Retroviral activation of a novel gene encoding a zinc finger protein in IL-3-dependent myeloid leukemia cell lines

Cell, Vol. 54, 831-840, September 9, 1988, Copyright © 1988 by Cell Press

Retroviral Activation of a Novel Gene Encoding a Zinc Finger Protein in IL-3-Dependent Myeloid Leukemia Cell Lines Kazuhiro Morishita,*t Diana S. Parker,* Michael L. Mucenski,~§ Nancy A. Jenkins,t Neal G. Copeland,$ and James N. Ihle*t * NCI-Frederick Cancer Research Facility BRI-Basic Research Program Molecular Mechanisms of Carcinogenesis Laboratory Frederick, Maryland 21701 NCI-Frederick Cancer Research Facility BRI-Basic Research Program Mammalian Genetics Laboratory Frederick, Maryland 21701

Summary Normal hematopoietic stem cells proliferate and differentiate in the presence of growth factors such as interleukin-3 (IL-3). Transformation can alter their growth factor requirements, the ability of the cells to differentiate, or both. To identify genes that are capable of transforming hematopoietic cells, IL-3-dependent cell lines, isolated from retrovirus induced myeloid leukemias, were examined for viral insertions in proto-oncogenes and in common sites of viral integration. Five of 37 cell lines contained proviruses in a common viral integration site termed the ecotropic virus integration 1 site (Evi.1). The integrations were correlated with the activation of transcription from the locus. Sequencing of cDNA clones and genomic clones demonstrated that the integrations had occurred near or in 5' noncoding exons of a novel gene. The sequence of the cDNA clones predicts that the gene product is a 120 kd protein that contains two domains with seven and three repeats of a DNA binding consensus sequence (zinc finger) initially described in the Xenopus transcription factor III A (TFIIIA). This represents the first demonstration of the retroviral activation of a gene encoding a zinc finger protein and the first implication for a member of this gene family in the transformation of hematopoietic cells. Introduction Mature hematopoietic cells are derived from pluripotential stem cells that proliferate and differentiate under the influence of hematopoietJc growth factors (Sachs, 1987; Metcalf, 1985). Interleukin-3 (IL-3) is a 28 kd, T cell-derived hematopoietic growth factor that supports the differentiation of stem cells along several myeloid lineages (Ihle et al., 1983; Prystowsky et al., 1984; Ihle and Weinstein, 1986; Suda et al., 1985; Ihle et al., 1985). Stem cells proliferating in IL-3 in vitro are committed to differentiate, 1"Present address: Department of Biochemistry, St. Jude Children's Research Hospital, Memphis, Tennessee38101. § Present address: Children'sHospital ResearchFoundation,3350 Elland Avenue,Cincinnati, Ohio 45229.

and although cells at intermediate stages can be isolated by cell sorting techniques, they terminally differentiate and cannot be maintained. In the absence of IL-3, the cells fail to differentiate and lose viability. The transformation of hematopoietic cells involves an altered ability to differentiate, altered growth factor requirements, or both (Sachs, 1978; Ihle et al., 1984a; Kahn et al., 1986). Although a number of studies have identified transforming genes which can abrogate the growth factor requirements of IL-3-dependent hematopoietic cells (Rapp et al., 1985; Pierce et al., 1985; Cook et al., 1985; Wheeler et al., 1987; Carmier and Samarut, 1986; Overell et al., 1987; Mathey-Prevot et al., 1986), no transforming genes have yet been shown to alter the ability of normal IL-3dependent hematopoietic cells to differentiate. Of potential use in studying this type of transformation are retrovirus-induced, IL-3-dependent myeloid leukemia cell lines (Ihle et al., 1984b; Holmes et al., 1985). These leukemia cell lines express lineage markers associated with intermediates in IL-3 supported differentiation, but do not differentiate, nor can the cells be induced to differentiate (D. Askew, K. Morishita, and J. N. Ihle, unpublished data). The properties of the cells therefore suggest that transformation has primarily affected their ability to differentiate. Transformation by replication competent retroviruses is often due to the integration of proviruses near or within cellular genes (Hayward et al., 1981; Neel et al., 1981), causing their altered expression. Although this mechanism was initially demonstrated for the activation of cellular homologs of retroviral transforming genes, the concept of insertional mutagenesis has been used to identify new transforming genes by identifying common sites of retroviral integrations and by characterizing the cellular genes that are altered in their expression. Genes that have been identified in this way include Pim-1, a serine protein kinase associated with MoLV transformation of T cells (Selten et al., 1986; Meeker et al., 1987), and Int-1, an extracellular glycoprotein of unknown function (Papkoff et al., 1987; Brown et al., 1987), and Int-2, a growth-factor-like gene (Yoshida et al., 1987; Casey et al., 1986; Moore et al., 1986), which are associated with the transformation of mammary cells by mouse mammary tumor virus (MMTV). To identify the genes that are associated with the transformation of IL-3-dependent myeloid leukemia cell lines, we have looked for the activation of known oncogenes or for viral integrations in previously identified common sites of integration. In previous studies (Weinstein et al., 1986; Weinstein et al., 1987), we have shown that, in two myeloid lines, retroviral insertions occurred in coding regions of the c-myb nuclear proto-oncogene. These insertions caused the increased expression of a carboxy-truncated protein comparable to the carboxy-truncation found in avian transforming virus, avian myeloblastosis virus (AMV) (Klempnauer et al., 1983; Klempnauer and Bishop, 1983). In addition, we have shown (Mucenski et al., 1988a) that retroviruses integrate into a common site of integration,

Cell 832

KB 0 I

5 I

10 I

DA-I (~) l

15 I

20 f

25 r

NFS-78 (+)

Sm

1

÷

÷

~ x,fi< spl,~

;

,~xScL;;

xx~s,,,, xScI Sci.~.x;

,~s,o

NFS-58 (+) NFS-60 (~)

I

Probe 4

I

Figure 1. RestrictionMap of the Evi-1 Locusand Site of RetrovirusIntegrations in IL-3-DependentLeukemiaCell Lines The restrictionmapfor the Evi-1locuswas developedusingthreeoverlappingEMBL-3phageclonesfrom eitherC57BL/6JDNA or DNAfrom a BALB/cderivedmyeloidleukemiacell line (DA-3).Verticalarrowsindicatethe positionsof proviralintegrationswithinthe Evi-1 locusfor the cell lines indicatedabovethe arrows.The horizontalarrows indicate the 5' to 3' directionof the virusesas determinedby restrictionmapping of genomic DNAs in Southern analysisor by restriction mappingof phage clones containingthe proviralintegrations.The 3.2 kb EcoRISail fragment indicatedas probe4 was used to isolateclonesfrom cDNA librariesfrom the NFS-78cell line.The restrictionenzymesindicated are EcoRI(E), Xbal (X), BamHI(B), Sacl (Sc), and Smal (Sm).

termed the ecotropic virus integration site 1 (Evi-1) in three IL-3-dependent lines. This locus was initially identified as a common integration site in myeloid tumors of the AKXD23 recombinant inbred strain of mice, and has been mapped to murine chromosome 3 (Mucenski et al., 1988a; Mucenski et al., 1988b). In the studies described here, we show that viral insertions in the Evi-1 locus in IL-3-dependent myeloid cell lines cause the activation of the transcription of a novel gene encoding a member of the zinc finger family of transcriptional regulatory proteins. The potential role for this protein in myeloid transformation is discussed. Results Characterization of Retroviral Insertions in the Evi-1 Locus in IL-3-Dependent Myeloid Leukemia Cell Lines IL-3-dependent cell lines were isolated from myeloid leukernias induced by either Moloney leukemia virus (MoLV) (Ihle et al., 1984b) or a wild mouse ecotropic virus termed CasBrM MuLV (Holmes et al., 1985). The cells require IL-3 for maintenance of viability, have an immature, myeloblastic morphology and phenotype, and do not spontaneously differentiate nor can they be induced to differentiate (Ihle et al., 1984a). To identify the genes associated with this phenotype of rnyeloid transformation, we looked for rearrangements of known oncogenes (Mos, Hras, Kras, c-rnyc, Myb, Lck, Hck, Ere-l, Ets-2) and for viral insertions in common sites of integrations (M/vi-1, M/vi-2, Pim-1, Pim-2, Fire-l, Fire-2, Evi-1, Evi-2) by Southern blot analysis. Among the 37 cell lines examined, two cell lines (NFS-60, VFLJ2) were found to have retroviral insertions in the myb locus (Weinstein et al., 1987; Weinstein et al., 1986) and three lines (NFS-60, NFS-78, NFS-48) were found to have retroviral insertions in a 7 kb EcoRI fragment which defined the Evi-1 virus integration site (Mucenski et al., 1988a). One cell line, NFS-60, contained integrations in both the myb gene and the Evi-1 locus.

To further characterize the Evi-1 locus, we developed a restriction map for the region surrounding the 7 kb EcoRI fragment and re-examined the cell lines for rearrangements in other regions of the locus. Three overlapping clones containing the normal allele were isolated from genomic libraries made in EMBL-3 with Sau3A partially digested, size-selected DNAs. The restriction map derived from these clones spanned approximately 28 kb (Figure 1). The 7 kb EcoRI fragment initially used to define the Evi-1 locus is indicated by the heavy line. Various probes were then used to screen for rearrangements outside of the 7 kb EcoRI fragment. As illustrated in Figure 1, two cell lines (DA-1, NFS-58) had viral insertions in a 5 kb EcoRI fragment adjacent to the 7 kb fragment. The structures and orientations of the integrated viruses were determined by restriction enzyme mapping of genomic DNAs (NFS-78, NFS-58) or genomic lambda DNA clones containing the integrated provirus (NFS-60, DA-1). In the NFS-78, NFS-58, and DA-1 cell lines, the viruses were integrated in the same orientation as indicated by the arrows in the parenthesis in Figure 1. In the NFS-78 and NFS-58 cell lines, the restriction maps indicated the presence of complete proviruses identical to the CasBrM MuLV used to induce the tumors (data not shown). In the DA-1 cell line, the restriction map of the virus was consistent with the presence of a complete mink cell focus-forming (MCF) derivative of the parental MoLV used to induce the tumors and contained a characteristic EcoRI site at 6.9 kb in the provirus (Quint et al., 1981; data not shown). In the NFS-60 cell line, the restriction map indicated the presence of a complete provirus identical to the CasBrM MuLV used to induce the tumor (data not shown), which had integrated in an orientation opposite the viruses in the other cell lines (as indicated in Figure 1). Characterization of cDNA Clones from NFS-78 Cells To determine whether viral integrations had affected transcription, genomic probes were used in Northern analysis. With a 3.2 kb EcoRI-Sall fragment (probe 4 in Figure 1), weak, diffuse hybridization in the range of 1-7 kb was detected with poly(A) RNA from the NFS-78 cell line (data not shown). To characterize the transcripts, two cDNA clones (78-5, 78-8) of 2.2 kb and 2.5 kb were isolated from a Xgtl0 cDNA library made with poly(A)+ RNA from NFS78 cells and containing 4 x 105 members. Their structures were determined by restriction enzyme analysis and by sequencing and comparison of the cDNA sequences with the genomic sequences at the integration site. The deduced structures are shown in Figure 2A. Both cDNA clones contained CasBrM MuLV sequences and cellular sequences. The 78-8 clone started in the env gene and continued through the 3' LTR into cellular sequences for 434 bp. At this point there was a splice donor site and splicing occurred out of one potential cellular exon to another exon. The 78-5 clone started in the po/gene and continued into the env gene region. At a cryptic splice donor site in the virus, splicing occurred to cellular sequences 3' of the integration site, to a site containing a consensus splice acceptor. This splicing defined a potential cellular exon 300 bp 3' of the integration site (labeled

Activation of Unique Finger Gene in Myeloid Leukemia 833

A

NSF-78 E2

E3

X78-5

B

NSF-58 3' 1 KB

E . .H . .P

H

n,

x

~/

•

k58-2

k58-1

clones. The 58-2 cDNA clone contained no viral sequences and started 71 nucleotides 3' of the 58-1 clone. The remainder of the sequence was identical to the 58-1 clone. Taken together, the data suggest that, within the region of the integrations, there exist two exons of 276 bp and 134 bp separated by approximately 5 kb. The third exon has not been localized by nucleotide sequencing, but by hybridization was localized to 10 kb 3' of the second exon. In NFS-78 cells the viral integration occurred approximately 300 bp 5' of exon 2. In NFS-60 cells the viral integration occurred within exon 2 (data not shown), while in NFS-58 cells the integration occurred near or within exon 1. In DA-1 cells the integration is further 5' of the integration site in NFS-58 cells and has not been precisely localized by sequencing.

exon 2 in Figure 2A). The sequences after the exon 2 region were identical to those in the 78-8 clone, further suggesting splicing to another cellular exon.

Proviruses Activate Transcription from the Locus The 58-2 clone contained no viral sequences and was therefore used in Northern analysis to study transcription in various cell lines. As shown in Figure 3, transcripts were readily detectable in cell lines containing Evi-1 rearrangements (NFS-58, NFS-60, NFS-78, DA-1), but were not detectable in cell lines without Evi-1 rearrangements, including IL-3-dependent myeloid cell lines (NFS-107, FDC-P1), factor-independent myeloid cell lines (NFS-61, NFS-124, WEHI-3, WEHI-3BD+), T cell lines (RL-12, DA-2), or a B cell line (DA-8). In NFS-60 cells there was a major transcript of approximately 5 kb. In NFS-58 cells transcripts of 5 kb and 4 kb were detectable. In NFS-78 cells there was a high level of expression of transcripts that varied in size from 1-7 kb, similar to the diffuse pattern seen with the initial genomic probes. This pattern was not due to RNA degradation as assessed by probing the blots with an actin probe (data not shown), and is speculated to be due to variably spliced viral-cellular hybrid transcripts. In DA-1 cells there was a major transcript that was slightly larger than the 5 kb transcript in NFS-60 cells.

Characterization of cDNA Clones from NFS-58 Cells Since the NFS-78 cDNA clones were complex and contained both viral and cellular sequences, cDNA libraries from other cell lines were screened. The probe used was a BgllI-Sall genomic fragment containing the 134 bp exon region. Using this probe, two cDNA clones were obtained from a Xgtl0 cDNA library made with poly(A)+ RNA from NFS-58 cells and containing 5 x 105 members. Two unique but overlapping clones (58-1, 58-2) of 3 kb and 5.1 kb, respectively, were isolated and sequenced. The deduced structures of the clones and their relationship to the integration site are illustrated in Figure 2B. The 5' end of the 58-1 clone contained 12 nucleotides of the viral 3' LTR, indicating that the transcript initiated in the virus and continued into cellular sequences. The next 276 nucleotides were derived from cellular sequences following the viral integration site. Following the 276 bp, there was a consensus splice donor site in the genomic sequence at which splicing had occurred. The following sequence was identical to the sequence of the presumptive second and third exons defined by the NFS-78 cDNA

The cDNA Clones Encode a Potential Zinc Finger Protein Since the 5.1 kb, 58-2 cDNA clone appeared to be full length, the complete nucleotide sequence was determined. As indicated in Figure 4 and shown in Figure 5, there was a single large open reading frame starting at a rnethionine at nucleotide position 478 and ending at a stop codon (TGA) at nucleotide position 3604. There is also a methionine at nucleotide 508 that contains flanking sequences that are closer to the Kozak consensus sequence for eukaryotic translation initiation (Kozak, 1987). The potential exon 1 and 2 sequences described above are 54 bp 5'of the start of the open reading frame, indicating that the viral integrations had occurred in 5' noncoding exons. The open reading frame contained 3126 nucleotides and the predicted translation product from the first methionine is a protein of 1042 amino acids with a calculated mass of 120 kd. Comparison of the nucleic acid sequence with sequences in the GenBank indicated no homology to the available sequences. However, a protein homology

Figure 2. Structureof cDNA Phage Clones from NFS-78and NFS-58 Cells Comparedwith the IntegrationSites The structuresof cDNA clones and genomic clones were determined by restrictionmapping and sequencing. (A) The restrictionmap for the integrationsite in NFS-78 is shown at the top. The position of the viral LTRs are indicated by the crosshatched bars.The solid bars indicatethe positionof possibleexonsfor the Evi-1 gene as discussedin the text. The structuresof the NFS-78 cDNA clones(78-8 and 78-5) are shown belowand are aligned to indicate the origin of sequenceswithin the clones. Regionsthat were removed by splicing are indicated by the nonhorizontallines. (B) The restrictionmap for the integrationsite in NFS-58cells is shown at the top. The positions of the virus and possible cellular exonsare indicatedas in (A). The structuresof the 5' regionsof the NFS-58cDNA clones (58-1 and 58-2) are shown below the genomic map and are oriented to indicate the origin of the sequences. The restriction enzyme sites shown are EcoRI (E), Hindlll (H), Xbal (X), Sail (S), Pstl (P), BamHI (B), and Sacl (Sc).

Cell 834

+ a

1

2

KB

5 i

E

'T ~5 Z

I Z

¢¢

I

E1

×5s.1 I

x58.2 ~

[

]

I

I

Kb Figure 4. Structure of the cDNA Clones from NFS-58 Cells

9.5 7.5 4,4

The restriction map derived from two overlapping cDNA clones from NFS-58 is shown below the scale line. The enzyme sites indicated are Sacl (Sc), Hindlll (H), Sinai (Sm), Pstl (P), and EcoRI (E). The open reading frame is indicated by the boxed area. The regions indicated as E1 and E2 are derived from genomic regions defined as exon 1 and exon 2 in Figures 2 and 3.

2.4 1.4

0.3

Figure 3. Northern Analysis of Evi-t Gene Expression in Various Hematopoietic and Lymphoid Cell Lines RNA was prepared, electrophoresed, and transferred to nitrocellulose as described in Experimental Procedures. Ten micrograms of RNA was used in each lane. The filter was hybridized with a 32p-labeled probe consisting of a purified EcoRI fragment of the 58-2 cDNA clone subcloned into pUC19. The cell lines examined were from MoLV induced tumors (DA lines), CasBrM MuLV induced tumors (NFS lines), a radiation induced T cell tumor (RL- 12), a long-term stromal cell culture (FDC-P1) or a chemically induced myeloid tumor (WEHI-3). Most of the cell lines are myeloid lineage except the T cell lines (DA-2 and RL-12) and a B cell line (DA-8). Among the myeloid lineage cells, NFS58, NFS-60, NFS-78, NFS-107, FDC-P1, and DA-1 require IL-3 for growth; the remainder are factor-independent for growth. The WEHI3BD+ line is a subline of WEHI-3 cells that can be induced to differentiate with G-CSF (Metcalf and Nicola, 1982). The position of RNA standards and their sizes are indicated on the right.

search against the National Biomedical Research Foundation protein data base indicated a striking homology to TFIIIA, a Xenopus RNA polymerase III transcription factor that regulates the expression of 5S RNA genes during development (Pelham and Brown, 1980; Honda and Roeder, 1980). The homology was limited to the TFilIA zinc finger domains that are involved in DNA binding (Miller et al., 1985; Diakun et al., 1986; Berg, 1986) and which are present in a number of transcriptional regulatory proteins (Evans and Hollenberg, 1988). As shown in Figure 6A, the predicted amino acid sequence of the Evi-1 gene product contained ten repeats of 27-28 amino acids in two domains. The repeats had the consensus sequence of [(F/Y) C XX C X(K/R)X F XXXSN L XR H XXXX (H/C) XXXX] containing the characteristic cysteine, phenylalanine, leucine, and histidine repeat structure of the zinc finger motif. As indicated in Figure 6B, there are seven repeat regions in

the amino-terminal region of the protein, six of which are tandemly repeated. The first repeat is separated from the other six by a gap of 25 amino acids. In addition there are three tandemly repeated zinc finger regions in the carboxy region. The first and second repeats in the second domain are connected by a nearly perfect "H-C link" consensus sequence [TGE(R/K)P(F/Y)X] found in many zinc finger proteins (Schuh et al., 1986). In addition to the DNA binding domains, several transcription factors contain acidic regions that are essential for transcriptional activation (Hope and Struhl, 1986; Ma and Ptashne, 1987a). As indicated in Figures 5 and 6B, the Evi-1 gene contains a highly acidic domain in the carboxy region of the protein. This stretch contains 25 of 52 acidic residues and extends from Asp 877 to Glu 928. This region also shows protein sequence similarity (35%) to an acidic region found in the human and mouse N-myc genes. Within the sequence there are six Asp-X-Ser/Thr sites for potential N-linked glycosylation at residues 270, 452, 471,738, 807, and 860. The first three sites are located between the two zinc finger domains, the fourth site is within the second zinc finger domain, and the last two sites are located between the second zinc finger domain and the acidic domain. The relevance of these potential glycosylation sites, however, is not known. Transport of proteins to the nucleus has been shown to be associated with specific protein sequences that contain clusters of three to six basic residues (Kalderon et al., 1984a; Kalderon et al., 1984b; Wychowski et al., 1986; Richardson et al., 1986; Noteborn et al., 1987; Lee et al., 1987; Burglin and De Robertis, 1987). None of the consensus sequences for nuclear transport were present. However, there are two small stretches of basic amino acids at residues 421-434 and residues 847-868. Following the open reading frame, there is a relatively large 3' noncoding region which contains a high percentage of A and T. Within this region there are five copies of the sequence ATTTA. These sequences have been associated with RNA instability and are speculated to mediate selective RNA degradation (Shaw and Kamen, 1986). The 600 bp nucleotide sequence following the EcoRI site in the 58-2 cDNA clone was only sequenced in one direction and is not shown.

Activation of Unique Finger Gene in Myeloid Leukemia 835

1 GGGGGTCTTTCAAAAACACTGTTGGCGGACAATAAATCCGAAACGCGTGGTCCTGGCGAT 61 CAGCTCCCAGGGAACGACAAACTFATCAGACACCCA]7-FGGAAGTGGAGACACGAGGCTF 121 TTATTTTAAAAAAAAAAIIIIflIIICTTTTAAAATATCTCGAAATGTTAGCGGGTGTTC 181 TTTGAAAAGATTTTCCAACTCGAGTACCTGGCTGCTGCTGATCTTA]77"TTCTTTAATTC 241 TGCTGTGATTGCTTTTGATTGCTGAGTTGAGGCCGTAGAAATCGGAAGATCTTAGATGAG 301 TTTTGCAATGTGAAGTTCTGCATAGATGCCAGTCAACCAGATGTAGGAAGCTGGCTCAAG 361 TACATCAGATTCGCTGGCTGCTATGATCAGCACAACCTTGTTGCATGCCAGATAAATGAT 421 CAGATATTCTACCGAGTAGTCGCAGACATTGCGCCTGGGGAAGAGCTCTTGCTGTTCATG Met

2281 GAGCCTCGAAAAAACCATGTGTTTGGGGAAAAGAAAGGAAGCAACATGGATACTAGGCCA GluProArgLysAsnHisValPheGlyGiuLysLysGlySerAsnMetAspThrArgPro 621 2341 TCTTCAGATGGCTCCTTGCAGCATGCCAGACCCACTCCCTTCTTCATGGACCCCATTTAT SerSerAspGlySerLeuGInHisAlaArgProThrProPhePheMetAspPro}leTyr 641 2401 AGAGTAGAGAAAAGAAAGTTAACTGACCCGCTTGAAGCTTTGA/~GAAAAATACTTGAGA ArgValGluLysArgLysLeuThrAspProLeuGluA]aLeuLysGluLysTyrLeuArg 661 2461 CCTTCTCCAGGATTCTTG'I7-TCACCCGCAAATGTCAGCAATFGAGAACATGGCAGAAAAG ProSerProGlyPheLeuPheHisProGInMetSerAla]leGluAsnMetAlaGluLys 681 2521 CTGGAAAGCTTCAGCGCCCTCAAACCTGAGGCCAGCGAGCTCCTGCAGTCCGTGCCCTCC LeuGluSerPheSerAlaLeuLysProGluAlaSerGluLeuLeuGInSerValProSer 701

481 AAGAGTGAAGAGGACCCGCACGAACCCATGGCGCCTGACATCCACGAAGAACGGCAGCAC LysSerGluGluAspProHisGluProMetAlaProAsplleHisGluGluArgGInHis 21

2581 ATGTTCAGCTTCCGAGCTCCTCCCAACACCCTGCCAGAGAACCTGCTGCGGAAGGGGAAA MetPheSerPheArgAlaProProAsnThrLeuProGluAsnLeuLeuArsLysGlyLy$ 721

541 CGCTGTGAGGACTGTGACCAGCTCTTTGAATCCAAGGCAGAGCTAGCCGATCACCAGAAG ArgCysGluAspCysAspGInLeuPheGluSerLysAlaGluLeuAlaAspHisGInLys 41

2641 GAGCGCTACACCTGCAGGTACTGTGGCAAGATATTTCCAAGGTCTGCGAACCTAACACGG G]uArsTyrThrCysArgTyrCysGlyLysIlePheProArgSerAlaAsnLeuThrArg 741

601 TTCCCATGCAGCACACCTCACTCGGCCTTCTCCATGGTGGAGGAGGACTTGCAACAAAAC PheProCysSerThrProHisSerA]aPheSerMetValGluGluAspLeuGInGInAsn 81

2701 CACTTGAGAACCCACACAGGAGAGCAACCTTACAGATGCAAATACTGTGATAGATCATTC HisLeuArgThrHisThrGlyGluGLnProTyrArgCysLysTyrCysAspArgSerPhe 761

661 CTGGAGAGTGAGAGCGATCTCCGAGAGATCCATGGCAACCAGGACTGTAAGGAATGTGAC LeuGluSerGluSerAspLeuArgGlulleHisGlyAsnGInAspCysLysGluCysAsp 81

2761 AGCATTTCTTCCAACCTGCAGCGACATGTGCGCAACATCCACAACAAGGAGAAGCCATTT SerIleSerSerAsnLeuG]nArsHisValArgAsn[leHisAsnLysGluLysProPhe 781

721 CGAGTTTTCCCCGATCTGCAAAGCTTGGAGAAGCACATGCTGTCACATACTGAGGAGAGG ArgValPheProAsoLeuGInSerLeuGluLysHisMetLeuSerHisThrGluGluArg 101

2821 AAGTGTCATTTATGTGACAGATGTTTTGGTCAACAAACCAATCTTGACAGACACCTGAAG LysCysHisLeuCysAspArsCysPheGlyGInGInThrAsnLeuAspArsHisLeuLys 601

761 GAATACAAGTGTGATCAGTGTCCCAAGGCATTTAACTGGAAGTCCAA17-FAATTCGCCAC GluTyrLysCysAspGInCysProLysAlaPheAsnTrpLysSerAsnLeuIleArgHis 121

2881 AAACATGAGAACGGCAACATGTCTGGGACGGCAACGTCCTCGCCTCACTCAGAGCTAGAA LysHisGluAsnGlyAsnMetSerGlyThrAlaThrSerSerProHIsSerGluLeuGlu 621

841 CAGATGTCACATGACAGTGGAAAGCACTATGAGTGTGAAAACTGTGCCAAGGTTTTCACG GInMetSerHisAspSerGlyLysHisTyrGluCysGluAsnCysAlaLysValPheThr 141

2041 AGCGCAGGCGCAATCCTGGATGACAAAGAAGATGCGTACTTTACAGAGATCCGCAATFTC SerAlaGlyAtaIleLeuAsDAspLysGluAsoAlaTyrPheThrGlu]ieArgAsnPhe 841

901 GACCCTAGCAACC'~CAGCGACACATTCGATCTCAGCATG17-GGTGCCCGGGCTCATGCT AspProSerAsnLeuGInArgHisI[eArgSerGInHisValGlyAlaArgAlaHisAla 161

3001 ATCGGGAACAGCAACCATGGTAGCCAGTCTCCTCGGAACATGGAAGAGAGGATGAATGGC IleGlyAsnSerAsnHisGlySerGInSerProArgAsnMetGluGluArgMetAsnGly 861

961 TGCCCCGAGTGTGGTAAAACATTTGCCAC]~CGTCAGGCCTCAAACAGCACAAGCACATC CysProGluCysGlyLysThrPheA]aThrSerSerGlyLeuLysGInHisLysHisI]e 181

3061 AGTCACTTCAAGGATAAAAAGGCTTTGGCAACCAGCCAAAATTCAGA'P~rATTGGATGAT SerHisPheLysAspLysLysAlaLeuAlaThrSerGInAsnSerAspLeuLeuAspAso 881

1021 CACAGCAGTGTGAAGCCCTTTATCTGTGAGGTCTGCCATAAATCCTATACTCAG17-FTCA HisSerSerValLysProPhe[leCysGluValCysHisLysSerTyrThrGInPheSer 201

3121 GAAGAAGTAGAAGATGAGGTGTTGTTGGATGAGGAGGATGAAGACAATGATATTCCTGGA GluGluValGluAspGluValLeuLeuAspGluGluAspGluAspAsnAspIleProGly 901

1081 AACCTTTGTCGTCATAAGCGCATGCATGCTGAT]-GCAGAACCCAAATCAAGTGCAAAGAC AsnLeuCysArgHisLysArgMetHisAlaAspCysArgThrGInIteLysCysLysAsp 221

3181 AAGCCCAGAAAGGAGCTAGGGGTGACTCG17-1"AGACGAGGAGATCCCGGAGGATGACTAC LysProArgLysGluLeuGlyValThrArgLeuAspGluGluIleProGluAsoAspTyr 921

1141 TGTGGACAAATGTTCAGCACTACGTCTTCCTrAAATAAACACAGGAGGi-FTTGTGAGGGC CysGlyGInMetPheSerThrThrSerSerLeuAsnLysHisArgArgPheCysGluGly 241

3241 GAAGAAGCTGGTGCCCTGGAGATGAGCTGTAAGGCGTCCCCGGTGAGGTATAAAGAGGAA GluGluAlaGlyAlaLeuGluMetSerCysLysAlaSerProValArgTyrLysGluGlu 941

1201 AAGAACCATTTTGCGGCAGGTGGATTTmGGCCAAGGCAI"FTCACTTCCTGGAACCCCA LysAsnHisPheAlaAlaGlyGlyPhePheGlyGInGlylleSerLeuProGlyThrPro 261

3301 GACTATAAATCTGGCC17rTCTGCTCTAGATCACATAAGGCACTTCACAGATAGCCTCAAA AspTyrLysSerGiyLeuSerAlaLeuAspHisIleArgHisPheThrAspSerLeuLys 961

1261 GCTATGGATAAAACGTCCATGGTTAATATGAGTCATGCCAACCCGGGCCTGGCTGACTAT AlaMetAspLysThrSerMetValAsnMetSerHisAlaAsnProGlyLeuAlaAspTyr 281

3361 ATGAGGGAAATGGAAGAGAATCAATACACTGACGCTGAGCTGTCCTCCA~AGTTCTTCT MetArgGluMetGluGluAsnGInTyrThrAspAlaGluLeuSerSerIleSerSerSer 561

1321 TTTGGCACCAATAGGCATCCTGCTGGTCTTACC]~FTCCAACAGCTCCTGGATTrTCCTTT PheGlyThrAsnArgHisProAlaGlyLeuThrPheProThrAiaProGlyPheSerPhe 301

3421 CATGTGCCAGAGGAGCTTAAACAGACGTTACACAGAAAGTCCAAATCACAGGCATATGCT HisValProGluG[uLeuLysGInThrLeuHisArgLysSerLysSerGInAlaTyrAla 1001

1361 AGCTTTCCTGGTCTGTTTCCTTCGGGCTTATACCACAGGCCTCCTTTGATACCCGCTAGT SerPheProGlyLeuPheProSerGlyLeuTyrHisArgProProLeulleProAlaSer 321

3481 ATGATGTTGTCACTGTCTGACAAGGATTCCCTCCATCCCACCTCCCACAG1-FCCTCCAAC MetMetLeuSerLeuSerAspLysAspSerLeuHisProThrSerHisSerSerSerAsn 1021

1441 CCTCCTGTTAAAGGATTATCAAGTACCGAACAGTCAAACAAATGTCAAAGTCCCCTCTTG ProProValLysGlyLeuSerSerThrGluGInSerAsnLysCysGInSerProLeuLeu 341

3541 GTGTGGCACAGCATGGCAAGGGCTGCAGCAGAATCCAGTGCCATCCAGTCCATAAGCCAT ValTrpHisSerMetAlaArgAlaAlaAlaGluSerSerAla[leGInSer]leSerHis 1041

1501 ACACATCCTCAGATACTGCCAGCTACACAGGATA~GAAGGCACTATCTAAACACCCA ThrHi~ProGIn~leLeuProAlaThrGInAsplleLeuLysAlaLeuSerLysHisPro 361

3601 GTATGACATTGTCAAGGI~FGACCAGAGTGGGACCAAGTCCAACGGTAGCATGGCTCT~C Val

1561 CCTGTAGGGGACAATAAGCCAGTGGAACTGCTGCCCGAGAGGTCCTCTGAAGAGAGGCCC ProValGlyAspAsnLysProValGluLeuLeuProGluArgSerSerGiuGluArgPro 381

3661 ATACAGAACAATTTACAAGACTGCTGAGCAGGATGCCTTATAACCCTGAAGGGTCACGCA

1621 CTTGAGAAAATCAGTGACCAGTCAGAGAGTAGTGACC1-FGATGATGTCAGTACACCAAGT LeuGluLyslleSerAspGInSerGluSerSerAspLeuAspAspValSerThrProSer 401

3761 TTATTCTCAATATTTTGTTTTGCACAGCCAAGGCAGCTGCTGACTTCTGGAGGATCAATT

1681 GGCAGTGACCTGGAAACAACCTCGGGCTCTGATCTGGAAAGTGACCI-i'GAAAGTGATAAA GlySerAspLeuGluThrThrSerGlySerAspLeuGluSerAspLeuGluSerAspLys 421

3901 TGCCGCAGGGCATGGGTGGCTGAGAGGAGCAG]7-GAAATGGCAGCATTGATATAAATGGA

3721 TTTAAAGTCTGGTGACCTTAAACTGAATGAGTAAAGAAAGAGAGAGAAAAAGGAAGCTAT

3841 AATCCAAAATGATTGGAGGGGAAAGGAAACCTCACCAGGGAAGGCATCTTTCATTCCCCC

1741 GAGAAATrGTAAAGAAAATGGTAAAATGI"TCAAAGACAAAGTAAGCCCTCTGCAGAATCTG GluLysCysLysG[uAsnGlyLysMetPheLysAspLysValSerProLeuGInAsnLeu 441

3961 CATTTCATAGAAATCAAACTCTACTCTACAGGATCACCTGATCTACTGGGAACAGTGGCT

1801 GCTTCGATAACTAATAAG&AAGAACACAACAATCA'i-TCCGTTTTCTCAGCATCTGTAGAG AlaSerIleThrAsnLysLysGluHisAsnAsnHisSerValPheSerAlaSerValGlu 461

4081 GGAAGTAGTCAGAAGAAATGCACAATGA]-FATAGGAAGTGATAGCAGGATTTTTTGTCAC

1861 GAGCAAAGTGCCGTGTCAGGAGCTGTGAATGATTCTATAAAGGCTAI~GCGTCTATTGCT GluGfnSerAlaVa]SerGlyAlaValAsnAspSerIleLysAlaIleAlaSerIleAla 481

4201 AGGGTAGTGTATATCTAAACTATGGTAGCTCTAGCAGAGAGGTTAAGTCGGTGACATAAT

1921 GAAAAATACTTTGGTTCTACAGGACTGGTGGGGCTGCAAGACAAAAAAGTTGGAGCGTTA GluLysTyrPheGlySerThrGlyLeuValGlyLeuGInAspLysLysValGlyAlaLeu 501 1981 CCTTACCCTTCCATGTTTCCCCTCCCGIIIIIICCAGCA~CTCTCAATCAATGTACCCA ProTyrProSerMetPheProLeuPr~PhePheProAlaPheSerGInSerMetTyrPro 521

4021 TCTAACTCCAGAIIIIIIIIEICCIIIIIAAAGTTTTATGTAATTTAATCTTTTGCAGAT 4141 CCCCCACACCCTCTTAACTTTGGCC~CTTGAGTACATTG~AAAACTAGGGGGAAAAA

4261 GTTATCACCACTGTACCACTAATACAATGTrGCCAAATCCTGTAATGACATCTTAATTTT 4321 AGACAATCATGTCACTGTTTTTAATGTTTCAAIIIIIITATATATTATATATATCATGTA 4381 TTTATTTGTTGGCAAACTATGGX-FTGTTGATCAAAAAGAGCACTGTTCCCGTCAGCCACT 4441 ATTTTATGATGTCTGAGGCACA

2041 TI-I-CCTGATAGAGAC'Fi-GAGGTCGTTACCTTTGAAAATGGAGCCCCAATCACCAAGTGAA PheProAspArgAspLeuArgSerLeuProLeuLysMetGluProGInSerProSerGlu 541 2101 GTTAAGAAACTGCAGAAGGGAAGCTCTGAGTCCCCTTTTGACCTCACCACTAAGAGAAAG ValLysLysLeuGInLysGlySerSerGluSerProPheAspLeuThrThrLysArgLys 561 2161 GATGAGAAGCCCTTGACTTCAGGCCCCTCGAAGCCTTCAGGAACACCAGCCACAAGCCAA AspGluLysProLeuThrSerGlyProSerLysProSerGlyThrProAlaThrSerGIn 581 2221 GACCAGCCCCTGGATCTAAGTATGGGCAGTAGGGGTAGAGCCAGTGGGACAAAGTTGACT AspGInProLeuAspLeuSerMetGlySerArgGlyArgAlaSerGlyThrLysLeuThr 801

Figure 5. Sequence of cDNA Clones from NFS-58 Libraries The sequences of the 58-1 and 58-2 clones are shown with the deduced amino acid sequence of the largest open reading frame. Nucleotide position 1 is the start of the 58-1 cDNA clone. The 58-2 cDNA clone begins at position 71. The 58-1 clone ends at nucleotide position 2915. The first 12, underlined nucleotides are derived from the viral LTR. The only sequence discrepancy in the overlapping regions of the two cDNA sequences was a T at position 2722 in the 58-1 cDNA clone. A T at this position would introduce a terminator codon and is therefore considered to be a sequence error introduced by reverse transcriptase.

Discussion Insertional activation of cellular g e n e s is a c o m m o n m e c h anism for transformation by replication c o m p e t e n t , non-

transforming retroviruses and has proven a v a l u a b l e m e a n s of identifying new transforming genes. W e have used this a p p r o a c h to identify cellular g e n e s that are c a p a b l e of transforming h e m a t o p o i e t i c cells. For these

Cell 836

103

4,

3 '

131

YK~DQ~PKA~NWKSN~,R~QMS* YE~EN~AKV~TDPSN~QR~'RSQ

5

160

H,~PEMO,T~A,SSOH,~M,,..mSSV,,

10,

6 7

188 217

FZ~EV~HKSYTQFSN~CR~KRM* HADCRTQ IK~KD~GQM~STTSS~NK~RRF*~EGKNH

216 244

Domain 2

1 2 3

Figure6. Structureof the Zinc FingerRepeats and Locationwithin the Evi-1 Gene The aminoacid sequencesof the ten finger repeat regionsare shown in (A). The aminoacid positionsof the repeatswithinthe two domains of the proteinare shownon the left and right. The consensus sequence for the finger regionsof the Evi-1 geneproductis shownon the bottom of (A). The schematic organizationof the predictedproteinis shownin (B). Thefinger repeat regions are indicated by the crosshatchedboxesand correspondto the numbered repeats indicated in (A) for the two domains. The acidicdomaindescribedin the text is indicated by the solid boxedarea.

A

Domain 1

1 ,1 ""MEDHDQLESK,EH,DHoK,, sT,.s DSGKH "GARA

•

724 752 781

YR K I YIcCDR S S T S S N I L [ Q R I H I V R N I FKC~JHL DRCF~JGQQTN~LIDRHLHJLKK*

130 159

TO,OP NKEKP ENGNM

,,,

780 808

Consensus

xx~x x~xx xl;Ixx xxxl~xx~xxxxl~xxx xx F/Y

KIR

SN

B

Domain 1

1

R

Domain 2

234567

1 23

Acidic Domain

I I

100

I

200

P

300

f

400

r

500

I

600

I

700

I

800

I 900

COOH I 1000

AA

studies, we used IL-3-dependent myeloid cell lines that were isolated from retrovirus-induced myelogenous leukemias. These cells are not detectably altered in their growth factor requirements, but are altered in their ability to terminally differentiate and therefore potentially allow the identification of genes that specifically affect differentiation. Our results demonstrate that in several of these cell lines, retroviruses have activated the expression of a gene that is a member of the zinc finger family of transcriptional regulatory proteins. Integrated retroviruses can affect normal gene expression by altering the gene product, altering the level of gene expression, or altering the regulation of expression. In the case of the Evi-1 gene, retroviral insertions induce the expression of a gene which does not appear to be normally expressed in myeloid cells. IL-3-dependent myeloid cells with similar phenotypes to cells having integrations in the Evi-1 locus do not detectably express the gene. Our results also indicate that the Evi-1 gene is not expressed in T or B cells. In addition, we have not detected expression in fetal liver, bone marrow, or spleen (K. Morishita, D. S. Parker, and J. N. Ihle, unpublished data), further indicating that the Evi-1 gene is not normally expressed in hematopoietic or lymphoid cells. It is possible, however, that the Evi-1 gene is expressed in an early hematopoietic progenitor cell that constitutes only a minor fraction of the cells in the tissues examined. We are currently screening additional adult and embryonic tissues as well as purified hematopoietic progenitor populations for expression of the Evi-1 gene. The activation of expression results from viral integrations in a 5' noncoding region of the gene and is likely due to a promoter insertion mechanism. The structures of the NFS-78 cDNA clones suggest that transcripts can arise by transcription through the viral 3' LTR as well as by splicing out of the virus into cellular sequences. The presence of diffuse transcripts in Northern analysis suggests that a va-

riety of additional RNA structures may also exist. In NFS58 cells, the virus is integrated in the same orientation as the gene, and one of the cDNA clones contained 3' LTR sequences, suggesting that the transcripts initiate in the virus. The presence of a major 5 kb RNA transcript suggests that many may initiate in the 3' LTR. In contrast, the retrovirus in NFS-60 cells is in the opposite orientation and therefore transcription may be enhanced or activated by the virus from a cryptic promoter. The transcriptional start sites in the NFS-60 cells are currently being determined. Comparison of the genomic and cDNA sequences suggests the presence of three exons containing 5' noncoding sequences over a region of about 20 kb, and a clustering of viral integration sites near the presumptive first and second exons. The size of the first exon cannot be determined from our data, since in NFS-58 cells the virus may have integrated within the exon or the transcripts may initiate in the virus and continue through intron sequences into the exon. The size of the second exon is defined by the cDNA clones as 134 bp and is approximately 5 kb from the first exon. The size of the third exon is not known, but begins 54 bp 5' of the first ATG and is located 10 kb from the second exon. Whether these regions represent true exons or arise because of aberrant splicing of transcripts from the proviruses can only be assessed by characterization of transcripts from the unrearranged gene. The Evi-1 gene encodes a zinc finger protein with an amino-terminal domain containing seven finger repeats and a carboxy-terminal domain containing three finger repeats. In general, the zinc finger proteins can be divided into a group that contain two or three tandemly repeated finger sequences (Spl, ADR1, NGFI-A, Krox-20), a group that contains one domain of multiple tandem repeats (Kr(Jppel, serendipity, Snal, Mkr-1, Mkr-2, GLI, TFIIIA, TDF), and a group that contains two or more domains of three or more tandem finger repeats (Xfin, hunchback). The significance of these differences are not known, al-

Activation of UniqueFingerGene in MyeloidLeukemia 837

though it is interesting that those genes that contain more than three finger repeats and multiple domains have been implicated in developmental regulation, while the genes with a single domain of two or three tandem repeats have been implicated in gene regulation in differentiated cells. The Evi-1 gene contains a highly acidic domain in the carboxy region. Such domains, and in particular amphipathic a-helical domains, have been shown to play an important role in the ability of transcriptional regulatory proteins to regulate gene expression and are speculated to be required for the interaction of the proteins with RNA polymerase. With the yeast proteins GAL4 and GCN4, it has been demonstrated that carboxy truncation of the genes and the removal of the acidic domains eliminates the ability of the protein to induce transcription (Hope and Struhl, 1986; Ma and Ptashne, 1987a). More strikingly, the carboxyl addition of random sequences containing a negative charge can restore the transcriptional activity of GAL4 (Giniger and Ptashne, 1987; Ma and Ptashne, 1987b). Although the Evi-1 gene contains elements that are associated with known transcriptional regulatory proteins, it is not known whether it is involved in gene regulation. However, Evi-1 cDNAs have been expressed in bacteria, and preliminary data (K. Morishita, T. Matsugi, and J. N. Ihle) indicate that the bacterially derived protein has DNA binding activity and that the DNA binding activity is inhibited by metal chelators. The role of the Evi-1 gene in the transformation of hematopoietic cells is not known. All of the cell lines with an activated Evi-1 gene are IL-3-dependent for growth and consequently the function of the Evi-1 gene can be hypothesized to be quite different from transforming genes which abrogate the growth factor requirements of myeloid cells. The IL-3-dependent cell lines are transformed with regard to their ability to terminally differentiate. For this reason, we hypothesize that activation of the Evi-1 gene has altered the ability of the cells to differentiate. This is a particularly attractive hypothesis because of the association of a number of the zinc finger genes with the regulation of gene expression during development. In particular, KrEtppel, hunchback, and serendipity were detected as developmental mutants in Drosophila (Preiss et al., 1985; Vincent et al., 1984; Vincent et al., 1985). TFIIIA is involved in the regulation of 5S RNA synthesis during Xenopus development (Pelham and Brown, 1980; Honda and Roeder, 1980) and Xfin is expressed in Xenopus in a manner which is consistent with a role in controlling gene activity during early embryonic development (Ruiz i Altaba et al., 1987). The testis-determining factor gene (TDF) has been implicated in sex determination during development (Page et al., 1987). In mice, the KrDppel related genes, Mkr-1 and Mkr-2, are expressed in embryonal cells, and their expression is shut off with differentiation (Chowdhury et al., 1987). To determine the effects of the Evi-1 gene on differentiation we have constructed retroviral vectors and are examining their transforming potential in in vitro cultures of normal hematopoietic cells. Interestingly one of the IL-3-dependent myeloid leukemia cell lines (NFS-60) contains rearrangements of both

the Evi-1 locus and the c-myb locus. Based on the properties of NFS-60 cells, we had previously proposed (Weinstein et al., 1986) that the myb gene rearrangement might have affected differentiation. Compared to other cell lines with myb gene rearrangements (Weinstein et al., 1987; Shen-Ong et al., 1987) the NFS-60 cells are at an earlier stage of differentiation. Therefore it is possible that myb gene rearrangements alter late stages of differentiation while expression of the Evi-1 gene affects earlier stages and in malignancy there is a selective advantage for the cells with more immature phenotypes. Alternatively, either the myb gene or the Evi-1 gene may transform hematopoietic cells in still undefined ways. Among the zinc finger proteins only one other gene has been implicated in transformation. GLI was identified as an amplified gene in human glioblastomas (Kinzler et al., 1987; Kinzler et al., 1988). From the sequence of cDNA clones the gene has recently been shown to encode a 118 kd protein containing five repeats of the finger motif in the amino terminal region. The GLI gene is expressed in embryonal cells but not in any of the adult tissues examined. The potential role for the amplification of the GLI gene in the transformation is not known. The frequent activation of the Evi-1 gene in murine myeloid leukemia suggests that this gene may be important in human myelogenous leukemia. Using the murine cDNA probes, we have cloned regions of the human gene and found that they are highly conserved and map to human chromosome 3 (K. Morishita, N. Sacchi, and J. N. Ihle, unpublished data). Chromosomal inversions and translocations involving chromosome 3 have been associated with myelodysplastic syndromes (Akahoshi et al., 1987), acute nonlymphoblastic leukemia (ANLL) (Bitter et al., 1985), and the blast stage of chronic myelogenous leukemia (Bernstein et al., 1986; Rubin et al., 1987; Shimazaki et al., 1986). Experiments are currently in progress to determine whether leukemias containing chromosome 3 abnormalities have rearrangements of the Evi-1 locus and express the gene.

Experimental Procedures Cell Lines and Growth Factors

The leukemiacellslineswereisolatedfrom primaryretrovirusinduced leukemias as previouslydescribed (Holmeset al., 1985; Ihle et al., 1984b).IL-3-dependentcell linesweremaintainedby semi-weeklypassage in RPMI-1640supplementedwith 10% fetal calf serum (FCS), glutamineand 20 U/ml of partiallypurified IL-3. IL-3-independentmyeloidand lymphoidcell linesweremaintainedin RMPI-1640containing 10% FCS and supplementedwith glutamine.Partiallypurified IL-3for routine cultureswas preparedfrom WEHI-3 conditionedmedia(CM). The CM was concentrated10- to 20-foldwith an Amicon Pelliconsystem and made50% in ammoniumsulfateby the additionof solid ammoniumsulfate.The precipitatewas removedby centrifugationand the soluble fraction made80% in ammoniumsulfate by the further addition of solid ammoniumsulfate. The 50%-80% precipitatewas collected by centrifugation, resuspendedin 0.01 M sodium phosphate buffer (pH 7.0) containing 0.02 M NaCI, and dialyzed extensively against the same buffer. The dialyzed materialwas run through a Whatman DEAE-52column equilibratedin the same buffer. Under these conditions, IL-3 does not bind to the column and elutes in the run throughfractions.The activefractionswerepooledand aliquoted for use in tissue culture.

Cell 838

Isolation of Genomic Clones and cDNA Clones High molecular weight DNA was isolated from various cell lines by the published procedures (Maniatis et al., 1982). Genomic libraries for the isolation of the Evi-1 locus were made by partially digesting DNA with Sau3A and fractionating the DNA on 0.5% agarose gels. DNA of 10-20 kb was isolated by electroelution from the gels and was purified on NACS columns (BRL). The purified DNA was ligated to the BamHI site of EMBL-3 phage DNA, and the DNA packaged with commercial packaging kits. Phage (1 x 106) plagues were screened with various probes labeled by random primer synthesis (Feinberg and Vogelstein, 1984) in the presence of [32p]dCTP (2000-3000 Ci/mmol). An NFS-60 genomic library was made by digesting DNA to completion with EcoHI and ligating size selected DNA with EcoRI digested EMBL-4 DNA. The recombinant phage were packaged and screened as above. Cloned genomic regions were mapped by restriction enzyme digestion of phage DNA. Subclones of various regions were made in pBR322 or pUC19. The cDNA libraries were made with poly(A) selected mRNA from NFS-58 and NFS-78 cells by published procedures (Gubler and Hoffman, 1983) and as recommended by the manufacturer using oligo(dT) primed synthesis of cDNA and EcoRI linkers to clone into EcoRI digested Xgtl0. Following packaging, the recombinant phage were screened with the indicated probes as described above. NucleoUde Sequencing For sequencing of genomic and cDNA clones, various restriction fragments were subcloned into M13 or Bluescript (Stratagene). The nucleotide sequences of genomic and cDNA clones were determined by the dideoxynucleotide chain termination method (Tautz et al., 1987). The sequences were read from both strands. The only discrepancy detected among the cDNA clones was a T at nucleotide position 2722 in the 58-1 cDNA clone. This would introduce a terminator codon into the open reading frame, and therefore is considered to be a likely error by reverse transcriptase in the synthesis of the cDNA. Southern and Northern Hybridizations Total cellular DNA was prepared as described above and was digested to completion with appropriate restriction enzymes. The DNA was then etectrophoresed in 0.8% agarose gels. The separated fragments were transferred to nitrocellulose filters as described (Southern, 1975), and were hybridized with 32p-labeled probes prepared as indicated above. Total cellular RNA was extracted by the guanidinium thiocyanate method (Chirgwin et al., 1979) and was purified by centrifugation through cesium chloride. Poly(A) containing RNA was isolated by retention on oligo(dT) columns (Collaborative Research). Poly(A) RNA (10-20 Ilg) was electrophoresed following denaturation with glyoxal and blotted onto HyBond (Amersham). The blots were probed with 32p-labeled probes using published conditions (Thomas, 1980). Acknowledgments Research was sponsored by The National Cancer Institute, DHHS, under contract #NO1-CO-74101 with Bionetics Research, Inc. The comments of this publication do not necessarily reflect the views or policies of the Dept. of Health and Human Services, nor does mention of trade names, commercial products, or organizations imply endorsement by the United States government. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Received June 3, 1988; revised July 5, 1988.

References Akahoshi, M., Oshimi, K., Mizoguchi, H., Okada, M., Enomoto, Y., and Watanabe, Y. (1987). Myeloproliferative disorders terminating in acute megakaryoblastic leukemia with chromosome 3q26 abnormality. Cancer 60, 2654-2661. Berg, J. M. (1986). Potential metal-binding domains in nucleic acid binding proteins. Science 232, 485-487. Bernstein, R., Bagg, A., Pinto, M., Lewis, D., and Mendelow, B. (1986).

Chromosome 3q21 abnormalities associated with hyperactive thrombopoiesis in acute blastic transformation of chronic myeloid leukemia. Blood 68, 652-657. Bitter, M.A., Neilly, M.E., LeBeau, M.M., Pearson, M.G., and Rowley, J. D. (1985). Rearrangements of chromosome 3 involving bands 3q21 and 3q26 are associated with normal or elevated platelet counts in acute nonlymphocytic leukemia. Blood 66, 1362-1370. Brown, A.M., Papkoff, J., Fung, Y.K., Shackleford, G.M., and Varmus, H. E. (1987). Identification of protein products encoded by the proto-oncogene int-l. MoI. Cell Biol. 7, 3971-3977. Burglin, T. R., and De Robertis, E. M. (1987). The nuclear migration signal of Xenopus laevis nucleoplasmin. EMBO. J. 6, 2617-2625. Carmier, J. E, and Samarut, J. (1986). Chicken myeloid stem cells infected by retroviruses carrying the v-fps oncogene do not require exogenous growth factors to differentiate in vitro. Cell 44, 159-165. Casey, G., Smith, R., McGillivray, D., Peters, G., and Dickson, C. (1986). Characterization and chromosome assignment of the human homolog of int-2, a potential proto-oncogene. Mol. Cell Biol. 6, 502-510. Chirgwin, J., Przybyla, A., MacDonald, R., and Rutter, W. (1979). Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18, 5294-5299. Chowdhury, K., Deutsch, U., and Gruss, P. (1987). A multigene family encoding several "finger" structures is present and differentially active in mammalian genomes. Cell 48, 771-778. Cook, W. D., Metcalf, D., Nicola, N. A., Burgess, A. W., and Walker, E (1985). Malignant transformation of a growth factor-dependent myeloid cell line by Abelson virus without evidence of an autocrine mechanism. Cell 41, 677-683. Diakun, G. I?, Fairall, L., and Klug, A. (1986). EXAFS study of the zincbinding sites in the protein transcription factor IliA. Nature 324, 698-699. Evans, R. M., and Hollenberg, S. M. (1988). Zinc fingers: gilt by association. Cell 52, 1-3. Feinberg, A. R, and Vogelstein, B. (1984). Addendum: a technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 137, 266-267. Giniger, E., and Ptashne, M. (1987). Transcription in yeast activated by a putative amphipathic alpha helix linked to a DNA binding unit. Nature 330, 670-672. Gubler, U., and Hoffman, B.J. (1983). A simple and very efficient method for generating cDNA libraries. Gene 25, 263-269. Hayward, W. S., Neel, B. G., and Astrin, S. M. (1981). Activation of a cellular oncogene by promoter insertion in ALV-induced lymphoid leukosis. Nature 290, 475-480. Holmes, K. L., Palaszynski, E., Fredrickson, T. N., Morse Ill, H. C., and Ihle, J. N. (1985). Correlation of cell-surface phenotype with the establishment of interleukin 3-dependent cell lines from wild-mouse murine leukemia virus-induced neoplasms. Proc. Natl. Acad. Sci. USA 82, 6687-6691. Honda, B. M., and Roeder, R. G. (1980). Association of a 5S gene transcription factor with 5S RNA and altered levels of the factor during cell differentiation. Cell 22, 119-126. Hope, I. A., and Struhl, K. (1986). Functional dissection of eukaryotic transcriptional activator protein, GCN4 of yeast. Cell 46, 885-894. Ihle, J. N., and Weinstein, Y. (1986). Immunological regulation of hematopoietic/lymphoid stem cell differentiation by interleukin 3. Adv. Immunol. 39, 1-50. Ihle, J. N., Keller, J., Oroszlan, S., Henderson, L. E., Copeland, T. D., Fitch, E, Prystowsky, M. B., Goldwasser, E., Schrader, J. W., Palaszynski, E., Dy, M., and Lebel, B. (1983). Biologic properties of homogeneous interleukin 3. I Demonstration of WEHI-3 growth factor activity, mast cell growth factor activity, p cell-stimulating factor activity, colonystimulating factor activity, and histamine-producing cell-stimulating factor activity. J. Immunol. 131, 282-287. Ihle, J. N., Morse Ill, H. C, Keller, J., and Holmes, K. L. (1984a). Interleukin 3 dependent retrovirus induced lymphomas: loss of the ability to terminally differentiate in response to differentiation factors. Curr. Top. Microbiol. Immunol. 113, 86-91.

Activation of Unique Finger Gene in Myeloid Leukemia 839

Ihle, J. N., Rein, A., and Mural, R. (1984b). Immunological and virological mechanisms in retrovirus induced murine leukemogenesis. In Advances in Viral Oncology, Volume 4, G. Klein, ed. (New York: Raven Press), pp. 95-137. Ihle, J. N., Keller, J., Rein, A., Cleveland, J., and Rapp, U. (1985). Interleukin-3 regulation of the growth of normal and transformed hematopoietic cells. In Cancer Cells 3: Growth Factors and Transformation, J. Feramisco, B. Ozanne, and C. Stiles, eds. (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory), pp. 211-219. Kahn, R, Leutz, A., and Graf, T. (1986). Individual and combined effects of viral oncogenes in hematopoietic cells. In Oncogenes and Growth Control, R Kahn and T. Graf, eds. (Berlin/Heidelberg: Springer-Verlag), pp. 312-319. Kalderon, D., Richardson, W. D., Markham, A. E, and Smith, A. E. (1984a). Sequence requirements for nuclear location of simian virus 40 large-T antigen. Nature 311, 33-38. Kalderon, D., Roberts, B. L., Richardson, W. D., and Smith, A. E. (1984b). A short amino acid sequence able to specify nuclear location. Cell 39, 499-509. Kinzler, K. W., Bigner, S. H., Bigner, D. D., Trent, J. M., Law, M. L., O'Brien, S.J., Wong, A. J., and Vogelstein, B. (1987). Identification of an amplified, highly expressed gene in a human glioma. Science 236, 70-73. Kinzler, K. W., Ruppert, J. M., Bigner, S. H., and Vogelstein, B. (1988). The GLI gene is a member of the Kr0ppel family of zinc finger proteins. Nature 332, 371-374. Klempnauer, K. H., and Bishop, J. M. (1983). Transduction of c-myb into avian myeloblastosis virus: locating points of recombination within the cellular gene. J. Virol. 48, 565-572. Klempnauer, K.H., Ramsay, G., Bishop, J. M., Moscovici, M. G., Moscovici, C., McGrath, J. R, and Levinson, A. D. (1983). The product of the retroviral transforming gene v-myb is a truncated version of the protein encoded by the cellular oncogene c-myb. Cell 33, 345-355. Kozak, M. (1987). An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs. Nucl. Acids Res. 15, 8125-8148. Lee, B. A., Maher, D.W., Hannink, M., and Donoghue, D. J. (1987). Identification of a signal for nuclear targeting in platelet-derived growthfactor-related molecules. Mol. Cell Biol. 7, 3527-3537. Ma, J., and Ptashne, M. (1987a). Deletion analysis of GAL4 defines two transcriptional activating segments. Cell 48, 847-853. Ma, J., and Ptashne, M. (1987b). A new class of yeast transcriptional activators. Cell 51, 113-119. Maniatis, T., Fritsch, E. E, and Sambrook, J. (1982). Molecular Cloning: A Laboratory Manual (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory). Mathey-Prevot, B., Nabel, G., Palacios, R., and Baltimore, D. (1986). Abelson virus abrogation of interleukin-3 dependence in a lymphoid cell line. Mol. Cell Biol. 6, 4133-4135. Meeker, T. C., Nagarajan, L., ar-Rushdi, A., and Croce, C. M. (1987). Cloning arid characterization of the human PIM-1 gene: a putative oncogene related to the protein kinases. J. Cell Biochem. 35, 105-112. Metcalf, D. (1985). The granutocyte-macrophage colony-stimulating factors. Science 229, 16-22. Metcalf, D., and Nicola, N. A. (1982). Autoinduction of differentiation in WEHI-3B leukemia cells. Int. J. Cancer 30, 773-780. Miller, J., McLachlan, A. D., and Klug, A. (1985). Repetitive zincbinding domains in the protein transcription factor IliA from Xenopus oocytes. EMBO J. 4, 1609-1614. Moore, R., Casey, G., Brookes, S., Dixon, M., Peters, G., and Dickson, C. (1986). Sequence, topography and protein coding potential of mouse int-2: a putative oncogene activated by mouse mammary tumour virus. EMBO J. 5, 919-924. Mucenski, M. L., Taylor, B.A., Ihle, J. N., Hartley, J. W., Morse III, H. C., Jenkins, N. A., and Copeland, N. G. (1988a). Identification of a common ecotropic viral integration site, Evi-1, in the DNA of AKXD murine myeloid tumors. Mol. Cell Biol. 8, 301-308. Mucenski, M. L., Taylor, B. A., Copeland, N. G., and Jenkins, N.A. (1988b). Chromosomal location of Evi-1, a common site of ecotropic vi-

ral integration in AKXD murine myeloid tumors. Oncogene Res. 2, 219-233. Neel, B. G., Hayward, W. S., Robinson, H. L., Fang, J., and Astrin, S.M. (1981). Avian leukosis virus-induced tumors have common proviral integration sites and synthesize discrete new RNAs: oncogenesis by promoter insertion. Cell 23, 323-334. Noteborn, M., Arnheiter, H., Richter-Mann, L., Browning, H., and Weissmann, C. (1987). Transport of the murine Mx protein into the nucleus is dependent on a basic carboxy-terminal sequence. J. Interferon Res. 7, 657-669. Overell, R. W., Watson, J. D., Gallis, B., Weisser, K. E., Cosman, D., and Widmer, M B. (1987). Nature and specificity of lymphokine independence induced by a selectable retroviral vector expressing v-src. Mol. Cell Biol. 7, 3394-3401. Page, D. C., Mosher, R., Simpson, E. M., Fisher, E. M. C., Mardon, G., Pollack, J., McGillivray, B., de la Chapelle, A., and Brown, L. G. (1987). The sex-determining region of the human Y chromosome encodes a finger protein. Cell 51, 1091-1104. Papkoff, J., Brown, A. M., and Varmus, H. E. (1987). The int-1 protooncogene products are glycoproteins that appear to enter the secretory pathway. Mol. Cell Biol. 7, 3978-3984. Pelham, H. R., and Brown, D. D. (1980). A specific transcription factor that can bind either the 5S RNA gene or 5S RNA. Proc. Natl. Acad. Sci. USA 77, 4170-4174. Pierce, J. H., Di Fiore, R R, Aaronson, S. A., Potter, M., Pumphrey, J., Scott, A., and Ihle, J. N. (1985). Neoplastic transformation of mast cells by Abelson-MuLV: abrogation of IL-3 dependence by a nonautocrine mechanism. Cell 41, 685-693. Preiss, A., Rosenberg, U. B., Kienlin, A., Seifert, E., and J&ckle, H. (1985). Molecular genetics of Krfippel, a gene required for segmentation of the Drosophila embryo. Nature 313, 27-32. Prystowsky, M. B., Otten, G., Naujokas, M.E, Vardiman, J., Ihle, J. N., Goldwasser, E., and Fitch, F. W. (1984). Multiple hemopoietic lineages are found after stimulation of mouse bone marrow precursor cells with interleukin 3. Am. J. Pathol. 117, 171-179. Quint, W., Quax, W., van der Putten, H., and Berns, A. (1981). Characterization of AKR murine leukemia virus sequences in AKR mouse sub-strains and structure of integrated recombinant genomes in tumor tissues. J. Virol. 39, 1-10. Rapp, U. R., Cleveland, J. L., Brightman, K., Scott, A., and Ihle, J. N. (1985). Abrogation of IL-3 and IL-2 dependence by recombinant murine retroviruses expressing v-myc oncogenes. Nature 317, 434-438. Rassart, E., Nelbach, L., and Jolicoeur, R (1986). Cas-Br-E murine leukemia virus: sequencing of the paralytogenic region of its genome and derivation of specific probes to study its origin and the structure of its recombinant genomes in leukemia tissues. J. Virol. 60, 910-919. Richardson, W. D., Roberts, B. L., and Smith, A. E. (1986). Nuclear location signals in polyoma virus large-T. Cell 44, 77-85. Rubin, C. M., Larson, R.A., Bitter, M.A., Carrino, J.J., Le Beau, M. M., Diaz, M. O., and Rowley, J. D. (1987). Association of a chromosomal 3;21 translocation with the blast phase of chronic myelogenous leukemia. Blood 70, 1338-1342. Ruiz i Altaba, A., Perry-O'Keefe, H., and Melton, D. A. (1987). Xfin: an embryonic gene encoding a multifingered protein in Xenopus. EMBO. J. 6, 3065-3070. Sachs, L. (1978). Control of normal cell differentiation and the phenotypic reversion of malignancy in myeloid leukemias. Nature 274, 535-539. Sachs, L. (1987). The molecular control of blood ceil development. Science 238, 1374-1379. Schuh, R., Aicher, W., Gaul, U., Cote, S., Preiss, A., Maier, D., Seifert, E., Nauber, U., Schroder, C., Kemler, R., and J&ckle, H. (1986). A conserved family of nuclear proteins containing structural elements of the finger protein encoded by KrClppel, a Drosophila segmentation gene. Cell 47, 1025-1032. Selten, G., Cuypers, H. T., Boelens, W., Robanus-Maandag, E., Verbeek, J., Domen, J., van Beveren, C., and Berns, A. (1986). The primary structure of the putative oncogene pim-1 shows extensive homology with protein kinases. Cell 46, 603-611.

Cell 840

Shaw, G., and Kamen, R. (1986). A conserved AU sequence from the 3' untranslated region of GM-CSF mRNA mediates selective mRNA degradation. Cell 46, 659-667. Shen-Ong, G. L. C., Holmes, K., and Morse III, H. C. (1987). Phorbol ester-induced growth arrest of murine myelomonocytic leukemia cells with virus-disrupted myb locus is not accompanied by decrease myc and myb expression. Proc. Natl. Acad. Sci. USA 84, 199-203. Shimazaki, C., FUjita, N., Nakanishi, S., Nishio, A., Haruyama, H., Nakagawa, M., Ijichi, H., Nishida, K., and Misawa, S. (1986). Inversion of chromosome 3 in a case of chronic myelogenous leukemia with abnormal thrombopoiesis. Cancer Genet. Cytogenet. 20, 121-127. Southern, E. M (1975). Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98, 503-517. Suda, T., Suda, J., Ogawa, M, and Ihle, J. N. (1985). Permissive role of interleukin 3 (IL-3) in proliferation and differentiation of multipotential hemopoietic progenitors in culture. J. Cell Physiol. 124, 182-190. Tautz, D., Lehmann, R., Schnurch, H., Schuh, R., Seifert, E., Kienlin, A., Jones, K., and J&ckle, H. (1987). Finger protein of novel structure encoded by hunchback, a second member of the gap class of Drosophilia segmentation genes. Nature 327, 383-389. Thomas, P. S. (1980). Hybridization of denatured RNA and small DNA fragments transferred to nitrocellulose. Proc. Natl. Acad. Sci. USA 77, 5201-52O5. Vincent, A., O'Connell, P., Gray, M. R., and Rosbash, M. (1984). Drosophila maternal and embryo mRNAs transcribed from a single transcription unit use alternate combinations of exons. EMBO. J. 3, 1003-1013. Vincent, A., Colot, H. V., and Rosbash, M. (1985). Sequence and structure of the serendipity locus of Drosophila melanogaster. A densely transcribed region including a blastoderm-specific gene. J. Mol. Biol. 186, 149-166. Weinstein, Y., Ihle, J. N., Lavu, S., and Reddy, E. P. (1986). Truncation of the c-myb gene by a retroviral integration in an interleukin 3-dependent myeloid leukemia cell line. Proc. Natl. Acad. Sci. USA 83, 5010-5014~ Weinstein, Y., Cleveland, J. L., Askew, D. S., Rapp, U. R., and Ihle, J. N. (1987). Insertion and truncation of c-myb by murine leukemia virus in a myeloid cell line derived from cultures of normal hematopoietic cells. J. Virol. 61, 2339-2343. Wheeler, E. F., Askew, D., May, S., Ihle, J. N., and Sherr, C. J. (1987). The v.fms oncogene induces factor-independent growth and transformation of the interleukin-3-dependent myeloid cell line FDC-PI. Mol. Cell Biol. 7, 1673-1680. Wychowski, C., Benichou, D., and Girard, M. (1986). A domain of SV40 capsid polypeptide VP1 that specifies migration into the cell nucleus. EMBO. J. 5, 2569-2576. Yoshida, T., Miyagawa, K., Odagiri, H., Sakamoto, H., Little, F~ F., Terada, M., and Sugimura, T. (1987). Genomic sequence of hst, a transforming gene encoding a protein homologous to fibroblast growth factors and the int-2-encoded protein. Proc. Natl. Acad. Sci. USA 84, 7305-73O9.