixtures (Z9E11-14:OAc: Z9E12-14:OAc) in different ratios (1:1, 4:1, 9:1, 19:1, 29:1, 39:1, 1:4, 1:9, 1:19, 1:29, and 1:39) with 0.2 ng were placed at the base in the upwind at end of the wind tunnel. About 20 μL of paraffin oil on a filter paper was used as the control. The filter paper with chemicals was changed every 20 min. At the beginning of an experiment, the tube was placed on a holder (120 cm from the chemical source, 30 cm above the floor) and the netting was removed. Males exposed to odorless air and host taro volatiles were released individually. These behavioral experiments were conducted at 7:00 p.m., the second day after the end of exposures similar to the EAG responses recordings. Each individual was given 3 min to respond, and each insect was tested only once. The insects that did not respond within 3 min were discarded. In total, 60 moths that were responsive were used for each group. The numbers of insects that displayed each of the following patterns were recorded: flying, oriented flight toward the source, and landing.

2.7. Quantitative Real-time PCR (qRT-PCR) Antennae from S. litura males were collected 34 h, at 7:00 p.m., the second day after the end of exposures after. Three replicates of 25 antennal pairs were collected. Antennae from each group were immediately homogenized in Trizol on ice, and stored at −80 °C until RNA extraction. Total RNA was extracted using Trizol method according to the manufacturer’s protocol. The concentrations of extracted RNA were determined using Nanodrop 1000 (Thermo Fisher). cDNA was synthesized using FastQuant RT Kit (with gDNase) in 20 μL reaction volumes (TIANGEN) containing 10 μL reaction system 1 (1 μg total RNA, 2 μL 5×gDNA buffer and RNase-Free water) and 10 μL reaction system 2 (2 μL 10×Fast RT Buffer, 1 μL RT Enzyme Mix, 2 μL FQ-RT Primer Mix, and 5 μL RNase-Free water). The reaction conditions were the following: incubating reaction system 1 at 42 °C for 3 min and placing on ice; then, adding reaction system 2 for a final incubation at 42 °C for 15 min and 95 °C for 3 min. All samples had 3 replicates. To study the effects of taro volatiles on gene expression levels in S. litura, we selected 7 sex pheromone receptors (OR1, OR3, OR6, OR11, OR13, OR16, and OR25). Among these, four (OR6, OR11, OR13, and OR16) were identified in a previous study (Zhang et al., 2015) and three (OR1, OR3, and OR25) were identified in our laboratory (data not shown). Two reference genes, GAPDH (GenBank No. HQ012003.2) and elongation factor 1-α (GenBank No. KC007373.1), were used to normalize the target gene expression and to correct for sample-tosample variation. The primers used in qRT-PCR are shown in Table 1. The antennal cDNA after exposure of S. litura to taro volatile and natural air (control) were used as templates for the qRT-PCR reactions. The amplification was performed in a Bio-Rad qRT-PCR instrument as follows: initial denaturation at 94 °C; 45 cycles at 94 °C for 15 s, 58 °C

2.6. Intracellular recordings of neuronal responses to taro volatiles preexposure The male moths were mounted in plastic tubes and immobilized with dental wax (Kerr Corporation, Romulus, MI, USA). Brains were dissected in a saline solution (150 mM NaCl, 3 mM CaCl2, 3 mM KCl, 25 mM C12H22O11 and 10 mM TES buffer, pH 6.9) until the whole antennal lobe was exposed. Borosilicate glass capillary electrodes (o.d. 1.0 mm, i.d. 0.5 mm; World Precision Instruments) with a resistance of 250 MΩ were pulled using a Flaming-Brown Puller (P-2000, Sutter Instrument). The electrode shaft was filled with filtered (0.2-μm pore size) 2.5 mol/L KCl solution and the glass microelectrode was inserted into the male-specific macroglomerular complex (MGC). Moth antennae were stimulated with a 500-ms air pulse containing S. litura sex pheromone blend (Z9E11-14:OAc: Z9E12-14:OAc at a ratio of 9:1) with 0.02, 0.2, 2, 20, and 200 ng or paraffin oil as a control. Intracellular recordings were carried out in bridge mode with an Axoclamp 900A 41

Journal of Insect Physiology 99 (2017) 39–46

X. Wan et al.

Fig. 1. The effects of pre-exposure to plant volatiles on mating rates (A), mating times (B), mating duration (C), number of oviposition (D), and egg hatching rates (E) in S. litura (mean ± SEM). Each treatment replicates six times. Asterisk indicates significant differences (P < 0.05) between control and plant volatile treated insects.

pheromone communications, we further investigated the EAG responses of pre-exposed and non-exposed S. litura males to the sex pheromone components and their mixtures (Z9E11-14:OAc: Z9E1214:OAc) in different ratios (1:1, 4:1, 9:1, 19:1, 29:1, 39:1, 1:4, 1:9, 1:19, 1:29, and 1:39). The results, interestingly, showed that plant volatile pre-exposures only significantly enhanced the EAG responses of males to the sex pheromone components, Z9E11-14:OAc and Z9E12-14:OAc, and their mixtures (Z9E11-14:OAc: Z9E12-14:OAc) in ratios, 1:1, 4:1, 9:1, 19:1, 29:1, and 39:1. The EAG responses of S. litura to the mixtures (Z9E11-14:OAc: Z9E12-14:OAc) in ratios 1:4, 1:9, 1:19, 1:29, and 1:39 were also somewhat enhanced by pre-exposures to taro volatiles, but there were not significant differences compared to the control (Fig. 2; Sup. Table 1), indicating that plant volatile pre-exposures had not effects on the EAG responses of S. litura to mixtures of Z9E11-14:OAc and Z9E12-14:OAc, when the proportion of Z9E12-14:OAc is higher than Z9E11-14:OAc. This result probably suggested that plant volatile pre-exposures mainly affect the EAG responses of S. litura to their major sex pheromone component, Z9E11-14:OAc. Further, the effects of preexposures on the EAG responses to the major sex pheromone component, Z9E11-14:OAc and the mixture (Z9E11-14:OAc: Z9E12-14:OAc) in ratio, 39:1 were significantly higher (P < 0.01) than all the other ratio mixtures, confirming that the promotion effect of plant volatile pre-exposure on EAG responses is higher to Z9E11-14:OAc than to Z9E12-14:OAc (P < 0.05) (Fig. 2; Sup. Table 1).

for 40 s, and 72 °C for 20 s. Relative gene expression was calculated using the 2−ΔΔCt method, where ΔCt = (Ct, target gene − Ct, reference gene), ΔΔCt = (ΔCt, different samples − ΔCt maximum) (Livak and Schmittgen, 2001). 2.8. Statistical analysis The multiple comparisons were executed by One-Way ANOVA followed by a least significant difference (LSD) test (significance level: P < 0.05) with SPSS10.0.1 software (SPSS Inc.), with P < 0.05 marked as ∗, P < 0.01 as ∗∗. 3. Results 3.1. The effects of pre-exposure to taro volatiles on the breeding behavior of S. litura Our results showed significantly higher numbers of mating couples in the group with plant volatile pre-exposed S. litura males than that in the group with non-exposed males (F = 12.53, df = 11, P < 0.05) (Fig. 1A). On average, the pre-exposed males mated with females 2.7 times, while non-exposed males mated 2.3 times, suggesting that exposure to taro volatiles may increase mating times in S. litura although only marginally (F = 1.53, df = 11, P > 0.05) (Fig. 1B). However, the average mating duration of pre-exposed males was significantly higher than the non-exposed males (F = 18.96, df = 11, P < 0.05) (Fig. 1C), indicating a higher mating success. The average number of ovipositions by females mated with pre-exposed males was slightly higher than that by females mated with non-exposed males (F = 2.17, df = 11, P > 0.05) (Fig. 1D). However, the eggs laid by females mated with pre-exposed males recorded significantly higher hatching rates than those laid by females mated with non-exposed males (F = 15.16, df = 11, P < 0.05) (Fig. 1E). These results indicated that plant volatile pre-exposures enhanced not only sexual behaviors but breeding as well.

3.3. The effects of pre-exposures to taro volatiles on the behavioral responses of S. litura to sex pheromone components and their mixtures in different ratios The behavioral responses of pre-exposed and non-exposed males to sex pheromone components and their mixtures in different ratios in wind tunnel are presented in Table 2. There was no significant difference in the flight responses of pre-exposed and non-exposed males to all tested chemicals, suggesting that taro volatiles may not affect the flight ability of male S. litura (P < 0.05) (Table 2; Sup. Table 2). However, pre-exposure to taro volatiles significantly enhanced the proportion of oriented flight to two sex pheromone components and their mixtures (Z9E11-14:OAc: Z9E12-14:OAc) in two ratios, 9:1 and 1:4 (P < 0.05) (Table 2; Sup. Table 2). Pre-exposed and non-exposed males landed on two sex pheromone

3.2. The effects of plant volatile pre-exposures on the EAG responses of S. litura to sex pheromone components and their mixtures in different ratios Considering that the sexual behaviors are influenced by sex 42

Journal of Insect Physiology 99 (2017) 39–46

X. Wan et al.

Fig. 2. The effects of pre-exposure to plant volatiles on the EAG responses of male S. litura to sex pheromones and their mixtures (Z9E11-14:OAc: Z9E12-14:OAc) in different ratios (mean ± SEM). Each treatment replicates ten times. Asterisk indicates significant differences (*P < 0.05 or **P < 0.01) between control and plant volatile treated insects.

components, Z9E11-14:OAc (17.5% and 27.5%, respectively) and Z9E12-14:OAc (12.5% and 12.5%, respectively) and six ratio mixtures (Z9E11-14:OAc: Z9E12-14:OAc), 1:1 (10% and 12.5%, respectively), 4:1 (7.5% and 7.5%, respectively), 9:1 (25% and 30%, respectively), 19:1 (12.5% and 17.5%, respectively), 29:1 (7.5% and 10%, respectively), 39:1 (7.5% and 12.5%, respectively), and 4:1 (2.5% and 2.5%, respectively) but not to the remaining ratio mixtures (Table 2; Sup. Table 2). There were significant differences between the landings of pre-exposed and non-exposed males to the major sex pheromone component, Z9E11-14:OAc and the mixtures in ratios, 9:1, 19:1, and 39:1 (Table 2; Sup. Table 2). Particularly, both pre-exposed and nonexposed males did not land on mixtures in ratios, 1:9, 1:19, 1:29, and 1:39, but they still showed oriented flight to the mixture in ratio, 1:9. These findings indicated that pre-exposures to the host plant preferred to positively affect the behavioral responses of S. litura to Z9E1114:OAc, rather than Z9E12-14:OAc, confirming the results obtained from EAG experiments, though they are not exactly in parallel.

Fig. 3. The effects of pre-exposure to plant volatiles on the sensitivity of antennal lobe neurons to the sex pheromone blend (Z9E11-14:OAc: Z9E12-14:OAc at the ratio of 9:1) in S. litura by intracellular recording (mean ± SEM). Data represent percentages of tested antennal lobe neurons responding to the sex pheromone blend with different thresholds in non-exposed (65 neurons in 20 males) and pre-exposed (63 neurons in 20 males) S. litura males. Asterisk indicates significant differences (P < 0.05) between control and plant volatile treated insects.

3.4. The effects of plant volatile pre-exposures on the central neuronal responses of S. litura to sex pheromone components and their mixtures in different ratios

exposed males were detected. These consisted of neurons with all different thresholds in response to sex pheromones and their mixtures. Overall, the pre-exposed males presented no significantly different proportion of neurons with high and medium threshold responses from non-exposed males, but had significantly higher proportion of neurons with low threshold response than non-exposed males (Fig. 3), suggesting that the taro volatiles mainly positively influence the neuronal

Neuronal responses of the antennal lobes in plant volatile preexposed and non-exposed males to sex pheromone components and their mixtures (Z9E11-14:OAc: Z9E12-14:OAc) in different ratios were conducted by intracellular recording and analyzed (Fig. 3). A total of 65 MGC-neurons in 20 non-exposed males and 63 MGC-neurons in 20 pre-

Table 2 The plant volatiles enhanced the behavioral responses of S. litura (Mean ± SE) to different sex pheromones and their mixtures in different ratios. Chemical sources

Z9E11-14:OAc Z9E12-14:OAc Z9E11-14:OAc: Z9E12-14:OAc

Oriented flight (%)

Flight (%)

1:1 4:1 9:1 19:1 29:1 39:1 1:4 1:9 1:19 1:29 1:39

Source landing (%)

Non-exposed

Pre-exposed

Non-exposed

Pre-exposed

Non-exposed

Pre-exposed

85 ± 6.23a 90 ± 5.92a 85 ± 6.23a 92.5 ± 4.68a 87.5 ± 5.65a 85 ± 4.74a 82.5 ± 6.23a 82.5 ± 4.92a 85 ± 5.23a 92.5 ± 4.25a 85 ± 3.96a 82.5 ± 3.68a 85 ± 4.25a

87.5 ± 5.22a 92.5 ± 6.11a 82.5 ± 5.22a 90 ± 5.25a 87.5 ± 5.72a 85 ± 5.81a 85 ± 5.42a 85 ± 4.19a 82.5 ± 4.09a 92.5 ± 5.16a 87.5 ± 4.62a 85 ± 4.31a 85 ± 4.17a

45 ± 2.23a 47.5 ± 2.98a 30 ± 2.13a 27.5 ± 2.45a 50 ± 3.56a 25 ± 0.29a 12.5 ± 1.23a 10 ± 1.97a 7.5 ± 1.26a 2.5 ± 0.19a 0a 0a 0a

62.5 ± 5.22b 57.5 ± 4.92b 27.5 ± 2.32a 25 ± 2.18a 57.5 ± 3.27b 25 ± 0.48a 12.5 ± 1.34a 12.5 ± 1.31a 12.5 ± 1.29b 2.5 ± 0.87a 0a 0a 0a

17.5 ± 1.23a 12.5 ± 1.03a 10 ± 0.63a 7.5 ± 0.62a 25 ± 1.08a 12.5 ± 0.23a 7.5 ± 0.13a 7.5 ± 0.96a 2.5 ± 0.65a 0a 0a 0a 0a

27.5 ± 2.02b 12.5 ± 0.95a 12.5 ± 1.12a 7.5 ± 0.76a 30 ± 1.58b 17.5 ± 0.43b 7.5 ± 0.27a 12.5 ± 1.52b 2.5 ± 0.69a 0a 0a 0a 0a

Means followed by the same and different letter(s) between non-exposed and pre-exposed are non-significantly and significantly different, respectively. Each treatment replicates six times.

43

Journal of Insect Physiology 99 (2017) 39–46

X. Wan et al.

(Gidday et al., 1994; Dolan et al., 1997). However, electrophysiological recordings have shown that such pre-stimulation also improves the peripheral nervous system response in male moths (Guerrieri et al., 2012). In the current study, we found that the 24 h pre-exposures of S. litura to volatiles from their host plant, taro (C. esculenta (L.) Schoot) significantly enhanced the reproductive behavior including mating rates, mating duration, and egg hatching rates, but not mating times and number of ovipositions even 24 h after the pre-exposures ended, suggesting that the pre-exposure effects may be longer than once thought (Fig. 1). This is consistent with a previous study showing that the mating success of A. fraterculus males increased significantly after exposure to guava fruit volatiles (Bachmann et al., 2015). The enhancing effects of taro volatile pre-exposures on the mating rates and mating duration may directly result in a higher egg hatching rate, which significantly affects the progeny. In this regard, our results strongly suggested that taro volatiles could enhance reproductive behaviors and improve reproductive strategies in S. litura. Furthermore, the effects of pre-exposure to taro volatiles on EAG, behavioral and neuronal responses of S. litura males to sex pheromones and their mixtures in different ratios, as well as the expression level of S. litura sex pheromone receptor genes strongly support these findings (Figs. 2–5; Table 2), suggesting that the enhancing effects of pre-exposures on reproductive behaviors are achieved by influencing communication between sexes through sex pheromones. This could explain why plant volatile pre-exposures have no effects on the mating times and numbers of ovipositions, which are not known to have correlations with sex pheromones. The increased electrophysiological and behavioral responses induced by pre-exposure to taro volatiles suggested that pre-exposures may have sensitized S. litura moths and may have been mediated by octopamine (Stelinski et al., 2003). An early odorant exposure has been evidenced to increase the number of associated mitral and tufted cells by 40% and 100%, respectively, suggesting that odor experience could enhance processing by changing the structure of olfactory bulb (Liu et al., 2016). Further, a brief sensory experience differentially affecting the volume of antennal lobe glomeruli and the mushroom body calyx in S. littoralis brain suggested that the antennal lobe sensitivity to the pheromone correlates to the volume of glomeruli, and the behavioral change may be caused by the output area of antennal lobe projection neurons elicited by sensory cues (Anton et al., 2016). Thus, the sensitization in moths induced by plant pre-exposures may be essentially caused by enlarging the volume of olfactory units in the brain, physiologically influencing the level of octopamine. In fact, plant volatiles inducing sensitization have been reported in previous studies. For instance, the exposure to volatile compounds was found to enhance the EAG responses of male S. exigua (Deng et al., 2004). Consistently, a recent study also showed that pre-exposure to a host plant (green Chinese onion, Allium fistulosum) promoted EAG responses of S. exigua male moths to plant volatiles and sex pheromones (Wan et al., 2015). The EAG responses of the oblique banded leaf roller, Choristoneura rosaceana, also were promoted by pre-exposure to host plant volatiles (Stelinski et al., 2003). These studies support the notion that preexposure to host plant volatiles may increase olfactory sensitivity in moths, and also enhance the electrophysiological and behavioral responses. With regard to our study, the enhanced electrophysiological and behavioral responses to sex pheromone components in S. litura subsequently promoted the sexual and reproductive behaviors relative to sex pheromone communications, such as mating rates, mating duration and egg hatching rate. Although it is known that odor pre-exposures influence the electrophysiological and behavioral responses of insects, the molecular mechanisms that trigger these changes are not known. It has been shown that odor exposure can modulate olfactory receptor gene expression in honeybees (Claudianos et al., 2014) and beet armyworm (Wan et al., 2015). Further, previous studies have reported that brood pheromone and queen pheromone can influence insect behavior by

Fig. 4. The effects of pre-exposure to plant volatiles on the neuronal responses of S. litura to the major sex pheromone component, Z9E11-14OAc at different dosages by intracellular recording (mean ± SEM). Each dosage replicates six times. Asterisk indicates significant differences (P < 0.05) between control and plant volatile treated insects.

sensitivity to the sex pheromones at low dosages, rather high dosages. On the other hand, the proportions of neurons with no response in preexposed males are significantly lower than those in non-exposed males (Fig. 3). The effects of taro volatile pre-exposures on the neuronal responses of S. litura to Z9E11-14:OAc at variable dosages by intracellular recording are shown in Fig. 4. The results showed that neuronal responses of pre-exposed and non-exposed males to Z9E11-14:OAc increased in a dose-dependent manner. However, the pre-exposed males presented significantly higher neuronal responses to Z9E1114:OAc than non-exposed males only at dosages 0.02 and 0.2 ng. There were no significant differences in neuronal responses between preexposed and non-exposed males at other dosages (Fig. 4), evidencing the results above. In all, our intracellular recording indicated that the neuronal sensitivity could be increased by pre-exposures of the taro volatiles when the stimulus chemicals present low dosages. 3.5. The effects of plant volatile pre-exposures on the expression levels of sex pheromone receptor genes qRT-PCR results indicated that expression levels of the sex pheromone receptor genes, OR1, OR6, OR11, OR13, and OR16 were 2.29-, 1.76-, 2.10-, 1.46-, and 1.75-fold higher in plant volatile pre-exposed males compared to non-exposed males (Fig. 5). Pre-exposure to taro volatiles only slightly enhanced gene expression levels of three other sex pheromone receptors, OR3 and OR25 (Fig. 5). 4. Discussion Pre-exposure to odors such as pheromones and plant volatiles in the environment can alter neuronal response, and may eventually alter the innate behavior of an insect (Barrozo et al., 2011; Chaffiol et al., 2014). It is known that the pre-stimulation process to odors occurs in the brain

Fig. 5. The effects of pre-exposure to plant volatiles on the expression levels of sex pheromone receptors (mean ± SEM). GAPDH and ELF-1α genes were used to normalize the target gene expression and to correct for sample-to-sample variation. The nonexposed treatment was selected as the calibrator. Asterisk indicates significant differences (P < 0.05) between control and plant volatile treated insects.

44

Journal of Insect Physiology 99 (2017) 39–46

X. Wan et al.

tion.

adjusting gene expression in the brain (Grozinger et al., 2003; Alaux et al., 2009; Zayed and Robinson, 2012). In this study, we detected sex pheromone receptor gene expression in S. litura males in the presence of taro volatiles and natural air consistent with previous findings that sexual and reproductive behaviors are strongly correlated to sex pheromones. These results revealed that taro volatiles up-regulated the gene expression of sex pheromone receptors in S. litura males to different extents (Fig. 5), providing a hint to the molecular mechanisms underlying the effects of plant volatile pre-exposure on reproductive behaviors in S. litura. Although we showed that plant volatile preexposure could significantly affect the expression of sex pheromone receptors in S. litura, this response may depend on the species, genes, exposure odors, and/or exposure time. For example, queen mandibular pheromone (QMP) was shown to transiently regulate the expression of several hundreds of genes and chronically regulate the expression of 19 genes. These changes were subsequently related to changes in behaviors such as nursing and foraging (Grozinger et al., 2003). Exposure of young honeybees to the brood pheromone up-regulated genes in the brain specialized in brood care but down-regulated genes in charge of foraging suggesting that pheromones influence behavior through largescale changes in brain gene expression (Alaux et al., 2009). Further, a brief pre-exposure to the pheromone gave rise to a significant increased responses of Agrotis ipsilon to sex pheromone 24 h after exposure, and the neonicotinoid insecticide, clothianidin further enhanced the experience-dependent increased behavioral responses to sex pheromone (Abrieux et al., 2016). A worst-case acute exposure to typical fieldrelevant levels of amitraz for 24 h was found to have not significant effects on honey bee learning, short-term memory, and hemolymph octopamine levels (Rix and Christopher, 2017). These studies demonstrate gene regulation by pheromones and illustrate the potential of genomics to trace the actions of a pheromone from perception to action, and thereby provide insights on how pheromones regulate social life. Claudianos and his group demonstrated the effects of plant volatiles on the expression levels of olfactory receptors in honey bees, and found that plant volatiles modulated gene expression differently in the antennae depending on the odor (Claudianos et al., 2014). Besides, we previously reported that pre-exposure to sex pheromones and plant volatiles significantly affected the expression profiles of olfactory genes and circadian rhythm in S. exigua (Wan et al., 2015). These studies show the different effects of odors on gene expression in different scenarios and suggest that the effect of odor pre-exposures on gene expression may be a complex mechanism. The positive effects of pre-exposure to plant volatiles on insect sexual behaviors may be applied not only to rear and protect beneficial insects but also to control insect pests. To rear beneficial insects, high numbers of males pre-exposed to host plant volatiles could be released into the field or rearing cage. Their increased sexual behavior and egg hatching rate may enhance the efficiency of reproduction and further increase progeny numbers. On the other hand, to control insect pests such as S. litura, plant volatile pre-exposures can be linked to sterile insect technique (SIT), a method of biological insect control, whereby a large number of sterile insects are released into the field resulting in females mating with a sterile male and yielding no offspring, thus reducing the population size (Klassen, 2005). The technique has been successfully used to control several tephritid fruit fly pests including the Mediterranean fruit fly, Ceratitis capitata and the Mexican fruit fly, Anastrepha ludens (Hendrichs et al., 2002; Enkerlin, 2005). The key to the success of SIT is the higher mating competiveness of sterile males compared to the wild-type males. In this regard, pre-exposure to host plant volatiles may enhance the success rate of SIT by enhancing the mating competiveness of sterile males, as implemented in previous studies (Shelly and McInnis, 2001; Shelly et al., 2007). Nevertheless, this study is only a preliminary experiment in lab. The emission rates of taro volatiles, mating competition between wild and reared males, and compounds of the volatiles were not tested yet. The further work will focus on these experiments in order to go further with its implementa-

Acknowledgements This study was funded by the Natural Science Foundation of Zhejiang Province, China (Grant No. LY15C030003) and Scientific Research Foundation of WenZhou Medical University (Grant No. 89213002) to X Wan. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.jinsphys.2017.03.007. References Abbas, N., Samiullaha, Shada, S.A., Razaqa, M., Waheedb, A., Aslamc, M., 2014. Resistance of Spodoptera litura (Lepidoptera: Noctuidae) to profenofos: relative fitness and cross resistance. Crop Prot. 58, 49–54. Abrieux, A., Mhamdi, A., Rabhi, K.K., Egon, J., Debernard, S., Duportets, L., TricoireLeignel, H., Anton, S., Gadenne, C., 2016. An insecticide further enhances experiencedependent increased behavioural responses to sex pheromone in a pest insect. PLoS One 11, e0167469. Alaux, C., Le Conte, Y., Adams, H.A., Rodriguez-Zas, S., Grozinger, C.M., Sinha, S., Robinson, G.E., 2009. Regulation of brain gene expression in honey bees by brood pheromone. Genes Brain Behav. 8, 309–319. Anton, S., Chabaud, M.A., Schmidt-Busser, D., Gadenne, B., Iqbal, J., Juchaux, M., List, O., Gaertner, C., Devaud, J.M., 2016. Brief sensory experience differentially affects the volume of olfactory brain centres in a moth. Cell Tissue Res. 13, 1–7. Bachmann, G.E., Segura, D.F., Devescovi, F., Juarez, M.L., Ruiz, M.J., Vera, M.T., Cladera, J.L., Teal, P.E., Fernandez, P.C., 2015. Male sexual behavior and pheromone emission is enhanced by exposure to guava fruit volatiles in Anastrepha fraterculus. PLoS One 10, e0124250. Barrozo, R.B., Jarriault, D., Deisig, N., Gemeno, C., Monsempes, C., Lucas, P., Gadenne, C., Anton, S., 2011. Mating-induced differential coding of plant odour and sex pheromone in a male moth. Eur. J. Neurosci. 33, 1841–1850. Bruce, T.J.A., Wadhams, L.J., Woodcock, C.M., 2005. Insect host location: a volatile situation. Trends Plant Sci. 10, 269–274. Chaffiol, A., Dupuy, F., Barrozo, R.B., Kropf, J., Renou, M., Rospars, J.P., Anton, S., 2014. Pheromone modulates plant odor responses in the antennal lobe of a moth. Chem. Senses 39, 451–463. Claudianos, C., Lim, J., Young, M., Yan, S., Cristino, A.S., Newcomb, R.D., Gunasekaran, N., Reinhard, J., 2014. Odor memories regulate olfactory receptor expression in the sensory periphery. Eur. J. Neurosci. 39, 1642–1654. Deng, J.Y., Wei, H.Y., Huang, Y.P., Du, J.W., 2004. Enhancement of attraction to sex pheromones of Spodoptera exigua by volatile compounds produced by host plants. J. Chem. Ecol. 30, 2037–2045. Devaud, J.-M., Acebes, A., Ferrùs, A., 2001. Odor exposure causes central adaptation and morphological changes in selected olfactory glomeruli in Drosophila. J. Neurosci. 21, 6274–6282. Dolan, R.J., Fink, G.R., Rolls, E., Booth, M., Holmes, A., Frackowiak, R.S., Friston, K.J., 1997. How the brain learns to see objects and faces in an impoverished context. Nature 389, 596–599. Dukas, R., 2008. Evolutionary biology of insect learning. Annu. Rev. Entomol. 53, 145–160. Enkerlin, W.R., 2005. Impact of fruit fly control programmes using the sterile insect technique. In: Dyck, V.A., Hendrichs, J., Robinson, A.S. (Eds.), Sterile Insect Technique: Principles and Practice in Area-Wide Integrated Pest Management. Springer, Dordrecht, The Netherlands, pp. 651–676. Gidday, J.M., Fitzgibbons, J.C., Shah, A.R., Park, T.S., 1994. Neuroprotection from ischemic brain injury by hypoxic preconditioning in the neonatal rat. Neurosci. Lett. 168, 221–224. Grozinger, C.M., Sharabash, N.M., Whitfield, C.W., Robinson, G.E., 2003. Pheromonemediated gene expression in the honey bee brain. Proc. Natl. Acad. Sci. U.S.A. 100, 14519–14525. Guerrieri, F., Gemeno, C., Monsempes, C., Anton, S., Jacquin-Joly, E., Lucas, P., Devaud, J.M., 2012. Experience-dependent modulation of antennal sensitivity and input to antennal lobes in male moths (Spodoptera littoralis) pre-exposed to sex pheromone. J. Exp. Biol. 215, 2334–2341. Hendrichs, J., Robinson, A.S., Cayol, J.P., Enkerlin, W.R., 2002. Medfly area wide sterile insect technique programmes for prevention, suppression or eradication: the importance of mating behavior studies. Fla. Entomol. 85, 1–13. Klassen, W., 2005. Area-wide integrated pest management and the sterile insect technique. In: Dyck, V.A., Hendrichs, J., Robinson, A.S. (Eds.), Sterile Insect Technique: Principles and Practice in Area-Wide Integrated Pest Management. Springer, Dordrecht, The Netherlands, pp. 39–68. Knipling, E.F., 1980. Regional management of the fall armyworm: a realistic approach? Fla. Entomol. 63, 468–480. Kolosova, N., Gorenstein, N., Kish, C.M., Dudareva, N., 2001. Regulation of circadian methyl benzoate emission in diurnally and nocturnally emitting plants. Plant Cell 13, 2333–2347.

45

Journal of Insect Physiology 99 (2017) 39–46

X. Wan et al.

Shelly, T.E., McInnis, D.O., 2001. Exposure to ginger root oil enhances mating success of irradiated, mass-reared males of Mediterranean fruit fly (Diptera: Tephritidae). J. Econ. Entomol. 94, 1413–1418. Stelinski, L.L., Miller, J.R., Ressa, N.E., Gut, L.J., 2003. Increased EAG responses of tortricid moths after prolonged exposure to plant volatiles: evidence for octopaminemediated sensitization. J. Insect Physiol. 49, 845–856. Sun, F., Du, J., Chen, T., 2003. The behavioral responses of Spodoptera litura (F.) males to the female sex pheromone in wind tunnel and field trapping tests. Acta Entomol. Sin. 46, 126–130. Tamaki, Y., Noguchi, H., Yushima, T., 1973. Sex pheromone of Spodoptera litura (F) (Lepidoptera: Noctuidae): isolation, identification and synthesis. Appl. Entomol. Zool. 8, 200–203. Thomas, M.J., Jacob, A., Nair, M.R.G.K., 1969. Host-biology relations of Spodoptera litura (F.) (Lepidoptera: Noctuidae). Indian J. Agric. Sci. 39, 400–402. Tong, H., Su, Q., Zhou, X., Bai, L., 2013. Field resistance of Spodoptera litura (Lepidoptera: Noctuidae) to organophosphates, pyrethroids, carbamates and four newer chemistry insecticides in Hunan, China. J. Pest. Sci. 86, 599–609. Wan, X., Qian, K., Du, Y., 2015. Synthetic pheromones and plant volatiles alter the expression of chemosensory genes in Spodoptera exigua. Sci. Rep. 5, 17320. Zayed, A., Robinson, G.E., 2012. Understanding the relationship between brain gene expression and social behavior: lessons from the honey bee. Annu. Rev. Genet. 46, 591–615. Zhang, J., Yan, S., Liu, Y., Jacquin-Joly, E., Dong, S., Wang, G., 2015. Identification and functional characterization of sex pheromone receptors in the common cutworm (Spodoptera litura). Chem. Senses 40, 7–16.

Kos, M., Houshyani, B., Overeem, A.J., Bouwmeester, H.J., Weldegergis, B.T., van Loon, J.J., Dicke, M., Vet, L.E., 2012. Genetic engineering of plant volatile terpenoids: effects on a herbivore, a predator and a parasitoid. Pest Manage. Sci. 69, 302–311. Kranz, J., Schumutterer, H., Koch, W., 1977. Diseases Pests and Weeds in Tropical Crops. Verlag Paul Parley, Berlin and Hamburg, Germany. Liu, A., Savya, S., Urban, N.N., 2016. Early odorant exposure increases the number of mitral and tufted cells associated with a single glomerulus. J. Neurosci. 36, 11646–11653. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2 −ΔΔCT method. Methods 25, 402–408. Niinemets, Ü., Loreto, F., Reichstein, M., 2004. Physiological and physicochemical controls on foliar volatile organic compound emissions. Trends Plant Sci. 9, 180–186. Pophof, B., Stange, G., Abrell, L., 2005. Volatile organic compounds as signals in a plantherbivore system: electrophysiological responses in olfactory sensilla of the moth Cactoblastis cactorum. Chem. Senses 30, 51–68. Rix, R., Christopher, C.G., 2017. Acute exposure to worst-case concentrations of amitraz does not affect honey bee learning, short-term memory, or hemolymph octopamine levels. J. Econ. Entomol. 110, 127–132. Saleem, M., Hussaina, D., Ghouseb, G., Abbasa, M., Fisherc, S.W., 2016. Monitoring of insecticide resistance in Spodoptera litura (Lepidoptera: Noctuidae) from four districts of Punjab, Pakistan to conventional and new chemistry insecticides. Crop Prot. 79, 177–184. Shelly, T., Edu, J., Smith, E., Hoffman, K., War, M., Santos, R., Favela, A., Garagliano, R., Ibewiro, B., McInnis, D., 2007. Aromatherapy on a large scale: exposing entire adult holding rooms to ginger root oil increases the mating competitiveness of sterile males of the Mediterranean fruit fly in field cage trials. Entomol. Exp. Appl. 123, 193–201.

46